Способ идентификации дрожжей рода pichia на основе пцр в реальном времени с использованием taqman зонда



Владельцы патента RU 2676099:

федеральное государственное бюджетное образовательное учреждение высшего образования "Воронежский государственный университет" (ФГБОУ ВО "ВГУ") (RU)

Изобретение относится к области микробиологии и предназначено для идентификации дрожжей рода Pichia. Осуществляют предварительное обогащение дрожжей, осаждение их центрифугированием, выделение ДНК с проведением ПЦР в реальном времени. Для амплификации используются праймеры и Taqman зонд. Логарифмическое повышение уровня флюоресценции в канале FAM амплификатора свидетельствует о наличии штамма дрожжей рода Pichia. Изобретение обеспечивает повышение чувствительности способа и сокращение времени анализа присутствия дрожжей рода Pichia. 1 ил., 1 пр.

 

Настоящее изобретение относится к микробиологии и касается способов измерения, использующих микроорганизмы, а именно, нуклеиновые кислоты. Данное изобретение может быть использовано в пищевой промышленности при идентификации дрожжей рода Pichia в как во входящем сырье пищевого предприятия, так и на разных этапах производства, включая конечную продукцию.

Раннее обнаружение дрожжей рода Pichia является актуальной задачей в масложировой промышленности ввиду широкого распространения этой группы микроорганизмов в данных видах продуктов, что приводит к их порче. Важность раннего обнаружения Pichia sp.позволит пищевым предприятиям быстро выявлять произведенную продукцию и входящее сырье предприятия, обсемененную этим видом дрожжей и вовремя ее браковать. Предварительно нами было выявлены многочисленные случаи загрязнения дрожжами рода Pichia пищевых продуктов с высоким содержанием жиров. Размножение этой группы организмов приводит к порче произведенной продукции и ее не соответствию требованиям СанПина.

На данный момент идентификацию дрожжей рода Pichia в большинстве случаев проводят по морфологическим признакам, что является сложной задачей, которую способен решить только высококвалифицированный микробиолог. Также, вывить данный организм{ можно с помощью секвенирования консервативных участков генома. Зачастую необходимо быстро выявить присутствие данной таксономической группы дрожжей ввиду их быстрого роста в продуктах с высоким содержанием жиров (например, майонез), чтобы выявить продукцию, а также входящее сырье, содержащие данную группу организмов для дальнейшей ее отбраковки.

Рядом авторов были разработаны молекулярно-генетические методы идентификации некоторых представителей рода Pichia молекулярно-генетическими методами. Был разработан молекулярно-генетический метод идентификации Pichia guilliermondii (MotaA.J. etal. Molecular identification of Pichia guilliermondii, Debary omyceshansenii and Candida palmioleophila. Genetics and Molecular Biology. 2012, 35(1): 122-125); молекулярно-генетический метод идентификации дрожжей, обсеменяющих винные продукты (Pramateftaki P.V. et al. Molecular identification of wine yeasts at species or strain level: a case study with strains from two vine-growing areas of Greece. JournalofAppliedMicrobiology. 2000, 89(2):236-248); молекулярно-генетический метод идентификации дрожжей, которые могут содержаться в крови (ChangH.C. etal. Rapid identification of yeasts in positive blood cultures by a multiplex PCR method. Journal of Clinical Microbiology.2001, 39:3466-3471); молекулярно-генетический метод идентификации дрожжей, значимых для ветеринарии (Garner C.D. et al. Molecular Identification of Veterinary Yeast Isolates by Use of Sequence-Based Analysis of the D1/D2 Region of the Large Ribosomal Subunit. Journal of Clinical Microbiology. 2010, 48(6):2140-2146) и др. Перечисленные молекулярно-генетические методы узкоспециальные и не имеют отношения к масложировой промышленности.

Известен способ определения наличия определенных микроорганизмов в биологическом образце (патент RU 2435865, МПК C12Q 1/68, G01N 33/569, G01N 33/543, опубл. 10.12.2011), взятый за прототип, включающий иммобилизацию биологического организма и его; ДНК с последующей идентификацией на основе ПЦР с генотипирующими праймерами. Недостатком данного способа является низкая видоспецифичность ввиду того, что одни лишь праймеры не обеспечивают высокой специфичности анализа, что может привести к ложноположительным результатам.

Задачей настоящего изобретения является разработка высокоспецифичного и оперативного способа идентификации присутствия дрожжей рода Pichia.

Технический результат заключается в разработке высокочувствительного способа и сокращении времени анализа присутствия дрожжей рода Pichia с 5 суток до 1 суток (в 5 раз).

Технический результат достигается тем, что в «способе идентификации дрожжей рода Pichia в майонезах на основе ПЦР в реальном времени, включающем предварительное обогащение дрожжей, осаждение их центрифугированием, выделение ДНК с проведением ПЦР в реальном времени, согласно изобретению, для амплификации используются праймеры PichUn-f GATCTCTTGGTTCTCGCATC и PichUn-r GCGTTCAAGAACTCGATGA, а также Taqman зонд PichUn-p FAM TCACACTAGGTATCGCATTTCGCTGC BHQ1, где логарифмическое повышение уровня флюоресценции свидетельствует о наличии штама дрожжей рода Pichia.

Предварительно проведен анализ нуклеотидной последовательности участка ДНК, включающего гены 18S рРНК, 5.8S рРНК и 28S рРНК и межгенные участки ITS1 и ITS2 для значимых в пищевой промышленности дрожжей рода Pichia. Установлены консервативные участки для данной группы организмов, которые позволяют разработать метод экспресс-идентификации дрожжей на основе ПЦР в реальном времени с использованием Taqman зонда, который представляет собой олигонуклеотид, к которому присоединены молекула флуорофора и молекула гасителя флуоресценции. При проведении ПЦР гибридизованный с ДНК зонд расщепляется ДНК-полимеразой (вследствие ее экзонуклеазной активности) и высвобождается флуоресцентная метка. Таким образом, наблюдается повышение уровня флуоресценции.

На фиг. 1 приведены кривые флуоресценции ДНК из 5 проб майонеза, полученные в ходе проведения ПЦР в реальном времени.

Способ идентификации дрожжей рода Pichia с помощью проведения ПЦР в реальном времени с использованием Taqman зонда в представленном способе реализуется следующим образом:

1. Производится сбор биологического материала (майонез, входящее сырье и др.). Для анализа используется 1 мл биологического материала.

2. Проводится предварительное 18-часовое обогащение образца в среде для культивирования дрожжей и плесени (например, бульон Сабуро). Объемное соотношение майонез/среда обогащения составляет не менее 1:10.

3. Проводится осаждение клеток дрожжей с помощью центрифугирования (например, 10000 g, 5 мин), супернатант вместе с майонезом удаляется.

4. Производится выделение ДНК из осажденных клеток, выделение ДНК можно осуществлять как с помощью коммерческих наборов («БиоСилика»,«ДНК-технологии», «Праймтех», «Zymоresearch» и др.), так и методами органической экстракции.

5. Проводят ПЦР. Используют следующие температурные циклы: 94°С 4 мин, 35 циклов (94°С 30 сек, 54°С 30 сек, 72°С 30 сек.)

Используется следующиепраймеры и зонд:

Прямой GATCTCTTGGTTCTCGCATC

Зонд FAM TCACACTAGGTATCGCATTTCGCTGC BHQ1

Обратный GCGTTCAAGAACTCGATGA

Данные праймеры амплифицируют продукт ПЦР длиной 114 п.н., который содержит нуклеотидные полиморфизмы, характерные только для дрожжей рода Pichia, с которыми взаимодействует Taqman зонд.

6. В случае, если наблюдается логарифмическое повышение уровня флуоресценции в канале FAM амплификатора, это означает, что продукт обсеменен дрожжами Pichia sp.

Предлагаемый способ является высокочувствительным, хорошо воспроизводимым и экономичным. Анализ можно проводить в лабораториях, имеющих амплификатор в реальном времени, центрифугу, сопутствующие реактивы и расходные материалы.

Способ поясняется примером:

После предварительного обогащения и выделения ДНК из 5 проб майонеза был проведен ПЦР в реальном времени (фиг. 1). В одной из проб (№1) наблюдался логарифмическое повышения уровня флуоресценции в канале FAM амплификатора, при этом в других пробах (№2-5) не наблюдалось повышение флуоресценции. Следовательно, проба майонеза №1 содержит дрожжи рода Pichia.

Способ идентификации дрожжей рода Pichia на основе ПЦР в реальном времени с использованием Taqman зонда, включающий предварительное обогащение дрожжей, осаждение их центрифугированием, выделение ДНК с проведением ПЦР в реальном времени, отличающийся тем, что для амплификации используются праймеры: прямой GATCTCTTGGTTCTCGCATC и обратный GCGTTCAAGAACTCGATGA, а также Taqman зонд FAM TCACACTAGGTATCGCATTTCGCTGC BHQ1, причем логарифмическое повышение уровня флюоресценции в канале FAM амплификатора в реальном времени свидетельствует о наличии штамма дрожжей рода Pichia.



 

Похожие патенты:

Предложенная группа изобретений относится к области молекулярной биологии и медицины. Предложены способ и набор праймеров и зондов для идентификации иммуногенных несоответствий ДНК в парах донор - реципиент.

Предложенная группа изобретений относится к области молекулярной биологии и медицины. Предложены способ и набор праймеров и зондов для идентификации иммуногенных несоответствий ДНК в парах донор - реципиент.

Изобретение относится к области генетики, молекулярной биологии и медицины. Предложен способ выявления соматических мутаций Q209P (с.

Изобретение относится к области генетики, молекулярной биологии и медицины. Предложен способ выявления соматических мутаций Q209P (с.

Изобретение относится к области генетики, молекулярной биологии и медицины. Предложен способ выявления соматических мутаций в генах BRAF, NRAS и KIT.

Изобретение относится к области генетики, молекулярной биологии и медицины. Предложен способ выявления соматических мутаций в генах BRAF, NRAS и KIT.

Изобретение относится к области биотехнологии и производству противоящурных вакцин, а именно к способу определения титра инфекционной активности вируса ящура в неинактивированном сырье для производства вакцины с применением метода ОТ-ПЦР-РВ и разработанной регрессионной моделью зависимости титра инфекционной активности вируса ящура от величины порогового цикла амплификации.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для диагностики молекулярного фенотипа больных, страдающих заболеванием, сопровождающимся хроническими воспалениями, с отнесением их к подгруппам «Th2-высокая», «Th2-низкая», «Th1-высокая» или «Th1-низкая».

Изобретение относится к области медицины, в частности к гинекологии. Предложен способ центильной оценки микроценоза слизистой влагалища у девочек путем отбора биоматериала со слизистой боковой стенки влагалища за физиологическим отверстием девственной плевы соскобом одноразовым урогенитальным зондом.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагинита Lactobacillus spp.

Изобретение относится к материаловедению, а именно к определению устойчивости материалов к биодеградации. Для этого подготавливают образцы с тестируемыми материалами, стерильную жидкую питательную среду (СЖПС) и питательную среду с тестовыми микроорганизмами (МЖПС).

Группа изобретений относится к области техники, раскрывающей биологические или химические исследования. Биодатчик содержит основу устройства, имеющую матрицу светочувствительных датчиков и матрицу световодов.

Изобретение относится к области медицины, а именно к гинекологии, и представляет собой способ прогнозирования риска развития наружного генитального эндометриоза, заключающийся в том, что выделяют ДНК из периферической венозной крови с последующим исследованием полиморфных вариантов С-511Т гена IL1B, С-590Т гена IL4, G-174C гена IL6, С-592А гена IL10, С-509Т гена TGFB, -604Т/С гена KDR, 735G/A гена Ang-2 и A-4889G гена CYP1A1, С-734А гена CYP1A2 и рассчитывают значение Р по формуле: ,где Р - значение вероятности развития признака, Y - значение уравнения регрессии, рассчитываемое по формуле: Y = -45,807+k1+k2+k3+k4+k5+k7+k8+k9; где ki выбирают в зависимости от полиморфных вариантов генов; и в случае, если значение Р равно или больше 0,5, прогнозируют высокий риск развития наружного генитального эндометриоза, а если значение Р меньше 0,5, прогнозируют низкий риск развития наружного генитального эндометриоза.

Изобретение относится к почвоведению, а именно к изучению формирования микрорусла на склонах пахотного горизонта методом точечного источника. Для этого образцы сухие почвогрунта просеивают через сито и укладывают в съемный наклонный лоток с шероховатой поверхностью и перфорированным дном для отделения воды, просочившейся через образец в мерную емкость для сбора воды и смытой почвы.

Предложенная группа изобретений относится к области молекулярной биологии и медицины. Предложены способ и набор праймеров и зондов для идентификации иммуногенных несоответствий ДНК в парах донор - реципиент.

Изобретение относится к области экологии, в частности к оценке территории, загрязненной тяжелыми металлами (ТМ), и может найти применение при мониторинге окружающей среды.

Изобретение относится к медицине, педиатрии, инфекционным болезням. Способ диагностики острых кишечных инфекций бактериальной этиологии у детей младшего возраста включает проведение общего анализа периферической крови, определение значения индекса ядерной интоксикации лейкоцитов, расчет вероятности бактериальной этиологии ОКИ по формуле: , где Р - вероятность в % бактериальной этиологии ОКИ; е - основание натурального логарифма, равное 2,7, Х - значение ЯИИ конкретного больного, при значении Р более 50% делают вывод о бактериальной этиологии ОКИ, менее 50% - об отсутствии бактериальной этиологии ОКИ.

Группа изобретений относится к модуляции уровней белков сыворотки для лечения пациентов с синдромом хрупкой X-хромосомы (FXS) и нарушениями аутистического спектра (ASD).

Изобретение относится к области медицины, а именно к детской кардиологии. Изобретение представляет собой способ прогнозирования риска развития приобретенной кардиомиопатии перед занятиями спортом, включающий определение в сыворотке крови у детей за 1 месяц до начала занятий спортом концентрации тропонина-Т, N-концевого натрийуретического пептида, интерлейкина-4 (ИЛ-4) и интерлейкина-6 (ИЛ-6), при этом прогнозируют высокий риск развития приобретенной кардиомиопатии при концентрации тропонина-Т от 0,37 до 0,48 нг/мл, при концентрации N-концевого натрийуретического пептида от 66,2 до 77,1 пг/мл, при концентрации ИЛ-4 от 2,6 до 3,1 пг/мл и при концентрации ИЛ-6 от 7,3 до 9,7 пг/мл и прогнозируют низкий риск развития вторичной кардиомиопатии при концентрации тропонина-Т от 0,21 до 0,36 нг/мл, при концентрации N-концевого натрийуретического пептида от 35,3 до 43,5 пг/мл, при концентрации ИЛ-4 от 3,4 до 4,58 пг/мл и при концентрации ИЛ-6 от 5,6 до 6,9 пг/мл.

Изобретение относится к области генетики, молекулярной биологии и медицины. Предложен способ выявления соматических мутаций Q209P (с.

Изобретение относится к области медицины, в частности стоматологии, медицинской микробиологии и эндокринологии, и может использоваться для прогноза развития сахарного диабета типа 2 у больных хроническим пародонтитом.

Изобретение относится к области микробиологии и предназначено для идентификации дрожжей рода Pichia. Осуществляют предварительное обогащение дрожжей, осаждение их центрифугированием, выделение ДНК с проведением ПЦР в реальном времени. Для амплификации используются праймеры и Taqman зонд. Логарифмическое повышение уровня флюоресценции в канале FAM амплификатора свидетельствует о наличии штамма дрожжей рода Pichia. Изобретение обеспечивает повышение чувствительности способа и сокращение времени анализа присутствия дрожжей рода Pichia. 1 ил., 1 пр.

Наверх