Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений



Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений
Антагонисты активина-actrii и их применение для лечения нарушений костной ткани и других нарушений

Владельцы патента RU 2678117:

ВАШИНГТОН ЮНИВЕРСИТИ (US)
СЕЛДЖИН КОРПОРЕЙШН (US)

Изобретение относится к области биотехнологии, конкретно к применению пептидных ингибиторов ActRIIВ, и может быть использовано в медицине для лечения атеросклеротической кальцификации. Изобретение позволяет уменьшить или ослабить один или более симптомов кальцификации сосудов у индивидуума, таких как повышение уровней кальция сосудов, повышенный апоптоз клеток гладких мышц сосудов, потерю эластичности артерий, увеличение скорости пульсовой волны, развитие гипертрофии левого желудочка, снижение перфузии коронарных артерий и ишемию миокарда. 13 з.п. ф-лы, 11 ил., 6 табл., 1 пр.

 

В настоящей заявке испрашивается приоритет предварительной патентной заявки США No. 61/721898, поданной 2 ноября 2012 г., и предварительной патентной заявки США No. 61/740665, поданной 21 декабря 2012 г., раскрытие каждой из которых приведено в настоящем документе в качестве ссылки в полном объеме.

1. Введение

В настоящем документе предлагаются способы лечения нарушений костной ткани, которые связаны с заболеванием почек, таким как хроническое заболевание почек - нарушение минерального обмена и костной ткани («CKD-MBD»), где способы включают введение ингибиторов активина-ActRII индивидууму, нуждающемуся в лечении. Кроме того, в настоящем документе предлагаются способы и композиции для лечения нарушений в виде пониженного оборота костной ткани, где способы включают введение ингибиторов активина-ActRII индивидууму, нуждающемуся в лечении. Также в настоящем документе предлагаются композиции для лечения заболеваний костной ткани, которые связаны с заболеванием почек, и композиции для лечения нарушений в виде пониженного оборота костной ткани и кальцификации сосудов.

2. Известный уровень техники

Рост и минерализация костей зависит от активности двух типов клеток, остеокластов и остеобластов, хотя хондроциты и клетки сосудов также участвуют в ключевых сторонах этих процессов. При развитии формирование костной ткани происходит с помощью двух механизмов, эндохондрального окостенения и внутримембранного окостенения, причем первый отвечает за формирование трубчатых костей, а второй отвечает за формирование топологически плоских костей, таких как кости черепа. Эндохондральное окостенение требуется для последовательного образования и деградации хрящевых структур в пластинах роста, которые служат в качестве матриц для образования остеобластов, остеокластов, сосудов и последующей минерализации. В процессе внутримембранного окостенения кости образуется непосредственно в соединительной ткани. Оба процесса требуют инфильтрации остеобластов и последующего отложения матрикса.

Хроническое заболевание почек связано с прогрессирующим ухудшением минерального гомеостаза с нарушением нормальных концентраций фосфора и кальция в сыворотке и тканях, а также с изменениями циркулирующих гормонов, таких как паратиреоидный гормон, 25-гидроксивитамин D, 1,25-дигидроксивитамин D, другие метаболиты витамина D, фактор-23 роста фибробластов и гормон роста. Смотри Chronic Kidney Disease-Mineral and Bone Disorder (CKD-MBD), Kidney Disease: Improving Global Outcomes (KDIGO) CKD-MBD Work Group, In: Kidney Int Suppl. (2009) 76 (Suppl 113):S1-130, page S3. Минеральный гомеостаз и гомеостаз гормонов, который нарушается при хроническом заболевании почек, имеет решающее значение для инициации формирования костей в процессе роста (моделирование костной ткани) и для структуры и функции костной ткани во взрослом возрасте (ремоделирование костной ткани). В результате аномалии костной ткани встречаются у больных с хроническим заболеванием почек. Кроме того, сходно с нарушениями минеральной и эндокринной функций, у больных с хроническим заболеванием почек может быть найдена внескелетная кальцификация. Эти синдромы обозначаются как хроническое заболевание почек, связанное с нарушениями минерального обмена и костной ткани («CDK-MBD»).

Костная ткань подвергается непрерывному обороту. Оборот костной ткани представляет собой процесс резорбции с последующей заменой кости. Остеобласты и остеокласты представляют собой клетки, необходимые для оборота костной ткани. Пониженный оборот и адинамические заболевания костной ткани характеризуются пониженными или отсутствующими резорбцией и замещением костной ткани. CKD-MBD может быть охарактеризовано как заболевание с пониженным оборотом и адинамической костной тканью. (Хроническое заболевание почек - нарушение минерального обмена и костной ткани (CKD-MBD): Improving Global Outcomes (KDIGO) CKD-MBD Work Group, In: Kidney Int Suppl. (2009) 76 (Suppl 113):S1-130, page S34).

Повышенные уровни кальция в сосудистой сети могут приводить к кальцификации сосудов, состоянию, характеризующемуся повышенной жесткостью сосудов. Пациенты с кальцификацией сосудов имеют повышенный риск инфаркта миокарда, и кальцификация сосудов особенно распространена у больных, страдающих болезнью почек, например, CKD-MBD. Смотри, например, Shanahan et al., 2011, Circ. Res. 109:697-711.

Два рецептора, относящиеся к типу II, ActRIIA и ActRIIB, были идентифицированы как рецепторы типа II активинов (Mathews and Vale, 1991, Cell 65:973-982; Attisano et al., 1992, Cell 68: 97-108). Кроме активинов ActRIIA и ActRIIB могут биохимически взаимодействовать с некоторыми другими белками семейства TGF-бета, включая BMP7, Nodal, GDF8 и GDF11 (Yamashita et al., 1995, J. Cell Biol. 130:217-226; Lee and McPherron, 2001, Proc. Natl. Acad. Sci. 98:9306-9311; Yeo and Whitman, 2001, Mol. Cell 7: 949-957; Oh et al, 2002, Genes Dev. 16:2749-54). ALK4 является основным рецептором типа I активинов, особенно активина A, и ALK-7 также может служить рецептором активинов, особенно активина B.

3. Краткое изложение сущности изобретения

В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения адинамического заболевания костной ткани у индивидуума, причем способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму, нуждающемуся в лечении адинамического заболевания костной ткани. Кроме того, в настоящем документе предлагаются способы лечения адинамического заболевания костной ткани в форме CKD-MBD у индивидуума, где способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму, нуждающемуся в лечении адинамического заболевания костной ткани в форме CKD-MBD.

В некоторых более конкретных вариантах осуществления адинамическое заболевание костной ткани характеризуется отсутствием включения тетрациклина в минерализованную костную ткань.

В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения CKD-MBD в форме пониженного оборота костной ткани у индивидуума, причем способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму, нуждающемуся в лечении CKD-MBD в форме пониженного оборота костной ткани. В более конкретном варианте осуществления CKD-MBD в форме пониженного оборота костной ткани представляет собой остеомаляцию.

В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения нарушения костной ткани у индивидуума, которое характеризуется гиперфосфатемией, причем способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму, нуждающемуся в лечении нарушения костной ткани, которое характеризуется гиперфосфатемией.

В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения атеросклеротической кальцификации у индивидуума, причем способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму, нуждающемуся в лечении атеросклеротической кальцификации.

В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения почечного заболевания у индивидуума, причем способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму, нуждающемуся в лечении заболевания почек. В более конкретном варианте осуществления заболевание почек представляет собой фиброз почек.

В конкретном варианте осуществления, представленном в настоящем документе, предлагается способ лечения внескелетной кальцификации у индивидуума, причем указанный способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму. В другом конкретном варианте осуществления, представленном в настоящем документе, предлагается способ профилактики внескелетной кальцификации у индивидуума, где указанный способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму. В конкретных вариантах осуществления внескелетная кальцификация, которую лечат или предотвращают у индивидуума способами, описанными в настоящем документе, представляет собой кальцификацию сосудов, т.е. накопление солей кальция в сосудистой сети индивидуума, например, кальцификацию артерий индивидуума.

В некоторых вариантах осуществления ингибитор ActRII, который может быть использован в способах, представленных в настоящем документе, представляет собой полипептид, содержащий аминокислотную последовательность, выбранную из группы, состоящей из: последовательности на 90% идентичной SEQ ID NO:2; на 95% идентичной SEQ ID NO:2; на 98% идентичной SEQ ID NO:2; SEQ ID NO:2; на 90% идентичной SEQ ID NO:3; на 95% идентичной SEQ ID NO:3; на 98% идентичной SEQ ID NO:3; SEQ ID NO:3; на 90% идентичной SEQ ID NO:6; на 95% идентичной SEQ ID NO:6; на 98% идентичной SEQ ID NO:6; SEQ ID NO:6; на 90% идентичной SEQ ID NO:7; на 95% идентичной SEQ ID NO:7; на 98% идентичной SEQ ID NO:7; SEQ ID NO:7; на 90% идентичной SEQ ID NO:12; на 95% идентичной SEQ ID NO:12; на 98% идентичной SEQ ID NO:12; SEQ ID NO:12; на 90% идентичной SEQ ID NO:17; на 95% идентичной SEQ ID NO:17; на 98% идентичной SEQ ID NO:17; SEQ ID NO:17; на 90% идентичной SEQ ID NO:20; на 95% идентичной SEQ ID NO:20; на 98% идентичной SEQ ID NO:20; SEQ ID NO:20; на 90% идентичной SEQ ID NO:21; на 95% идентичной SEQ ID NO:21; на 98% идентичной SEQ ID NO:21; и SEQ ID NO:21. В более конкретном варианте осуществления ингибитор ActRII представляет собой полипептид, включающий аминокислотную последовательность SEQ ID NO:7. В более конкретном варианте осуществления ингибитор ActRII вводят парентерально.

В конкретном варианте осуществления ингибитор ActRII, который может быть использован со способами, предлагаемыми в настоящем документе, представляет собой ингибитор ActRIIA, где ингибитор ActRIIA включает или состоит из полипептида, выбранного из группы, состоящей из: a. полипептида, по меньшей мере, на 90% идентичного последовательности SEQ ID NO:2; b. полипептида, по меньшей мере, на 95% идентичного SEQ ID NO:2; с. Полипептида, по меньшей мере, на 98% идентичного последовательности SEQ ID NO:2; d. SEQ ID NO:2; е. полипептида, по меньшей мере, на 90% идентичного SEQ ID NO:3; f. полипептида, по меньшей мере, на 95% идентичного SEQ ID NO:3; g. полипептида, по меньшей мере, на 98% идентичного последовательности SEQ ID NO:3; h. SEQ ID NO:3; i. полипептида, по меньшей мере, на 90% идентичного SEQ ID NO:6; j. полипептида, по меньшей мере, на 95% идентичного SEQ ID NO:6; k. полипептида, по меньшей мере, на 98% идентичного SEQ ID NO:6; l. SEQ ID NO:6; m. полипептида, по меньшей мере, на 90% идентичного SEQ ID NO:7; n. полипептида, по меньшей мере, на 95% идентичного SEQ ID NO:7; о. полипептида, по меньшей мере, на 98% идентичного SEQ ID NO:7; р. SEQ ID NO:7; q. полипептида, по меньшей мере, на 90% идентичного SEQ ID NO:12; r. полипептида, по меньшей мере, на 95% идентичного SEQ ID NO:12; s. полипептида, по меньшей мере, на 98% идентичного последовательности SEQ ID NO:12; и t. SEQ ID NO:12. В конкретном варианте осуществления ингибитор ActRIIA представляет собой полипептид, включающий или состоящий из аминокислотной последовательности SEQ ID NO:7.

В другом конкретном варианте осуществления ингибитор ActRII, который может быть использован со способами, предлагаемыми в настоящем документе, представляет собой ингибитор ActRIIB, где ингибитор ActRIIB включает или состоит из полипептида, выбранного из группы, состоящей из: a. полипептида, по меньшей мере, на 90% идентичного SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 или 43; b. полипептида, по меньшей мере, на 95% идентичного SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 или 43; c. полипептида, по меньшей мере, на 98% идентичного SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 или 43; d. SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 или 43; e. полипептида, на 90% идентичного SEQ ID NO:20, 21, 24, 25, 34, 35, 38, 39, 40, 41, 44, 46 или 47; f. полипептида, на 95% идентичного SEQ ID NO:20, 21, 24, 25, 34, 35, 38, 39, 40, 41, 44, 46 или 47; g. полипептида, на 98% идентичного SEQ ID NO:20, 21, 24, 25, 34, 35, 38, 39, 40, 41, 44, 46 или 47; и h. SEQ ID NO:20, 21, 24, 25, 34, 35, 38, 39, 40, 41, 44, 46 или 47. В конкретном варианте осуществления ингибитор ActRIIB представляет собой полипептид, включающий или состоящий из SEQ ID NO:23. В другом конкретном варианте осуществления ингибитор ActRIIB представляет собой полипептид, включающий или состоящий из SEQ ID NO:25.

В другом конкретном варианте осуществления ингибитор ActRIIA и ингибитор ActRIIB могут быть использованы в способах, представленных в настоящем документе (например, может быть использована композиция, содержащая ингибитор ActRIIA и ингибитор ActRIIB; или ингибитор ActRIIA и ингибитор ActRIIB оба можно вводить одновременно, индивидууму, получающему лечение в соответствии со способами, описанными в данном документе), в которых ингибитор ActRIIA включает или состоит из полипептида, выбранного из группы, состоящей из: a. полипептида, по меньшей мере, на 90% идентичного последовательности SEQ ID NO:2; b. полипептида, по меньшей мере, на 95% идентичного SEQ ID NO:2; c. полипептида, по меньшей мере, на 98% идентичного SEQ ID NO:2; d. SEQ ID NO:2; e. полипептида, по меньшей мере, на 90% идентичного SEQ ID NO:3; f. полипептида, по меньшей мере на 95% идентична SEQ ID NO:3; g. полипептида, по меньшей мере, на 98% идентичного последовательности SEQ ID NO:3; h. SEQ ID NO:3; i. полипептида, по меньшей мере, на 90% идентичного SEQ ID NO:6; j. полипептида, по меньшей мере, на 95% идентичного SEQ ID NO:6; k. полипептида, по меньшей мере, на 98% идентичного SEQ ID NO:6; l. SEQ ID NO:6; m. полипептида, по меньшей мере, на 90% идентичного SEQ ID NO:7; n. полипептида, по меньшей мере, на 95% идентичного последовательности SEQ ID NO:7; o. полипептида, по меньшей мере, на 98% идентичного SEQ ID NO:7; p. SEQ ID NO:7; q. полипептида, по меньшей мере, на 90% идентичного SEQ ID NO:12; r. полипептида, по меньшей мере, на 95% идентичного SEQ ID NO:12; s. полипептида, по меньшей мере, на 98% идентичного SEQ ID NO:12; и t. SEQ ID NO:12; и в которых ингибитор ActRIIB включает или состоит из полипептида, выбранного из группы, состоящей из: a. полипептида, по меньшей мере, на 90% идентичного SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 или 43; b. полипептида, по меньшей мере, на 95% идентичного SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 или 43; c. полипептида, по меньшей мере, на 98% идентичного SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 или 43; d. SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 или 43; e. полипептида, на 90% идентичного SEQ ID NO:20, 21, 24, 25, 34, 35, 38, 39, 40, 41, 44, 46 или 47; f. полипептида, на 95% идентичного SEQ ID NO:20, 21, 24, 25, 34, 35, 38, 39, 40, 41, 44, 46 или 47; g. Полипептида, на 98% идентичного SEQ ID NO:20, 21, 24, 25, 34, 35, 38, 39, 40, 41, 44, 46 или 47; и h. SEQ ID NO:20, 21, 24, 25, 34, 35, 38, 39, 40, 41, 44, 46, или 47. В конкретном варианте осуществления ингибитор ActRIIA представляет собой полипептид, включающий или состоящий из SEQ ID NO:7, и ингибитор ActRIIB представляет собой полипептид, включающий или состоящий из SEQ ID NO:23. В другом конкретном варианте осуществления ингибитор ActRIIA представляет собой полипептид, включающий или состоящий из SEQ ID NO:7, и ингибитор ActRIIB представляет собой полипептид, включающий или состоящий из SEQ ID NO:25.

В некоторых вариантах осуществления возраст индивидуума, подлежащего лечению способами, предлагаемыми в настоящем документе, составляет менее 18 лет. В некоторых вариантах осуществления индивидуум, подлежащий лечению с помощью способов, предлагаемых в настоящем документе, страдает терминальной стадией почечной недостаточности. В некоторых вариантах осуществления индивидуум, подлежащий лечению с помощью способов, предлагаемых в настоящем документе, подвергается диализу. В некоторых вариантах осуществления, представленных в настоящем документе, предлагается способ увеличения роста индивидуума.

В некоторых вариантах осуществления, предлагаемых в настоящем документе, представлены способы лечения или профилактики гиперфосфатемии, вторичного гиперпаратиреоза (обусловленного увеличением фосфора), внескелетной кальцификации, например, кальцификации сосудов, и адинамического заболевания костной ткани у индивидуума, где способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму, нуждающемуся в лечении гиперфосфатемии, вторичного гиперпаратиреоза (обусловленного увеличением фосфора), внескелетной кальцификации, например, кальцификации сосудов, и адинамического заболевания костей.

4. Краткое описание фигур

Фигура 1: Масса тела мышей после частичной нефрэктомии.

Фигура 2: Изменения BMD после частичной нефрэктомии мышей, оцениваемые с помощью сканирования DEXA.

Фигура 3: Влияние мышиного аналога SEQ ID NO 7 («mActRIIA-Fc») на изменения гематокрита после частичной нефрэктомии мышей.

Фигура 4: 3D визуализация микроКТ репрезентативных костей после частичной нефрэктомии мышей.

Фигура 5: Лечение mActRIIA-Fc увеличивает гематокрит.

Фигура 6: mActRIIA-Fc повышает минеральную плотность костей.

Фигура 7: Типичные микроКТ сканы бедренной кости.

Фигура 8: mActRIIA-Fc увеличивает толщину кортикального слоя бедренной кости Mid-Shaft.

Фигура 9: mActRIIA-Fc увеличивает объем губчатой кости.

Фигура 10: mActRIIA-Fc увеличивает толщину губчатого слоя дистальной части бедренной кости.

Фигура 11: mActRIIA-Fc вызывает снижение уровней кальция в аорте в модели мышей CKD.

5. Подробное описание

5.1 Обзор

В настоящем документе в одном аспекте предлагается способ лечения хронического заболевания почек-нарушений минерального обмена и костной ткани (CKD-MBD), где способ включает введение ингибитора ActRII больному, нуждающемуся в лечении. Ингибитор ActRII может быть ингибитором ActRIIА и/или ActRIIB.

CKD-MBD может быть диагностировано как системное нарушение минерального и костного метаболизма из-за хронической болезни почек и проявляется в виде либо единственного нарушения, либо их сочетания (1) аномалий кальция; фосфора; продукта кальция х фосфора; щелочных фосфатаз (всех или специфических для костной ткани); бикарбоната; паратиреоидного гормона («ПТГ»); 1-84 ПТГ, отношения 1-84-ПТГ/7-84-ПТГ; остеокальцина; остеопротегрина; устойчивой к тартрату изоформы 5b кислой фосфатазы («TRAP-5b»); пиридинолина и дезоксипиридинолина; пептидов аминоконцевого расширения проколлагена типа 1; C-концевых поперечных сшивок; С-концевых поперечных сшивок коллагена; фактора роста фибробластов 23 («FGF23»); фетилина-A; или метаболизма витамина D; (2) аномалий оборота костной ткани, минерализации, объема, линейного роста или силы; и (3) кальцификации сосудов или других мягких тканей. Смотри Nickolas, 2008, Kidney International 74:721-731; и Moe et al., 2006, Kidney International 69: 1945-1953. Руководства по диагностике CKD-MBD можно найти, например, в клинических протоколах по профилактике, диагностике, оценке и лечению хронического заболевания почек-нарушений минерального обмена и костной ткани (CKD-MBD), Kidney Disease: Improving Global Outcomes (KDIGO) CKD-MBD Work Group, In: Kidney Int Suppl. (2009) 76 (Suppl 113):S1-130.

В некоторых вариантах осуществления в настоящем описании предлагаются способы лечения форм CKD-MBD с пониженным оборотом костной ткани, где способ включает введение ингибитора ActRII больному, нуждающемуся в лечении. В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения CKD-MBD, характеризуемого гиперфосфатемией и/или гиперкальциемией. В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения CKD-MBD, характеризуемого внескелетной кальцификацией, такой как, но, не ограничиваясь этим, атеросклеротическая кальцификация.

В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения CKD-MBD, при котором хроническое заболевание почек достигло 3 стадии, 4 стадии, 5 стадии или 5D стадии. В конкретном варианте осуществления заболевание почек представляет собой терминальную стадию заболевания почек. В некоторых вариантах осуществления, представленных в настоящем описании, предлагаются способы лечения CKD-MBD, характеризуемого скоростью клубочковой фильтрации менее 60 мл/мин/1,73 м2 у взрослых или менее 89 мл/мин/1,73 м2 у педиатрической больных. Смотри Moe et al., 2006, Kidney International 69: 1945-1953. В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения у взрослых CKD-MBD, характеризуемого скоростью клубочковой фильтрации менее 50 мл/мин/1,73 м2, 40 мл/мин/1,73 м2, 30 мл/мин/1,73 м2, 20 мл/мин/1,73 м2 или менее 10 мл/мин/1,73 м2. В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения педиатрических больных с CKD-MBD, характеризуемым скоростью клубочковой фильтрации менее 80 мл/мин/1,73 м2, 70 мл/мин/1,73 м2, 60 мл/мин/1,73 м2, 50 мл/мин/1,73 м2, 40 мл/мин/1,73 м2, 30 мл/мин/1,73 м2, 20 мл/мин/1,73 м2 или менее 10 мл/мин/1,73 м2.

Не вдаваясь в теорию, скорость клубочковой фильтрации менее 60 мл/мин/1,73 м2 у взрослых больных и менее 89 мл/мин/1,73 м2 у педиатрических больных приводит к определяемым аномалиям в уровнях кальция, уровнях фосфора, уровнях ПТГ и метаболизма витамина D; и аномальные уровни этих маркеров приводят к заболеванию костной ткани.

В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения патологии костной ткани, связанной с хроническим заболеванием почек, т.е. CKD-MBD. Смотри Moe et al., 2006, Kidney International 69: 1945-1953. В некоторых вариантах осуществления CKD-MBD представляет собой CKD-MBD с пониженным оборотом костной ткани. CKD-MBD с пониженным оборотом костной ткани может быть диагностировано с помощью гистологических признаков, изложенных в таблице 1 ниже. Смотри квалификационные инициативные руководства исхода почечных заболеваний национального почечного фонда на веб-сайте национального почечного фонда.

Таблица 1
Гистологические особенности CKD-MBD с пониженным оборотом костной ткани
Характеристика Адинамическая Остеомаляция
Образование кости
Объем губчатой кости Нормальный, низкий Вариабельный
Низкий, нормальный или высокий
Объем остеоида Нормальный, низкий Высокий-очень высокий
Толщина остеоидного рубца Нормальная, низкая Высокая-очень высокая
Количество остеобластов Низкое Низкое
Скорость образования кости Низкая-очень низкая Низкая-очень низкая
Латентный период минерализации Нормальный Удлиненный
Резорбция кости
Периметр разрушаемой кости Нормальный, низкий Вариабельный
Часто низкий, может быть высоким
Количество остеокластов Низкое Низкое, может быть нормальным или высоким
Фиброз костного мозга Отсутствует Отсутствует

В конкретном варианте осуществления, представленном в настоящем документе, предлагается способ лечения внескелетной кальцификации у индивидуума, где указанный способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму. В другом конкретном варианте осуществления, представленном в настоящем документе, предлагается способ профилактики внескелетной кальцификации у индивидуума, где указанный способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму. В конкретных вариантах осуществления внескелетная кальцификация, которую лечат или предотвращают у индивидуума способами, описанными в настоящем документе, представляет собой кальцификацию сосудов, т.е. накопление солей кальция в сосудистой сети индивидуума, например, кальцификацию артерий индивидуума.

В некоторых вариантах осуществления способы лечения или профилактики внескелетной кальцификации, например, кальцификации сосудов, представленные в настоящем документе, применены к индивидууму, у которого выявлен риск развития внескелетной кальцификации, например, кальцификации сосудов (т.е. индивидууму с риском такого развития вводят ингибитор ActRII в соответствии со способами, описанными в данном документе). В конкретном варианте осуществления индивидуум с риском развития внескелетной кальцификации, например, кальцификации сосудов, имеет гиперхолестеринемию. В другом конкретном варианте осуществления индивидуум с риском развития внескелетной кальцификации, например, кальцификации сосудов, имеет гипертонию. В другом конкретном варианте осуществления индивидуум с риском развития внескелетной кальцификации, например, кальцификации сосудов, имеет диабет. В другом конкретном варианте осуществления индивидуум с риском развития внескелетной кальцификации, например, кальцификации сосудов, имеет заболевание почек (например, терминальную стадию почечной недостаточности). В другом конкретном варианте осуществления индивидуум с риском развития внескелетной кальцификации, например, кальцификации сосудов, имеет хроническое заболевание почек. В другом конкретном варианте осуществления индивидуум с риском развития внескелетной кальцификации, например, кальцификации сосудов, имеет повышенный окислительный стресс, например, дисбаланс между продукцией оксидантов и антиоксидантной активностью в сосудистой сети. В другом конкретном варианте осуществления индивидуум с риском развития внескелетной кальцификации, например, кальцификации сосудов, имеет недостаток ингибитора кальцификации (например, дефицит одного или нескольких из фетуина-A, белка матрикса gla (MGP) и остеопротегрина (OPG)).

В некоторых вариантах осуществления индивидуумы, страдающие кальцификацией сосудов, которых лечат в соответствии со способами, описанными в настоящем документе, имеют кальцификацию медии (также известную, как склероз Монкеберга или медиакальциноз). Кальцификация медии характеризуется диффузными отложениями минеральных веществ в медии артериальной оболочки. В конкретном варианте осуществления индивидуумы, страдающие кальцификацией медии, являются пожилыми. В конкретном варианте осуществления индивидуумы, страдающие кальцификацией медии, имеют нарушение, которое вызывает кальцификацию медии, например, сахарный диабет, заболевание почек (например, CKD).

В некоторых вариантах осуществления индивидуумы, страдающие кальцификацией сосудов, которых лечат в соответствии со способами, описанными в настоящем документе, имеют кальцификацию интимы. Кальцификация интимы связана с атеросклерозом и прогрессирует при прогрессировании атеросклеротических бляшек.

В некоторых вариантах осуществления индивидуумы, страдающие формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющие риск их развития, имеют повышенные уровни FGF23, гормона, вырабатываемого остеоцитами в ответ на снижение механической нагрузки, снижение формирования костной ткани и избыток фосфора в обмениваемом пуле (смотри, например, Hruska and Mathew, 2011, Advances in Chronic Kidney Disease 18(2):98-104), по сравнению с уровнями FGF23 у индивидуумов, которые не страдают формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или не имеют риска их развития. Уровни FGF23 могут быть определены с помощью способов, известных в данной области техники, например, ELISA, с использованием образцов от индивидуумов, например, крови, сыворотки. В конкретном варианте осуществления уровень FGF23 (например, уровень, определяемый в сыворотке) у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития, приблизительно на 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% или более 50% выше, чем уровень FGF23 (например, уровень, определяемый в сыворотке) у индивидуума, который не страдает формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или не имеет риска их развития. В другом конкретном варианте осуществления уровень FGF23 (например, уровень, определяемый в сыворотке) у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития, приблизительно на 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 50-75% или 75-100% выше, чем уровень FGF23 (например, уровень, определяемый в сыворотке) у индивидуума, который не страдает формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или не имеют риска их развития.

В некоторых вариантах осуществления уровни FGF23 у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития, могут быть использованы для мониторинга эффективности способа, описанного в настоящем документе, например, способа лечения формы CKD-MBD, и/или способа лечения внескелетной кальцификации (например, кальцификации сосудов), где такие способы включают введение терапевтически эффективного количества ингибитора ActRII, описанного в настоящем документе. В конкретном варианте осуществления индивидуум, которого лечат в соответствии с одним или более из способов, описанных в настоящем документе, имеет пониженный уровень FGF23 (например, при определении в сыворотке индивидуума) по сравнению с уровнем FGF23, определяемым у индивидуума перед лечением с помощью способа, описанного в настоящем документе. В другом конкретном варианте осуществления уровень FGF23 (например, уровень, определяемый в сыворотке) у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития, которого лечат с помощью способа, описанного в настоящем документе, снижается приблизительно на 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, или более 50% по сравнению с уровнем FGF23 (например, уровнем, определяемым в сыворотке), определяемым у индивидуума перед лечением с помощью способа, описанного в данном документе. В другом конкретном варианте осуществления уровень FGF23 (например, уровень, определяемый в сыворотке) у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития, снижается приблизительно на 5-10%, 10- 20%, 20-30%, 30-40%, 40-50%, 50-60%, 50-75% или 75-100% по сравнению с уровнем FGF23 (например, уровнем, определяемым в сыворотке), определяемым у индивидуума перед лечением с помощью способа, описанного в данном документе.

В конкретном варианте осуществления, представленном в настоящем документе, предлагается способ лечения формы CKD-BMD и/или внескелетной кальцификации, например, кальцификации сосудов, включающий: (i) введение ингибитора ActRII индивидууму, имеющему форму CKD-MBD и/или внескелетную кальцификацию, например, кальцификацию сосудов; (ii) определение количества FGF23 в образце ткани (например, в сыворотке) указанного индивидуума после введения ингибитора ActRII; и (iii), если количество FGF23 в указанном образце ткани уменьшается не более чем приблизительно на 5%, 10%, 15%, 20% или 25% или приблизительно на 5-10%, 10-20%, 20-30% по сравнению с количеством FGF23, определенным в образце ткани того же типа от указанного индивидуума (например, в другом образце сыворотки от того же индивидуума) до введения ингибитора ActRII, повторное введение ингибитора ActRII. В некоторых вариантах осуществления, если количество FGF23 не уменьшается после введения ингибитора ActRII, может быть увеличена доза вводимого ингибитора ActRII. В некоторых вариантах осуществления, если количество FGF23 не уменьшается после введения ингибитора ActRII, может быть увеличена частота введения вводимого ингибитора ActRII.

В некоторых вариантах осуществления у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития, имеются повышенные уровни склеростина, белка, повышенного у индивидуумов, страдающих CKD-MBD или имеющих риск его развития (смотри, например, Graciolli et al., 2010, J Am Soc Nephrol 21:774A) по отношению к уровням склеростина у индивидуумов, не страдающих формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или не имеющих риск их развития. Уровни склеростина могут быть определены с помощью способов, известных в данной области техники, например, ELISA, с использованием образцов от индивидуумов, например, крови, сыворотки. В конкретном варианте осуществления уровень склеростина (например, уровень, определяемый в сыворотке) у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития, приблизительно на 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% или более 50% выше, чем уровень склеростина (например, уровень, определяемый в сыворотке) у индивидуума, не страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или не имеющего риск их развития. В другом конкретном варианте осуществления уровень склеростина (например, уровень, определяемый в сыворотке) у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития, приблизительно на 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 50-75% или 75-100% выше, чем уровень склеростина (например, уровень, определяемый в сыворотке) у индивидуума, не страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или не имеющего риск их развития.

В определенных вариантах осуществления уровень склеростина у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития может быть использован для мониторинга эффективности способа, описанного в настоящем документе, например, способа лечения формы CKD-MBD и/или способа лечения внескелетной кальцификации (например, кальцификации сосудов), где такие способы включают введение терапевтически эффективного количества ингибитора ActRII, описанного в настоящем документе. В конкретном варианте осуществления у индивидуума, которого лечили в соответствии с одним или более из способов, описанных в настоящем документе, имеется пониженный уровень склеростина (например, при определении в сыворотке индивидуума) по сравнению с уровнем склеростина, определяемым у индивидуума пред лечением с помощью способа, описанного в настоящем документе. В другом конкретном варианте осуществления уровень склеростина (например, уровень, определяемый в сыворотке) у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития, которого лечили с помощью способа, описанного в настоящем документе, уменьшается приблизительно на 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, или более 50% по отношению к уровню склеростина (например, уровню, определяемому в сыворотке), определяемому у индивидуума перед лечением с помощью способа, описанного в настоящем документе. В другом конкретном варианте осуществления уровень склеростина (например, уровень, определяемый в сыворотке) у индивидуума, страдающего формой CKD-MBD и/или внескелетной кальцификацией, например, кальцификацией сосудов, или имеющего риск их развития, уменьшается приблизительно на 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 50-75% или 75-100%, по отношению к уровню склеростина (например, уровню, определяемому в сыворотке), определяемому у индивидуума перед лечением с помощью способа, описанного в настоящем документе.

В конкретном варианте осуществления, представленном в настоящем документе, предлагается способ лечения формы CKD-BMD и/или внескелетной кальцификации, например, кальцификации сосудов, включающий: (i) введение ингибитора ActRII индивидууму, имеющему форму CKD-MBD и/или внескелетную кальцификацию, например, кальцификацию сосудов; (ii) определение количества склеростина в образце ткани (например, в сыворотке) указанного индивидуума после введения ингибитора ActRII; и (iii), если количество склеростина в указанном образце ткани уменьшается не более чем приблизительно на 5%, 10%, 15%, 20% или 25% или приблизительно на 5-10%, 10-20%, 20-30% по сравнению с количеством склеростина, определенным в образце той же ткани от указанного индивидуума (например, в другом образце сыворотки от того же индивидуума) до введения ингибитора ActRII, повторное введение ингибитора ActRII. В некоторых вариантах осуществления, если количество склеростина не уменьшается после введения ингибитора ActRII, может быть увеличена доза вводимого ингибитора ActRII. В некоторых вариантах осуществления, если количество склеростина не уменьшается после введения ингибитора ActRII, может быть увеличена частота введения вводимого ингибитора ActRII.

В некоторых вариантах осуществления возраст индивидуума, страдающего кальцификацией сосудов, которого лечат в соответствии со способами, описанными в настоящем документе, составляет менее 18 лет. В конкретном варианте осуществления возраст индивидуума, страдающего кальцификацией сосудов, которого лечат в соответствии со способами, описанными в настоящем документе, составляет менее 13 лет. В другом конкретном варианте осуществления возраст индивидуума, страдающего кальцификацией сосудов, которого лечат в соответствии со способами, описанными в настоящем документе, составляет менее 12, менее 11, менее 10, менее 9, менее 8, менее 7, менее 6 или менее 5 лет. В другом конкретном варианте осуществления возраст индивидуума, страдающего кальцификацией сосудов, которого лечат в соответствии со способами, описанными в настоящем документе, составляет 1-3 года, 3-5 лет, 5-7 лет, 7-9 лет, 9-11 лет, 11-13 лет, 13-15 лет, 15-20 лет, 20-25 лет, 25-30 лет или более 30 лет. В другом конкретном варианте осуществления возраст индивидуума, страдающего кальцификацией сосудов, которого лечат в соответствии со способами, описанными в настоящем документе, составляет 30-35 лет, 35-40 лет, 40-45 лет, 45-50 лет, 50-55 лет, 55-60 лет или более 60 лет. В другом конкретном варианте осуществления возраст индивидуума, страдающего кальцификацией сосудов, которого лечат в соответствии со способами, описанными в настоящем документе, составляет 60-65 лет, 65-70 лет, 70-75 лет, 75-80 лет или более 80 лет.

В некоторых вариантах осуществления индивидуум, страдающий кальцификацией сосудов, которого лечат в соответствии со способами, описанными в настоящем документе, имеет терминальную стадию почечной недостаточности. В некоторых вариантах осуществления индивидуум, страдающий кальцификацией сосудов, которого лечат в соответствии со способами, описанными в настоящем документе, подвергается диализу.

В некоторых вариантах осуществления эффективность лечения или профилактики внескелетной кальцификации, например, кальцификации сосудов, оценивается с использованием одного или нескольких анализов, известных специалистам в данной области техники. Иллюстративные анализы описаны в разделе 5.3(a)(iv). В соответствии с такими вариантами осуществления специалисту в данной области техники будет понятно, что индивидуум, подлежащий лечению ингибитором ActRII, как описано в настоящем документе, может иметь свои схемы лечения, адаптированные на основании результатов анализов. Например, индивидууму, подлежащему лечению с помощью способа, описанного в настоящем документе, у которого выявлено увеличение уровня кальция, например, кальция сосудов, (например, кальция артерий) можно вводить повышенную дозу ингибитора ActRII или можно вводить ингибитор ActRII чаще (т.е., время между введениями дозы может быть уменьшено). Наоборот, индивидууму, подлежащему лечению с помощью способа, описанного в настоящем документе, у которого выявлено понижение уровня кальция, например, кальция сосудов, (например, кальция артерий) можно вводить пониженную дозу ингибитора ActRII или можно вводить ингибитор ActRII реже (т.е., время между введениями дозы может быть увеличено).

В некоторых вариантах осуществления способы, предлагаемые в настоящем документе, приводят к улучшению симптомов одного или более из следующего: гиперфосфатемии, вторичного гиперпаратиреоза (в связи с увеличением фосфора) и внескелетной кальцификации, например, кальцификации сосудов. Любой способ, известный специалисту в данной области техники для определения степени этих симптомов, может быть использован со способами, представленными в настоящем документе. В конкретных вариантах осуществления способы, описанные в настоящем документе, приводят к улучшению одного или более симптомов кальцификации сосудов. Иллюстративные симптомы включают без ограничения повышение уровней кальция сосудов (например, артерий), повышение апоптоза клеток гладких мышц сосудов, потерю эластичности артерий, увеличение PWV (скорости пульсовой волны), развитие гипертрофии левого желудочка, снижение перфузии коронарных артерий и ишемию миокарда.

В некоторых вариантах осуществления способы, описанные в настоящем документе, приводят к снижению уровней кальция сосудов, например, кальция артерий, у индивидуума, по меньшей мере, на 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% или 50%. В некоторых вариантах осуществления способы, описанные в настоящем документе, приводят к снижению уровней кальция сосудов, например, кальция артерий, у индивидуума на 5-10%, 10-15%, 15-20%, 20-25%, 25-0%, 30-35%, 35-40%, 40-45% или 45-50%.

В конкретном варианте осуществления, представленном в настоящем документе, предлагается способ снижения уровней кальция сосудов у индивидуума, включающий: (i) введение ингибитора ActRII индивидууму, нуждающемуся в снижении уровней кальция сосудов (например, индивидууму, имеющему форму CKD-MBD и/или внескелетную кальцификацию, например, кальцификацию сосудов); (ii) определение количества кальция сосудов в образце ткани (например, в сыворотке) указанного индивидуума после введения ингибитора ActRII; и (iii), если количество кальция сосудов в указанном образце ткани уменьшается не более чем приблизительно на 5%, 10%, 15%, 20% или 25% или приблизительно на 5-10%, 10-20%, 20-30% по сравнению с количеством кальция сосудов, определенным в образце той же ткани от указанного индивидуума (например, в другом образце сыворотки от того же индивидуума) до введения ингибитора ActRII, повторное введение ингибитора ActRII. В некоторых вариантах осуществления, если количество кальция сосудов не уменьшается после введения ингибитора ActRII, может быть увеличена доза вводимого ингибитора ActRII. В некоторых вариантах осуществления, если количество кальция сосудов не уменьшается после введения ингибитора ActRII, может быть увеличена частота введения вводимого ингибитора ActRII.

В некоторых вариантах осуществления способы, описанные в настоящем документе, приводят к уменьшению прогрессии по шкале Агатстона у индивидуума с кальцификацией сосудов или риском ее развития. В конкретном варианте осуществления способы, описанные в настоящем документе, ведут к 5%, 10%, 15%, 20%, 25%, 30% или более 30% снижению баллов по шкале Агатстона у индивидуума с кальцификацией сосудов или риском ее развития по сравнению с баллами по шкале Агатстона у индивидуума до введения ингибитора ActRII в соответствии со способами, описанными в настоящем документе (смотри, например, раздел 5.3(а)(iv)). В другом конкретном варианте осуществления способы, описанные в настоящем документе, ведут к 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45% или 45-50% снижению баллов по шкале Агатстона у индивидуума с кальцификацией сосудов или риском ее развития по сравнению с баллами по шкале Агатстона у индивидуума до введения ингибитора ActRII в соответствии со способами, описанными в настоящем документе (смотри, например, раздел 5.3(а)(iv)).

В другом конкретном варианте осуществления способы, описанные в настоящем документе, приводят к снижению уровней кальция в сосудистой сети индивидуума, например, к снижению уровней кальция в одной или более артерий индивидуума, например, индивидуума с кальцификацией сосудов или риском ее развития. В другом конкретном варианте осуществления способы, описанные в настоящем документе, приводят к снижению уровней фосфора в сосудистой сети индивидуума, например, к снижению уровней фосфора в одной или более артерий индивидуума, например, индивидуума с кальцификацией сосудов или риском ее развития.

В некоторых вариантах осуществления, представленных в настоящем документе, предлагаются способы лечения нарушений с пониженным оборотом костной ткани. Пониженный оборот костной ткани может быть диагностирован с помощью тестов, изложенных в разделе 5.3(а) ниже. Биохимические маркеры оборота костной ткани включают: поперечные сшивки коллагена сыворотки или мочи (N-телопептид или C-телопептид), специфичную для кости щелочную фосфатазу, остеокальцин сыворотки и/или пропептид коллагена типа 1, 25-гидроксивитамин D и паратиреоидный гормон («ПТГ»). В конкретном варианте осуществления нарушение с пониженным оборотом костной ткани представляет собой адинамическое заболевание костной ткани. В некоторых вариантах осуществления больной, подлежащий лечению с помощью способов, представленных в настоящем документе, имеет снижение оборота костной ткани, по меньшей мере, на 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% или 100%. В некоторых вариантах осуществления больной, подлежащий лечению с помощью способов, представленных в настоящем документе, имеет снижение оборота костной ткани не более чем на 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% или 100%. В некоторых вариантах осуществления больной, подлежащий лечению с помощью способов, представленных в настоящем документе, имеет снижение оборота костной ткани между 10% и 25%, 20% и 35%, 30% и 45%, 40% и 55%, 50% и 65%, 60% и 75%, 70% и 85%, 80% и 95%, 90% и 100%. В некоторых вариантах осуществления снижение оборота костной ткани сравнивают с данными истории болезни этого больного. В других вариантах осуществления снижение оборота костной ткани сравнивают со средним оборотом костной ткани в популяции без патологии костной ткани. Популяция без патологии костной ткани может быть того же возраста и/или пола что и больной.

В конкретном варианте осуществления, представленном в настоящем документе, предлагается способ лечения нарушения с пониженным оборотом костной ткани, например, адинамического нарушения костной ткани, включающий: (i) введение ингибитора ActRII индивидууму, имеющему нарушение с пониженным оборотом костной ткани; (ii) определение уровня оборота костной ткани у указанного индивидуума после введения ингибитора ActRII (например, с помощью одного или более тестов, представленных в разделе 5.3(а) ниже, и/или с помощью измерения одного или более биохимических маркеров костной ткани); и (iii) если уровень оборота костной ткани у индивидуума снижен не более чем приблизительно на 5%, 10%, 15%, 20% или 25% или приблизительно на 5-10%, 10-20%, 20-30% по сравнению с уровнем оборота костной ткани у индивидуума до введения ингибитора ActRII, повторное введение ингибитора ActRII. В некоторых вариантах осуществления, если уровень оборота костной ткани не снижается после введения ингибитора ActRII, может быть увеличена доза вводимого ингибитора ActRII. В некоторых вариантах осуществления, если уровень оборота костной ткани не снижается после введения ингибитора ActRII, может быть увеличена частота введения вводимого ингибитора ActRII.

5.2 Ингибиторы ACTRII

(a) Ингибиторы ACTRIIА

При применении в настоящем документе термин «ActRIIA» относится к семейству рецепторных белков активина типа Па (ActRIIA) любых видов и к вариантам, происходящим от таких белков ActRIIA путем мутагенеза или другой модификации. Ссылку на ActRIIA в настоящем документе следует понимать как ссылку на любую из идентифицированных на настоящий момент форм. Члены семейства ActRIIA обычно представляют собой трансмембранные белки, состоящие из лигандсвязывающего внеклеточного домена с обогащенной цистеином областью, трансмембранного домена и цитоплазматического домена с предсказанной активностью серин/треонин-киназы.

Ингибиторы ActRIIA, предназначенные для использования в композициях и способах, описанных в настоящем документе, включают без ограничения, активин-связывающие растворимые полипептиды ActRIIA; антитела, которые связываются с активином (особенно с субъединицами активина A или B, также обозначаемыми как βA или βB), и нарушают связывание с ActRIIA; антитела, которые связываются с ActRIIA и нарушают связывание активина; белки, не являющиеся антителами, выбранные для связывания с активином или ActRIIA (в качестве примеров таких белков и методов их создания и отбора смотри, например, патенты WO/2002/088171, WO/2006/055689, WO/2002/032925, WO/2005/037989 US 2003/0133939 и US 2005/0238646, каждый из которых включен в настоящее описание в качестве ссылки в полном объеме); и рандомизированные пептиды, выбранные для связывания активина или ActRIIA, которые могут быть конъюгированы с доменом Fc.

В некоторых вариантах осуществления два или более различных белка (или другие фрагменты) со связывающей активностью в отношении активина или ActRIIA, особенно активин-связывающие, которые блокируют сайты связывания типа I (например, растворимого рецептора активина типа I) и типа II (например, растворимого рецептора активина типа II), соответственно, могут быть связаны друг с другом с созданием бифункциональной или мультифункциональной связывающей молекулы, которая ингибирует ActRIIA и, таким образом, может быть использована в композициях и способах, описанных в настоящем документе. В некоторых вариантах осуществления антагонисты оси сигнализации активин-ActRIIA, которые ингибируют ActRIIA, включают аптамеры нуклеиновых кислот, в композициях и способах, описанных в настоящем документе, используются также небольшие молекулы и другие агенты.

(i) Ингибиторы ActRIIA, включающие полипептиды ActRIIA

Термин «полипептид ActRIIA» включает полипептиды, включающие любой природный полипептид, член семейства ActRIIA, а также любые их варианты (включая мутанты, фрагменты, гибриды и формы пептидомиметиков), которые сохраняют полезную активность. Например, полипептиды ActRIIA включают полипептиды, происходящие от последовательности любого известного ActRIIA, имеющие последовательность, по меньшей мере, приблизительно на 80% идентичную последовательности полипептида ActRIIA, и необязательно идентичную, по меньшей мере, на 85%, 90%, 95%, 97%, 98%, 99% или более. Например, полипептид ActRIIA может связываться и ингибировать функцию белка ActRIIA и/или активина. Полипептид ActRIIB может быть выбран по его способности стимулировать рост костей и минерализацию костей. Примеры полипептидов ActRIIA включают полипептид-предшественник ActRIIA человека (SEQ ID NO:1), и растворимые полипептиды ActRIIA человека (например, SEQ ID NO:2, 3, 7 и 12). В отношении полипептида-предшественника ActRIIA, чья аминокислотная последовательность представлена SEQ ID NO:1, сигнальный пептид полипептида-предшественника ActRIIA человека, расположен в положениях аминокислот от 1 до 20; внеклеточный домен находится в положениях аминокислот от 21 до 135, и связанные с N-концом сайты гликозилирования полипептида-предшественника ActRIIA человека (SEQ ID NO:1) находятся в положениях аминокислот 43 и 56 SEQ ID NO:1. Последовательность нуклеиновой кислоты, кодирующая полипептид-предшественник ActRIIB человека с SEQ ID NO:1, раскрыта в SEQ ID NO:4 (нуклеотиды 164-1705, поступление NM_001616 Genbank). Последовательность нуклеиновой кислоты, кодирующая растворимый полипептид ActRIIA человека с SEQ ID NO:2, представлена в SEQ ID NO:5. Смотри таблицу 6 для описания последовательностей.

В конкретных вариантах осуществления полипептиды ActRIIA, используемые в композициях и способах, описанных в настоящем документе, представляют собой растворимые полипептиды ActRIIA. Внеклеточный домен белка ActRIIA может связываться с активином и обычно является растворимым, и, таким образом, может быть назван растворимым активин-связывающим полипептидом ActRIIA. Таким образом, при применении в настоящем документе термин «растворимый полипептид ActRIIA» обычно относится к полипептидам, включающим внеклеточный домен белка ActRIIA, включая любой природный внеклеточный домен белка ActRIIA, а также любые его варианты (включая мутанты, фрагменты и формы пептидомиметиков). Растворимые полипептиды ActRIIA могут связываться с активином; однако, белок ActRIIA дикого типа не проявляет существенной селективности в отношении связывания активина по сравнению с GDF8/11. Нативные или измененные белки ActRIIA могут придать дополнительную специфичность в отношении активина в результате соединения их со вторым связывающим агентом, селективным для активина. Примеры растворимых активин-связывающих полипептидов ActRIIA включают растворимые полипептиды, представленные в SEQ ID NO:2, 3, 7, 12 и 13. Другие примеры растворимых активин-связывающих полипептидов ActRIIA включают сигнальную последовательность в дополнение к внеклеточному домену белка ActRIIA, например, лидирующую последовательность меллитина медоносной пчелы (SEQ ID NO:8), лидирующую последовательность тканевого активатора плазминогена (TPA) (SEQ ID NO:9) или нативную лидирующую последовательность ActRIIA (SEQ ID NO:10). Полипептид ActRIIA-hFc, представленный в SEQ ID NO:13, использует лидирующую последовательность TPA.

В некоторых вариантах осуществления ингибиторы ActRIIA, используемые в композициях и способах, описанных в настоящем документе, включают конъюгат/гибридный белок, включающий активин-связывающий домен ActRIIA, связанный с фрагментом Fc антитела. В некоторых вариантах осуществления активин-связывающий домен соединен с фрагментом Fc антитела через линкер, например, пептидный линкер. Необязательно домен Fc имеет одну или более мутаций в таких остатках, как Asp-265, лизин 322 и Asn-434. В некоторых случаях мутантный домен Fc, имеющий одну или более из этих мутаций (например, мутацию Asp-265), имеет пониженную способность связываться с рецептором Fcγ по сравнению с доменом Fc дикого типа. В других случаях мутантный домен Fc, имеющий одну или более из этих мутаций (например, мутацию Asn-434), обладает повышенной способностью связываться с Fc-рецептором, относящимся к МНС класса I (FcRN), по сравнению с доменом Fc дикого типа. Примеры гибридных белков, включающих растворимый внеклеточный домен ActRIIA, соединенный с Fc-доменом, представлены в SEQ ID NO:6, 7, 12 и 13.

В конкретном варианте осуществления ингибиторы ActRIIA, используемые в композициях и способах, описанных в настоящем документе, включают внеклеточный домен ActRIIA или его часть, связанную с фрагментом Fc антитела, где указанный ингибитор ActRIIA включает аминокислотную последовательность, которая, по меньшей мере, на 75% идентична аминокислотной последовательности, выбранной из SEQ ID NO:6, 7, 12 и 13. В другом конкретном варианте осуществления ингибиторы ActRIIA, используемые в композициях и способах, описанных в настоящем документе, включают внеклеточный домен ActRIIA, или его часть, связанную с фрагментом Fc антитела, где указанный ингибитор ActRIIA включает аминокислотную последовательность, которая, по меньшей мере, на 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% идентична аминокислотной последовательности, выбранной из SEQ ID NO:6, 7, 12 и 13.

В некоторых вариантах осуществления ингибиторы ActRIIA, используемые в композициях и способах, описанных в настоящем документе, включают укороченную форму внеклеточного домена ActRIIA. Укорочение может быть с карбоксильного конца и/или аминоконца полипептида ActRIIA. В некоторых вариантах осуществления укорочение может составлять 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 аминокислот в длину относительно зрелого внеклеточного домена полипептида ActRIIB. В некоторых вариантах осуществления укорочение может составлять 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, или 25 N-концевых аминокислот относительно внеклеточного домена зрелого полипептида ActRIIA. В некоторых вариантах осуществления укорочение может составлять 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 С-концевых аминокислот относительно внеклеточного домена зрелого полипептида ActRIIA. Например, укороченные формы ActRIIA включают полипептиды с аминокислотами 20-119; 20-128; 20-129; 20-130; 20-131; 20-132; 20-133; 20-134; 20-131; 21-131; 22-131; 23-131; 24-131 и 25-131, где положения аминокислот относятся к положениям аминокислот в SEQ ID NO:1.

В некоторых вариантах осуществления ингибиторы ActRIIA, используемые в композициях и способах, описанных в настоящем документе, включают внеклеточный домен ActRIIA с одной или более аминокислотными заменами. В некоторых вариантах осуществления ингибиторы ActRIIA, используемые в композициях и способах, описанных в настоящем документе, включают укороченную форму внеклеточного домена ActRIIA, которая также несет аминокислотную замену.

В конкретном варианте осуществления ингибитор ActRIIA для использования в композициях и способах, описанных в настоящем документе, представляет собой гибридный белок внеклеточного домена рецептора ActRIIA человека и фрагмента Fc IgGl. В другом конкретном варианте осуществления ингибитор ActRIIA для использования в композициях и способах, описанных в настоящем документе, представляет собой гибридный белок укороченного внеклеточного домена рецептора ActRIIA человека и фрагмента Fc IgGl. В другом конкретном варианте осуществления ингибитор ActRIIA для использования в композициях и способах, описанных в настоящем документе, представляет собой гибридный белок укороченного внеклеточного домена рецептора ActRIIA человека и фрагмента Fc IgGl, где укороченный внеклеточный домен рецептора ActRIIA человека обладает одной или более аминокислотными заменами.

Функционально активные фрагменты полипептидов ActRIIA могут быть получены, например, путем скрининга полипептидов, полученных рекомбинантно из соответствующего фрагмента нуклеиновой кислоты, кодирующей полипептид ActRIIA. Кроме того, фрагменты могут быть химически синтезированы с использованием способов, известных в данной области техники, таких, как традиционные методы твердофазного синтеза f-Moc по Меррифилду или t-Boc химия. Фрагменты могут быть получены (рекомбинантно или путем химического синтеза) и протестированы для идентификации тех пептидильных фрагментов, которые могут функционировать в качестве антагонистов (ингибиторов) белка ActRIIA или сигнализации, опосредуемой активином.

Кроме того, функционально активные варианты полипептидов ActRIIA могут быть получены, например, путем скрининга библиотек модифицированных полипептидов, полученных рекомбинантно из соответствующих подвергнутых мутагенезу нуклеиновых кислот, кодирующих полипептид ActRIIA. Варианты могут быть получены и протестированы для идентификации вариантов, которые могут функционировать в качестве антагонистов (ингибиторов) белка ActRIIA или сигнализации, опосредуемой активином. В некоторых вариантах осуществления функциональный вариант полипептидов ActRIIA включает аминокислотную последовательность, которая, по меньшей мере, на 75% идентична аминокислотной последовательности, выбранной из SEQ ID NO:2 или 3. В некоторых случаях функциональный вариант имеет аминокислотную последовательность, по меньшей мере, на 80%, 85%, 90%, 95%, 97%, 98%, 99% или 100% идентичную аминокислотной последовательности, выбранной из SEQ ID NO:2 или 3.

Функциональные варианты могут быть получены, например, путем модификации структуры полипептида ActRIIA для таких целей, как повышение терапевтической эффективности или стабильности (например, полупериода жизни ex vivo и устойчивости к протеолитической деградации in vivo). Такие модифицированные полипептиды ActRIIA при выборе для сохранения связывания активина могут рассматриваться как функциональные эквиваленты природных полипептидов ActRIIA. Модифицированные полипептиды ActRIIA также могут быть получены, например, путем замены, делеции или добавления аминокислот. Например, разумно ожидать, что отдельная замена лейцина на изолейцин или валин, аспартата на глутамат, треонина на серин или подобная замена аминокислоты структурно родственной аминокислотой (например, при консервативных мутациях) не будет иметь большого влияния на биологическую активность полученной молекулы. Консервативные замены представляют собой замены, которые имеют место внутри семейства аминокислот, которые сходны по своим боковым цепям. Будет ли изменение в аминокислотной последовательности полипептида ActRIIA вести к функциональному гомологу, может быть легко определено путем оценки способности варианта полипептида ActRIIA вызывать в клетках ответ, сходный с ответом полипептида ActRIIA дикого типа.

В некоторых вариантах осуществления ингибитор ActRIIA, предназначенный для использования в композициях и способах, описанных в настоящем документе, может включать полипептид ActRIIA, имеющий одну или более специфических мутаций, которые могут изменять гликозилирование полипептида. Такие мутации могут вводить или удалять один или более сайтов гликозилирования, таких как О-связанные или N-связанные сайты гликозилирования. Узнаваемые аспарагин-связанные сайты гликозилирования обычно включают последовательность трипептида, аспарагин-Х-треонин (или аспарагин-Х-серин) (где «X» обозначает любую аминокислоту), которая специально узнается соответствующими клеточными ферментами гликозилирования. Изменение также может быть сделано путем добавления или замены одного или более остатков серина или треонина в последовательности полипептида ActRIIA дикого типа (для О-связанных сайтов гликозилирования). Разнообразие аминокислотных замен или делеций в одном или обоих первом или третьем положении аминокислот узнаваемого сайта гликозилирования (и/или делеция аминокислоты во втором положении) приводит к отсутствию гликозилирования в модифицированной последовательности трипептида. Другим способом увеличения числа углеводных остатков в полипептиде ActRIIA является химическое или ферментативное присоединение гликозидов к полипептиду ActRIIA. В зависимости от используемого способа присоединения сахар(а) могут быть присоединены к (a) аргинину и гистидину; (b) свободным карбоксильным группам; (с) свободным сульфгидрильным группам, таким как группы цистеина; (d) свободным гидроксильным группам, таким как группы серина, треонина или гидроксипролина; (e) ароматическим остаткам, таким как остатки фенилаланина, тирозина или триптофана; или (f) амидной группе глутамина. Эти способы описаны в патенте WO 87/05330, опубликованном 11 сентября 1987 г., и в статье Aplin and Wriston (1981) CRC Crit. Rev. Biochem., pp. 259-306,, включенной в настоящее описание в качестве ссылки. Удаление одного или более углеводных остатков, присутствующих в полипептиде ActRIIA, может быть достигнуто химически и/или ферментативно. Химическое дегликозилирование может включать, например, экспозицию полипептида ActRIIA с соединением трифторметансульфоновой кислоты или эквивалентным соединением. Такая обработка приводит к отщеплению большинства или всех сахаров за исключением связующего сахара (N-ацетилглюкозамина или N-ацетилгалактозамина), оставляя аминокислотную последовательность интактной. Химическое дегликозилирование дополнительно описывается Hakimuddin et al. (1987) Arch. Biochem. Biophys. 259:52 и Edge et al. (1981) Anal. Biochem. 118:131. Ферментативное расщепление углеводных остатков в полипептидах ActRIIA может быть достигнуто путем использования различных эндо- и экзогликозидаз, как описано Thotakura et al. (1987) Meth. Enzymol. 138:350. Последовательность полипептида ActRIIA может быть подогнана соответствующим образом в зависимости от типа используемой системы экспрессии, так как клетки млекопитающих, дрожжей, насекомых и растений все могут вводить различный характер гликозилирования, на который может влиять аминокислотная последовательность пептида. В целом белки ActRIIA для применения у человека могут быть экспрессированы в линии клеток млекопитающих, которая обеспечивает надлежащее гликозилирование, такой как клеточная линия НЕК293 или СНО, хотя другие системы экспрессии, такие как системы экспрессии других клеточных линий млекопитающих, линии клеток дрожжей со сконструированными ферментами гликозилирования и клетки насекомых, как ожидается, также пригодны.

Кроме того, в настоящем документе предлагаются способы создания мутантов, особенно наборы комбинаторных мутантов полипептида ActRIIA, а также укороченные мутанты; пулы комбинаторных мутантов особенно полезны для идентификации последовательностей функциональных вариантов. Цель скрининга таких комбинаторных библиотек может заключаться в создании, например, полипептидных вариантов ActRIIA, которые могут действовать либо как агонисты, либо как антагонисты, или альтернативно, которые все обладают новыми вариантами активности. Разнообразные методы скрининга приведены ниже, и такие методы могут быть использованы для оценки вариантов. Например, вариант полипептида ActRIIA может быть подвергнут скринингу на способность связываться с лигандом ActRIIA, чтобы предотвратить связывание лиганда ActRIIA с полипептидом ActRIIA или чтобы помешать сигнализации, вызываемой лигандом ActRIIA.

Могут быть созданы происходящие комбинаторно варианты, которые обладают селективной или в целом повышенной активностью по отношению к природному полипептиду ActRIIA. Кроме того, мутагенез может привести к вариантам, которые имеют внутриклеточный период полужизни, значительно отличающийся от соответствующего периода полипептида ActRIIA дикого типа. Например, измененному белку может быть придана либо более высокая стабильность, либо более низкая стабильность в отношении протеолитической деградации или других клеточных процессов, которые приводят к разрушению или иным образом инактивируют нативный полипептид ActRIIA. Такие варианты и гены, которые их кодируют, могут быть использованы для изменения уровней полипептида ActRIIA путем модуляции периода полужизни полипептидов ActRIIA. Например, короткий период полужизни может приводить к более кратковременным биологическим эффектам и может позволить более жестко контролировать уровни рекомбинантного полипептида ActRIIA у больного. В гибридном белке с Fc мутации могут быть сделаны в линкере (если таковой имеется) и/или в части Fc для изменения периода полужизни белка.

Комбинаторная библиотека может быть получена путем вырожденной библиотеки генов, кодирующих библиотеку полипептидов, каждый из которых включает, по меньшей мере, часть потенциальных полипептидных последовательностей ActRIIA. Например, смесь синтетических олигонуклеотидов может быть ферментативно лигирована в последовательности генов так, что вырожденный набор потенциальных нуклеотидных последовательностей полипептида ActRIIA будет способен экспрессироваться в виде индивидуальных полипептидов или альтернативно в виде набора более крупных гибридных белков (например, для фагового дисплея).

Существует много способов, с помощью которых библиотека потенциальных гомологов может быть получена из вырожденной олигонуклеотидной последовательности. Химический синтез вырожденной последовательности гена может быть осуществлен в автоматическом синтезаторе ДНК, и синтетические гены затем лигируют в соответствующий вектор для экспрессии. Синтез вырожденных олигонуклеотидов хорошо известен в данной области техники (смотри, например, Narang, S A (1983) Tetrahedron 39:3; Itakura et al., (1981) Recombinant DNA, Proc. 3rd Cleveland Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp 273-289; Itakura et al., (1984) Annu. Rev. Biochem. 53:323; Itakura et al., (1984) Science 198:1056; Ike et al., (1983) Nucleic Acid Res. 11 :477). Такие методы использованы для направленной эволюции других белков (смотри, например, Scott et al., (1990) Science 249:386-390; Roberts et al., (1992) PNAS USA 89:2429-2433; Devlin et al., (1990) Science 249: 404-406; Cwirla et al., (1990) PNAS USA 87: 6378-6382; а также патенты США NO. 5223409, 5198346 и 5096815).

Альтернативно, другие формы мутагенеза могут быть использованы для создания комбинаторной библиотеки. Например, варианты полипептида ActRIIA могут быть получены и выделены из библиотеки путем скрининга с использованием, например, аланин-сканирующего мутагенеза и тому подобного (Ruf et al., (1994) Biochemistry 33:1565-1572; Wang et al., (1994) J. Biol. Chem. 269:3095-3099; Balint et al., (1993) Gene 137:109-118; Grodberg et al., (1993) Eur. J. Biochem. 218:597-601; Nagashima et al., (1993) J. Biol. Chem. 268:2888-2892; Lowman et al., (1991) Biochemistry 30:. 10832-10838; и Cunningham et al., (1989) Science 244:1081-1085), с помощью сканирующего линкер мутагенеза (Gustin et al., (1993) Virology 193:653-660; Brown et al., (1992) Mol. Cell Biol. 12:2644-2652; McKnight et al., (1982) Science 232:316); с помощью насыщающего мутагенеза (Meyers et al., (1986) Science 232:613); с помощью ПЦР-мутагенеза (Leung et al., (1989) Method Cell Mol Biol 1:11-19); или с помощью случайного мутагенеза, включая химический мутагенез и т.д. (Miller et al., (1992) A Short Course in Bacterial Genetics, CSHL Press, Cold Spring Harbor, N.Y.; и Greener et al., (1994) Strategies in Mol Biol 7:32-34). Сканирующий линкер мутагенез особенно в комбинаторном методе является привлекательным способом идентификации укороченных (биологически активных) форм полипептидов ActRIIA.

Широкий спектр методов известен в данной области техники для скрининга генных продуктов комбинаторных библиотек, полученных с помощью точечных мутаций и укорочений, и в данном случае для скрининга библиотек кДНК на генные продукты, имеющие определенное свойство. Такие методы должны быть обычно адаптированы для быстрого скрининга библиотек генов, созданных комбинаторным мутагенезом полипептидов ActRIIA. Наиболее широко используемые методы скрининга больших библиотек генов обычно включают клонирование генной библиотеки в реплицируемые экспрессионные векторы, трансформацию соответствующих клеток полученной библиотекой векторов и экспрессию комбинаторных генов в условиях, в которых обнаружение желаемой активности облегчает относительно простое выделение вектора, кодирующего ген, продукт которого обнаружен. Предпочтительные тесты включают тесты на связывание активина и тесты на клеточную сигнализацию, опосредуемую активином.

В некоторых вариантах осуществления полипептиды ActRIIA, используемые в качестве ингибиторов в способах и композициях, описанных в настоящем документе, могут дополнительно включать посттрансляционные модификации в дополнение к тем, которые естественным образом присутствуют в полипептидах ActRIIA. Такие модификации могут включать, но не ограничиваются этим, ацетилирование, карбоксилирование, гликозилирование, фосфорилирование, липидизацию и ацилирование. В результате модифицированные полипептиды ActRIIA могут содержать элементы, не являющиеся аминокислотами, такие как полиэтиленгликоли, липиды, поли- или моносахарид и фосфаты. Эффекты таких элементов, не являющихся аминокислотами, на функциональность полипептида ActRIIA могут быть проверены с помощью любого способа, известного специалисту в данной области техники. Когда полипептид ActRIIA продуцируется в клетках путем расщепления образующейся формы полипептида ActRIIA, посттрансляционный процессинг может быть также важен для правильной укладки и/или функции белка. Различные клетки (такие как клетки CHO, HeLa, MDCK, 293, W138, NIH-3T3 или HEK293) имеют специфический клеточный аппарат и характерные механизмы для такой посттрансляционной активности и могут быть выбраны для обеспечения правильной модификации и процессинга полипептидов ActRIIA.

В некоторых аспектах функциональные варианты и модифицированные формы полипептидов ActRIIA, используемые в качестве ингибиторов в способах и композициях, описанных в настоящем документе, включают гибридные белки, имеющие, по меньшей мере, часть полипептидов ActRIIA и один или более доменов слияния. Хорошо известные примеры таких доменов слияния включают, но не ограничиваются этим, полигистидин, Glu-Glu, глутатион-S-трансферазу (GST), тиоредоксин, протеин А, протеин G, константную область тяжелой цепи иммуноглобулина (Fc), связывающий мальтозу белок (МВР) или сывороточный альбумин человека. Домен слияния может быть выбран таким образом, чтобы придать желаемое свойство. Например, некоторые домены слияния особенно полезны для выделения гибридных белков с помощью аффинной хроматографии. Для аффинной очистки используются соответствующие матрицы для аффинной хроматографии, такие как смолы, конъюгированные с глутатионом, амилазой и никелем или кобальтом. Многие из таких матриц доступны в форме «набора», такого как система очистки Pharmacia GST и система QIAexpress.TM. (Qiagen), используемая с партнерами гибрида (His6). В качестве другого примера домен слияния может быть выбран таким образом, чтобы облегчить обнаружение полипептидов ActRIIA. Примеры таких доменов обнаружения включают различные флуоресцентные белки (например, GFP) а также «эпитопные метки», которые обычно представляют собой короткие пептидные последовательности, которые доступны для специфического антитела. Хорошо известные эпитопные метки, к которым легкодоступны специфические моноклональные антитела, включают FLAG, гемагглютинин вируса гриппа (НА), и метки с-myc. В некоторых случаях домены слияния имеют сайт расщепления протеазами, такими как фактор Ха или тромбин, который позволяет соответствующей протеазе частично гидролизовать гибридные белки, и тем самым высвободить из них рекомбинантные белки. Высвобожденные белки могут быть отделены от домена слияния с помощью последующего хроматографического разделения. В некоторых предпочтительных вариантах осуществления полипептид ActRIIA соединен с доменом, который стабилизирует полипептид ActRIIA in vivo («стабилизирующий» домен). Под «стабилизирующим» подразумевается все, что увеличивает период полужизни в сыворотке независимо от того, возникает ли это из-за пониженного разрушения, снижения клиренса почкой или другого фармакокинетического эффекта. Гибриды с фрагментом Fc иммуноглобулина, как известно, придают желаемые фармакокинетические свойства широкому диапазону белков. Кроме того, гибриды с сывороточным альбумином человека могут придать желаемые свойства. Другие типы доменов слияния, которые могут быть выбраны, включают мультимеризующие (например, димеризующие, тетрамеризующие) домены и функциональные домены (которые придают дополнительную биологическую функцию, такую как дополнительная стимуляция роста костей или роста мышц, в зависимости от пожелания).

Следует понимать, что различные элементы гибридных белков могут быть организованы любым способом, который соответствует желаемой функциональности. Например, полипептид ActRIIA может быть размещен к С-концу от гетерологичного домена или, альтернативно, гетерологичный домен может быть размещен к С-концу от полипептида ActRIIA. Домен полипептида ActRIIA и гетерологичный домен не обязательно должны быть смежными в гибридном белке, и дополнительные домены или аминокислотные последовательности могут быть включены к С- или к N-концу от любого домена или между доменами.

В некоторых вариантах осуществления полипептиды ActRIIA, используемые в качестве ингибиторов в способах и композициях, описанных в настоящем документе, могут содержать одну или более модификаций, которые способны стабилизировать полипептиды ActRIIA. Например, такие модификации могут повысить период полужизни полипептидов ActRIIA in vitro, повысить период полужизни полипептидов ActRIIA в кровотоке или уменьшить протеолитическую деградацию полипептидов ActRIIA. Такие стабилизирующие модификации могут включать, но не ограничиваются этим, гибридные белки (включая, например, гибридные белки, включающие полипептид ActRIIA и стабилизирующий домен), модификации сайта гликозилирования (включая, например, добавление сайта гликозилирования к полипептиду ActRIIA) и модификации углеводного фрагмента (включая, например, удаление углеводных остатков полипептида ActRIIA). В случае гибридных белков полипептид ActRIIA соединяют со стабилизирующим доменом, таким как молекула IgG (например, домен Fc). При применении в настоящем документе термин «стабилизирующий домен» относится не только к области домена слияния (например, Fc), как в случае гибридных белков, но также включает небелковые модификации, такие как углеводная часть или небелковый полимер, такой как полиэтиленгликоль.

В некоторых вариантах осуществления, выделенные и/или очищенные формы полипептидов ActRIIA, которые выделены или иным образом по существу свободны от других белков, могут быть использованы в способах и композициях, описанных в настоящем документе. Полипептиды ActRIIA в целом могут быть получены путем экспрессии рекомбинантных нуклеиновых кислот.

В некоторых аспектах полипептиды ActRIIA, используемые в композициях и способах, описанных в настоящем документе, создаются с использованием выделенных и/или рекомбинантных нуклеиновых кислот, кодирующих любой из полипептидов ActRIIA (например, растворимые полипептиды ActRIIA), включая фрагменты, функциональные варианты и гибридные белки, раскрытые в настоящем документе. Например, SEQ ID NO:4 кодирует природный полипептид-предшественник ActRIIA человека, в то время как SEQ ID NO:5 кодирует внеклеточный домен ActRIIA после процессинга. Такие нуклеиновые кислоты могут быть одноцепочечными или двухцепочечными. Такие нуклеиновые кислоты могут представлять собой молекулы ДНК или РНК. Эти нуклеиновые кислоты могут быть использованы, например, в способах получения полипептидов ActRIIA или в виде непосредственных терапевтических агентов (например, при генной терапии).

В некоторых аспектах нуклеиновые кислоты, кодирующие полипептиды ActRIIA, могут включать нуклеиновые кислоты, которые являются вариантами SEQ ID NO:4 или 5. Вариант нуклеотидных последовательностей включает последовательности, которые отличаются одной или более нуклеотидными заменами, добавками или делециями, такие как аллельные варианты.

В некоторых вариантах осуществления, выделенные или рекомбинантные последовательности нуклеиновой кислоты, кодирующие полипептиды ActRIIA могут быть, по меньшей мере, на 80%, 85%, 90%, 95%, 97%, 98%, 99% или 100% идентичны SEQ ID NO:4 или 5. Специалисту в данной области должно быть понятно, что последовательности нуклеиновых кислот, комплементарные SEQ ID NO:4 или 5, и варианты SEQ ID NO:4 или 5 могут быть использованы для получения полипептидов ActRIIA, пригодных для использования в способах и композициях, описанных в настоящем документе. В других вариантах осуществления такие последовательности нуклеиновой кислоты могут быть выделены, получены рекомбинантным способом и/или соединены с гетерологичной нуклеотидной последовательностью, или получены из библиотеки ДНК.

В других вариантах осуществления нуклеиновые кислоты, используемые для получения полипептидов ActRIIA, пригодные для использования в способах и композициях, описанных в настоящем документе, могут включать нуклеотидные последовательности, которые гибридизуются в условиях высокой жесткости с нуклеотидной последовательностью, обозначенной SEQ ID NO:4 или 5, последовательностью, комплементарной SEQ ID NO:4 или 5, или с их фрагментами. Специалисту в данной области должно быть понятно, что подходящие условия жесткости, которые способствуют гибридизации ДНК, могут варьироваться. Например, можно осуществить гибридизацию 6,0 раз с хлоридом натрия/цитратом натрия (SSC) при температуре приблизительно 45 градусов по Цельсию, а затем промывкой 2,0 раза SSC при 50 градусах Цельсия. Например, концентрация соли на стадии промывки может быть выбрана при низкой жесткости приблизительно 2,0 раза SSC при 50 градусах Цельсия, при высокой жесткости приблизительно 0,2 раза SSC при 50 градусах Цельсия. Кроме того, температура на стадии промывки может быть увеличена от комнатной температуры приблизительно 22 градуса по Цельсию в условиях низкой жесткости до температуры приблизительно 65 градусов по Цельсию в условиях высокой жесткости. Как температура, так и концентрация соли может варьироваться, или температура или концентрация соли может поддерживаться постоянной, в то время как изменяется другая переменная. В одном варианте осуществления нуклеиновые кислоты, которые гибридизуются в условиях низкой жесткости 6 раз SSC при комнатной температуре с последующей промывкой 2 раза SSC при комнатной температуре, можно использовать с методами и композициями, описанными в настоящем документе.

Выделенные нуклеиновые кислоты, которые отличаются от нуклеиновых кислот, представленных в SEQ ID NO: 4 или 5 из-за вырожденности генетического кода, также могут быть использованы при получении полипептидов ActRIIA, пригодных для использования в способах и композициях, описанных в настоящем документе. Например, ряд аминокислот определяется более чем одним триплетом. Кодоны, которые определяют одну и ту же аминокислоту, или синонимы (например, CAU и CAC являются синонимами гистидина), могут вести к «молчащим» мутациям, которые не влияют на аминокислотную последовательность белка. Однако ожидается, что полиморфизмы последовательности ДНК, которые приводят к изменениям в аминокислотных последовательностях белков согласно изобретению, должны существовать в клетках млекопитающих. Специалисту в данной области техники должно быть понятно, что эти вариации одного или более нуклеотидов (приблизительно до 3-5% нуклеотидов) в нуклеиновых кислотах, кодирующих конкретный белок, могут существовать среди особей данного вида из-за естественных вариаций аллелей.

В некоторых вариантах осуществления рекомбинантные нуклеиновые кислоты могут быть функционально связаны с одной или более регуляторными нуклеотидными последовательностями в экспрессионном конструкте. Регуляторные нуклеотидные последовательности должны обычно подходить для экспрессии в используемой клетке-хозяине. Многочисленные типы соответствующих экспрессионных векторов и подходящие регуляторные последовательности известны в данной области техники для различных клеток-хозяев. Обычно указанные одна или более регуляторные нуклеотидные последовательности могут включать, но не ограничиваться этим, промоторные последовательности, лидирующие или сигнальные последовательности, сайты связывания рибосом, последовательности инициации и терминации транскрипции, последовательности инициации и терминации трансляции и энхансерные или активаторные последовательности. В данном описании рассматриваются конститутивные или индуцибельные промоторы, как известно в данной области техники. Промоторы могут представлять собой либо природные промоторы, либо гибридные промоторы, которые сочетают в себе элементы более одного промотора. Экспрессионный конструкт может присутствовать в клетке в эписоме, такой как плазмида, или экспрессионный конструкт может быть вставлен в хромосому. В предпочтительном варианте осуществления экспрессионный вектор содержит ген маркера селекции для возможности отбора трансформированных клеток-хозяев. Гены маркеров селекции хорошо известны в данной области техники и должны варьироваться в зависимости от используемой клетки-хозяина.

В некоторых аспектах нуклеиновая кислота, используемая при получении полипептидов ActRIIA, пригодная для использования в способах и композициях, описанных в настоящем документе, может быть предоставлена в экспрессионном векторе, включающем нуклеотидную последовательность, кодирующую полипептид ActRIIA и функционально связанную, по меньшей мере, с одной регуляторной последовательностью. Регуляторные последовательности известны в данной области техники и выбираются так, чтобы управлять экспрессией полипептида ActRIIA. Соответственно, термин регуляторная последовательность включает промоторы, энхансеры и другие элементы, контролирующие экспрессию. Примеры регуляторных последовательностей описаны в Goeddel; Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, Calif. (1990). Например, любую из широкого разнообразия последовательностей, контролирующих экспрессию, которые контролируют экспрессию последовательности ДНК, когда функционально связаны с ней, можно использовать в этих векторах, чтобы экспрессировать последовательности ДНК, кодирующие полипептид ActRIIA. Такие пригодные последовательности, контролирующие экспрессию, включают, например, ранний и поздний промоторы SV40, промотор tet, немедленный ранний промотор аденовируса или цитомегаловируса, промоторы RSV, систему lac, систему trp, систему TAC или TRC, промотор Т7, экспрессия которого управляется РНК-полимеразой Т7, главные операторные и промоторные области фага лямбда, контролирующие области белка оболочки FD, промотор 3-фосфоглицераткиназы или других гликолитических ферментов, промоторы кислой фосфатазы, например, Pho5, промоторы факторов α-спаривания дрожжей, многогранный промотор бакуловирусной системы и другие последовательности, известные как контролирующие экспрессию генов прокариотных или эукариотных клеток или их вирусов, и различные их сочетания. Следует понимать, что дизайн экспрессионного вектора может зависеть от таких факторов, как выбор клетки-хозяина, подвергаемой трансформации, и/или тип желаемого белка, предназначенного для экспрессии. Кроме того, также необходимо учитывать число копий вектора, способность контролировать это число копий и экспрессию любого другого белка, кодируемого вектором, такого как маркеры антибиотиков.

Рекомбинантная нуклеиновая кислота, используемая при получении полипептидов ActRIIA, пригодных для использования в способах и композициях, описанных в настоящем документе, может быть получена путем лигирования клонированного гена или его части в вектор, подходящий для экспрессии либо в клетках прокариот, клетках эукариот (дрожжей, птиц, насекомых или млекопитающих), либо в обеих. Экспрессионные векторы для получения рекомбинантного полипептида ActRIIA включают плазмиды и другие векторы. Например, подходящие векторы включают типы плазмид: плазмиды, производные pBR322, плазмиды, производные pEMBL, плазмиды, производные pEX, плазмиды, производные pBTac, и плазмиды, производные pUC, для экспрессии в прокариотных клетках, таких как E. coli.

Некоторые экспрессионные векторы млекопитающих содержат как прокариотные последовательности для облегчения воспроизведения вектора в бактериях, так и одну или несколько эукариотных транскрипционных единиц, которые экспрессируются в эукариотных клетках. Примерами экспрессионных векторов млекопитающих, подходящих для трансфекции эукариотных клеток, являются векторы, происходящие от PcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVneo, pMSG, pSVT7, pko-neo и pHyg. Некоторые из этих векторов модифицированы последовательностями из бактериальных плазмид, таких как pBR322, для облегчения репликации и селекции устойчивости к лекарствам как в прокариотных, так и в эукариотных клетках. Альтернативно, производные вирусов, таких как вирус папилломы крупного рогатого скота (BPV-1) или вирус Эпштейна-Барра (pHEBo, производное pREP и P205), могут быть использованы для временной экспрессии белков в эукариотных клетках. Примеры других вирусных (включая ретровирусные) систем экспрессии можно найти ниже в описании систем доставки при генной терапии. Различные методы, используемые для получения плазмид и трансформации организмов-хозяев, хорошо известны в данной области техники. В отношении других подходящих систем экспрессии как в прокариотных, так и в эукариотных клетках, а также общих рекомбинантных процедур смотри Molecular Cloning A Laboratory Manual, 3rd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press, 2001). В некоторых случаях может быть желательна экспрессия рекомбинантных полипептидов с использованием бакуловирусной системы экспрессии. Примеры таких бакуловирусных систем экспрессии включают векторы, происходящие от pVL (такие как pVL1392, pVL1393 и pVL941), векторы, происходящие от pAcUW (такие как pAcUWl) и векторы, происходящие от pBlueBac (такие как содержащая β-gal pBlueBac III).

Могут быть созданы векторы для получения желаемых полипептидов ActRIIA в клетках СНО, такие как вектор Pcmv-Script (Stratagene, La Jolla, Calif.), векторы pcDNA4 (Invitrogen, Carlsbad, Calif.) и векторы PCI-neo (Promega, Madison, Wis.). Как должно быть очевидно, желаемые генные конструкты могут быть использованы для индукции экспрессии желаемых полипептидов ActRIIA в клетках, воспроизводящихся в культуре, например, для получения белков, включая гибридные белки или варианты белков для очистки.

Клетки-хозяева, трансфецированные рекомбинантным геном, включающим кодирующую последовательность (например, SEQ ID NO:4 или 5) одного или более желаемого полипептида ActRIIA, могут быть использованы для получения полипептидов ActRIIA, пригодных для использования в способах и композициях, описанных в данном документе. Клетка-хозяин может быть любой прокариотной или эукариотной клеткой. Например, полипептид ActRIIA, предлагаемый в настоящем документе, может быть экспрессирован в бактериальных клетках, таких как E. coli, клетках насекомых (например, с помощью бакуловирусной системы экспрессии), дрожжей или клетках млекопитающих. Другие подходящие клетки-хозяева известны специалистам в данной области техники.

Соответственно, в настоящем документе предлагаются способы получения полипептидов ActRIIA. Например, клетку-хозяина, трансфецированную экспрессионным вектором, кодирующим полипептид ActRIIA, можно культивировать в соответствующих условиях для возможности возникновения экспрессии полипептида ActRIIA. Полипептид ActRIIA может секретироваться и может быть выделен из смеси клеток и из среды, содержащей полипептид ActRIIA. Альтернативно, полипептид ActRIIA может оставаться в цитоплазме или в мембранной фракции, и клетки собирают, лизируют и выделяют белок. Культура клеток включает клетки-хозяева, среды и другие побочные продукты. Подходящие среды для культивирования клеток хорошо известны в данной области техники. Желаемые полипептиды ActRIIA могут быть выделены из клеточной культуральной среды, клеток-хозяев или обоих источников с использованием способов, известных в данной области техники для очистки белков, включая ионообменную хроматографию, гель-фильтрационную хроматографию, ультрафильтрацию, электрофорез, иммуноаффинную очистку с использованием антител, специфичных для конкретных эпитопов полипептидов ActRIIA, и аффинную очистку с агентом, который связывается с доменом, соединенным с полипептидом ActRIIA (например, для очистки гибрида ActRIIA-Fc может быть использована колонка с протеином А). В предпочтительном варианте осуществления полипептид ActRIIA представляет собой гибридный белок, содержащий домен, который облегчает его очистку. В одном варианте осуществления очистка достигается с помощью ряда стадий колоночной хроматографии, включая, например, три или более из следующих стадий в любом порядке: хроматографию на колонке с протеином А, хроматографию на сефарозе Q, хроматографию не фенилсефарозе, хроматографию, исключающую по размеру, и катионообменную хроматографию. Очистка может быть завершена фильтрацией вирусов и заменой буфера. Как показано в настоящем документе, белок ActRIIA-hFc очищали до чистоты >98% при определении с помощью хроматографии, исключающей по размеру, и >95% при определении с помощью SDS-PAGE. Этот уровень чистоты был достаточен для достижения желаемых эффектов на костную ткань у мышей и имел приемлемый профиль безопасности у мышей, крыс и приматов, не являющихся человеком.

В другом варианте осуществления гибридный ген, кодирующий лидирующую последовательность для очистки, такую как последовательность сайта расщепления поли(His)/энтерокиназой на N-конце желаемого фрагмента рекомбинантного полипептида ActRIIA, может предоставить возможность очистки экспрессированного гибридного белка с помощью аффинной хроматографии с использованием смолы с металлом Ni2+. Лидирующую последовательность для очистки потом можно удалить с помощью обработки энтерокиназой с получением очищенного полипептида ActRIIA (например, смотри Hochuli et al., (1987) J. Chromatography 411:177; and Janknecht et al., PNAS USA 88:8972).

Методы получения гибридных генов хорошо известны. По существу выполняется присоединение различных фрагментов ДНК, кодирующих разные полипептидные последовательности, в соответствии с традиционными методами с использованием тупых концов или ступенчатых концов для лигирования, гидролиза ферментом рестрикции для обеспечения подходящими концами, заполнения липких концов, если это необходимо, обработки щелочной фосфатазой во избежание нежелательного присоединения и ферментативного лигирования. В другом варианте осуществления гибридный ген может быть синтезирован общепринятыми способами, включая автоматизированные синтезаторы ДНК. Альтернативно, может быть проведена ПЦР-амплификация фрагментов гена с использованием якорных праймеров, которые дают комплементарные выступы между двумя последовательными генными фрагментами, которые впоследствии можно подвергать отжигу с созданием последовательности гибридного гена (смотри, например, Current Protocols in Molecular Biology, eds. Ausubel et al., John Wiley & Sons: 1992).

Гибридный белок ActRIIA-Fc может быть экспрессирован в стабильно трансфецированных клетках СНО-DUKX Bl1 из вектора pAID4 (SV40 ori/энхансер, промотор CMV) с использованием лидирующей последовательности тканевого плазминогена SEQ ID NO:9. Фрагмент Fc представляет собой последовательность Fc IgGl человека, как показано в SEQ ID NO:7. В некоторых вариантах осуществления при экспрессии содержащийся белок имеет в среднем приблизительно от 1,5 до 2,5 моль сиаловой кислоты на молекулу гибридного белка ActRIIA-Fc.

В некоторых вариантах осуществления длительный период полужизни гибридного ActRIIA-Fc в сыворотке больных людей может составлять 25-32 дня. Кроме того, клетки СНО, экспрессирующие продукт, могут иметь более высокое сродство к лиганду активину B, чем сообщалось для гибридного белка ActRIIA-hFc, экспрессируемого в клетках 293 человека (del Re et al., J Biol Chem. 2004 Dec 17;279(51):53126-35). Кроме того, не будучи связанными какой-либо теорией, использование лидирующей последовательности TPA обеспечивало более высокую продукцию, чем другие лидирующие последовательности и в отличие от ActRIIA-Fc, экспрессируемого с природной лидирующей последовательностью, может обеспечить N-концевую последовательность высокой степени чистоты. Использование природной лидирующей последовательности может привести к двум основным видам ActRIIA-Fc, каждый из которых имеет различную N-концевую последовательность.

(b) Ингибиторы ActRIIB

При применении в настоящем документе термин «ActRIIB» относится к семейству рецепторных белков типа IIB активина (ActRIIB) из любых видов и к вариантам, полученным от таких белков ActRIIB путем мутагенеза или иной модификации. Ссылку на ActRIIB в настоящем документе следует понимать как ссылку на любой из идентифицированных на настоящий момент форм рецептора. Члены семейства ActRIIB обычно представляют собой трансмембранные белки, состоящие из лигандсвязывающего внеклеточного домена с обогащенной цистеином областью, трансмембранного домена и цитоплазматического домена с предсказанной активностью серин/треонинкиназы.

Ингибиторы ActRIIB для использования в композициях и способах, описанных в настоящем документе, включают без ограничения активин-связывающие растворимые полипептиды ActRIIB; антитела, которые связываются с активином (в частности с субъединицами активина A или B, также называемыми βA или βB) и нарушают связывание ActRIIB; антитела, которые связываются с ActRIIB и нарушают связывание активина; белки, не являющиеся антителами, выбранные для связывания активина или ActRIIB; и рандомизированные пептиды, выбранные для связывания активина или ActRIIB, которые можно конъюгировать с доменом Fc.

В некоторых вариантах осуществления два или более различных белка (или другие фрагменты) с активностью в виде связывания активина или ActRIIB, особенно связывания активина, которые блокируют сайты связывания типа I (например, растворимого рецептора типа I активина) и типа II (например, растворимого рецептора тип II активина), соответственно, могут быть соединены друг с другом для создания бифункциональной или многофункциональной связывающей молекулы, которая ингибирует ActRIIB и, таким образом, может быть использована в композициях и способах, описанных в настоящем документе. В некоторых вариантах осуществления антагонисты оси сигнализации активин-ActRIIB, которые ингибируют ActRIIB, включают аптамеры нуклеиновых кислот, небольшие молекулы и другие агенты, используемые в композициях и способах, описанных в настоящем документе.

(i) Ингибиторы, включающие полипептиды ActRIIB

При применении в настоящем документе термин «полипептид ActRIIB» относится к полипептидам, содержащим любой природный полипептид член семейства ActRIIB, а также любые их варианты (включая мутанты, фрагменты, гибриды и формы пептидомиметиков), которые сохраняют полезную активность. Например, полипептиды ActRIIB включают полипептиды, происходящие из последовательности любого известного рецептора ActRIIB, имеющие последовательность, по меньшей мере, приблизительно на 80% идентичную последовательности полипептида ActRIIB, и необязательно идентичную, по меньшей мере, на 85%, 90%, 95%, 96%, 97%, 98%, 99% или более. Например, полипептид ActRIIB может связывать и ингибировать функцию белка ActRIIB и/или активина. Пример полипептида ActRIIB включает предшественник полипептида ActRIIB человека (SEQ ID NO:16 или SEQ ID NO:28). Что касается предшественника полипептида ActRIIB, чья аминокислотная последовательность представлена в SEQ ID NO:16 или SEQ ID NO:28 (то есть, предшественника полипептида ActRIIB человека), сигнальный пептид предшественника полипептида ActRIIB локализован в положениях аминокислот с 1 по 18; внеклеточный домен расположен в положениях аминокислот с 19 по 134, и потенциальные сайты N-связанного гликозилирования расположены в положениях аминокислот 42 и 65. Последовательность нуклеиновой кислоты, кодирующая предшественник полипептида ActRIIB человека SEQ ID NO:16, раскрыта как SEQ ID NO:19 (SEQ ID NO:19 дает аланин в кодоне, соответствующем положению аминокислоты 64, но может быть легко модифицирована специалистом в данной области техники с использованием способов, известных в данной области техники, для получения вместо него аргинина в кодоне, соответствующем аминокислоте в положении 64). Смотри таблицу 6 для описания последовательностей.

Нумерация аминокислот для всех полипептидов, относящихся к ActRIIB, описанных в настоящем документе, основана на нумерации аминокислот SEQ ID NO:16 и SEQ ID NO:28 (которые отличаются только аминокислотой, экспрессируемой в положении 64), если специально не указано иное. Например, если полипептид ActRIIB описан как имеющий замену/мутацию в положении 79 аминокислоты, то следует понимать, что положение 79 относится к 79-й аминокислоте в SEQ ID NO:16 или SEQ ID NO:28, из которых произошел полипептид ActRIIB. Аналогичным образом, если полипептид ActRIIB описан как имеющий аланин или аргинин в положении 64 аминокислоты, то следует понимать, что положение 64 относится к 64-й аминокислоте в SEQ ID NO:16 или SEQ ID NO:28, из который произошел полипептид ActRIIB.

В некоторых вариантах осуществления ингибиторы ActRIIB, используемые в композициях и способах, описанных в настоящем документе, включают полипептиды, включающие активин-связывающий домен ActRIIB. В некоторых вариантах осуществления активин-связывающие домены ActRIIB включают внеклеточный домен ActRIIB или его часть. В конкретных вариантах осуществления внеклеточный домен ActRIIB или его часть растворимы. Иллюстративные модифицированные формы полипептидов ActRIIB описаны в публикации заявок на патент США NO. 20090005308 и 20100068215, содержание которых включено в настоящее описание в качестве ссылки в полном объеме.

В конкретных вариантах осуществления полипептиды ActRIIB, используемые в композициях и способах, описанных в настоящем документе, представляют собой растворимые полипептиды ActRIIB. Термин «растворимый полипептид ActRIIB» обычно относится к полипептидам, содержащим внеклеточный домен белка ActRIIB, включая любой природный внеклеточный домен белка ActRIIB, а также любые их варианты (в том числе мутанты, фрагменты и формы пептидомиметиков). Растворимые полипептиды ActRIIB могут связываться с активином; однако, белок ActRIIB дикого типа не проявляет существенной селективности в связывании активина по сравнению с GDF8/11. В некоторых вариантах осуществления измененные формы ActRIIB с различными связывающими свойствами могут быть использованы в способах, представленных в настоящем документе. Такие измененные формы раскрыты, например, в международных публикациях патентных заявок NO. WO 2006/012627 и WO 2010/019261, содержание которых включено в настоящее описание в качестве ссылки в полном объеме. Природные или измененные белки ActRIIB могут придавать дополнительную специфичность в отношении активина за счет соединения их со вторым избирательным для активина связывающим агентом. Примеры растворимых полипептидов ActRIIB включают внеклеточный домен полипептида ActRIIB человека (например, SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 и 43).

Гибридный белок с Fc, имеющий внеклеточную последовательность ActRIIB, раскрытый Hilden et al. (Blood, 1994, 83(8):2163-70), который имеет аланин в положении, соответствующем аминокислоте 64 аминокислотной последовательности предшественника ActRIIB, т.е. SEQ ID NO:16 (далее обозначаемом как «A64»), как показано, обладает относительно низким сродством к активину и GDF-11. В отличие от этого гибридный белок с Fc с аргинином в положении 64 в аминокислотной последовательности предшественника ActRIIB (далее обозначаемый как «R64») обладает сродством к активину и GDF-11 в диапазоне от низкого наномолярного до высокого пикомолярного (смотри, например, заявку на патент США No 20100068215, раскрытие которой включено в настоящее описание в полном объеме). Аминокислотная последовательность предшественника ActRIIB с аргинином в положении 64 представлена в SEQ ID NO:28. Таким образом, в некоторых вариантах осуществления полипептиды ActRIIB, используемые в соответствии с композициями и способами, описанными в настоящем документе, могут включать либо (i) аланин в положении, соответствующем аминокислоте 64 в аминокислотной последовательности предшественника ActRIIB, т.е. SEQ ID NO:16; либо (ii) аргинин в положении 64 аминокислотной последовательности предшественника ActRIIB, т.е. SEQ ID NO:28. В других вариантах осуществления полипептиды ActRIIB, используемые в соответствии с композициями и способами, описанными в настоящем документе, могут содержать аминокислоту, которая не является аланином или аргинином в положении, соответствующем аминокислоте 64 в аминокислотной последовательности предшественника ActRIIB, т.е. SEQ ID NO:16 или SEQ ID NO:28.

Показано, что делеция пролинового узла на С-конце внеклеточного домена ActRIIB снижает сродство рецептора к активину (смотри, например Attisano et al., Cell, 1992, 68(1):97-108). Гибридный белок ActRIIB-Fc, содержащий аминокислоты 20-119 из SEQ ID NO:28 (т.е. SEQ ID NO:32), «ActRIIB (20-119)-Fc», характеризовался пониженным связыванием GDF-11 и активина по сравнению с гибридным белком ActRIIB-Fc, содержащим аминокислоты 20-134 из SEQ ID NO:28 (т.е. SEQ ID NO:31), «ActRIIB (20-134)-Fc», который включает область пролинового узла и полный юкстамембранный домен. Тем не менее, гибридный белок ActRIIB-Fc, содержащий аминокислоты 20-129 из SEQ ID NO:28 «ActRIIB (20-129)-Fc», сохраняет сходную, но несколько сниженную активность по сравнению с неукороченным внеклеточным доменом ActRIIB, даже если область пролинового узла нарушается. Таким образом, полипептиды ActRIIB, включающие внеклеточные домены, которые останавливаются на аминокислоте 134, 133, 132, 131, 130 и 129 SEQ ID NO:28 (или SEQ ID NO:16) все, как ожидается, будут активными, но конструкты, кончающиеся на аминокислоте 134 или 133, могут быть наиболее активными. Аналогичным образом не ожидается, что мутации в любом из остатков 129-134 в высокой степени изменят аффинность связывания лиганда, на что указывает тот факт, что мутации P129 и P130 в SEQ ID NO:28, существенно не снижают связывание лиганда. Таким образом, полипептиды ActRIIB, используемые в соответствии с методами и композициями, описанными в настоящем документе, могут оканчиваться уже на аминокислоте 109 (т.е. концевом цистеине) в SEQ ID NO:28 (или SEQ ID NO:16), однако, формы, оканчивающиеся на или между положениями аминокислот 109 и 119 в SEQ ID NO:28 (или SEQ ID NO:16), как ожидается, будут иметь пониженную лиганд-связывающую способность.

Аминокислота 29 в SEQ ID NO:16 и SEQ ID NO:28 представляет собой начальный цистеин в последовательности предшественника ActRIIB. Ожидается, что полипептид ActRIIB, начиная с аминокислоты 29 N-конца SEQ ID NO:16 или SEQ ID NO:28, или перед этими положениями аминокислот, сохранит лиганд-связывающую активность. Мутации с заменой аланина на аспарагин в положении 24 SEQ ID NO:16 или SEQ ID NO:28 вводит последовательность N-связанного гликозилирования без существенного влияния на связывание лиганда. Это подтверждает, что мутации в области между отщепляемым сигнальным пептидом и областью поперечной сшивки цистеинами, соответствующей аминокислотам 20-29 из SEQ ID NO:16 или SEQ ID NO:28, хорошо переносятся. В частности, полипептиды ActRIIB, начинающиеся с положения аминокислоты 20, 21, 22, 23 и 24 SEQ ID NO:16 или SEQ ID NO:28 будет сохранять активность, и полипептиды ActRIIB, начинающиеся с положений аминокислот 25, 26, 27, 28 и 29 SEQ ID NO:16 или SEQ ID NO:28, также, как ожидается, сохранят активность. Полипептид ActRIIB, начинающийся с положения аминокислоты 22, 23, 24 или 25 в SEQ ID NO:16 или SEQ ID NO:28, будет иметь наибольшую активность.

Взятые вместе, активные части (т.е. полипептиды ActRIIB) белка-предшественника ActRIIB (т.е. SEQ ID NO:16 или SEQ ID NO:28), предназначенные для использования в соответствии с методами и композициями, описанными в настоящем документе, обычно включают аминокислоты 29-109 SEQ ID NO:16 или SEQ ID NO:28, и такие полипептиды ActRIIB могут, например, начинаться с остатка, соответствующего любой из аминокислот 19-29 SEQ ID NO:16 или SEQ ID NO:28 и заканчиваться в положении, соответствующем любой из аминокислот 109-134 из SEQ ID NO:16 или SEQ ID NO:28. Конкретные примеры полипептидов ActRIIB, охватываемые настоящим документом, включают полипептиды, которые начинаются с положения аминокислоты от 19-29, 20-29 или 21-29 в SEQ ID NO:16 или SEQ ID NO:28 и кончаются в положении аминокислоты от 119-134, 119-133 или 129-134, 129-133 в SEQ ID NO:16 или SEQ ID NO:28. Другие конкретные примеры полипептидов ActRIIB, охватываемые настоящим документом, включают полипептиды, которые начинаются с положения аминокислоты от 20-24 (или 21-24, или 22-25) последовательности SEQ ID NO:16 или SEQ ID NO:28, и кончаются положением аминокислоты от 109-134 (или 109-133), 119-134 (или 119-133) или 129-134 (или 129-133) SEQ ID NO:16 или SEQ ID NO:28. Варианты полипептидов ActRIIB, попадающие в пределы этих диапазонов, также охватываются, в частности, варианты, которые имеют, по меньшей мере, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичность или гомологию последовательности с соответствующей частью SEQ ID NO:16 или SEQ ID NO:28.

В некоторых вариантах осуществления ингибиторы ActRIIB, используемые в композициях и способах, описанных в настоящем документе, включают укороченную форму внеклеточного домена ActRIIB. Укорочение может быть на карбоксильном конце и/или на аминоконце полипептида ActRIIB. В некоторых вариантах осуществления укорочение может быть на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 аминокислот в длину по сравнению со зрелым внеклеточным доменом полипептида ActRIIB. В некоторых вариантах осуществления укорочение может быть на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 N-концевых аминокислот зрелого внеклеточного домена полипептида ActRIIB. В некоторых вариантах осуществления укорочение может быть на 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 С-концевых аминокислот зрелого внеклеточного домена полипептида ActRIIB. Например, укороченные формы ActRIIB включают полипептиды с аминокислотами 20-119; 20-128; 20-129; 20-130; 20-131; 20-132; 20-133; 20-134; 20-131; 21-131; 22-131; 23-131; 24-131 и 25-131, где положения аминокислот относятся к положениям аминокислот в SEQ ID NO:16 или SEQ ID NO:28.

Дополнительные иллюстративные укороченные формы ActRIIB включают (i) полипептиды, начинающиеся с аминокислот в любом из положений аминокислот 21-29 SEQ ID NO:16 или SEQ ID NO:28 (необязательно начинающиеся с 22-25 SEQ ID NO:16 или SEQ ID NO:28) и заканчивающиеся в любом из положений аминокислот 109-134 SEQ ID NO:16 или SEQ ID NO:28; (ii) полипептиды, начинающиеся с любой из аминокислот 20-29 SEQ ID NO:16 или SEQ ID NO:28 (необязательно начинающиеся с 22-25 SEQ ID NO:16 или SEQ ID NO:28) и заканчивающиеся в любом из положений аминокислот 109-133 SEQ ID NO:16 или SEQ ID NO:28; (iii) полипептиды, начинающиеся с любой из аминокислот 20-24 SEQ ID NO:16 или SEQ ID NO:28 (необязательно начинающиеся с 22-25 SEQ ID NO:16 или SEQ ID NO:28) и заканчивающиеся в любом из положений аминокислот 109-133 SEQ ID NO:16 или SEQ ID NO:28; (iv) полипептиды, начинающиеся с любой из аминокислот 21-24 SEQ ID NO:16 или SEQ ID NO:28 и заканчивающиеся в любом из положений аминокислот 109-134 SEQ ID NO:16 или SEQ ID NO:28; (v) полипептиды, начинающиеся с любой из аминокислот 20-24 SEQ ID NO:16 или SEQ ID NO:28 и заканчивающиеся в любом из положений аминокислот 118-133 SEQ ID NO:16 или SEQ ID NO:28; (vi) полипептиды, начинающиеся с любой из аминокислот 21-24 SEQ ID NO:16 или SEQ ID NO:28 и заканчивающиеся в любом из положений аминокислот 118-134 SEQ ID NO:16 или SEQ ID NO:28; (vii) полипептиды, начинающиеся с любой из аминокислот 20-24 SEQ ID NO:16 или SEQ ID NO:28 и заканчивающиеся в любом из положений аминокислот 128-133 SEQ ID NO:16 или SEQ ID NO:28; (viii) полипептиды, начинающиеся с любой из аминокислот 20-24 SEQ ID NO:16 или SEQ ID NO:28 и заканчивающиеся в любом из положений аминокислот 128-133 SEQ ID NO:16 или SEQ ID NO:28; (ix) полипептиды, начинающиеся с любой из аминокислот 21-29 SEQ ID NO:16 или SEQ ID NO:28 и заканчивающиеся в любом из положений аминокислот 118-134 SEQ ID NO:16 или SEQ ID NO:28; (х) полипептиды, начинающиеся с любой из аминокислот 20-29 SEQ ID NO:16 или SEQ ID NO:28 и заканчивающиеся в любом из положений аминокислот 118-133 SEQ ID NO:16 или SEQ ID NO:28; (xi) полипептиды, начинающиеся с любой из аминокислот 21-29 SEQ ID NO:16 или SEQ ID NO:28 и заканчивающиеся в любом из положений аминокислот 128-134 SEQ ID NO:16 или SEQ ID NO:28; и (xii) полипептиды, начинающиеся с любой из аминокислот 20-29 SEQ ID NO:16 или SEQ ID NO:28 и заканчивающиеся в любом из положений аминокислот 128-133 SEQ ID NO:16 или SEQ ID NO:28. В конкретном варианте осуществления полипептиды ActRIIB включают, по существу состоят или состоят из аминокислотной последовательности, начинающейся с положения аминокислоты 25 SEQ ID NO:16 или SEQ ID NO:28 и заканчивающейся в положении аминокислоты 131 SEQ ID NO:16 или SEQ ID NO:28. В другом конкретном варианте осуществления полипептид ActRIIB состоит из или по существу состоит из аминокислотной последовательности SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 или 43.

Любой из полипептидов ActRIIB, используемых в композициях и способах, описанных в настоящем документе, может быть получен в виде гомодимера. Любой из полипептидов ActRIIB, используемых в композициях и способах, описанных в настоящем документе, может быть составлен в виде гибридного белка, имеющего гетерологичный участок, который включает константную область тяжелой цепи IgG, такую как домен Fc. Любой из полипептидов ActRIIB, используемых в композициях и способах, описанных в настоящем документе, может содержать кислую аминокислоту в положении, соответствующем положению 79 в SEQ ID NO:16 или SEQ ID NO:28, необязательно в сочетании с одной или более дополнительными аминокислотными заменами, делециями или вставками по отношению к SEQ ID NO:16 или SEQ ID NO:28.

В конкретных вариантах осуществления ингибиторы ActRIIB, используемые в композициях и способах, описанных в настоящем документе, включают внеклеточный домен ActRIIB с одной или более аминокислотными заменами/мутациями. Такая аминокислотная замена/мутация может представлять собой, например, замену лейцина в положении аминокислоты 79 SEQ ID NO:16 или SEQ ID NO:28 кислой аминокислотой, такой как аспарагиновая кислота или глутаминовая кислота. Например, положение L79 SEQ ID NO:16 или SEQ ID NO:28 во внеклеточном домене полипептидов ActRIIB может быть изменено для придания измененных связывающих свойств для активина-миостатина (GDF-11). Мутации L79A и L79P снижают связывание GDF-11 в большей степени, чем связывание активина. Мутации L79E и L79D сохраняют связывание GDF-11, при этом демонстрируя значительное снижение связывания активина.

В некоторых вариантах осуществления ингибиторы ActRIIB, используемые в композициях и способах, описанных в настоящем документе, включают укороченную форму внеклеточного домена ActRIIB, которая также несет аминокислотную замену, например, замену лейцина в положении аминокислоты 79 SEQ ID NO:16 или SEQ ID NO:28 кислой аминокислотой, такой как аспарагиновая кислота или глутаминовая кислота. В конкретном варианте осуществления укороченная форма внеклеточного домена полипептида ActRIIB, который также несет аминокислотную замену, используемая в композициях и способах, описанных в настоящем документе, представляет собой SEQ ID NO:23. Формы ActRIIB, которые являются укороченными и/или несут одну или более аминокислотных замен, могут быть соединены с доменом Fc антитела, как обсуждалось выше.

Функционально активные фрагменты полипептидов ActRIIB могут быть получены, например, путем скрининга полипептидов, полученных рекомбинантно из соответствующего фрагмента нуклеиновой кислоты, кодирующей полипептид ActRIIB. Кроме того, фрагменты могут быть химически синтезированы с использованием способов, известных в данной области техники, таких как традиционные методы твердофазного синтеза f-Moc по Меррифилду или t-Boc химия. Фрагменты могут быть получены (рекомбинантно или путем химического синтеза) и протестированы для идентификации тех пептидильных фрагментов, которые могут функционировать в качестве антагонистов (ингибиторов) белка ActRIIB или сигнализации, опосредуемой активином.

Кроме того, функционально активные варианты полипептидов ActRIIB могут быть получены, например, путем скрининга библиотек модифицированных полипептидов, полученных рекомбинантно из соответствующих подвергнутых мутагенезу нуклеиновых кислот, кодирующих полипептид ActRIIB. Варианты могут быть получены и протестированы для идентификации вариантов, которые могут функционировать в качестве антагонистов (ингибиторов) белка ActRIIB или путей сигнализации, опосредуемых активином. В некоторых вариантах осуществления функциональный вариант полипептидов ActRIIB включает аминокислотную последовательность, которая, по меньшей мере, на 75% идентична аминокислотной последовательности, выбранной из SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42, и 43. В некоторых вариантах осуществления функциональный вариант имеет аминокислотную последовательность, по меньшей мере, на 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% идентичную аминокислотной последовательности, выбранной из SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42, и 43.

Функциональные варианты могут быть получены, например, путем модификации структуры полипептида ActRIIB с целью повышения терапевтической эффективности или стабильности (например, срока годности ex vivo и устойчивости к протеолитической деградации in vivo). Такие модифицированные полипептиды ActRIIB при выборе для сохранения связывания активина рассматриваются как функциональные эквиваленты природных полипептидов ActRIIB. Модифицированные полипептиды ActRIIB также могут быть получены, например, путем замены, делеции или добавления аминокислот. Например, разумно ожидать, что отдельная замена лейцина на изолейцин или валин, аспартата на глутамат, треонина на серин или сходная замена аминокислоты структурно родственной аминокислотой (например, консервативные мутации) не будет иметь большого влияния на биологическую активность полученной молекулы. Консервативные замены представляют собой замены, которые имеют место внутри семейства аминокислот, которые сходны по своим боковым цепям. Будет ли изменение в аминокислотной последовательности полипептида ActRIIB приводить к функциональному гомологу, может быть легко определено путем оценки способности варианта полипептида ActRIIB давать в клетках ответ, подобный ответу на полипептид ActRIIB дикого типа.

Мутанты полипептидов ActRIIB, в частности, набор комбинаторных мутантов полипептида ActRIIB, а также укороченные мутанты; пулы комбинаторных мутантов, особенно пригодные для идентификации последовательностей функциональных вариантов, могут быть особенно полезными в способах и композициях, описанных в настоящем документе. Цель скрининга таких комбинаторных библиотек может заключаться в создании, например, полипептидных вариантов ActRIIB, которые могут действовать либо как агонисты, либо как антагонисты, или альтернативно, которые все вместе обладают новой активностью.

Показано, что лигандсвязывающий карман ActRIIB определяется остатками Y31, N33, N35, L38 по T41, E47, E50, Q53 по K55, L57, H58, Y60, S62, K74, W78 по N83, Y85, R87, A92 и E94 по F101 SEQ ID NO:16 или SEQ ID NO:28. Ожидается, что консервативные мутации в этих положениях будут допускаться, хотя мутация K74A хорошо переносится, как и R40A, K55A, F82A и мутации в положении L79. R40 представляет собой К у Xenopus, указывая на то, что основные аминокислоты в этом положении будет допускаться. Q53 представляет собой R у бычьего ActRIIB и К у ActRIIB Xenopus, и, следовательно, аминокислоты, включая R, K, Q, N и Н будут допускаться в этом положении. Таким образом, общая формула полипептида ActRIIB для использования в способах и композициях, описанных в настоящем документе, представляет собой формулу, которая включает аминокислоты 29-109 SEQ ID NO:16 или SEQ ID NO:28, но необязательно начиная с положения аминокислоты в диапазоне от 20-24 или 22-25 в SEQ ID NO:16 или SEQ ID NO:28 и заканчивая положением аминокислоты в диапазоне от 129-134 в SEQ ID NO:16 или SEQ ID NO:28, и включающую не более 1, 2, 5 или 15 консервативных аминокислотных замен в лигандсвязывающем кармане, и ноль, одну или более неконсервативных изменений в положениях аминокислот 40, 53, 55, 74, 79 и/или 82 в SEQ ID NO:16 или SEQ ID NO:28 в лигандсвязывающем кармане. Такой полипептид ActRIIB может сохранять более 80%, 90%, 95% или 99% идентичность последовательности или гомологию последовательности с последовательностью аминокислот 29-109 в SEQ ID NO:16 или SEQ ID NO:28. Сайты вне связывающего кармана, в которых вариабельность может особенно хорошо переноситься, включают амино- и карбокси-концы внеклеточного домена ActRIIB, и положения 42-46 и 65-73. Замена аспарагина на аланин в положении 65 SEQ ID NO:16 или SEQ ID NO:28 (N65A) действительно улучшает связывание лиганда при исходной A64 и, таким образом, как ожидается, не имеет вредного влияния на связывание лиганда при исходной R64. Это изменение, вероятно, устраняет гликозилирование в N65 при исходной A64, демонстрируя тем самым, что существенное изменение в этой области, вероятно, будет переноситься. В то время как замена R64A плохо переносится, замена R64K хорошо переносится, и, таким образом, другой основной остаток, такой как H, может переноситься в положении 64.

В конкретном примере полипептида ActRIIB с мутацией в лигандсвязывающем домене положительно заряженный аминокислотный остаток Asp (D80) лигандсвязывающего домена ActRIIB может быть заменен на другой аминокислотный остаток, так, что вариант полипептида ActRIIB преимущественно будет связываться с GDF8, но не с активином. В конкретном варианте осуществления остаток D80 заменяют аминокислотным остатком, выбранным из группы, состоящей из: незаряженного аминокислотного остатка, отрицательно заряженного аминокислотного остатка и гидрофобного аминокислотного остатка. В еще одном конкретном примере гидрофобный остаток L79 может быть заменен на кислые аминокислоты - аспарагиновую кислоту или глутаминовую кислоту для значительного уменьшения связывания активина при сохранении связывания GDF11. Как должно быть понятно специалисту в данной области техники, большинство описанных мутаций, вариантов или модификаций может быть сделано на уровне нуклеиновой кислоты или в некоторых случаях с помощью посттрансляционной модификации или химического синтеза. Такие методы хорошо известны в данной области техники.

В конкретных вариантах осуществления ингибиторы ActRIIB, используемые в композициях и способах, описанных в настоящем документе, включают конъюгированный/гибридный белок, включающий внеклеточный домен (например, активин-связывающий домен) рецептора ActRIIB, соединенный с фрагментом Fc антитела. Такие конъюгированные/гибридные белки могут включать любой из полипептидов ActRIIB, раскрытых в данном описании (например, любую из SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42, или 43), любые полипептиды ActRIIB, известные в данной области техники, или любые полипептиды ActRIIB, созданные с помощью методов, известных в данной области техники и/или представленные в данном документе.

В некоторых вариантах осуществления внеклеточный домен соединен с фрагментом Fc антитела через линкер, например, пептидный линкер. Примеры линкеров включают короткие полипептидные последовательности, такие как 2-10, 2-5, 2-4, 2-3 аминокислотных остатка (например, глицина), такие как, например, линкер Gly-Gly-Gly. В конкретном варианте осуществления линкер включает аминокислотную последовательность Gly-Gly-Gly (GGG). В другом конкретном варианте осуществления линкер включает аминокислотную последовательность Thr-Gly-Gly-Gly (TGGG). Необязательно домен Fc имеет одну или более мутаций в таких остатках, как Asp-265, лизин 322 и Asn-434. В некоторых случаях мутантный домен Fc, имеющий одну или более из этих мутаций (например, мутации Asp-265), имеет пониженную способность связываться с рецептором Fсγ по сравнению с доменом Fc дикого типа. В других случаях мутантный домен Fc, имеющий одну или более из этих мутаций (например, мутацию Asn-434), имеет повышенную способность связывания с Fc-рецептором, родственным МНС класса I (FcRN), по сравнению с доменом Fc дикого типа. Примеры гибридных белков, включающих растворимый внеклеточный домен ActRIIB, соединенный с доменом Fc, представлены в SEQ ID NO:20, 21, 24, 25, 34, 35, 38, 39, 40, 41, 44, 46, и 47.

В конкретном варианте осуществления ингибиторы ActRIIB, используемые в композициях и способах, описанных в настоящем документе, включают внеклеточный домен ActRIIB или его часть, связанную с фрагментом Fc антитела, где указанный ингибитор ActRIIB включает аминокислотную последовательность, которая, по меньшей мере, на 75% идентична аминокислотной последовательности, выбранной из SEQ ID NO:20, 21, 24, 25, 34, 35, 38, 39, 40, 41, 44, 46, и 47. В другом конкретном варианте осуществления ингибиторы ActRIIB, используемые в композициях и способах, описанных в настоящем документе, включают внеклеточный домен ActRIIB или его часть, соединенную с фрагментом Fc антитела, где указанный ингибитор ActRIIB включает аминокислотную последовательность, которая, по меньшей мере, на 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% идентична аминокислотной последовательности, выбранной из SEQ ID NO:20, 21, 24, 25 , 34, 35, 38, 39, 40, 41, 44, 46 и 47.

В конкретном варианте осуществления ингибитор ActRIIB для использования в композициях и способах, описанных в настоящем документе, представляет собой гибридный белок внеклеточного домена рецептора ActRIIB человека и фрагмента Fc IgGl. В другом конкретном варианте осуществления ингибитор ActRIIB для использования в композициях и способах, описанных в настоящем документе, представляет собой гибридный белок укороченного внеклеточного домена рецептора ActRIIB человека и домена Fc IgGl. В другом конкретном варианте осуществления ингибитор ActRIIB для использования в композициях и способах, описанных в настоящем документе, представляет собой гибридный белок укороченного внеклеточного домена рецептора ActRIIB человека и домена Fc IgGl, где укороченный внеклеточный домен рецептора ActRIIB человека имеет аминокислотную замену в положении аминокислоты, соответствующем аминокислоте 79 SEQ ID NO:16 или SEQ ID NO:28. В одном варианте осуществления аминокислотная замена в положении аминокислоты, соответствующем аминокислоте 79 SEQ ID NO:16 или SEQ ID NO:28, представляет собой замену лейцина на аспарагиновую кислоту (т.е. мутацию L79D).

В конкретном варианте осуществления ингибитор ActRIIB для использования в композициях и способах, описанных в настоящем документе, представляет собой SEQ ID NO:24 или 25, которая представляет собой гибридный белок внеклеточного домена рецептора ActRIIB человека и фрагмента Fc IgGl, где указанный внеклеточный домен ActRIIB включает аминокислоты 25-131 из SEQ ID NO:28 с мутацией L79D. Последовательность нуклеиновой кислоты, кодирующая гибридный белок ActRIIB-Fc SEQ ID NO:24 представлена в SEQ ID NO:45.

В другом конкретном варианте осуществления ингибитор ActRIIB для использования в композициях и способах, описанных в настоящем документе, представляет собой SEQ ID NO:34 или 35, которая представляет собой гибридный белок внеклеточного домена рецептора ActRIIB человека и фрагмента Fc IgGl, где указанный внеклеточный домен ActRIIB включает аминокислоты 25-131 SEQ ID NO:16 с мутацией L79D.

Связанные с аспарагином сайты гликозилирования обычно включают последовательность трипептида, аспарагин-Х-треонин (или аспарагин-Х-серин) (где «X» обозначает любую аминокислоту), которая специально узнается соответствующими клеточными ферментами гликозилирования. Изменение также может быть сделано путем добавления к последовательности полипептида ActRIIB дикого типа или замены в ней одного или более остатков серина или треонина (для О-связанных сайтов гликозилирования). Разнообразие аминокислотных замен или делеций в одном или обоих первом или третьем положении аминокислот узнаваемого сайта гликозилирования (и/или делеция аминокислоты во втором положении) приводит к отсутствию гликозилирования в модифицированной последовательности трипептида. Другим способом увеличения числа углеводных остатков в полипептиде ActRIIB является химическое или ферментативное присоединение гликозидов к полипептиду ActRIIB. В зависимости от используемого способа присоединения сахар(а) могут быть присоединены к (a) аргинину и гистидину; (b) свободным карбоксильным группам; (с) свободным сульфгидрильным группам, таким как группы цистеина; (d) свободным гидроксильным группам, таким как группы серина, треонина или гидроксипролина; (e) ароматическим остаткам, таким как остатки фенилаланина, тирозина или триптофана; или (f) амидной группе глутамина. Эти способы описаны в международной патентной заявке США No. WO 87/05330, опубликованной 11 сентября 1987 г., и в статье Aplin and Wriston (1981) CRC Crit. Rev. Biochem., pp. 259-306, включенной в настоящее описание в качестве ссылки. Удаление одного или более углеводных остатков, присутствующих в полипептиде ActRIIB, может быть достигнуто химически и/или ферментативно. Химическое дегликозилирование может включать, например, экспозицию полипептида ActRIIB с соединением трифторметансульфоновой кислоты или эквивалентным соединением. Такая обработка приводит к отщеплению большинства или всех сахаров за исключением связующего сахара (N-ацетилглюкозамина или N-ацетилгалактозамина), оставляя аминокислотную последовательность интактной. Химическое дегликозилирование дополнительно описывается Hakimuddin et al. (1987) Arch. Biochem. Biophys. 259:52 и Edge et al. (1981) Anal. Biochem. 118:131. Ферментативное расщепление углеводных остатков в полипептидах ActRIIB может быть достигнуто путем использования различных эндо- и экзогликозидаз, как описано Thotakura et al. (1987) Meth. Enzymol. 138:350. Последовательность полипептида ActRIIB может быть подогнана соответствующим образом в зависимости от типа используемой системы экспрессии, так как клетки млекопитающих, дрожжей, насекомых и растений все могут вводить различный характер гликозилирования, на который может влиять аминокислотная последовательность пептида. В целом белки ActRIIB для применения у человека могут быть экспрессированы в линии клеток млекопитающих, которая обеспечивает надлежащее гликозилирование, такой как клеточные линии НЕК293 или СНО, хотя другие системы экспрессии, такие как системы экспрессии других клеточных линий млекопитающих, линии клеток дрожжей со сконструированными ферментами гликозилирования и клетки насекомых, как ожидается, также будут пригодными.

В конкретных вариантах осуществления мутантные полипептиды ActRIIB, включающие добавление дополнительного N-связанного сайта гликозилирования (N-X-S/T), что увеличивает период полужизни гибридного белка ActRIIB-Fc в сыворотке по сравнению с формой ActRIIB(R64)-Fc, могут быть использованы в способах и композициях, описанных в настоящем документе. В конкретном варианте осуществления введение аспарагина в положение 24 SEQ ID NO:16 или SEQ ID NO:28 (A24N) приводит к созданию последовательности NXT, которая придает более длительный период полужизни. Другие последовательности NX(T/S) могут быть найдены в 42-44 (NQS) и 65-67 (NSS), хотя последняя не может быть эффективно гликозилирована с R в положении 64 (т.е. в полипептидах R64). Последовательности N-X-S/T могут быть введены в основном в положениях вне лигандсвязывающего кармана ActRIIB, что подробно описано выше. Особенно подходящие сайты для введения неэндогенных последовательностей N-X-S/T включают аминокислоты 20-29, 20-24, 22-25, 109-134, 120-134 или 129-134 SEQ ID NO:16 или SEQ ID NO:28. Последовательности N-X-S/T могут быть также введены в линкер между последовательностью ActRIIB и Fc или другого компонента гибрида. Такой сайт может быть введен с минимальным усилием путем введения N в правильном положении по отношению к уже существующей S или T, или путем введения S или T в положении, соответствующем ранее существующей N. Таким образом, желаемые изменения для создания N-связанного сайта гликозилирования представляют собой: A24N, R64N, S67N (возможно в сочетании с изменением N65A), E106N, R112N, G120N, E123N, P129N, A132N, R112S и Rl12T (со всеми положениями аминокислот, соответствующими положениям, в которых они могут быть найдены в SEQ ID NO:16 или SEQ ID NO:28). Любая S, которая, как предсказывается, будет гликозилирована может быть заменена на Т, не создавая иммуногенного сайта из-за защиты, обеспечиваемой гликозилированием. Точно так же, любая Т, которая, как предсказывается, будет гликозилирована может быть заменена на S. Таким образом, изменения S67T и S44T охватываются в настоящем документе. Таким же образом в варианте A24N может быть использовано изменение S26T. Соответственно, полипептид ActRIIB может включать одну или более дополнительных, неэндогенных консенсусных последовательностей N-связанного гликозилирования.

Различные методы скрининга могут быть использованы для оценки вариантов полипептида ActRIIB. Например, вариант полипептида ActRIIB может быть подвергнут скринингу на способность связываться с лигандом ActRIIB для предотвращения связывания лиганда ActRIIB с полипептидом ActRIIB или для препятствования сигнализации, вызванной лигандом ActRIIB. Активность полипептида ActRIIB или его вариантов может быть также протестирована в клеточной системе или путем анализа in vivo.

Могут быть получены происходящие комбинаторно варианты, которые обладают селективной или в целом повышенной активностью по сравнению с природным полипептидом ActRIIB. Кроме того, мутагенез может привести к вариантам, которые имеют внутриклеточный период полужизни, существенно отличающийся от соответствующего периода полипептида ActRIIB дикого типа. Например, измененному белку может быть придана либо более высокая стабильность, либо более низкая стабильность в отношении протеолитической деградации или других клеточных процессов, которые приводят к разрушению, или иным образом инактивируют нативный полипептид ActRIIB. Такие варианты и гены, которые их кодируют, могут быть использованы для изменения уровней полипептида ActRIIB путем модуляции периода полужизни полипептидов ActRIIB. Например, короткий период полужизни может привести к индукции более коротких биологических эффектов и может позволить более жестко контролировать уровни рекомбинантных полипептидов ActRIIB у больного. Для изменения периода полужизни белка в гибридном белке с Fc мутации могут быть сделаны в линкере (если он имеется) и/или во фрагменте Fc.

Комбинаторная библиотека может быть получена с помощью библиотеки вырожденных генов, кодирующих библиотеку полипептидов, каждый из которых включает, по меньшей мере, часть потенциальных полипептидных последовательностей ActRIIB. Например, смесь синтетических олигонуклеотидов может быть ферментативно лигирована в генные последовательности так, что вырожденный набор потенциальных нуклеотидных последовательностей полипептида ActRIIB будет способен к экспрессии в виде отдельных полипептидов или альтернативно в виде набора более крупных гибридных белков (например, для фагового дисплея).

Существует много способов, с помощью которых может быть создана библиотека потенциальных гомологов из вырожденной олигонуклеотидной последовательности. Химический синтез вырожденной последовательности гена может быть осуществлен в автоматическом синтезаторе ДНК, и синтезированные гены затем лигируют в соответствующий вектор для экспрессии. Синтез вырожденных олигонуклеотидов хорошо известен в данной области техники (смотри, например, Narang, S A (1983) Tetrahedron 39:3; Itakura et al., (1981) Recombinant DNA, Proc. 3rd Cleveland Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp 273-289; Itakura et al, (1984) Annu. Rev. Biochem. 53:323; Itakura et al, (1984) Science 198:1056; Ike et al., (1983) Nucleic Acid Res. 11:477). Такие методы были использованы для направленной эволюции других белков (смотри, например, Scott et al., (1990) Science 249:386-390; Roberts et al., (1992) PNAS USA 89:2429-2433; Devlin et al., (1990) Science 249: 404-406; Cwirla et al., (1990) PNAS USA 87: 6378-6382; а также патенты США NO. 5223409, 5198346 и 5096815).

В качестве альтернативы могут быть использованы другие формы мутагенеза для генерации комбинаторной библиотеки. Например, варианты полипептида ActRIIB могут быть получены и выделены из библиотеки путем скрининга с использованием, например, аланин-сканирующего мутагенеза и тому подобного (Ruf et al., (1994) Biochemistry 33: 1565-1572; Wang et al., (1994) J. Biol. Chem. 269:3095-3099; Balint et al., (1993) Gene 137:109-118; Grodberg et al., (1993) Eur. J. Biochem. 218:597-601; Nagashima et al., (1993) J. Biol. Chem. 268:2888-2892; Lowman et al., (1991) Biochemistry 30: 10832-10838; и Cunningham et al., (1989) Science 244:1081-1085), с помощью линкер-сканирующего мутагенеза (Gustin et al., (1993) Virology 193:653-660; Brown et al., (1992) Mol. Cell Biol. 12:2644-2652; McKnight et al., (1982) Science 232:316); с помощью насыщающего мутагенеза (Meyers et al., (1986) Science 232:613); ПЦР-мутагенеза (Leung et al., (1989) Method Cell Mol Biol 1:11-19); или путем случайного мутагенеза, включая химический мутагенез и т.д. (Miller et al., (1992) A Short Course in Bacterial Genetics, CSHL Press, Cold Spring Harbor, N.Y.; и Greener et al., (1994) Strategies in Mol Biol 7:32-34). Линкер-сканирующий мутагенез, особенно в комбинаторной установке, является привлекательным способом идентификации укороченных (биоактивных) форм полипептидов ActRIIB.

Широкий спектр методов известен в данной области техники для скрининга генных продуктов комбинаторных библиотек, полученных точечными мутациями и укорочениями, и в том числе для скрининга библиотек кДНК на генные продукты, имеющие определенное свойство. Такие методы должны обычно адаптироваться для быстрого скрининга библиотек генов, генерируемых комбинаторным мутагенезом полипептидов ActRIIB. Наиболее широко используемые методы скрининга больших библиотек генов обычно включают клонирование генной библиотеки в реплицируемые экспрессионные векторы, трансформацию соответствующих клеток полученной библиотекой векторов и экспрессию комбинаторных генов в условиях, когда определение желаемой активности облегчает относительно простое выделение вектора, кодирующего ген, продукт которого определен. Предпочтительные методы включают методы определения связывания активина и методы определения опосредованной активином клеточной сигнализации.

В некоторых вариантах осуществления полипептиды ActRIIB, используемые в способах и композициях, описанных в настоящем документе, могут дополнительно включать посттрансляционные модификации в дополнение к тем, которые присутствуют в полипептидах ActRIIB в природе.

Такие модификации включают, но не ограничиваются этим, ацетилирование, карбоксилирование, гликозилирование, фосфорилирование, липидизацию и ацилирование. В результате модифицированные полипептиды ActRIIB могут содержать элементы, не являющиеся аминокислотами, такие как полиэтиленгликоли, липиды, поли- или моносахарид и фосфаты. Эффекты таких неаминокислотных элементов на функции полипептида ActRIIB могут быть протестированы с помощью любого способа, известного специалисту в данной области техники. Когда полипептид ActRIIB продуцируется в клетках путем расщепления образующейся формы полипептида ActRIIB, посттрансляционный процессинг также может иметь большое значение для правильной укладки и/или функции белка. Различные клетки (такие как клетки CHO, HeLa, MDCK, 293, W138, NIH-3T3 или HEK293) имеют специфический клеточный аппарат и характерные механизмы для такой посттрансляционной активности и могут быть выбраны для обеспечения правильной модификации и процессинга полипептидов ActRIIB.

В некоторых аспектах функциональные варианты или модифицированные формы полипептидов ActRIIB включают гибридные белки, имеющие, по меньшей мере, часть полипептидов ActRIIB и один или более доменов слияния. Хорошо известные примеры таких доменов слияния включают, но не ограничиваются этим, полигистидин, Glu-Glu, глутатион-S-трансферазу (GST), тиоредоксин, протеин А, протеин G, константную область тяжелой цепи иммуноглобулина (Fc), связывающий мальтозу белок (МВР) или сывороточный альбумин человека. Домен слияния может быть выбран таким образом, чтобы придать желаемые свойства. Например, некоторые домены слияния особенно полезны для выделения гибридных белков с помощью аффинной хроматографии. Для аффинной очистки используются соответствующие матрицы для аффинной хроматографии, такие как смолы, конъюгированные с глутатионом, амилазой и никелем или кобальтом. Многие из таких матриц доступны в форме «набора», такого как система очистки Pharmacia GST и система QIAexpressTM (Qiagen), используемая с партнерами гибрида (His6). В качестве другого примера домен слияния может быть выбран таким образом, чтобы облегчить обнаружение полипептидов ActRIIB. Примеры таких доменов для обнаружения включают различные флуоресцентные белки (например, GFP) а также «эпитопные метки», которые обычно представляют собой короткие пептидные последовательности, к которым имеет доступ специфическое антитело. Хорошо известные эпитопные метки, к которым имеет легкий доступ специфические моноклональные антитела, включают FLAG, гемагглютинин вируса гриппа (НА) и метки с-myc. В некоторых случаях домены слияния имеют сайт расщепления протеазами, такими как фактор Ха или тромбин, который позволяет соответствующей протеазе частично гидролизовать гибридные белки и тем самым высвободить из них рекомбинантные белки. Высвобожденные белки могут быть, затем отделены от домена слияния с помощью последующего хроматографического разделения. В некоторых предпочтительных вариантах осуществления полипептид ActRIIB соединен с доменом, который стабилизирует полипептид ActRIIB in vivo («стабилизирующий» домен). Под «стабилизирующим» подразумевается все, что увеличивает период полужизни в сыворотке независимо от того, возникает ли это из-за пониженного разрушения, снижения клиренса почкой или другого фармакокинетического эффекта. Гибриды с фрагментом Fc иммуноглобулина, как известно, придают желаемые фармакокинетические свойства широкому диапазону белков. Кроме того, гибриды с сывороточным альбумином человека могут придать желаемые свойства. Другие типы доменов слияния, которые могут быть выбраны, включают мультимеризующие (например, димеризующие, тетрамеризующие) домены и функциональные домены (которые придают дополнительную биологическую функцию, такую как дополнительная стимуляция роста костной ткани или роста мышц, в зависимости от пожелания).

Следует понимать, что различные элементы гибридных белков могут быть организованы любым способом, который соответствует желаемой функциональности. Например, полипептид ActRIIB может быть размещен к С-концу от гетерологичного домена или, альтернативно, гетерологичный домен может быть размещен к С-концу от полипептида ActRIIB. Домен полипептида ActRIIB и гетерологичный домен не обязательно должны быть смежными в гибридном белке, и дополнительные домены или аминокислотные последовательности могут быть включены к С- или N-концу от любого домена или между доменами.

В некоторых вариантах осуществления полипептиды ActRIIB, используемые в способах и композициях, описанных в настоящем документе, содержат одну или более модификаций, которые способны стабилизировать полипептиды ActRIIB. Например, такие модификации повышают период полужизни полипептидов ActRIIB in vitro, повышают период полужизни полипептидов ActRIIB в кровотоке или уменьшают протеолитическую деградацию полипептидов ActRIIB. Такие стабилизирующие модификации включают, но не ограничиваются этим, гибридные белки (включая, например, гибридные белки, включающие полипептид ActRIIB и стабилизирующий домен), модификации сайта гликозилирования (включая, например, добавление сайта гликозилирования к полипептиду ActRIIB) и модификации углеводного фрагмента (включая, например, удаление углеводных остатков полипептида ActRIIB). В случае гибридных белков полипептид ActRIIB соединяют со стабилизирующим доменом, таким как молекула IgG (например, домен Fc). При применении в настоящем документе термин «стабилизирующий домен» относится не только к домену слияния (например, Fc), как в случае гибридных белков, но также включает небелковые модификации, такие как углеводная часть или небелковый полимер, такой как полиэтиленгликоль.

В некоторых вариантах осуществления в способах и композициях, описанных в настоящем документе, используются выделенные и/или очищенные полипептиды ActRIIB, т.е. полипептиды ActRIIB, которые выделены или иным образом по существу свободны от других белков, и могут быть использованы в способах и композициях, описанных в настоящем документе. Полипептиды ActRIIB в целом могут быть получены путем экспрессии рекомбинантных нуклеиновых кислот.

В некоторых аспектах полипептиды ActRIIB, используемые в способах и композициях, описанных в настоящем документе, кодируются выделенными и/или рекомбинантными нуклеиновыми кислотами, включая фрагменты, функциональные варианты и гибридные белки, раскрытые в настоящем документе. Например, SEQ ID NO:19 кодирует природный полипептид-предшественник ActRIIB человека. Такие нуклеиновые кислоты могут быть одноцепочечными или двухцепочечными. Такие нуклеиновые кислоты могут представлять собой молекулы ДНК или РНК. Эти нуклеиновые кислоты могут быть использованы, например, в способах получения полипептидов ActRIIB или в виде непосредственных терапевтических агентов (например, при генной терапии).

В некоторых аспектах нуклеиновые кислоты, которые могут быть использованы для получения полипептидов ActRIIB, пригодные для использования в способах и композициях, описанных в данном документе, дополнительно понимаются как включающие нуклеиновые кислоты, которые являются вариантами SEQ ID NO:19, а также варианты тех последовательностей нуклеиновых кислот, которые кодируют растворимые полипептиды ActRIIB (например, нуклеиновые кислоты, которые кодируют SEQ ID NO:17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 и 43). Варианты нуклеотидных последовательностей включают последовательности, которые отличаются одной или более нуклеотидными заменами, добавками или делециями, такие как аллельные варианты.

В некоторых вариантах осуществления выделенные или рекомбинантные последовательности нуклеиновой кислоты, которые могут быть использованы для получения полипептидов ActRIIB, пригодных для использования в способах и композициях, описанных в настоящем документе, по меньшей мере, на 80%, 85%, 90%, 95%, 97%, 98%, 99% или 100% идентичны SEQ ID NO:19 или тем последовательностям нуклеиновых кислот, которые кодируют растворимые полипептиды ActRIIB (например, нуклеиновым кислотам, которые кодируют SEQ ID NO: 17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42, и 43). Специалисту в данной области техники должно быть понятно, что последовательности нуклеиновых кислот, комплементарные SEQ ID NO:19, или те последовательности нуклеиновых кислот, которые кодируют растворимые полипептиды ActRIIB (например, нуклеиновые кислоты, которые кодируют SEQ ID NO: 17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 и 43), и варианты SEQ ID NO:19 или те последовательности нуклеиновых кислот, которые кодируют растворимые полипептиды ActRIIB (например, нуклеиновые кислоты, которые кодируют SEQ ID NO: 17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42, и 43) могут быть использованы в способах и композициях, описанных в настоящем документе. В других вариантах осуществления последовательности нуклеиновых кислот могут быть выделены, получены рекомбинантным способом и/или соединены с гетерологичной нуклеотидной последовательностью, или найдены в библиотеке ДНК.

В других вариантах осуществления нуклеиновые кислоты, которые могут быть использованы для получения полипептидов ActRIIB, пригодные для использования в способах и композициях, описанных в настоящем документе, включают нуклеотидные последовательности, которые гибридизуются в условиях высокой жесткости с нуклеотидной последовательностью, обозначенной SEQ ID NO:19, или с теми последовательностями нуклеиновых кислот, которые кодируют растворимые полипептиды ActRIIB (например, с нуклеиновыми кислотами, которые кодируют SEQ ID NO: 17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 и 43), с последовательностью, комплементарной SEQ ID NO:19, или тем последовательностям нуклеиновых кислот, которые кодируют растворимые полипептиды ActRIIB (например, нуклеиновым кислотам, которые кодируют SEQ ID NO: 17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 и 43), или с их фрагментами. Специалисту в данной области техники должно быть понятно, что подходящие условия жесткости, которые способствуют гибридизации ДНК, могут варьироваться. Например, можно осуществить гибридизацию 6,0 раз с хлоридом натрия/цитратом натрия (SSC) при температуре приблизительно 45 градусов Цельсия, затем с промывкой 2,0 раза SSC при 50 градусах Цельсия. Например, концентрация соли на стадии промывки может быть выбрана от низкой жесткости приблизительно 2,0 раза SSC при 50 градусах Цельсия до высокой жесткости приблизительно 0,2 раза SSC при 50 градусах Цельсия. Кроме того, температура на стадии промывки может быть увеличена от комнатной температуры приблизительно 22 градуса по Цельсию в условиях низкой жесткости до температуры приблизительно 65 градусов по Цельсию в условиях высокой жесткости. Как температура, так и концентрация соли может варьироваться, или температура или концентрация соли может поддерживаться постоянной, в то время как изменяется другая переменная. В одном варианте осуществления нуклеиновые кислоты, которые гибридизуются в условиях низкой жесткости 6 раз SSC при комнатной температуре с последующей промывкой 2 раза SSC при комнатной температуре, можно использовать с методами и композициями, описанными в настоящем документе.

Выделенные нуклеиновые кислоты, которые отличаются от нуклеиновых кислот, представленных в SEQ ID NO:19, или тех последовательностей нуклеиновых кислот, которые кодируют растворимые полипептиды ActRIIB (например, нуклеиновых кислот, которые кодируют SEQ ID NO: 17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 и 43), из-за вырожденности генетического кода, также могут быть использованы для получения полипептидов ActRIIB, пригодных для использования в способах и композициях, описанных в настоящем документе. Например, ряд аминокислот определяется более чем одним триплетом. Кодоны, которые определяют одну и ту же аминокислоту, или синонимы (например, CAU и CAC являются синонимами гистидина), могут вести к «молчащим» мутациям, которые не влияют на аминокислотную последовательность белка. Однако ожидается, что полиморфизмы последовательности ДНК, которые приводят к изменениям в аминокислотных последовательностях белков согласно изобретению, должны существовать в клетках млекопитающих. Специалисту в данной области техники должно быть понятно, что эти вариации одного или более нуклеотидов (приблизительно до 3-5% нуклеотидов) нуклеиновых кислот, кодирующих конкретный белок, могут существовать среди особей данного вида из-за естественных вариаций аллелей. Любая и все такие вариации нуклеотидов и возникающие в результате аминокислотные полиморфизмы могут быть использованы в способах и композициях, описанных в настоящем документе.

В некоторых вариантах осуществления рекомбинантные нуклеиновые кислоты, которые могут быть использованы для получения полипептидов ActRIIB, пригодных для использования в способах и композициях, описанных в настоящем документе, могут быть функционально связаны с одной или более регуляторными нуклеотидными последовательностями в экспрессионном конструкте. Регуляторные нуклеотидные последовательности должны обычно подходить для клетки-хозяина, используемой для экспрессии. Многочисленные типы соответствующих экспрессионных векторов и подходящие регуляторные последовательности известны в данной области техники для различных клеток-хозяев. Обычно указанные одна или более регуляторные нуклеотидные последовательности могут включать, но не ограничиваться этим, промоторные последовательности, лидирующие или сигнальные последовательности, сайты связывания рибосом, последовательности инициации и терминации транскрипции, последовательности инициации и терминации трансляции и энхансерные или активаторные последовательности. Конститутивные или индуцибельные промоторы могут использоваться в способах и композициях, описанных в настоящем документе, как известно в данной области техники. Промоторы могут представлять собой либо природные промоторы, либо гибридные промоторы, которые сочетают в себе элементы более одного промотора. Экспрессионный конструкт может присутствовать в клетке в эписоме, такой как плазмида, или экспрессионный конструкт может быть вставлен в хромосому. В предпочтительном варианте осуществления экспрессионный вектор содержит ген маркера селекции для возможности отбора трансформированных клеток-хозяев. Гены маркеров селекции хорошо известны в данной области техники и должны варьироваться в зависимости от используемой клетки-хозяина.

В некоторых аспектах нуклеиновые кислоты, которые могут быть использованы для получения полипептидов ActRIIB, пригодные для использования в способах и композициях, описанных в настоящем документе, предоставляются в экспрессионном векторе, включающем нуклеотидную последовательность, кодирующую полипептид ActRIIB и функционально связанную, по меньшей мере, с одной регуляторной последовательностью. Регуляторные последовательности известны в данной области техники и выбираются так, чтобы управлять экспрессией полипептида ActRIIB. Соответственно, термин регуляторная последовательность включает промоторы, энхансеры и другие элементы, контролирующие экспрессию. Примеры регуляторных последовательностей описаны в Goeddel; Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, Calif. (1990). Например, любую из широкого разнообразия контролирующих экспрессию последовательностей, которые контролируют экспрессию последовательности ДНК, когда функционально связаны с ней, можно использовать в этих векторах для экспрессии последовательностей ДНК, кодирующих полипептид ActRIIB. Такие пригодные последовательности, контролирующие экспрессию, включают, например, ранний и поздний промоторы SV40, промотор tet, немедленный ранний промотор аденовируса или цитомегаловируса, промоторы RSV, систему lac, систему trp, систему TAC или TRC, промотор Т7, экспрессия которого управляется РНК-полимеразой Т7, главные операторные и промоторные области фага лямбда, контролирующие области белка оболочки FD, промотор 3-фосфоглицераткиназы или других гликолитических ферментов, промоторы кислой фосфатазы, например, Pho5, промоторы факторов α-скрещивания дрожжей, многогранный промотор бакуловирусной системы и другие последовательности, известные как контролирующие экспрессию генов прокариотных или эукариотных клеток или их вирусов, и различные их сочетания. Следует понимать, что дизайн экспрессионного вектора может зависеть от таких факторов, как выбор клетки-хозяина, подвергаемой трансформации, и/или тип желаемого белка, предназначенного для экспрессии. Кроме того, необходимо также учитывать число копий вектора, способность контролировать это число копий и экспрессию любого другого белка, кодируемого вектором, такого как маркеры антибиотиков.

Рекомбинантная нуклеиновая кислота может быть получена путем лигирования клонированного гена или его части в вектор, подходящий для экспрессии либо в клетках прокариот, клетках эукариот (дрожжей, птиц, насекомых или млекопитающих), либо в обеих. Экспрессионные векторы для получения рекомбинантного полипептида ActRIIB включают плазмиды и другие векторы. Например, подходящие векторы включают типы плазмид: плазмиды, производные pBR322, плазмиды, производные pEMBL, плазмиды, производные pEX, плазмиды, производные pBTac, и плазмиды, производные pUC, для экспрессии в прокариотных клетках, таких как E. coli.

Некоторые экспрессионные векторы млекопитающих содержат как прокариотные последовательности для облегчения воспроизведения вектора в бактериях, так и одну или более эукариотных транскрипционных единиц, которые экспрессируются в эукариотных клетках. Примерами экспрессионных векторов млекопитающих, подходящих для трансфекции эукариотных клеток, являются векторы, происходящие от PcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVneo, pMSG, pSVT7, pko-neo и pHyg. Некоторые из этих векторов модифицированы последовательностями из бактериальных плазмид, таких как pBR322, для облегчения репликации и селекции устойчивости к лекарствам как в прокариотных, так и в эукариотных клетках. Альтернативно, производные вирусов, таких как вирус папилломы крупного рогатого скота (BPV-1) или вирус Эпштейна-Барра (pHEBo, производное pREP и P205), могут быть использованы для временной экспрессии белков в эукариотных клетках. Примеры других вирусных (включая ретровирусные) систем экспрессии можно найти ниже в описании систем доставки при генной терапии. Различные методы, используемые для получения плазмид и трансформации организмов-хозяев, хорошо известны в данной области техники. В отношении других подходящих систем экспрессии как в прокариотных, так и в эукариотных клетках, а также общих рекомбинантных процедур смотри Molecular Cloning A Laboratory Manual, 3rd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press, 2001). В некоторых случаях может быть желательна экспрессия рекомбинантных полипептидов с использованием бакуловирусной системы экспрессии. Примеры таких бакуловирусных систем экспрессии включают векторы, происходящие от pVL (такие как pVL1392, pVL1393 и pVL941), векторы, происходящие от pAcUW (такие как pAcUWl) и векторы, происходящие от pBlueBac (такие как содержащая β-gal pBlueBac III).

В одном варианте осуществления может быть создан вектор для получения полипептидов ActRIIB, используемых в способах и композициях, описанных в настоящем документе, в клетках СНО, такой как вектор Pcmv-Script (Stratagene, La Jolla, Calif.), векторы pcDNA4 (Invitrogen, Carlsbad, Calif.) и векторы PCI-neo (Promega, Madison, Wis.). Как должно быть очевидно, желаемые генные конструкты могут быть использованы для индукции экспрессии желаемых полипептидов ActRIIB в клетках, воспроизводящихся в культуре, например, для получения белков, включая гибридные белки или варианты белков для очистки.

Клетки-хозяева, трансфецированные рекомбинантным геном, включающим кодирующую последовательность (например, SEQ ID NO:19 или те последовательности нуклеиновых кислот, которые кодируют растворимые полипептиды ActRIIB (например, нуклеиновые кислоты, которые кодируют SEQ ID NO: 17, 18, 23, 26, 27, 29, 30, 31, 32, 33, 36, 37, 42 и 43)) одного или более желаемого полипептида ActRIIB, могут быть использованы для получения полипептидов ActRIIB, пригодных для использования в способах и композициях, описанных в данном документе. Клетка-хозяин может быть любой прокариотной или эукариотной клеткой. Например, полипептид ActRIIB может быть экспрессирован в бактериальных клетках, таких как E. coli, клетках насекомых (например, с помощью бакуловирусной системы экспрессии), дрожжей или клетках млекопитающих. Другие подходящие клетки-хозяева известны специалистам в данной области техники.

Соответственно, в настоящем документе предлагаются способы получения полипептидов ActRIIB, используемых в способах и композициях, описанных в настоящем документе. Например, клетку-хозяина, трансфецированную экспрессионным вектором, кодирующим полипептид ActRIIB, можно культивировать в соответствующих условиях для возможности возникновения экспрессии полипептида ActRIIB. Полипептид ActRIIB может секретироваться и может быть выделен из смеси клеток и из среды, содержащей полипептид ActRIIB. Альтернативно, полипептид ActRIIB может оставаться в цитоплазме или в мембранной фракции, и клетки собирают, лизируют и выделяют белок. Культура клеток включает клетки-хозяева, среды и другие побочные продукты. Подходящие среды для культивирования клеток хорошо известны в данной области техники. Желаемые полипептиды ActRIIB могут быть выделены из клеточной культуральной среды, клеток-хозяев или обоих источников с использованием способов, известных в данной области техники для очистки белков, включая ионообменную хроматографию, гель-фильтрационную хроматографию, ультрафильтрацию, электрофорез, иммуноаффинную очистку с использованием антител, специфичных для конкретных эпитопов полипептидов ActRIIB, и аффинную очистку с агентом, который связывается с доменом, соединенным с полипептидом ActRIIB (например, для очистки гибрида ActRIIB-Fc может быть использована колонка с протеином А). В предпочтительном варианте осуществления полипептид ActRIIB представляет собой гибридный белок, содержащий домен, который облегчает его очистку. В предпочтительном варианте осуществления очистка достигается с помощью ряда стадий колоночной хроматографии, включая, например, три или более из следующих стадий в любом порядке: хроматографию на колонке с протеином А, хроматографию на сефарозе Q, хроматографию не фенилсефарозе, хроматографию, исключающую по размеру, и катионообменную хроматографию. Очистка может быть завершена фильтрацией вирусов и заменой буфера. Как показано в настоящем документе, белок ActRIIB-hFc очищали до чистоты >98% при определении с помощью хроматографии, исключающей по размеру, и >95% при определении с помощью SDS-PAGE. Этот уровень чистоты был достаточен для достижения желаемых эффектов на костную ткань у мышей и имел приемлемый профиль безопасности у мышей, крыс и приматов, не являющихся человеком.

В другом варианте осуществления гибридный ген, кодирующий лидирующую последовательность для очистки, такую как последовательность сайта расщепления поли(His)/энтерокиназой на N-конце желаемого фрагмента рекомбинантного полипептида ActRIIB, может предоставить возможность очистки экспрессированного гибридного белка с помощью аффинной хроматографии с использованием смолы с металлом Ni2+. Лидирующую последовательность для очистки потом можно удалить с помощью обработки энтерокиназой с получением очищенного полипептида ActRIIB (например, смотри Hochuli et al., (1987) J. Chromatography 411:177; и Janknecht et al., PNAS USA 88:8972).

Методы получения гибридных генов хорошо известны. По существу выполняется присоединение различных фрагментов ДНК, кодирующих разные полипептидные последовательности, в соответствии с традиционными методами с использованием тупых концов или ступенчатых концов для лигирования, гидролиза ферментом рестрикции для обеспечения подходящими концами, заполнения липких концов, если это необходимо, обработки щелочной фосфатазой во избежание нежелательного присоединения и ферментативного лигирования. В другом варианте осуществления гибридный ген может быть синтезирован общепринятыми способами, включая автоматизированные синтезаторы ДНК. Альтернативно, может быть проведена ПЦР-амплификация фрагментов гена с использованием якорных праймеров, которые дают комплементарные выступы между двумя последовательными генными фрагментами, которые впоследствии можно подвергать отжигу с созданием последовательности гибридного гена (смотри, например, Current Protocols in Molecular Biology, eds. Ausubel et al., John Wiley & Sons: 1992).

Гибридный белок ActRIIB-Fc может быть экспрессирован в стабильно трансфецированных клетках СНО-DUKX B11 из вектора pAID4 (SV40 ori/энхансер, промотор CMV) с использованием лидирующей последовательности тканевого плазминогена SEQ ID NO:8. Фрагмент Fc может включать последовательность Fc IgGl человека, как показано в SEQ ID NO:7. В некоторых вариантах осуществления при экспрессии содержащийся белок имеет в среднем приблизительно от 1,5 до 2,5 моль сиаловой кислоты на молекулу гибридного белка ActRIIB-Fc.

В некоторых вариантах осуществления длительный период полужизни гибридного ActRIIB-Fc в сыворотке больных людей может составлять 25-32 дня. Кроме того, клетки СНО, экспрессирующие продукт, могут иметь более высокое сродство к лиганду активину B, чем сообщалось для гибридного белка ActRIIB-hFc, экспрессируемого в клетках 293 человека (del Re et al., J Biol Chem. 2004 Dec 17;279(51):53126-35). Кроме того, не будучи связанными какой-либо теорией, использование лидирующей последовательности TPA обеспечивало более высокую продукцию, чем другие лидирующие последовательности и в отличие от ActRIIB-Fc, экспрессируемого с природной лидирующей последовательностью, может обеспечить N-концевую последовательность высокой степени чистоты. Использование природной лидирующей последовательности может привести к двум основным видам ActRIIB-Fc, каждый из которых имеет различную N-концевую последовательность.

(ii) Другие ингибиторы рецепторов ActRII

В некоторых вариантах осуществления ингибиторы рецепторов ActRII, используемые в композициях и способах, описанных в настоящем документе, представляют собой соединения в виде нуклеиновых кислот.

Примеры категорий соединений в виде нуклеиновых кислот, которые ингибируют рецепторы ActRII, включают антисмысловые нуклеиновые кислоты, конструкты siRNA или RNAi и каталитические конструкты нуклеиновых кислот. Соединение в виде нуклеиновой кислоты может быть одно- или двухцепочечным. Двухцепочечное соединение может также включать области липких концов или некомплементарности, где одна или другая из цепей является одноцепочечной. Одноцепочечное соединение может включать области самокомплементарности, обозначающие, что соединение может образовывать так называемую «шпильку» или структуру «стебель- петля» с областью двуспиральной структуры.

В некоторых вариантах осуществления соединения в виде нуклеиновых кислот, которые ингибируют рецепторы ActRII, могут включать нуклеотидную последовательность, комплементарную области, состоящий из не более 1000, не более 500, не более 250, не более 100 или не более 50, 35, 30, 25, 22, 20 или 18 нуклеотидов последовательности нуклеиновой кислоты полноразмерного рецептора ActRII или последовательности нуклеиновой кислоты активина (например, последовательности нуклеиновой кислоты субъединицы А активина или субъединицы B активина, также обозначаемой как βA или βB). В конкретных вариантах осуществления область комплементарности должна составлять, по меньшей мере, 8 нуклеотидов, и необязательно, по меньшей мере, 10 или, по меньшей мере, 15 нуклеотидов и, необязательно, от 15 до 25 нуклеотидов. Область комплементарности может находиться в пределах интрона, кодирующей последовательности или некодирующей последовательности желаемого транскрипта, например, в части кодирующей последовательности. Обычно соединение в виде нуклеиновой кислоты, которое ингибирует рецептор ActRII, должно иметь длину от приблизительно 8 до приблизительно 500 нуклеотидов или пар оснований в длину, и необязательно длина может составлять от приблизительно 14 до приблизительно 50 нуклеотидов. Соединение в виде нуклеиновой кислоты, которое ингибирует рецептор ActRII, может представлять собой ДНК (особенно при использовании в качестве антисмысловой), РНК или гибрид РНК:ДНК. Любая из цепей может включать смесь ДНК и РНК, а также модифицированные формы, которые не могут быть легко классифицированы как ДНК или РНК. Кроме того, двухцепочечное соединение в виде нуклеиновой кислоты может представлять собой ДНК:ДНК, ДНК:РНК или РНК:РНК, и любая цепь может также включать смесь ДНК и РНК, а также модифицированные формы, которые не могут быть легко классифицированы как ДНК или РНК.

Соединения в виде нуклеиновых кислот, которые ингибируют рецептор ActRII, могут включать любую из множества модификаций, включая одну или более модификации остова (сахаро-фосфатной части природной нуклеиновой кислоты, включая межнуклеотидные связи) или части оснований (части пурина или пиримидина природной нуклеиновой кислоты). В некоторых вариантах осуществления соединение в виде антисмысловой нуклеиновой кислоты должно иметь длину от приблизительно 15 до приблизительно 30 нуклеотидов, и часто должно содержать одну или более модификаций для улучшения некоторых характеристик, таких как стабильность в сыворотке, стабильность в клетке или устойчивость в месте предполагаемой доставки соединения, таком как, например, желудок в случае перорально доставляемых соединений, и легкие для ингалируемых соединений. В случае конструкта RNAi цепь, комплементарная желаемому транскрипту, обычно представляет собой РНК или ее модификации. Другая цепь может представлять собой РНК, ДНК или любой другой вариант. Дуплексная часть двухцепочечной или одноцепочечной «шпильки» конструкта RNAi может в некоторых вариантах осуществления иметь длину от 18 до 40 нуклеотидов в длину и, необязательно, приблизительно от 21 до 23 нуклеотидов в длину, при условии, что она служит в качестве субстрата фермента Dicer. Каталитические или ферментативные нуклеиновые кислоты могут представлять собой рибозимы или ДНК-ферменты и также могут содержать модифицированные формы. В некоторых вариантах осуществления соединения в виде нуклеиновых кислот, которые ингибируют рецепторы ActRII, могут ингибировать экспрессию их мишени приблизительно на 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или более при физиологических условиях и в концентрации, когда антисмысловой или смысловой контроль обладает небольшим эффектом или не влияет. Концентрации для тестирования эффекта соединений в виде нуклеиновых кислот включают 1, 5, 10 микромоль или более.

В других вариантах осуществления ингибиторы рецепторов ActRII, используемые в композициях и способах, описанных в настоящем документе, представляют собой антитела. Такие антитела включают антитела, которые связываются с активином (особенно с субъединицами A или B активина, также называемыми βA или βB) и нарушают его связывание с рецептором ActRII; и антитела, которые связываются с полипептидными рецепторами ActRII (например, с растворимым полипептидом ActRIIA или растворимым полипептидом ActRIIB) и нарушают связывание активина.

С помощью использования иммуногенов, происходящих от полипептидного рецептора ActRII или полипептида активина, антисыворотки или моноклональные антитела против белка/против пептида могут быть получены с помощью стандартных протоколов (смотри, например, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)). Млекопитающее, такое как мышь, хомяк или кролик, можно иммунизировать иммуногенной формой полипептидного рецептора ActRII, антигенным фрагментом, который способен вызывать образование антител, или гибридным белком. Методы придания иммуногенности белку или пептиду включают конъюгацию с носителями или другие способы, хорошо известные в данной области техники. Иммуногенную часть рецептора ActRII или полипептида активина можно вводить в присутствии адъюванта. Ход иммунизации можно контролировать путем определения титров антител в плазме или сыворотке. Стандартный метод ELISA или другие иммунологические методы могут быть использованы с иммуногеном в качестве антигена для оценки уровней антител.

После иммунизации животного антигенным препаратом полипептидного рецептора ActRII могут быть получены антисыворотки и при желании из сыворотки могут быть выделены поликлональные антитела. Для получения моноклональных антител от иммунизированного животного могут быть собраны продуцирующие антитела клетки (лимфоциты) и слиты с помощью стандартных процедур слияния соматических клеток с иммортализованными клетками, такими как клетки миеломы, с получением гибридомных клеток. Такие методы хорошо известны в данной области техники и включают, например, метод гибридомы (первоначально разработанный Kohler and Milstein, (1975) Nature, 256: 495-497), метод гибридомы B-клеток человека (Kozbar et al., (1983) Immunology Today, 4: 72), и метод EBV-гибридомы для получения моноклональных антител человека (Cole et al., (1985) Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96). Клетки гибридомы могут быть подвергнуты иммунохимическому скринингу на продукцию антител, специфически взаимодействующих с полипептидным рецептором ActRII, и на моноклональные антитела, выделенные из культуры, включающей такие клетки гибридомы.

Термин «антитело», используемый в настоящем документе, предназначен для включения их фрагментов, которые также специфически взаимодействуют с исследуемым полипептидом. Антитела могут быть фрагментированы с использованием обычных методов, и фрагменты подвергаются скринингу на применимость таким же образом, как это описано выше для целых антител. Например, F(аb)2-фрагменты могут быть получены путем обработки антитела пепсином. Полученный F(аb)2-фрагмент может быть обработан с целью восстановления дисульфидных мостиков с получением Fab-фрагментов. Антитело дополнительно предназначено для включения биспецифических, одноцепочечных, химерных, гуманизированных и полностью человеческих молекул, имеющих сродство к рецептору ActRII или к полипептиду активину, придаваемое, по меньшей мере, одной областью CDR антитела. Антитело может дополнительно включать присоединенную к нему метку, которую можно определить (например, метка может представлять собой радиоизотоп, флуоресцентное соединение, фермент или кофактор фермента).

В некоторых вариантах осуществления антитело является рекомбинантным антителом, обозначение которого охватывает любое антитело, созданное частично методами молекулярной биологии, включая антитела с пересадкой CDR или химерные антитела, антитела человека или другие антитела, сконструированные из выбранных из библиотеки доменов антител, одноцепочечные антитела и однодоменные антитела (например, белки VH человека или белки VHH верблюда). В некоторых вариантах осуществления антитело может представлять собой моноклональное антитело и в некоторых вариантах осуществления. Например, способ выработки моноклонального антитела, которое специфически связывается с полипептидным рецептором ActRII или с полипептидом активином, может включать введение мыши количества иммуногенной композиции, включающей полипептидный антиген, эффективного для стимуляции определяемого иммунного ответа, получение от мыши продуцирующих антитело клеток (например, клеток селезенки) и слияние клеток, продуцирующих антитело, с клетками миеломы для получения продуцирующих антитело гибридом и тестирование продуцирующих антитело гибридом для идентификации гибридомы, продуцирующей моноклональное антитело, которое специфически связывается с антигеном. После получения гибридому можно воспроизводить в культуре клеток, необязательно в условиях культивирования, когда клетки полученной гибридомы продуцируют моноклональное антитело, которое специфически связывается с антигеном. Моноклональное антитело может быть очищено из клеточной культуры.

Прилагательное «специфически взаимодействующее с» при использовании в отношении антитела предназначено для обозначения, как это обычно понимается в данной области техники, того, что антитело является достаточно селективным для представляющего интерес антигена (например, полипептидного рецептора ActRII) по сравнению с другими антигенами, не представляющими интерес, что это антитело пригодно как минимум для определения присутствия антигена, представляющего интерес, в конкретном типе биологического образца. В некоторых методах, использующих антитела, например, при терапевтическом применении, может быть желательна более высокая степень специфичности связывания. Моноклональные антитела обычно имеют более высокую тенденцию (по сравнению с поликлональными антителами) к эффективной дискриминации желаемых антигенов и перекрестно реагирующих полипептидов. Одной из характеристик, которая влияет на специфичность взаимодействия антитело:антиген, является сродство антитела к антигену. Хотя желаемая специфичность может быть достигнута при различном диапазоне сродства, обычно предпочтительные антитела должны обладать сродством (константой диссоциации) примерно 10-6, 10-7, 10-8, 10-9 или менее. Учитывая чрезвычайно прочное связывание между активином и рецептором ActRII, ожидается, что нейтрализующие антитела против активина или против рецептора ActRII обычно должны иметь константу диссоциации 10-10 или менее.

Кроме того, методы, используемые для скрининга антител с целью идентификации желаемого антитела, могут зависеть от свойств полученного антитела. Например, если антитело будет использоваться для связывания антигена в растворе, может быть желательно тестирование связывания в растворе. Множество различных методов доступно для тестирования взаимодействия антител с антигенами с целью идентификации конкретных желаемых антител. Такие методы включают в себя методы ELISA, методы оценки связывания с помощью поверхностного плазмонного резонанса (например, тестирование связывания Biacore.TM., Biacore AB, Uppsala, Sweden), сэндвич-методы (например, система парамагнитных шариков IGEN International, Inc., Gaithersburg, Md.), методы вестерн-блоттинга, иммунопреципитации и иммуногистохимии.

В некоторых вариантах осуществления ингибиторы рецепторов ActRII для использования в композициях и способах, описанных в настоящем документе, включают альтернативные формы активина, в отдельности формы с изменениями в связывающем домене рецептора типа I, способные связываться с рецепторами типа II и не способные образовывать активный третичный комплекс. В некоторых вариантах осуществления нуклеиновые кислоты, такие как антисмысловые молекулы, siRNA или рибозимы, которые ингибируют активин A, B, C или E, или, особенно, экспрессию рецептора ActRII, могут быть использованы в композициях и способах, описанных в настоящем документе.

В других вариантах осуществления ингибиторы рецепторов ActRII, используемые в композициях и способах, описанных в настоящем документе, представляют собой белки, не являющиеся антителами, с антагонистической активностью в отношении рецептора ActRII, включая ингибин (т.е. альфа-субъединицу ингибина), фоллистатин (например, фоллистатин-288 и фоллистатин-315), церберус, белок, родственный фоллистатину («FSRP»), эндоглин, активин С, альфа(2)-макроглобулин и Ml08A - мутант активина А (с заменой метионина на аланин в положении 108).

В конкретном варианте осуществления ингибитор рецептора ActRII для использования в композициях и способах, описанных в настоящем документе, представляет собой полипептид фоллистатин, который препятствует биологической активности активина и/или связывается с активином. Термин «полипептид фоллистатин» включает полипептиды, включающие любой природный полипептид фоллистатина, а также любые его варианты (включая мутанты, фрагменты, гибриды и формы пептидомиметиков), которые сохраняют полезную активность, и дополнительно включает любой функциональный мономер или мультимер фоллистатина. Варианты полипептидов фоллистатина, которые сохраняют связывающие активин свойства, могут быть идентифицированы на основе предыдущих исследований по характеристике взаимодействий фоллистатина и активина. Например, в патенте WO2008/030367, который включен в настоящий документ в качестве ссылки в полном объеме, раскрываются конкретные домены фоллистатина («FSDs»), которые, как показано, важны для связывания активина. Полипептиды фоллистатина включают полипептиды, происходящие из последовательности любого известного фоллистатина, имеющего последовательность, по меньшей мере, приблизительно на 80% идентичную последовательности полипептида фоллистатина, и необязательно идентичную, по меньшей мере, на 85%, 90%, 95%, 96%, 97%, 98%, 99% или более. Примеры полипептидов фоллистатина включают зрелый полипептид фоллистатин или более короткие изоформы или другие варианты полипептида-предшественника фоллистатина человека, как описано, например, в патенте WO2005/025601, который включен в настоящий документ в качестве ссылки в полном объеме.

В конкретном варианте осуществления ингибитор рецепторов ActRII для использования в композициях и способах, описанных в настоящем документе, представляет собой ген, родственный фоллистатин-подобному белку (FLRG), который является антагонистом биологической активности активина и/или связывается с активином. Термин «полипептид FLRG» включает полипептиды, включающие любой природный полипептид FLRG, а также любые его варианты (включая мутанты, фрагменты, гибриды и формы пептидомиметиков), которые сохраняют полезную активность. Варианты полипептидов FLRG, которые сохраняют связывающие активин свойства, могут быть идентифицированы с помощью рутинных методов анализа взаимодействий FLRG и активина. Смотри, например, патент США No. 6537966, который включен в настоящий документ в качестве ссылки в полном объеме. Полипептиды FLRG включают полипептиды, происходящие из последовательности любого известного FLRG, имеющие последовательность, по меньшей мере, приблизительно на 80% идентичную последовательности полипептида FLRG, и необязательно идентичную, по меньшей мере, на 85%, 90%, 95%, 96%, 97%, 98%, 99% или более.

В некоторых вариантах осуществления функциональные варианты или модифицированные формы полипептидов фоллистатина и полипептидов FLRG включают гибридные белки, имеющие, по меньшей мере, часть полипептидов фоллистатина или полипептидов FLRG и один или более доменов слияния, таких как, например, домены, которые облегчают выделение, определение, стабилизацию или мультимеризацию полипептида. Подходящие домены слияния подробно обсуждались выше при ссылке на полипептиды ActRIIА и ActRIIB. В одном варианте осуществления ингибитор рецепторов ActRII представляет собой гибридный белок, включающий связывающую активин часть полипептида фоллистатина, соединенную с доменом Fc. В другом варианте осуществления ингибитор рецепторов ActRII представляет собой гибридный белок, включающий связывающую активин часть полипептида FLRG, соединенную с доменом Fc.

5.3 Методы

(a) Методы диагностики

(i) Оборот костной ткани

Различные циркулирующие маркеры оборота костной ткани могут быть использованы для диагностики заболеваний костей, таких как пониженный оборот костной ткани. Циркулирующие маркеры костной ткани представляют собой маркеры остеогенеза, такие как специфическая щелочная фосфатаза кости (bAP), остеокальцин, C-концевой пропептид проколлагена типа I (PICP) и инсулиноподобный фактор роста 1 (IGF-1), причем некоторые представляют собой маркеры резорбции кости, такие как пиридинолин, дезоксипиридинолин, устойчивая к тартрату кислая фосфатаза (TRAP), TRAP типа 5В, пиридинолин, дезоксипиридинолин и C-концевой телопептид проколлагена типа I (ICTP), поперечные сшивки коллагена сыворотки или мочи (N-телопептид или C-телопептид) и 25-гидроксивитамин D. Могут быть также использованы методы измерения полноразмерной молекулы паратиреоидного гормона (ПТГ). Специалисту известны методы визуализации, позволяющие оценить минеральную плотность костной ткани (BMD). Смотри, например, Tilman B. Drueke and Sharon M. Moe, Disturbances of bone and mineral metabolism in chronic kidney disease: an international initiative to improve diagNOis and treatment, Nephrol Dial Transplant (2004) 19: 534-536; Okuno S, Inaba M., Biochemical markers of bone turnover. New aspect. Dialysis and bone metabolic marker, Clin Calcium. 2009 Aug; 19(8):1084-91; Herberth J, Monier-Faugere MC, Mawad HW, Branscum AJ, Herberth Z, Wang G, Cantor T, Malluche HH, The five most commonly used intact parathyroid hormone assays are useful for screening but not for diagNOing bone turnover abnormalities in CKD-5 patients, Clin Nephrol. 2009 Jul;72(l):5-14; Lehmann G, Ott U, Kaemmerer D, Schuetze J, Wolf G, Bone histomorphometry and biochemical markers of bone turnover in patients with chronic kidney disease Stages 3-5, Clin Nephrol. 2008 Oct; 70(4):296-305; Drueke TB., Is parathyroid hormone measurement useful for the diagNOis of renal bone disease?, Kidney Int. 2008 Mar; 73(6):674-6; Yamada S, Inaba M, Kurajoh M, Shidara K, Imanishi Y, Ishimura E, Nishizawa Y., Utility of serum tartrate-resistant acid phosphatase (TRACP5b) as a bone resorption marker in patients with chronic kidney disease: independence from renal dysfunction., Clin Endocrinol (Oxf). 2008 Aug; 69(2): 189-96. Epub 2008 Jan 23. Смотри также Paul D. Miller, DiagNOis and Treatment of Osteoporosis in Chronic Renal Disease, 2009.

Другим маркером для мониторинга резорбции костей у больных CKD с умеренной дисфункцией почек является концентрация N-телопептида коллагена типа I (S-NTX) в сыворотке крови. Смотри, например, Hamano T, Fujii N, Nagasawa Y, Isaka Y, Moriyama T, Okada N, Imai E, Horio M, Ito T., Serum NTX is a practical marker for assessing antiresorptive therapy for glucocorticoid treated patients with chronic kidney disease., Bone. 2006 Nov;39(5): 1067-72. Epub 2006 Jun 16.

Количественная компьютерная томография (QCT) также может быть использована для определения оборота костной ткани.

(ii) Модель адинамического нарушения костной ткани

Мышиная модель адинамического нарушения костной ткани в условиях почечной нагрузки представляет собой использование мышиной модели нефрэктомии, например, модели 5/6 нефрэктомии, используемой в разделах 6.2 и 6.3, в которой мышей кормили диетой с низким содержанием фосфатов.

В другой мышиной модели мышам делали электрокоагуляцию одной почки и нефрэктомию другой почки. Мышей кормили едой с низким содержанием фосфатов с добавлением кальцитриола. Смотри, например, Lund et al., 2004, J Am Soc Nephrol 15:349-369.

(iii) Тетрациклиновая маркировка костей

Диагностический тест, который может быть использован для определения типа заболевания костной ткани, связанного с CKD, представляет собой биопсию гребня подвздошной кости с двойной маркировкой тетрациклином и гистоморфометрическим анализом кости. Смотри, например, Национальный фонд почки: руководство NKF KDOQI.

(iv) Кальцификация сосудов

Неконтрастирующая компьютерная томография (КТ) для визуализации степени кальцификации коронарных артерий (CAC) и контрастирующая КТ для неинвазивной коронарной ангиографии (CTA) представляют собой разработки, обычно используемые для диагностики обструктивных заболеваний коронарных артерий. Для диагностической и прогностической оценки сердца могут быть также использованы радионуклидное стресс-тестирование, сканирование кальция коронарных артерий и неинвазивная коронарная ангиография. Смотри: Berman DS, Shaw LJ, Hachamovitch R, Friedman JD, Polk DM, Hayes SW, Thomson LE, Germano G, Wong ND, Kang X, Rozanski A., Comparative use of radionuclide stress testing, coronary artery calcium scanning, and noninvasive coronary angiography for diagNOtic and progNOtic cardiac assessment, Semin Nucl Med. 2007 Jan;37(l):2-16.

Результаты скрининга коронарного кальция у бессимптомных больных могут быть использованы в качестве сравнения. Например, результаты скрининга кальция, полученные до начала заболевания почек, могут быть использованы в качестве сравнения при кальцификации сосудов, связанной с заболеванием почек.

Возможные методы определения и количественной оценки кальцификации коронарных артерий (CAC) включают, но не ограничиваются этим, рентгеновскую компьютерную томографию и однофотонную эмиссионную компьютерную томографию перфузии миокарда (SPECT). Moser KW, O'Keefe JH Jr, Bateman TM, McGhie IA., Coronary calcium screening in asymptomatic patients as a guide to risk factor modification and stress myocardial perfusion imaging, J Nucl Cardiol. 2003 Nov-Dec;10(6):590-8. Мультидетекторная компьютерная томография (MDCT) также может быть использована для обнаружения кальцификации сосудов (смотри, например, Burrill et al, 2007, Postgrad. Med. J. 83(985):698-704).

Другим методом диагностики кальцификации сосудов является анализ захвата фтор-18-фтордезоксиглюкозы (FDG) стенкой грудной аорты при сочетанной позитронно-эмиссионной томографии (ПЭТ)/ компьютерной томографии (КТ). Смотри: Tatsumi M, Cohade C, Nakamoto Y, Wahl RL., Fluorodeoxyglucose uptake in the aortic wall at PET/CT: possible finding for active atherosclerosis, Radiology. 2003 Dec;229(3):831-7. Epub 2003 Oct 30.

В еще одном варианте осуществления сверхбыстрая КТ может быть использована для обнаружения наличия атеросклеротического коронарного заболевания. Смотри, например, Breen JF, Sheedy PF 2nd, Schwartz RS, Stanson AW, Kaufmann RB, Moll PP, Rumberger JA, Coronary artery calcification detected with ultrafast CT as an indication of coronary artery disease, Radiology. 1992 Nov;185(2):435-9.

Сканирование с помощью электронно-лучевой компьютерной томографии также может быть использовано для диагностики заболевания коронарной артерии. Смотри, например, Schmermund A, Baumgart D, Sack S, Mohlenkamp S, Gronemeyer D, Seibel R, Erbel R., Assessment of coronary calcification by electron-beam computed tomography in symptomatic patients with normal, abnormal or equivocal exercise stress test, Eur Heart J. 2000 Oct;21(20):1674-82.

Другой метод определения кальцификации сосудов касается состава бляшек при плексогенной и тромбоэмболической легочной гипертензии. Хроническая тромбоэмболическая легочная гипертензия связана с атеросклеротическими бляшками с обогащенной гликофорином мацерированной основой, а плексогенная легочная гипертензия - с фиброзными бляшками. Тромбоэмболический материал играет важную роль в формировании мацерированной основы, в которой основным компонентом является гликофорин, происходящий из мембран эритроцитов. Таким способом исследуется хроническая тромбоэмболическая и плексогенная легочная гипертензия (первичная и вторичная (синдром Эйзенменгера)). Смотри: Arbustini E, Morbini P, Darmini AM, Repetto A, Minzioni G, Piovella F, Vigano M, Tavazzi L, Plaque composition in plexogenic and thromboembolic pulmonary hypertension: the critical role of thrombotic material in pultaceous core formation, Heart. 2002 Aug; 88(2):177-82.

Шкала Агатстона, система подсчета кальция на основе измерений плотности отложенных кальциевых бляшек может быть использована для количественной оценки кальцификации сосудов. В этой системе уровни кальцификации сосудов могут быть измерены с помощью мультидетекторной компьютерной томографии (MDCT), и может быть оценено уменьшение скорости прогрессии по шкале Агатстона (смотри, например, Sharma et al., 2010, Vase. Health Risk Manag. 6:603-611).

Кроме того, кальцификация сосудов может быть оценена при использовании методов, описанных в Adragao et al., 2004, Nephrol. Dial. Transplant 19:1480-1488.

Другой анализ для использования при количественной оценке кальцификации сосудов у индивидуума представляет собой специфическую для повреждения шкалу оценки уровня кальция, которая включает способ измерения кальция, который является результатом КТ тестирования кальцификации коронарной артерии. Этот метод описан, например, Akram and Voros, 2008, Int. J. cardiovac. Imaging 14:743-749.

(v) Заболевание почек

Скорость клубочковой фильтрации может быть определена с помощью любого способа, известного специалисту в данной области техники для определения заболевания почек. Смотри веб-сайт Национального фонда почек.

(vi) Вторичный паратиреоз

Вторичный гиперпаратиреоз возникает, когда паращитовидные железы производят слишком много паратиреоидного гормона (ПТГ) из-за слишком низких уровней кальция или повышенных уровней фосфора. Уровни кальция, фосфора и ПТГ могут быть определены в образцах крови.

(vii) Гиперфосфатемия

Аномально повышенные уровни фосфата в крови можно определить любым способом, известным специалисту в данной области техники.

(b) Методы скрининга

Различные варианты полипептида ActRII или растворимые варианты полипептида ActRII могут быть протестированы на их способность ингибировать ActRII. Кроме того, соединения могут быть протестированы на их способность ингибировать ActRII. Как только ингибиторная активность в отношении ActRII подтверждается, эти соединения могут быть использованы с методами, предлагаемыми в настоящем документе. ActRII может представлять собой ActRIIA или ActRIIB. Ниже описываются методы для ActRIIA, но они аналогично могут быть выполнены для ActRIIB.

Например, может быть оценено влияние варианта полипептида ActRIIA на экспрессию генов, участвующих в формировании костной ткани или деструкции костной ткани. Это в случае необходимости может быть осуществлено в присутствии одного или более рекомбинантных белковых лигандов ActRIIA (например, активина), и клетки могут быть трансфецированы таким образом, чтобы продуцировать полипептид ActRIIA и/или его вариант, и необязательно лиганд ActRIIA. Кроме того, полипептид ActRIIA можно вводить мыши или другому животному, и может быть оценено одно или более свойств костной ткани, таких как плотность или объем. Может быть также оценена скорость заживления переломов костей. Рентгеновская абсорбциометрия с двойной энергией (DEXA) представляет собой общепризнанный, неинвазивный, количественный метод оценки плотности костной ткани у животного. У человека системы DEXA для центральных областей могут быть использованы для оценки плотности костной ткани позвоночника и таза. Это наилучшие методы предсказания общей плотности костной ткани. Системы DEXA для периферических областей могут быть использованы для оценки плотности костной ткани в периферических костях, включая, например, кости руки, запястья, лодыжки и стопы. Традиционные рентгеновские системы визуализации, включая сканирование CAT, могут быть использованы для оценки роста костей и заживления переломов. Кроме того, плотность костной ткани может быть измерена с помощью количественной компьютерной томографии (qCT). Может быть также оценена механическая прочность кости.

В некоторых аспектах в настоящем документе предлагается использование полипептидов ActRIIA (например, растворимых полипептидов ActRIIA) и полипептидов активина для идентификации соединений (агентов), которые являются агонистами или антагонистами сигнального пути активина-ActRIIA. Соединения, идентифицированные с помощью этого скрининга, могут быть протестированы для оценки их способности модулировать рост костей или минерализацию in vitro. Необязательно эти соединения могут быть дополнительно протестированы в животных моделях с целью оценки их способности модулировать рост тканей in vivo.

Существует множество подходов к скринингу терапевтических агентов для модуляции роста тканей, направленных на полипептиды активин и ActRIIA. В некоторых вариантах осуществления высокопроизводительный скрининг соединений может осуществляться для идентификации агентов, которые вмешиваются в опосредованные активином или ActRIIA эффекты на костную ткань. В некоторых вариантах осуществления этот анализ выполняется для скрининга и идентификации соединений, которые специфически ингибируют или снижают связывание полипептида ActRIIA с активином. Альтернативно анализ может быть использован для идентификации соединений, которые повышают связывание полипептида ActRIIA с активином. В другом варианте осуществления соединения могут быть идентифицированы по их способности взаимодействовать с активином или полипептидом ActRIIA.

Должно быть достаточно различных форматов анализов, и в свете настоящего описания те из них, которые описаны в настоящем документе не достаточно, тем не менее должны быть понятны любому специалисту в данной области техники. Как описано в настоящем документе, тестируемые соединения (агенты), используемые в настоящем документе, могут быть созданы с помощью любого комбинаторного химического метода. Альтернативно, желаемые соединения могут быть природными биомолекулами, синтезируемыми in vivo или in vitro. Соединения (агенты), подвергаемые тестированию на их способность действовать в качестве модуляторов роста тканей, могут быть получены, например, с помощью бактерий, дрожжей, растений или других организмов (например, природные продукты), получены химически (например, небольшие молекулы, включая пептидомиметики) или получены рекомбинантно. Тестируемые соединения, рассматриваемые в настоящем документе, включают непептидильные органические молекулы, пептиды, полипептиды, пептидомиметики, сахара, гормоны и молекулы нуклеиновых кислот. В конкретном варианте осуществления тестируемый агент представляет собой небольшую органическую молекулу, имеющую молекулярную массу менее приблизительно 2000 дальтон.

Тестируемые соединения могут быть предоставлены в виде отдельных, дискретных частей, или представлены в библиотеках большей сложности, таких как полученные с помощью комбинаторной химии. Эти библиотеки могут включать, например, спирты, алкилгалогениды, амины, амиды, сложные эфиры, альдегиды, простые эфиры и другие классы органических соединений. Представление тестируемых соединений тест-системе может быть либо в выделенном виде, либо в виде смесей соединений, особенно на начальных стадиях скрининга. Необязательно соединения могут быть дериватизированы с помощью других соединений и иметь дериватизирующие группы, которые облегчают выделение соединений. Неограничивающие примеры дериватизирующих групп включают биотин, флуоресцеин, дигоксигенин, зеленый флуоресцентный белок, изотопы, полигистидин, магнитные шарики, глутатион-S-трансферазу (GST), фотоактивируемые поперечные сшивки или любые их сочетания.

Во многих программах скрининга лекарственных средств, которые тестируют библиотеки соединений и натуральные экстракты, желательны высокопроизводительные анализы для максимизации количества соединений, проверенных в течение данного периода времени. Анализы, которые выполняются в бесклеточных системах, например, которые можно получить с очищенными или полуочищенными белками, часто являются предпочтительными в качестве «первичного» скрининга, потому что они могут быть созданы для обеспечения быстрой разработки и относительно легкого обнаружения изменения молекулярной мишени, которое опосредуется тестируемым соединением. Кроме того, эффекты клеточной токсичности или биодоступности тестируемого соединения обычно могут быть проигнорированы в системе in vitro, вместо этого анализ сосредотачивается главным образом на влиянии лекарства на молекулярную мишень, что может проявляться в изменении сродства связывания полипептида ActRIIA и активина.

Просто в качестве иллюстрации в иллюстративном примере скрининга представляющее интерес соединение вводят в контакт с выделенным и очищенным полипептидом ActRIIA, который обычно способен связываться с активином. К смеси соединения и полипептида ActRIIA затем добавляют композицию, содержащую лиганд ActRIIA. Определение и количественная оценка комплексов ActRIIA/активин дает инструмент для определения эффективности соединения относительно ингибирования (или потенцирования) образования комплекса полипептида ActRIIA и активина. Эффективность соединения может быть оценена путем создания кривых доза-ответ по данным, полученным с использованием различных концентраций тестируемого соединения. Кроме того, может быть выполнен также контрольный анализ для обеспечения контрольной линией для сравнения. Например, в контрольном анализе выделенный и очищенный активин добавляют к композиции, содержащей полипептид ActRIIA, и образование комплекса ActRIIA/активин количественно измеряют в отсутствие тестируемого соединения. Следует понимать, что в целом порядок, в котором реагенты могут быть смешаны, может варьироваться, и они могут быть смешаны одновременно. Кроме того, вместо очищенных белков могут быть использованы клеточные экстракты и лизаты, чтобы предоставить подходящую бесклеточную систему тестирования.

Образование комплекса между полипептидом ActRIIA и активином может быть определено с помощью различных методов. Например, модуляция образования комплексов может быть количественно оценена с помощью иммунологического анализа или путем хроматографического определения с использованием, например, белков, меченных поддающейся определению меткой, такой как радиоактивная метка (например, 32P, 35S, 14С или 3H), флуоресцентная метка (например, ФИТЦ) или ферментативно меченный ActRIIA полипептид или активин.

В некоторых вариантах осуществления в настоящем документе предполагается использование флуоресцентного поляризационного анализа и анализа с помощью передачи энергии флуоресцентного резонанса (FRET) для измерения, либо прямого, либо непрямого, степени взаимодействия между полипептидом ActRIIA и его связывающим белком. Кроме того, другие методы определения, такие как методы, основанные на оптических волноводах (публикации РСТ WO 96/26432 и патент США No. 5677196), поверхностном плазмонном резонансе (SPR), сенсорах поверхностного заряда и сенсорах поверхностного усилия, совместимы со многими вариантами осуществления, описанными в настоящем документе.

Кроме того, анализ с улавливанием взаимодействия, также известный как «двугибридный анализ», может быть использован для идентификации агентов, которые нарушают или усиливают взаимодействие между полипептидом ActRIIA и связывающимся с ним белком. Смотри, например, патент США No. 5283317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J Biol Chem 268: 12046-12054; Barrel et al. (1993) Biotechniques 14:920-924; и Iwabuchi et al. (1993) Oncogene 8: 1693-1696). В конкретном варианте осуществления в настоящем документе охватывается использование обратных двугибридных систем для идентификации соединений (например, небольших молекул или пептидов), которые вызывают диссоциацию взаимодействия между полипептидом ActRIIA и связывающимся с ним белком. Смотри, например, Vidal and Legrain, (1999) Nucleic Acids Res 27:919-29; Vidal and Legrain, (1999) Trends Biotechnol 17:374-81; и патенты США NO. 5525490; 5955280; и 5965368.

В некоторых вариантах осуществления исследуемые соединения идентифицируют по их способности взаимодействовать с полипептидом ActRIIA или активином. Взаимодействие между соединением и полипептидом ActRIIA или активином может быть ковалентным или нековалентным. Например, такое взаимодействие может быть идентифицировано на уровне белка с использованием биохимических методов in vitro, включая поперечную фотосшивку, связывание меченного лиганда и аффинную хроматографию (Jakoby W B et al., 1974, Methods in Enzymology 46: 1). В некоторых случаях соединения могут быть подвергнуты скринингу в анализе на основе их механизма действия, такого как анализ для определения соединений, которые связываются с активином или полипептидом ActRIIA. Он может включать событие связывания в твердой фазе или в жидкой фазе. Альтернативно ген, кодирующий активин или полипептид ActRIIA, может быть трансфецирован с репортерной системой (например, β-галактозидазой, люциферазой или зеленым флуоресцентным белком) в клетку и проведен его скрининг, предпочтительно высокопроизводительный скрининг, против библиотеки или отдельного члена библиотеки. Может быть использован другой механизм, основанный на анализе связывания, например, анализ связывания, с помощью которого определяют изменения свободной энергии. Анализы связывания могут быть выполнены с мишенью, прикрепленной к лунке, шарику или чипу, или мишень захватывается иммобилизованным антителом, или она отделяется с помощью капиллярного электрофореза. Связанные соединения могут быть определены обычно с помощью колориметрического или флуоресцентного, или поверхностного плазмонного резонанса.

В некоторых аспектах в настоящем документе предлагаются способы и агенты для модуляции (стимуляции или ингибирования) образования костной ткани и увеличения костной массы. Таким образом, любое идентифицированное соединение может быть протестировано в целых клетках или тканях, in vitro или in vivo для подтверждения его способности модулировать рост или минерализацию костей. Различные методы, известные в данной области, могут быть использованы для этой цели. В частности, эти соединения могут быть протестированы на их способность повышать оборот костной ткани.

Например, влияние ActRIIA, или полипептидов активина, или тестируемых соединений на рост костей или хрящевой ткани может быть определено путем измерения индукции Msx2 или дифференцировки остеопрогениторных клеток в остеобласты в клеточных системах анализа (смотри, например, Daluiski et al., Nat Genet. 2001, 27(l):84-8; Hino et al., Front Biosci. 2004, 9:1520-9). Другой пример анализа на основе клеточных систем включает анализ остеогенной активности исследуемого ActRIIA или полипептидов активина и тестируемых соединений, проводимый на мезенхимальных клетках-предшественниках и остеобластах. В качестве иллюстрации, могут быть сконструированы рекомбинантные аденовирусы, экспрессирующие активин или полипептид ActRIIA, для инфицирования плюрипотентных мезенхимальных клеток-предшественников клеток C3H10T1/2, преостеобластных клеток С2С12 и остеобластных клеток TE-85. Остеогенную активность затем определяют путем измерения индукции щелочной фосфатазы, остеокальцина и минерализации матрикса (смотри, например, Cheng et al., J bone Joint Surg Am. 2003, 85-A(8): 1544-52).

Кроме того, в настоящем документе предлагаются методы in vivo для измерения роста костей или хрящей. Например, Namkung-Matthai et al., Bone, 28:80-86 (2001) раскрывают крысиную модель остеопороза, в которой изучается репарация кости в ранний период после перелома. Kubo et al., Steroid Biochemistry & Molecular Biology, 68: 197-202 (1999) также раскрывают крысиную модель остеопороза, в которой изучается репарация кости в поздний период после перелома. Andersson et al., J. Endocrinol. 170:529-537 описывают крысиную модель остеопороза, в которой мышей овариэктомируют, что приводит у мышей к потере существенной части минерального содержимого костей и к потере минеральной плотности костной ткани, причем губчатые кости теряют приблизительно 50% минеральной плотности костной ткани. Плотность костной ткани может быть увеличена у овариэктомированных мышей путем введения таких факторов, как паратиреоидный гормон. В некоторых аспектах могут быть использованы методы определения заживления переломов, известные в данной области техники. Эти методы включают метод переломов, гистологический анализ и биомеханический анализ, которые описаны, например, в патенте США No. 6521750, который включен в качестве ссылки в полном объеме для раскрытия в нем экспериментальных протоколов для индукции переломов, а также измерения размера переломов и процесса репарации.

5.4 Дозы

В настоящем документе предлагаются способы лечения CKD-MBD и/или заболевания с низким оборотом костной ткани, где способы включают введение больному, нуждающемуся в таком лечении, терапевтически эффективного количества ингибитора ActRII (смотри раздел 5.2). В некоторых вариантах осуществления ингибитор ActRII представляет собой ингибитор ActRIIA, как изложено в разделе 5.2(а). В других вариантах осуществления ингибитор ActRII представляет собой ингибитор ActRIIB, как изложено в разделе 5.2(b). В некоторых вариантах осуществления ингибитор ActRII представляет собой сочетание ингибитора ActRIIA и ингибитора ActRIIB.

В некоторых вариантах осуществления терапевтически эффективное количество ингибитора ActRII достаточно для улучшения одного симптома CKD-MBD. В некоторых вариантах осуществления терапевтически эффективное количество ингибитора ActRII достаточно для предотвращения ухудшения, по меньшей мере, одного симптома CKD-BMD.

В некоторых вариантах осуществления терапевтически эффективное количество ингибитора ActRII улучшает или стабилизирует функцию почек. Функция почек может быть измерена с помощью оценки скорости клубочковой фильтрации. Смотри, например, раздел 5.4(а)(iv). В некоторых вариантах осуществления терапевтически эффективное количество ингибитора ActRII представляет собой суточную дозу, которая достаточна для стабилизации скорости клубочковой фильтрации больного CKD-MBD в течение срока лечения ингибитором ActRII и, по меньшей мере, в течение 3 месяцев, 6 месяцев, 9 месяцев или 12 месяцев. В некоторых вариантах осуществления терапевтически эффективное количество ингибитора ActRIIA представляет собой суточную дозу, которая достаточна для повышения скорости клубочковой фильтрации, по меньшей мере, на 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% или, по меньшей мере, на 50%.

В некоторых вариантах осуществления терапевтически эффективное количество ингибитора ActRII увеличивает уровень эритроцитов крови и/или уровень гемоглобина у больного.

В некоторых вариантах осуществления терапевтически эффективное количество ингибитора ActRII эффективно в отношении (a) увеличения уровней эритроцитов и/или гемоглобина у больного; (b) улучшения качества костной ткани и/или минеральной плотности костной ткани у больного; и (с) улучшения функции почек у больного.

В некоторых вариантах осуществления терапевтически эффективное количество ингибитора ActRII эффективно в отношении (a) увеличения уровней эритроцитов и/или гемоглобина у больного; (b) повышения оборота костной ткани у больного; и (с) улучшения функции почек у больного.

В некоторых вариантах осуществления ингибитор ActRII дозируется с интервалами и в количествах, достаточных для достижения концентрации в сыворотке 0,2 микрограмм/кг или более, и сывороточные уровни 1 микрограмм/кг или 2 микрограмм/кг или более желательны для достижения существенного влияния на плотность и прочность костной ткани. Режимы дозирования могут быть разработаны для достижения концентрации в сыворотке от 0,2 до 15 микрограмм/кг, и, необязательно, от 1 до 5 микрограмм/кг. У человека сывороточные уровни 0,2 микрограмм/кг могут быть достигнуты с помощью однократной дозы 0,1 мг/кг или более, и сывороточные уровни 1 микрограмм/кг могут быть достигнуты с помощью однократной дозы 0,3 мг/кг или более. Наблюдаемый период полужизни молекулы в сыворотке составляет приблизительно от 20 до 30 дней, что существенно выше, чем у большинства белков гибридов с Fc, и, таким образом, устойчивый эффективный уровень в сыворотке может быть достигнут, например, путем введения дозы 0,2-0,4 мг/кг еженедельно или один раз в две недели, или более высокие дозы могут быть использованы с более длительными интервалами между введением доз. Например, дозы 1-3 мг/кг могут быть использованы один раз в месяц или в два месяца, и влияние на костную ткань может быть достаточно продолжительным, так что введение дозы необходимо только один раз каждые 3, 4, 5, 6, 9, 12 или более месяцев.

5.5 Фармацевтические композиции

В некоторых вариантах осуществления антагонисты активина-ActRII (например, полипептиды ActRII), составляют с фармацевтически приемлемым носителем для использования со способами, описанными в настоящем документе. Например, полипептид ActRII можно вводить отдельно или в качестве компонента фармацевтической композиции (терапевтической композиции). Рассматриваемые соединения могут быть составлены для введения любым удобным для использования в медицине или ветеринарии способом. ActRII может представлять собой ActRIIA или ActRIIB.

В некоторых вариантах осуществления терапевтические методы, описанные в настоящем документе, включают введение композиции системно или местно в виде имплантата или устройства. При введении терапевтические композиции, используемые в настоящем документе, могут быть в апирогенной, физиологически приемлемой форме. Терапевтически пригодные агенты, отличные от антагонистов ActRIIA, которые также могут быть необязательно включены в композицию, как описано выше, могут быть введены одновременно с рассматриваемыми соединениями (например, полипептидами ActRII, такими как полипептиды ActRIIA и/или ActRIIB (см раздел 5.2)) или последовательно.

Обычно, антагонисты ActRIIA могут вводиться парентерально. Фармацевтические композиции, пригодные для парентерального введения, могут включать один или более полипептидов ActRII в сочетании с одним или более фармацевтически приемлемыми, стерильными, изотоническими, водными или неводными растворами, дисперсиями, суспензиями или эмульсиями, или со стерильными порошками, которые могут быть реконструированы в стерильные инъекционные растворы или дисперсии непосредственно перед использованием, которые могут содержать антиоксиданты, буферы, бактериостатики, растворенные вещества, которые придают композиции изотоничность с кровью предполагаемого реципиента, или суспендирующие или загущающие агенты. Примеры подходящих водных и неводных носителей, которые могут быть использованы в фармацевтических композициях, используемых в способах, описанных в настоящем документе, включают воду, этанол, полиолы (такие как глицерин, пропиленгликоль, полиэтиленгликоль и тому подобное) и их подходящие смеси, растительные масла, такие как оливковое масло, и инъецируемые органические сложные эфиры, такие как этилолеат. Надлежащую текучесть можно поддерживать, например, путем использования покрывающих материалов, таких как лецитин, путем поддержания требуемого размера частиц в случае дисперсий и путем использования поверхностно-активных веществ.

Кроме того, композиция может быть инкапсулирована или введена в форме для доставки к участку ткани-мишени (например, к костной ткани). В некоторых вариантах осуществления композиции, используемые в способах, описанных в настоящем документе, могут включать матрикс, способный доставлять одно или более терапевтических соединений (например, полипептидов ActRIIA) к участку ткани-мишени (например, к костной ткани), обеспечивающий структуру для развивающейся ткани и оптимально способный к резорбции в организме. Например, матрикс может обеспечить медленное высвобождение полипептидов ActRIIA. Такие матриксы могут быть созданы из материалов, используемых в настоящее время для других имплантируемых агентов в медицинских целях.

Выбор материала матрикса основывается на биосовместимости, биодеградируемости, механических свойствах, косметическом внешнем виде и свойствах границ раздела. Конкретное применение рассматриваемых композиций будет определяться соответствующим составом. Потенциальные матриксы для композиций могут представлять собой биодеградируемые материалы определенного химического состава - сульфат кальция, трикальцийфосфат, гидроксиапатит, полимолочную кислоту и полиангидриды. Другие потенциальные материалы представляют собой биодеградируемые и биологически хорошо описанные материалы, такие как костная ткань или коллаген кожи. Дополнительные матриксы состоят из чистых белков или компонентов внеклеточного матрикса. Другие потенциальные матриксы представляют собой биологически недеградируемый материал определенного химического состава, например, агломерированный гидроксиапатит, биостекло, алюминаты или другие керамические агенты. Матриксы могут состоять из сочетаний любых из указанных выше типов материала, таких как полимолочная кислота и гидроксиапатит или коллаген и трикальцийфосфат. Биокерамические агенты в композиции могут быть модифицированы, например, в кальций-алюминат-фосфат и обработаны для изменения размера пор, размера частиц, формы частиц и биодеградируемости.

В некоторых вариантах осуществления композиции, используемые в способах, описанных в настоящем документе, могут быть введены перорально, например, в форме капсул, саше, пилюль, таблеток, пастилок (с использованием ароматизированной основы, обычно сахарозы и гуммиарабика или трагаканта), порошков, гранул, или в виде раствора или суспензии в водной или неводной жидкости, или в виде жидкой эмульсии масла-в-воде или воды-в-масле, или в виде эликсира или сиропа, или в виде пастилок (с использованием инертной основы, такой как желатин и глицерин или сахароза и гуммиарабик), и/или в виде ополаскивателя полости рта и тому подобного, каждая из которых содержит предварительно определенное количество агента в качестве активного ингредиента. Агент можно также вводить в виде болюса, лекарственной кашки или пасты.

В твердых лекарственных формах для перорального введения (капсулах, таблетках, пилюлях, драже, порошках, гранулах и тому подобном) одно или более терапевтических соединений, используемых в способах, описанных в настоящем документе, может быть смешано с одним или более фармацевтически приемлемыми носителями, такими как

цитрат натрия или дикальцийфосфат, и/или любой носитель из следующих: (1) наполнители или разбавители, такие как крахмалы, лактоза, сахароза, глюкоза, маннит и/или кремниевая кислота; (2) связующие вещества, такие как, например, карбоксиметилцеллюлоза, альгинаты, желатин, поливинилпирролидон, сахароза и/или гуммиарабик; (3) увлажнители, такие как глицерин; (4) дезинтегрирующие агенты, такие как агар-агар, карбонат кальция, картофельный крахмал или крахмал тапиоки, альгиновая кислота, некоторые силикаты и карбонат натрия; (5) замедляющие растворение агенты, такие как парафин; (6) ускорители всасывания, такие как четвертичные аммониевые соединения; (7) увлажняющие агенты, такие как, например, цетиловый спирт и моностеарат глицерина; (8) абсорбенты, такие как каолин и бентонитовая глина; (9) смазывающие агенты, такие как тальк, стеарат кальция, стеарат магния, твердые полиэтиленгликоли, лаурилсульфат натрия и их смеси; и (10) красители. В случае капсул, таблеток и пилюль фармацевтические композиции могут также включать забуферивающие агенты. Твердые композиции подобного типа могут также быть использованы в качестве наполнителей в мягких и наполняемых твердыми агентами желатиновых капсулах с использованием таких наполнителей, как лактоза или молочный сахар, а также полиэтиленгликоли высокой молекулярной массы и тому подобное.

Жидкие лекарственные формы для перорального введения включают фармацевтически приемлемые эмульсии, микроэмульсии, растворы, суспензии, сиропы и эликсиры. В дополнение к активному ингредиенту жидкие лекарственные формы могут содержать инертные разбавители, обычно используемые в данной области техники, такие как вода или другие растворители, солюбилизирующие агенты и эмульгаторы, такие как этиловый спирт, изопропиловый спирт, этилкарбонат, этилацетат, бензиловый спирт, бензилбензоат, пропиленгликоль, 1,3-бутиленгликоль, масла (в частности, хлопковое, арахисовое, кукурузное масло, масло зародышевого жмыха, оливковое, касторовое и кунжутное масло), глицерин, тетрагидрофуриловый спирт, полиэтиленгликоли и сложные эфиры жирных кислот и сорбитана и их смеси. Кроме инертных разбавителей пероральные композиции могут также включать адъюванты, такие как увлажняющие агенты, эмульгаторы и суспендирующие агенты, подсластители, ароматизаторы, красители, отдушки и консерванты.

Суспензии помимо активных соединений могут содержать суспендирующие агенты, такие как этоксилированные изостеариловые спирты, полиоксиэтиленсорбит и сложные эфиры сорбита, микрокристаллическую целлюлозу, метагидроксид алюминия, бентонит, агар-агар и трагакант, а также их смеси.

Композиции, используемые в способах, описанных в настоящем документе, могут также содержать адъюванты, такие как консерванты, увлажняющие агенты, эмульгаторы и диспергирующие агенты. Предотвращение действия микроорганизмов может быть обеспечено путем включения различных антибактериальных и противогрибковых агентов, например парабена, хлорбутанола, фенола, сорбиновой кислоты и тому подобного. Желательным может быть также включение в композиции изотонических агентов, таких как сахара, хлорид натрия и тому подобное. Кроме того, пролонгированное всасывание инъекционной фармацевтической формы может быть вызвано включением агентов, которые замедляют всасывание, таких как моностеарат алюминия и желатин.

Следует понимать, что режим дозирования должен определяться лечащим врачом с учетом различных факторов, которые модифицируют действие рассматриваемых соединений, используемых в способах, описанных в настоящем документе (например, полипептидов ActRII, таких как полипептиды ActRIIA и/или ActRIIB (см раздел 5.2)). Различные факторы включают, но не ограничиваются этим, желаемое количество образуемой костной массы, степень потери плотности костной ткани, место повреждения кости, состояние поврежденной кости, возраст больного, пол и диету, тяжесть любого заболевания, которое может вносить вклад в потерю костной массы, время введения и другие клинические факторы. Необязательно дозировка может варьироваться в зависимости от типа матрикса, используемого для реконституции и типов соединений в композиции. Добавление других известных факторов роста в конечную композицию также может влиять на дозировку. Ход лечения можно контролировать с помощью периодической оценки роста кости и/или ее репарации, например, с помощью рентгеновского облучения (включая DEXA), гистоморфометрического определения и мечения тетрациклином.

В некоторых вариантах осуществления способы, описанные в настоящем документе, включают генную терапию для продукции полипептидов ActRII in vivo. Такая терапия должна достигнуть своего терапевтического эффекта в результате введения полинуклеотидных последовательностей ActRII в клетки или ткани, имеющие нарушения, как указано выше. Доставка полинуклеотидных последовательностей ActRII может быть достигнута с использованием рекомбинантного экспрессионного вектора, такого как химерный вирус, или коллоидная дисперсионная система. Для терапевтической доставки полинуклеотидных последовательностей ActRII предпочтительно использование липосом с направленным действием. Полипептиды ActRII могут представлять собой полипептиды ActRIIA и/или ActRIIB (см раздел 5.2)).

Различные вирусные векторы, которые могут быть использованы для генной терапии, как описано в настоящем документе, включают аденовирус, вирус герпеса, вирус коровьей оспы или, предпочтительно, РНК-вирус, такой как ретровирус. Предпочтительно ретровирусный вектор представляет собой производное ретровируса мыши или птицы. Примеры ретровирусных векторов, в которые может быть вставлен один чужеродный ген, включают, но не ограничиваются этим: вирус лейкоза Молони мыши (MoMuLV), вирус саркомы Харви мыши (HaMuSV), вирус опухоли молочной железы мыши (MuMTV) и вирус саркомы Рауса (RSV). Ряд дополнительных ретровирусных векторов может включать множественные гены. Все эти векторы могут переносить или включать ген маркера селекции, так что трансдуцированные клетки могут быть идентифицированы и получены. Ретровирусные векторы можно сделать специфичными для мишени путем присоединения, например, сахара, гликолипида или белка. Предпочтительно направленное действие достигается с помощью антител. Специалистам в данной области техники должно быть понятно, что конкретные полинуклеотидные последовательности могут быть вставлены в ретровирусный геном или присоединены к оболочке вируса для возможности осуществления специфической направленной доставки ретровирусного вектора, содержащего полинуклеотид ActRIIA. В предпочтительном варианте осуществления вектор направлен на костную или хрящевую ткань.

Альтернативно, клетки тканевой культуры могут быть непосредственно трансфецированы плазмидами, кодирующими ретровирусные структурные гены gag, pol и env, с помощью обычной трансфекции с использованием фосфата кальция. Эти клетки затем трансфецируют плазмидным вектором, содержащим гены, представляющие интерес. Полученные клетки высвобождают ретровирусный вектор в культуральную среду.

Другая система направленной доставки полинуклеотидов ActRIIA представляет собой коллоидную дисперсионную систему. Коллоидные дисперсионные системы включают макромолекулярные комплексы, нанокапсулы, микросферы, шарики и системы на основе липидов, включая эмульсии масла-в-воде, мицеллы, смешанные мицеллы и липосомы. Одна коллоидная система, которая может быть использована, представляет собой липосому. Липосомы представляют собой искусственные, заключенные в мембрану везикулы, которые пригодны в качестве носителей для доставки in vitro и in vivo. РНК, ДНК и интактные вирионы могут быть инкапсулированы в водной внутренней части и доставляться в клетки в биологически активной форме (смотри, например, Fraley, et al., Trends Biochem. Sci., 6:77, 1981). Методы эффективного переноса генов с использованием доставки с помощью липосом известны в данной области техники, смотри, например, Mannino, et al., Biotechniques, 6:682, 1988. Состав липосомы обычно представляет собой комбинацию фосфолипидов, обычно в сочетании со стероидами, особенно холестерином. Также могут быть использованы другие фосфолипиды или другие липиды. Физические характеристики липосом зависят от рН, ионной силы и присутствия двухвалентных катионов.

Примеры липидов, пригодных для получения липосом, включают фосфатидильные соединения, такие как фосфатидилглицерин, фосфатидилхолин, фосфатидилсерин, фосфатидилэтаноламин, сфинголипиды, цереброзиды и ганглиозиды. Иллюстративные фосфолипиды включают фосфатидилхолин яйца, дипальмитоилфосфатидилхолин и дистеароилфосфатидилхолин. Направленная доставка липосом возможна также на основе, например, органоспецифичности, клеточной специфичности, и специфичности для органелл, как известно в данной области техники.

В некоторых вариантах осуществления ингибитор ActRIIA в фармацевтической композиции является по существу чистым. В частности, не более 20%, 10%, 5%, 2,5%, 1%, 0,1%, или не более 0,05% соединений в фармацевтической композиции являются соединениями, отличными от ингибитора ActRII и фармацевтически приемлемого носителя.

6. ПРИМЕРЫ

6.1 Пример 1

(a) Гибридные белки ActRIIA-Fc

Описан растворимый гибридный белок ActRIIA, который имеет внеклеточный домен ActRIIA человека, соединенный с доменом Fc человека или мыши с минимальным линкером. Конструкты обозначаются как ActRIIA-hFc и mActRIIA-Fc, соответственно. ActRIIA-hFc предлагается как SEQ ID NO:7. mActRIIA-Fc является мышиным аналогом SEQ ID NO:7.

Белки ActRIIA-hFc и mActRIIA-Fc экспрессировали в клеточных линиях СНО. Рассматривали три различные лидирующие последовательности:

(i) меллитина медоносной пчелы (HBML): SEQ ID NO:8

(ii) тканевого активатора плазминогена (ТРA): SEQ ID NO:9

(iii) нативную ActRIIA: SEQ ID NO:10

В выбранной форме использовалась лидирующая последовательность TPA, и она без процессинга имела следующую аминокислотную последовательность, представленную в SEQ ID NO:13. Этот полипептид кодируется SEQ ID NO:14.

(b) Гибридные белки ActRIIB-Fc

Кокристаллическая структура внеклеточного домена ActRIIB человека, соединенного с доменом Fc человека, и активина не играла никакой роли для концевых (С-концевых) 15 аминокислот (в данном описании обозначаемых «хвостом») внеклеточного домена при связывании лиганда. Эта последовательность не способна давать кристаллическую структуру, что предполагает, что эти остатки присутствуют в гибкой петле, которая упорядоченно не упаковывается в кристалл. Thompson et al. EMBO J. 2003 Apr 1; 22(7):1555-66. Эта последовательность также мало консервативна между ActRIIB и ActRIIA. Соответственно, эти остатки были опущены в основном или базовом гибридном конструкте ActRIIB-Fc. Кроме того, положение 64 в базовой форме занимает аланин, что обычно рассматривается как форма «дикого типа», хотя аллель A64R встречается в природе. Таким образом, базовый гибрид ActRIIB-Fc имеет последовательность, раскрытую в SEQ ID NO:21.

Неожиданно обнаружено, что С-концевой хвост усиливает связывание активина и GDF-11, таким образом, предпочтительный вариант ActRIIB-Fc имеет последовательность SEQ ID NO:20.

Различные варианты ActRIIB, которые могут быть использованы в соответствии со способами, описанными в настоящем документе, описаны в международной патентной заявке, опубликованной как WO2006/012627 (смотри, например, стр. 59-60), включенной в настоящий документ в качестве ссылки в полном объеме.

6.2 Влияние ингибирования mACTRIIA в мышиной модели хронического заболевания почек

Это исследование было направлено на изучение влияния растворимого ActRIIA мыши, соединенного с Fc мыши через минимальный линкер (SEQ ID NO:54), на результат лечения мышиной модели хронической болезни почек и CKD-MBD, оцениваемый по параметрам крови и костной ткани.

Больные хроническим заболеванием почек (CKD) могут страдать анемией, а также иметь остеопению. Мыши с частичным удалением почек (5/6 нефрэктомия) были использованы в качестве модели CKD для тестирования действия полипептида с аминокислотной последовательностью SEQ ID NO:54 в этой модели. Мышам делали две хирургические операции: 1) полностью удаляли одну почку и 2) лигировали 2 из 3 почечных артерий в оставшейся почке. Ложнооперированных мышей включали также в качестве контроля. Ложные операции или 5/6 нефрэктомию выполняли в Jackson Laboratories.

После получения мышей их содержали на диете с высоким содержанием жиров в течение всего исследования. Через две недели после последнего хирургического вмешательства мышей делили на группы (либо ложнооперированные, либо с CKD) и начинали дозированное введение носителя (PBS) или mActRIIA-Fc в дозе 10 мг/кг два раза в неделю в течение 8 недель. Периодически во время исследования делали полный анализ крови (CBC) для оценки анемии.

Минеральную плотность костей определяли с помощью рентгеновской абсорбциометрии с двойной энергией (DEXA, PIXIMus). В заключение исследования проводили вскрытие для сбора длинных костей задних конечностей и основных органов. Остаток почки отправляли на гистологическое исследование и окрашивали H&E или трихромом. Бедренные кости сканировали с помощью uCT (Scanco) для определения микроархитектоники кости.

Мыши выглядели нормальными и здоровыми на протяжении периода исследования и прибавляли в весе по мере продвижения исследования (фигура 1). Минеральная плотность костной ткани увеличивалась во всех четырех группах мышей, но у мышей (ложнооперированных и с CKD), которых лечили mActRIIA-Fc, наблюдалось более высокое увеличение, чем у группы, получавшей носитель (фигура 2). При лечении mActRIIA-Fc к концу исследования мыши с CKD имели минеральную плотность кости, которая была равной или превышала плотность, имевшуюся у мышей c лечением SHAM-VEH. Мыши с CKD также начинали страдать анемией к концу исследования (НСТ <40%), но лечение mActRIIA-Fc предотвращало анемию в группе с CKD (HCT> 40%; фигура 3). Мыши, которых лечили mActRIIA-Fc в группе ложнооперированных, также продемонстрировали увеличение HCT по сравнению с контролями VEH. Анализ с помощью микроКТ бедренных костей после вскрытия показал увеличение губчатой кости у мышей, обработанных mActRIIA-Fc, но к этому времени не было существенных различий в прогрессии заболевания между группами ложнооперированных и с CKD, обработанными носителем. При вскрытии не наблюдалось существенных различий в массе органов, хотя мыши, обработанные mActRIIA-Fc, имели небольшое увеличение массы жировых тел. Окрашенные трихромом гистологические срезы остатка почки не указывали на широкое распространение фиброза у мышей с CKD в данный момент исследования.

6.3 Ингибирование mACTRIIA предотвращает анемию и потерю костной ткани в терапевтической модели установленного заболевания почек

Хирургическое удаление 5/6 почек у грызунов обычно выполняется по экспериментальному протоколу, используемому для моделирования хронического заболевания почек. При этой двухфазной хирургической операции 2/3 одной почки и всю почку на противоположной стороне удаляют с использованием асептических хирургических процедур. В результате хирургической операции у опытных животных нарушается функция почек, и они проявляют физиологическое поведение, аналогичное людям с хроническим заболеванием почек.

Ложную операцию или 5/6 нефрэктомию выполняли в Jackson Laboratories в соответствии со стандартными операционными процедурами. Животным давали оправиться от операции, а затем перевозили. Животные акклиматизировались к лабораторным условиям в течение как минимум 48 часов перед проведением первых измерений. В течение этого периода за всеми животными наблюдали относительно появления каких-либо признаков клинических нарушений, из-за которых они будет исключены из исследования. Животным был присвоен номер исследования на карточках их клеток, и их однозначно идентифицировали по насечке на ухе.

ActRIIA-mIgG2aFc разбавляли с использованием стерильного PBS до концентрации 2,0 мг/мл. Концентрация дозы составляла: 2,0 мг/мл. ActRIIA-mIgG2aFc хранили при -65°С±15°С, материал можно было оттаивать при комнатной температуре или в течение ночи при 4°С. Белок после оттаивания хранили на влажном льду до использования.

Тридцати самкам мышей C57BL/6 (возрастом 10 недель) была проведена хирургическая операция 5/6 нефрэктомии, при которой одну почка удаляли полностью со следующим через две недели лигированием 2 из 3 почечных вен оставшейся почки. Ложные операции выполняли также у тридцати самок C57BL/6, при которых животных подвергали той же брюшной хирургической процедуре без удаления почек. После восстановления после второй операции животных перевозили и давали акклиматизироваться в лабораторных условиях в течение как минимум 48 часов. Через два месяца после второй хирургической операции мышей рандомизировали в одну из четырех экспериментальных групп по 15 мышей на группу (таблица 2). Мышей взвешивали и вводили либо mActRIIA-Fc, либо PBS дважды в неделю в течение в общей сложности 8 недель. Измерения в разные промежутки времени минеральной плотности костной ткани (BMD) и гематологических параметров делали в начале исследования, промежуточной точке времени и в конце исследования. При вскрытии кости собирали и хранили для гистологического исследования или для анализа с помощью микроКТ сканирования.

Таблица 2
Группа N Мыши Диета Обработка Операция Концентрация Путь
1 15 C57BL/6 Корм PBS Ложная Объем п/к
2 15 C57BL/6 Корм mActRIIA-Fc Ложная 10 мг/кг п/к
3 15 C57BL/6 Корм PBS 5/6 нефрэкт. Объем п/к
4 15 C57BL/6 Корм mActRIIA-Fc 5/6 нефрэкт. 10 мг/кг п/к

(a) Экспериментальные процедуры

(i) Вариант хирургического вмешательства

Проводили двухстадийную хирургическую операцию самкам мышей C57BL/6 в возрасте 10 недель для достижения 5/6 нефрэктомии или эквивалентную ложную хирургическую операцию.

(ii) Схема введения лекарственной формы животным

Введение лекарственной формы в данном исследовании начинали через один месяц после завершения хирургической операции по 5/6 нефрэктомии. Мышей взвешивали и вводили либо PBS, либо mActRIIA-Fc в дозе 10 мг/кг два раза в неделю путем подкожной инъекции.

(iii) Сканирования DXA

Лонгитудинальные измерения BMD проводили ежемесячно у наркотизированных мышей с использованием сканирования DXA (Lunar PIXIMus, GE Medical Systems). Во время сканирующего DXA анализа BMD голову мыши исключали из интересующей области для предотвращения количественных артефактов, связанных с черепом.

(iv) Сбор крови

Лонгитудинальные измерения полного количества форменных элементов крови (Hm2, VetScan) делали в крови, собираемой ежемесячно при подчелюстном кровопускании. В конце исследования осуществляли последнее взятие крови, кровь собирали и разделяли либо в пробирке, содержащей ЭДТА, для анализа CBC, либо в пробирке для отделения сыворотки для сбора сыворотки. Сыворотку замораживали при -80°С для последующего анализа.

(v) Анализ сыворотки

Замороженную сыворотку размораживали и 100 мкл анализировали с помощью анализатора Vetscan VS2 (Abaxis, Inc.). Комплексный диагностический ротор использовали для анализа образцов на сывороточный альбумин (альбумин), щелочную фосфатазу (ALP), аланинаминотрансферазу (ALT), амилазу (AMY), общий билирубин (TBIL), азот мочевины крови (BUN), общий кальций (Са++), фосфор (PHOS), креатинин (CRE), глюкозу (GLU), натрий (Na+), калий (К+), общий белок (TP) и глобулин (GLOB).

(vi) Вскрытие

В заключение исследования мышей умерщвляли путем ингаляции CO2. Почки и селезенки удаляли, взвешивали и хранили в 10% формалине. Большие берцовые кости и бедренные кости собирали и хранили в 70% этаноле.

(vii) Анализ с помощью микроКТ

В конце эксперимента левые бедренную кость и большую берцовую кость от каждой мыши иссекали и фиксировали в 70% этаноле. Кости сканировали с помощью Scanco microCT (VivaCT75, Scanco) при 55 кВ, 145 микроА и размере воксела 20 микром. Отсканированные изображения реконструировали с использованием вложенного Scanco программного обеспечения. Объем губчатой кости (BV/TV) и толщину трабекулярной кости (Tb.Th) оценивали на срезах кости толщиной 400 микром, которые располагались на 200 микром дистальнее верхушки бедра. Толщину кортикального слоя измеряли на срезах кости толщиной 200 микром при центрировании по средней линии бедра.

(viii) Анализ данных

Сравнение между мышами, получавшими mActRIIA-Fc и носитель, и их тканями осуществляли с помощью критерия Стьюдента с использованием Microsoft Excel. Данные выражали в виде среднего значения ±SEM.

(b) Результаты

Изобретатели исследовали способность mActRIIA-Fc предотвращать анемию и потерю костной массы в мышиной модели хронического заболевания почек. После 2 месяцев прогрессии заболевания после хирургической операции по 5/6 нефрэктомии (день 0), у мышей с 5/6 нефрэктомией (CKD) наблюдалось значительное снижение гематокрита по сравнению с группами ложнооперированных (-5,4%, P<0,01). Лонгитудинальный отбор образцов крови и последующий анализ CBC показал, что через 4 и 8 недель лечения у мышей, получавших mActRIIA-Fc, в обеих группах, как с CKD, так и ложнооперированных, наблюдалось значительное увеличение гематокрита по сравнению с их аналогами, получавшими VEH (фигура 5).

После 2 месяцев прогрессии заболевания после хирургической операции по 5/6 нефрэктомии (день 0), у мышей с 5/6 нефрэктомией (CKD) наблюдалось значительное снижение BMD по сравнению с группами ложнооперированных (-5,4%, P<0,01). Через 6 недель лечения mActRIIA-Fc группы с ложной операцией и группы с CKD имели значительно более высокую BMD по сравнению с их аналогами, получавшими VEH (фигура 6).

В заключение исследования задние конечности собирали и фиксировали в 70% этаноле. Правую бедренную кость сканировали микроКТ (VivaCT 75, Scanco) для количественной оценки кортикальной и трабекулярной структуры костной ткани. На фигуре 7 показаны изображения поперечного сечения бедренных костей каждой экспериментальной группы. У нефрэктомированных мышей выявлено снижение толщины кортикального слоя, и отсутствие очевидных изменений в структуре трабекулярной кости.

Мыши, получавшие mActRIIA-Fc, характеризовались увеличением, как толщины кортикальной костной ткани, так и объема трабекулярной костной ткани. Анализы средней части бедренной кости использовали для количественной оценки средней толщины кортикальной костной ткани в каждой группе (фигура 8). Мыши с CKD имели более тонкий кортикальный слой, чем у их аналогов с ложной операцией, как в группе, получавшей VEH (P<0,01), так и в группе, получавшей mActRIIA-FC (P<0,01). Мыши, получавшие mActRIIA-Fc, характеризовались существенным увеличением толщины кортикального слоя в группах как ложнооперированных (+17%, P<0,01), так и с CKD (+19,2%, P<0,01) по сравнению с мышами соответствующих групп, получавшими VEH. Как свидетельствуют примеры изображений на фигуре 7, анализы дистального отдела бедренной кости выявили резкое увеличение объема и толщины губчатой кости у мышей, получавших mActRIIA-Fc. mActRIIA-Fc обладал способностью значительно увеличивать объем губчатой костной ткани (фигура 9) и толщину трабекулярной костной ткани (фигура 10) по сравнению с мышами, получавшими VEH, в группах как ложнооперированных, так и с CKD. Измерения объема губчатой костной ткани на 8-й неделе продемонстрировали, что мыши, получавшие mActRIIA-Fc, характеризовались существенным увеличением объема губчатой костной ткани в группах как ложнооперированных (+549%, Р<0,001), так и с CKD (+827%, Р<0,001), по сравнению с соответствующими группами мышей, получавших VEH. Измерения толщины губчатой костной ткани на 8-й неделе продемонстрировали, что мыши, получавшие mActRIIA-Fc, характеризовались существенным увеличением толщины губчатой костной ткани в группах с CKD (+62%, Р<0,001) по сравнению с соответствующими группами мышей, получавших VEH.

В конце при забое собирали цельную кровь у всех животных и обрабатывали для получения сыворотки. Образцы сыворотки анализировали с использованием анализатора Vetscan VS2 (Abaxis, Inc.) с использованием ротора с комплексным профилем. Средние значения для аналитов из каждой группы представлены в таблице 3. Сравнение контрольных групп ложнооперированных и с CKD, получавших носитель, показало увеличение азота мочевины крови (BUN) и креатинина (CRE), как и ожидалось в связи с нарушением функции почек. Кроме того, были увеличены уровни ALT и амилазы (AMY) у мышей с CKD из-за изменения функции почек или предположительно из-за изменения также функции печени после нефрэктомии. Уровни кальция (Ca++) и суммарной щелочной фосфатазы (ALP) также увеличивались, как и ожидалось в связи с увеличением оборота костной ткани. Лечение mActRIIA-Fc повышало уровни ALP как у ложнооперированных мышей, так и у мышей с CKD, из-за анаболических свойств препарата в отношении костной ткани. У мышей с CKD лечение mActRIIA-Fc вызывало снижение уровней альбумина (ALB), общего белка (TP) и CRE по сравнению с контролями CKD-VEH, но они не отличались от имеющихся у ложнооперированных мышей. Не думается, что эти изменения имеют отношение к модели или лечению в этот момент.

Таблица 3
SHAM VEH SHAM
mActRIIA-Fc
CKD VEH CKD mActRIIA-Fc
AMY Ед./л 865,45±39,41 803,38±66,06 1486,18±53,82 1418,42±36,68
TBIL мг/дл 0,25±0,02 0,23±0,02 0,23±0,01 0,27±0,01ū
BUN мг/дл 27,92±1,39 29,20±1,26 52,75±2,66 51,50±2,10
CA++ мг/дл 10,18±0,16 10,38±0,12 11,00±,13 11,33±0,13
PHOS мг/дл 8,58±0,17 8,96±0,28 8,28±0,36 7,96±0,26
CRE мг/дл 0,33±0,05 0,40±0,05 0,44±0,05 0,31±0,02ū
GLU мг/дл 198,50±6,52 260,90±28,79* 223,67±13,53 260,86±14,98
NA+ ммоль/л 156,50±0,77 157,60±0,73 158,58±2,37 155,64±0,34
K+ ммоль/л 7,65±0,14 7,85±0,15 7,98±0,14 7,77±0,13
TP г/дл 5,66±0,05 5,42±0,057* 5,73±0,08 5,47±0,07ū
GLOB г/дл 1,79±0,08 1,67±0,06 1,73±0,07 1,97±0,06ū
*=р<0,05 по сравнению с ложнооперированными, получавшими VEH; ++=р<0,05 по сравнению с мышами с CKD, получавшими VEH

(с) Выводы

Лечение mActRIIA-Fc способно предотвратить анемию и потерю костной массы в модели 5/6 нефрэктомии как хронического заболевания почек. У мышей с CKD наблюдалась анемия, они имели более низкую BMD и более тонкую структуру кортикального слоя бедренной кости по сравнению с ложнооперированным контролем. Лечение мышей с CKD с помощью mActRIIA-Fc существенно увеличивало гематокрит, BMD и структуру кортикального слоя костной ткани по сравнению с мышами, получавшими VEH. Кроме того, лечение mActRIIA-Fc способно увеличить объем трабекулярной костной ткани и толщину трабекулярной кости у мышей с CKD до величин, более высоких, чем у мышей, получавших VEH, в группах как ложнооперированных, так и с CKD. Эти данные показывают, что блокирование сигнализации рецептора активина типа IIA в результате введения mActRIIA-Fc может предотвратить анемию и потерю костной массы при 5/6 нефрэктомии как модели хронического заболевания почек.

6.4 Прогнозирующий пример ингибирования mACTRIIA для лечения адинамического заболевания костной ткани в контексте CDK

У мышей проводили электрокоагуляцию одной почки и нефрэктомию другой почки. Мышей кормили кормом с низким содержанием фосфата, с добавлением кальцитриола. Смотри, например, Lund et al., 2004, J Am Soc Nephrol 15:349-369.

Это исследование направлено на изучение влияния растворимого ActRIIA мыши, который соединен с Fc мыши через минимальный линкер (SEQ ID NO:54), на нормализацию параметров крови и костной ткани в мышиной модели адинамического заболевания костной ткани.

Мышей с электрокоагуляцией одной почки и нефрэктомией другой почки использовали в качестве модели адинамического заболевания костной ткани при CKD («ADB») для тестирования действия полипептида с аминокислотной последовательностью SEQ ID NO:54 в этой модели. Мышам делали две хирургических операции: 1) полного удаления одной почки и 2) электрокоагуляции другой почки. Ложнооперированных мышей также включали в качестве контролей. Хирургические операции могут быть проведены, как описано Lund et al., 2004, J Am Soc Nephrol 15:349-369.

Одна группа мышей получала корм с низким содержанием фосфатов с добавлением кальцитриола. Другая группа мышей получала нормальный корм. Через две недели после последней хирургической операции мышей делили на группы (как ложнооперированных, так и ADB) и начинали введение носителя (PBS) или mActRIIA-Fc в дозе 10 мг/кг два раза в неделю в течение 8 недель. Полный анализ крови (CBC) делали периодически в ходе исследования для оценки анемии.

Минеральную плотность костей определяли с использованием рентгеновской абсорбциометрии с двойной энергией (DEXA, PIXIMus). В заключении исследования проводили вскрытие для сбора длинных костей задних конечностей и основных органов. Остаток почки посылали для проведения гистологического исследования и окрашивания H&E или трихромом. Бедренные кости сканировали uCT (Scanco) для определения микроархитектоники кости. Количественная компьютерная томография (QCT) также может быть использована для определения оборота костной ткани.

6.5 Влияние ингибирования ACTRIIA на кальцификацию сосудов

В этом примере показано, что ингибирование ACTRIIA является эффективным для снижения уровня кальция в сосудистой сети индивидуумов, и, таким образом, представляет собой средство для лечения кальцификации сосудов.

Стадию 3 хронического заболевания почек (CKD) вызывали у 14-недельных мышей ldlr-/- (линия С57В1/6J; Jackson Laboratory), которых кормили диетой с высоким содержанием жиров («мыши c CKD»). Рецептор липопротеидов низкой плотности (LDLR), как известно, вовлечен в клиренс липидов, и мыши, нокаутные по ldlr, представляют собой модель атеросклероза. У мышей с дефицитом ldlr, которых кормят диетой с высоким содержанием жиров/холестерина, развивается атеросклероз и бляшки в аорте, связанные с кальцификацией, что стимулируется CKD, вызванной удалением почек. CKD индуцировали у мышей ldlr-/- путем 5/6 нефрэктомии (смотри выше). Как описано выше, 5/6 нефрэктомия включает полное удаление одной почки с последующим лигированием 2 из 3 почечных вен в оставшейся почке.

Через 22 недели у мышей с CKD была выявлена кальцификация сосудов, что подтверждено химическим количественным определением кальцификации. Вкратце, при вскрытии у мышей извлекают сердца и аорты, и все посторонние ткани удаляют тупым отделением под препаровальной лупой. Ткани обезвоживают в течение 20-24 часов при 55°С, взвешивают и измельчают в порошок в ступке с помощью пестика. Кальций элюируют 10% муравьиной кислотой (10:1 об./масс.) в течение 24 часов при 4°С. Содержание кальция в элюате анализируют с использованием метода крезолфталеин-комплексона (Sigma, St Louis) в соответствии с инструкциями производителя, и результаты корректируют на массу сухой ткани.

Мыши с CKD были разделены на две экспериментальные группы (i) мыши, получавшие mActRIIA-Fc; и (ii) мыши, получавшие CKD-3-носитель, которым вводили только часть носителя из композиции mActRIIA-Fc (т.е. мышам вводили композицию физиологического раствора без mActRIIA-Fc). Мышам, получавшим mActRIIA-Fc (n=5), вводили 10 мг/кг mActRIIA-Fc два раза в неделю в течение 6 недель. Мышам, получавшим CKD-3-носитель (n=6; носитель=физиологический раствор), вводили только носитель в те же дни, что и дни введения mActRIIA-Fc мышам, получавшим mActRIIA-Fc. В качестве отрицательных контролей использовали мышей дикого типа (n=6; линия С57В1/6J) и ложнооперированных мышей (n=8; линия С57В1/6J). Ложнооперированные мыши представляли собой мышей ldlr-/-, которые были прооперированы, но у которых не индуцировано CKD (например, не была проведена нефрэктомия). Всех мышей забивали на 28-й неделе для оценки уровней кальция аорты в каждой из четырех экспериментальных групп (получавших CKD-3-носитель; получавших mActRIIA-Fc-; ложнооперированных и дикого типа).

В таблице 4 ниже предоставлены уровни кальция аорты, выявляемые у каждой мыши, используемой в исследовании (колонка 2), а также средние уровни кальция для каждой из экспериментальных групп - ложнооперированных, получавших CKD-3-носитель, получавших mActRIIA-Fc, и мышей дикого типа (колонка 3). Результаты представлены в виде графика на фигуре 11. Как продемонстрировано с помощью этих данных, очевидное уменьшение кальция аорты наблюдалось у мышей, принадлежащих к группе, получавшей mActRIIA-Fc, по сравнению с группой, получавшей носитель. У 4 из 5 мышей с CKD, получавших mActRIIA-Fc, уровни кальция аорты были сравнимы с уровнями, наблюдаемыми в двух группах отрицательного контроля (мышей дикого типа и ложнооперированных мышей).

Повышенные уровни кальция сосудов (например, артерий), как известно, связаны с кальцификацией сосудов (смотри, например, Raggi P et al., Clin J Am Soc Nephrol 2008; 3: 836-843). Таким образом, приведенные выше результаты показывают, что ингибирование ActRIIA представляет собой подходящий подход к лечению и профилактике кальцификации сосудов.

Таблица 4
Уровни кальция аорты
Экспериментальная группа Конкретные уровни Ca2+ у индивидуума (мг/г) Средний Ca2+ мг/г
Дикий тип (n=6) 0,25, 0,11, 0,26,
0,36, 0,31, 0,35
0,27±0,09
Ложнооперированные (n=8) 0,28, 0,18, 0,24, 0,16,
0,13, 0,25, 0,26, 0,27
0,22±0,06
CKD-3-носитель (n=6) 0,58, 0,17, 0,51,
0,56, 0,31, 0,99
0,52±0,28
mActRIIA-Fc (n=5) 0,83, 0,28, 0,19,
0,13, 0,04
0,29±0,31

6.6 Влияние ингибирования ACTRIIA на кальцификацию сосудов

В этом примере описывается исследование влияния ингибирования ActRII на кальцификацию сосудов у индивидуумов с хроническим заболеванием почек.

Может быть использована мышиная модель раннего CKD-MBD, описанная в предыдущих примерах. В этой модели к удалению почек добавляется генетический дефицит рецептора LDR, ldlr, и мыши находятся на диете с высоким содержанием жиров и с высоким содержанием холестерина. На стадии 3 CKD животные характеризуются индуцированной CKD стимуляцией кальцификации сосудов, уменьшением формирования костной ткани, повышенными уровнями FGF23, гиперфосфатемией и повышенными уровнями ПТГ.

(a) Материалы и методы

Животные и диеты: мыши без рецептора LDL (LDLR-/-) линии С57В1/6J или мыши С57В1/6J дикого типа могут приобретаться в Jackson Laboratory (Bar Harbor, Maine) и разводиться в беспатогенной среде. Животные могут быть на три недели отлучены от диеты с кормом, имеющим 6,75% калорий в виде жира. К 10 неделе некоторые животные могут быть переведены на диету с высоким уровнем холестерина (0,15%), имеющей 42% калорий в виде жира (Harlan Teklad, Madison WI, Product No. TD88137), диету, которая, как показано, вызывает атеросклероз с кальцификацией сосудов на этом генетическом фоне (смотри, например, Towler et al., 1998, J Biol Chem 273:30427-30434). Содержание кальция во всех диетах может составлять 0,6%. Животным может быть предоставлен доступ к воде ad libitum, и они содержатся в соответствии с местными и национальными руководствами по уходу за животными. mActRIIA-Fc можно вводить в/бр (10 мг/кг) два раза в неделю.

Хирургические процедуры: процедура в две стадии может быть использована для создания CKD, как описано ранее (смотри, например, Davies et al., 2003, J Am Soc Nephrol 14:1559-1567; и Davies et al., 2005, J Am Soc Nephrol 16:917-928). Вкратце, электрокоагуляция может быть применена в отношении правой почки через 2 см боковой разрез на 10 неделе постнатальной жизни с последующей полной левосторонней нефрэктомией через аналогичный разрез через 2 недели. Контрольным животным можно проводить ложные операции, при которых соответствующая почка подвергается экспозиции и мобилизации, но никаким другим способом не обрабатывается. Внутрибрюшинная анестезия (ксилазин 13 мг/кг и кетамин 87 мг/кг) может быть использована для всех процедур. Образцы крови подкожной вены ноги могут быть взяты через 1 неделю после второй операции для оценки базовой функции почек после хирургического вмешательства. Животные могут быть забиты под наркозом через 20 недель или 26 недель в зависимости от группы после взятия крови путем внутрисердечной пункции. Сердце и аорта могут быть выделены en bloc.

Приготовление тканей: образцы после резекции могут быть зафиксированы в формалине и затем разделены следующим образом: сердце, восходящая часть аорты и дуга аорты могут быть отделены от нисходящей части аорты и сагиттально разделены пополам через выходной тракт аорты. Нисходящая часть аорты может быть разделена пополам коронарно, приблизительно на середине ее длины. Все четыре фрагмента могут быть заключены в один и тот же парафиновый блок. Могут быть нарезаны срезы (толщиной 5 мкм) и окрашены гематоксилином и эозином, трихромом, ализариновым красным и методом фон Косса.

Иммуногистохимия: Срезы ткани могут быть получены, как описано выше, депарафинизированы в ксилоле и ступенчато регидратированы в линейке этанолов. Эндогенная активность пероксидазы может быть заблокирована путем инкубации в 3% перекиси водорода (Sigma, St Louis MO), и неспецифическое связывание может быть заблокировано с помощью 10-минутной инкубации с фирменным раствором казеина в PBS («Background SNIPER», BioCare Medical, Walnut Creek CA). Демаскировка антигена может быть осуществлена с помощью 5-минутной инкубации с цитратным буфером («Decloaker» BioCare Medical, Walnut Creek CA) при 100°С. Срезы могут быть проинкубированы с аффинно-очищенными поликлональными антителами козы против остеокальцина (ОС) мыши (Biogenesis Inc, Brentwood NH) в течение ночи, затем проинкубированы с биотинилированными вторичными антителами мыши против Ig козы в течение 10 минут перед окрашиванием комплексом стрептавидин-конъюгированная пероксидаза (все реагенты, BioCare Medical, Walnut Creek CA), и подкрашены 0,1% гематоксилином (Sigma).

ОТ-ПЦР: РНК может быть проэкстрагирована из образцов ткани с использованием набора RNAqueous-4PCR (Ambion) в соответствии с инструкциями производителя. ОТ-ПЦР может быть выполнена с использованием набора для одностадийной ОТ-ПЦР (Qiagen, Valencia CA) в соответствии с инструкциями производителя. Условия могут представлять собой: 50°С в течение 30 мин, 95°С в течение 15 мин, затем 35-40 циклов при 94°С в течение 1 мин, 60°C в течение 1 мин и 72°С в течение 1 мин, затем 72°С в течение 10 мин. Могут быть выбраны праймеры, специфичные для остеокальцина мыши и GAPDH мыши.

Количественная оценка химической кальцификации: Сердца и аорты могут быть извлечены при забое, и все посторонние ткани удалены тупым отделением под препаровальной лупой. Ткани могут быть обезвожены в течение 20-24 часов при 55°С, взвешены и измельчены в порошок в ступке с помощью пестика. Кальций может быть проэлюирован 10% муравьиной кислотой (10:1 об./масс.) в течение 24 часов при 4°С. Содержание кальция в элюате может быть оценено с использованием метода крезолфталеин-комплексона (Sigma, St Louis) в соответствии с инструкциями производителя, и результаты могут быть скорректированы на массу сухой ткани.

Гистоморфометрия костей: скорость образования кости может быть определена с помощью двойной флуоресцентной метки. Все мыши могут получать внутрибрюшинно кальцеин (20 мг/кг) за 7 дней и 2 дня до забоя. Обе бедренные кости могут быть отпрепарированы во время забоя животных, и помещены в 70% этанол. Образцы могут быть имплантированы недекальцифицированными в пластиковый набор для заключения H7000 (Energy Beam Sciences). Срезы костей могут быть сделаны в продольном направлении через фронтальную плоскость с толщиной срезов 10 мкм на микротоме JB-4 (Energy Beam Sciences). Неокрашенные срезы могут быть использованы для флуоресцентного анализа с кальцеиновой меткой. Срезы могут быть проанализированы при увеличении X400 под микроскопом Leitz, соединенным с анализатором визуализации остеометрии (Osteometries, Atlanta GA). Десять смежных полей по 0,0225 мм2 дистального отдела бедренной кости 150 мкм проксимальнее ростовой пластины могут быть рассмотрены на животное.

Измерения паратиреоидного гормона и биохимических показателей сыворотки: Образцы крови могут быть получены через 2 и 8 недель CKD с помощью аспирации подкожной вены ноги капиллярной трубочкой и с помощью другой процедуры (внутрисердечной пункции) в момент забоя (12 недель CKD) и перенесены в гепаринизированные пробирки. После центрифугирования (400X g в течение 5 минут) плазма может быть отделена, разделена на аликвоты и заморожена при -80°С. Уровни интактного ПТГ (в крови, полученной только при забое, из-за необходимого объема крови) могут быть измерены иммунорадиометрическим методом (IRMA) с двойными антителами, с использованием коммерчески доступного набора (Immutopics, San Clemente, CA). Азот мочевины крови (BUN), сывороточный кальций и фосфор могут быть измерены стандартными методами с использованием многоканального анализатора.

Измерения FGF23: Набор для ELISA анализа FGF23 мыши может быть приобретен у компании KaiNO.

Измерения DKKl и остеокальцина: могут быть использованы коммерческие наборы для ELISA анализа DKK1 и не полностью карбоксилированного остеокальцина.

Измерения OPG и sRANKL: Отношение OPG к RANKL может быть определено с помощью анализов в сыворотке. Эти анализы продемонстрировали хорошую корреляцию с оборотом костной ткани и избытком резорбции костной ткани (смотри, например, Geusens et al., 2006, Arthritis & Rheumatism 54:1772-17775). Уровни sRANKL в сыворотке могут быть определены с помощью радиоиммуноанализа (Linco Research, St. Louis MO). Уровни сывороточного OPG могут быть измерены с помощью метода ELISA (OSTEOmedical NL, Marishof, NL). Коэффициенты вариации (CV) внутри анализа и между анализами составляли менее 10% для обоих тестов, что соответствует приводимым производителями. Предел определения для sRANKL составлял 0,08 пмоль/л и для OPG 0,14 пмоль/л.

Измерение маркеров оборота костной ткани: Сывороточные P1NP и остеокальцин могут быть использованы в качестве маркеров активности остеобластов, и форма 5b устойчивой к тартрату кислой фосфатазы (TRACP 5b) (mouseTRAP, IDS Ltd, Bolden, UK) может быть использована в качестве маркера уровней остеокластов.

Измерение маркеров воспаления: Анализы сыворотки на TNF-альфа и С-реактивный белок могут быть использованы для прослеживания уровней воспаления и ответа на mActPIIA-Fc.

Статистический анализ: Данные могут быть проанализированы на статистическую значимость (P<0,05) с использованием дисперсионного анализа ANOVA. Сравнение может быть сделано между животными, получавшими носитель (контрольная группа), и животными, получавшими mActRIIA-Fc. Сравнение также может быть сделано между ложнооперированными мышами и мышами с CKD, получавшими носитель и mActPIIA-Fc. Эти анализы могут быть осуществлены с использованием статистического пакета SPSS 11.0 (Needham Heights, MA).

(b) Параметры исследования

Мыши, используемые в исследовании, могут быть распределены в одну из восьми групп, как показано в таблице 5 ниже.

Таблица 5
Группа Описание группы # Животных
A Дикий тип 10
B LDLR, диета с высоким содержанием жиров/CKD, получавшие носитель, забой на 22 нед. 10
C LDLR, диета с высоким содержанием жиров/CKD, получавшие RAP-011, забой на 22 нед. 10
D LDLR, диета с высоким содержанием жиров/CKD, получавшие носитель, забой на 28 нед. 10
E LDLR, диета с высоким содержанием жиров/CKD, получавшие RAP-011, забой на 28 нед. 10
F LDLR, диета с высоким содержанием жиров/ложная операция, забой на 28 нед. 10
G LDLR, диета с высоким содержанием жиров/ложная операция, забой на 20 нед. 10
H LDLR, диета с высоким содержанием жиров/CKD, забой на 14 нед. 10

Одна группа животных (группа H в таблице 5) может быть забита на 14 неделе для измерения исходной кальцификации сосудов и гистоморфометрии на момент начала терапии. Группы С и Е могут быть использованы для оценки эффективности лечения mActRIIA-Fc по сравнению с группами, получавшими носитель (группами В и D), в течение различных периодов CKD. Группы F и G являются соответствующими по возрасту ложнооперированными животными, получавшими корм с высоким содержанием жиров, которые могут быть использованы в качестве контроля относительно действия CKD. Размеры группы составляют по 10 животных в каждой группе после рандомизации в экспериментальные группы, что может быть достаточным для получения статистической значимости.

На 16-18 неделе может быть измерена скорость клубочковой фильтрации (СКФ) с помощью инъекции инулина мышам и измерения его исчезновения. При забое кровь может быть получена при внутрисердечной пункции, и могут быть определены уровни DKK1, FGF23, остеокальцина, паратгормона и кальцитриола в сыворотке наряду с сывороточным кальцием, Pi, азотом мочевины крови (BUN), глюкозой и уровнем холестерина.

Могут быть проанализированы аорты животных ldlr-/- с CKD, получавших корм с высоким содержанием жиров. Могут быть получены суммарные уровни кальция аорты и микроскопические срезы, окрашенные методом фон Косса. Аорты могут быть обработаны для получения РНК для анализа экспрессии генов аорты. Аорты могут быть обработаны для иммуногистохимии. На 22 неделе в модели CKD, описанной выше, во время забоя групп B и C, выявлена кальцификация сосудов и присутствует адинамическое нарушение костной ткани, несмотря на вторичный гиперпаратиреоз. Между 22 и 28 неделями, кальцификация сосудов прогрессирует и за счет эффектов присутствия паратгормона начинают увеличиваться поверхности остеобластов.

Эксперимент, описанный в этом примере, может быть использован для определения влияния ингибирования ActRII на кальцификацию сосудов, скорости оборота костной ткани и вторичный гиперпаратиреоз, наблюдаемый у индивидуумов с CKD.

Таблица 6
Информация о последовательностях
Описание последовательности
SEQ ID NO: Описание Последовательность
1 Предшественник полипептида ActRIIA человека MGAAAKLAFAVFLISCSSGAILGRSETQECLFFNANWEKDRTNQTGVEPC YGDKDKRRHCFATWKNISGSIEIVKQGCWLDDINCYDRTDCVEKKDSPEV YFCCCEGNMCNEKFSYFPEMEVTQPTSNPVTPKPPYYNILLYSLVPLMLI AGIVICAFWVYRHHKMAYPPVLVPTQDPGPPPPSPLLGLKPLQLLEVKAR GRFGCVWKAQLLNEYVAVKIFPIQDKQSWQNEYEVYSLPGMKHENILQFI GAEKRGTSVDVDLWLITAFHEKGSLSDFLKANVVSWNELCHIAETMARGL AYLHEDIPGLKDGHKPAISHRDIKSKNVLLKNNLTACIADFGLALKFEAG KSAGDTHGQVGTRRYMAPEVLEGAINFQRDAFLRIDMYAMGLVLWELASR CTAADGPVDEYMLPFEEEIGQHPSLEDMQEVVVHKKKRPVLRDYWQKHAG MAMLCETIEECWDHDAEARLSAGCVGERITQMQRLTNIITTEDIVTVVTM VTNVDFPPKESSL
2 Последовательность растворимого (внеклеточного) полипептида ActRIIA человека после процессинга ILGRSETQECLFFNANWEKDRTNQTGVEPCYGDKDKRRHCFATWKNISGS IEIVKQGCWLDDINCYDRTDCVEKKDSPEVYFCCCEGNMCNEKFSYFPEM EVTQPTSNPVTPKPP
3 Последовательность растворимого (внеклеточного) полипептида ActRIIA человека после процессинга с делецией 15 аминокислот с С-конца ILGRSETQECLFFNANWEKDRTNQTGVEPCYGDKDKRRHCFATWKNISGS IEIVKQGCWLDDINCYDRTDCVEKKDSPEVYFCCCEGNMCNEKFSYFPEM
4 Последовательность нуклеиновой кислоты, кодирующая белок-предшественник ActRIIA человека ATGGGAGCTGCTGCAAAGTTGGCGTTTGCCGTCTTTCTTATCTCCTGTTC TTCAGGTGCTATACTTGGTAGATCAGAAACTCAGGAGTGTCTTTTCTTTA ATGCTAATTGGGAAAAAGACAGAACCAATCAAACTGGTGTTGAACCGTGT TATGGTGACAAAGATAAACGGCGGCATTGTTTTGCTACCTGGAAGAATAT TTCTGGTTCCATTGAAATAGTGAAACAAGGTTGTTGGCTGGATGATATCA ACTGCTATGACAGGACTGATTGTGTAGAAAAAAAAGACAGCCCTGAAGTA TATTTTTGTTGCTGTGAGGGCAATATGTGTAATGAAAAGTTTTCTTATTT TCCAGAGATGGAAGTCACACAGCCCACTTCAAATCCAGTTACACCTAAGC CACCCTATTACAACATCCTGCTCTATTCCTTGGTGCCACTTATGTTAATT GCGGGGATTGTCATTTGTGCATTTTGGGTGTACAGGCATCACAAGATGGC CTACCCTCCTGTACTTGTTCCAACTCAAGACCCAGGACCACCCCCACCTT CTCCATTACTAGGGTTGAAACCACTGCAGTTATTAGAAGTGAAAGCAAGG GGAAGATTTGGTTGTGTCTGGAAAGCCCAGTTGCTTAACGAATATGTGGC TGTCAAAATATTTCCAATACAGGACAAACAGTCATGGCAAAATGAATACG AAGTCTACAGTTTGCCTGGAATGAAGCATGAGAACATATTACAGTTCATT GGTGCAGAAAAACGAGGCACCAGTGTTGATGTGGATCTTTGGCTGATCAC AGCATTTCATGAAAAGGGTTCACTATCAGACTTTCTTAAGGCTAATGTGG TCTCTTGGAATGAACTGTGTCATATTGCAGAAACCATGGCTAGAGGATTG GCATATTTACATGAGGATATACCTGGCCTAAAAGATGGCCACAAACCTGC CATATCTCACAGGGACATCAAAAGTAAAAATGTGCTGTTGAAAAACAACC TGACAGCTTGCATTGCTGACTTTGGGTTGGCCTTAAAATTTGAGGCTGGC AAGTCTGCAGGCGATACCCATGGACAGGTTGGTACCCGGAGGTACATGGC TCCAGAGGTATTAGAGGGTGCTATAAACTTCGAAAGGGATGCATTTTTGA GGATAGATATGTATGCCATGGGATTAGTCCTATGGGAACTGGCTTCTCGC TGTACTGCTGCAGATGGACCTGTAGATGAATACATGTTGCCATTTGAGGA GGAAATTGGCCAGCATCCATCTCTTGAAGACATGCAGGAAGTTGTTGTGC ATAAAAAAAAGAGGCCTGTTTTAAGAGATTATTGGCAGAAACATGCTGGA ATGGCAATGCTCTGTGAAACCATTGAAGAATGTTGGGATCACGACGCAGA AGCCAGGTTATCAGCTGGATGTGTAGGTGAAAGAATTACCCAGATGCAGA GACTAACAAATATTATTACCACAGAGGACATTGTAACAGTGGTCACAATG GTGACAAATGTTGACTTTCCTCCCAAAGAATCTAGTCTATGA
5 Последовательность нуклеиновой кислоты, кодирующая растворимый (внеклеточный) полипептид ActRIIA человека ATACTTGGTAGATCAGAAACTCAGGAGTGTCTTTTCTTTAATGCTAATTG GGAAAAAGACAGAACCAATCAAACTGGTGTTGAACCGTGTTATGGTGACA AAGATAAACGGCGGCATTGTTTTGCTACCTGGAAGAATATTTCTGGTTCC ATTGAAATAGTGAAACAAGGTTGTTGGCTGGATGATATCAACTGCTATGA CAGGACTGATTGTGTAGAAAAAAAAGACAGCCCTGAAGTATATTTTTGTT GCTGTGAGGGCAATATGTGTAATGAAAAGTTTTCTTATTTTCCAGAGATG GAAGTCACACAGCCCACTTCAAATCCAGTTACACCTAAGCCACCC
6 Гибридный белок, включающий растворимый внеклеточный домен ActRIIA, соединенный с доменом Fc THTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVD(A)VSHE DPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEY KCK(A)VSNKALPVPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLT CLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGPFFLYSKLTVDKSR WQQGNVFSCSVMHEALHN(A)HYTQKSLSLSPGK*
7 Внеклеточный домен ActRIIA человека, соединенный с доменом Fc человека ILGRSETQECLFFNANWEKDRTNQTGVEPCYGDKDKRRHCFATWKNISGS IEIVKQGCWLDDINCYDRTDCVEKKDSPEVYFCCCEGNMCNEKFSYFPEM EVTQPTSNPVTPKPPTGGGTHTCPPCPAPELLGGPSVFLFPPKPKDTLMI SRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVV SVLTVLHQDWLNGKEYKCKVSNKALPVPIEKTISKAKGQPREPQVYTLPP SREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGS FFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK
8 Лидирующая последовательность меллитина медоносной пчелы (NBML) MKFLVNVALVFMVVYISYIYA
9 Лидирующая последовательность активатора тканевого плазминогена (TPA) MDAMKRGLCCVLLLCGAVFVSP
10 Природная лидирующая последовательность ActRIIA MGAAAKLAFAVFLISCSSGA
11 N-концевая последовательность ActRIIa-hFc и ActRIIa-mFc ILGRSETQE
12 Белок ActRIIa-Fc с делецией 15 аминокислот с С-конца внеклеточного домена ActRIIA ILGRSETQECLFFNANWEKDRTNQTGVEPCYGDKDKRRHCFATWKNISGS IEIVKQGCWLDDINCYDRTDCVEKKDSPEVYFCCCEGNMCNEKFSYFPEM TGGGTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSH EDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKE YKCKVSNKALPVPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLTCL VKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQ QGNVFSCSVMHEALHNHYTQKSLSLSPGK
13 Лидирующая последовательность ActRIIA-hFc до процессинга MDAMKRGLCCVLLLCGAVFVSPGAAILGRSETQECLFFNANWEKDRTNQT GVEPCYGDKDKRRHCFATWKNISGSIEIVKQGCWLDDINCYDRTDCVEKK DSPEVYFCCCEGNMCNEKFSYFPEMEVTQPTSNPVTPKPPTGGGTHTCPP CPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWY VDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKAL PVPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIA VEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVM HEALHNHYTQKSLSLSPGK
14 Последовательность нуклеиновой кислоты, кодирующая ActRIIA-hFc с лидирующей последовательностью TPA до процессинга ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGC AGTCTTCGTTTCGCCCGGCGCCGCTATACTTGGTAGATCAGAAACTCAGG AGTGTCTTTTTTTAATGCTAATTGGGAAAAAGACAGAACCAATCAAACTG GTGTTGAACCGTGTTATGGTGACAAAGATAAACGGCGGCATTGTTTTGCT ACCTGGAAGAATATTTCTGGTTCCATTGAATAGTGAAACAAGGTTGTTGG CTGGATGATATCAACTGCTATGACAGGACTGATTGTGTAGAAAAAAAAGA CAGCCCTGAAGTATATTTCTGTTGCTGTGAGGGCAATATGTGTAATGAAA AGTTTTCTTATTTTCCGGAGATGGAAGTCACACAGCCCACTTCAAATCCA GTTACACCTAAGCCACCCACCGGTGGTGGAACTCACACATGCCCACCGTG CCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAA AACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTG GTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGT GGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGT ACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGAC TGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCC AGTCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAAC CACAGGTGTACACCCTGCCCCCATCCCGGGAGGAGATGACCAAGAACCAG GTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGT GGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTC CCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTATAGCAAGCTCACCGTG GACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCA TGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGG GTAAATGAGAATTC
15 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга с делецией 6 аминокислот с N-конца домена EC и делецией 4 аминокислот с С-конца домена EC (аминокислоты 25-130 SEQ ID NO:28) и с мутацией L79D ETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSGTIELV KKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPEAGGP
EVTYEPPP
16 Предшественник последовательности белка ActRIIB человека (A64) MTAPWVALALLWGSLW PGSGRGEAETRECIYY NANWELERTNQSGLER CEGEQDKRLHCYASWA NSSGTIELVKKGCWLD DFNCYDRQECVATEEN PQVYFCCCEGNFCNER FTHLPEAGGPEVTYEP PPTAPTLLTVLAYSLL PIGGLSLIVLLAFWMY RHRKPPYGHVDIHEDP GPPPPSPLVGLKPLQL LEIKARGRFGCVWKAQ LMNDFVAVKIFPLQDK QSWQSEREIFSTPGMK HENLLQFIAAEKRGSN LEVELWLITAFHDKGS LTDYLKGNIITWNELC HVAETMSRGLSYLHED VPWCRGEGHKPSIAHR DFKSKNVLLKSDLTAV LADFGLAVRFEPGKPP GDTHGQVGTRRYMAPE VLEGAINFQRDAFLRI DMYAMGLVLWELVSRC KAADGPVDEYMLPFEE EIGQHPSLEELQEVVV HKKMRPTIKDHWLKHP GLAQLCVTIEECWDHD AEARLSAGCVEERVSL IRRSVNGTTSDCLVSL VTSVTNVDLPPKESSI
17 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга (аминокислоты 19-134 SEQ ID NO:16) SGRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWANSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPT
18 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга с делецией 15 аминокислот с С-конца (аминокислоты 19-119 SEQ ID NO:16) SGRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWANSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE A
19 Последовательность нуклеиновой кислоты, кодирующая белок-предшественник ActRIIB (A64) человека ATGACGGCGCCCTGGGTGGCCCTCGCCCTCCTCTGGGGATCGCTGTGGCC CGGCTCTGGGCGTGGGGAGGCTGAGACACGGGAGTGCATCTACTACAACG CCAACTGGGAGCTGGAGCGCACCAACCAGAGCGGCCTGGAGCGCTGCGAA GGCGAGCAGGACAAGCGGCTGCACTGCTACGCCTCCTGGGCCAACAGCTC TGGCACCATCGAGCTCGTGAAGAAGGGCTGCTGGCTAGATGACTTCAACT GCTACGATAGGCAGGAGTGTGTGGCCACTGAGGAGAACCCCCAGGTGTAC TTCTGCTGCTGTGAAGGCAACTTCTGCAACGAGCGCTTCACTCATTTGCC AGAGGCTGGGGGCCCGGAAGTCACGTACGAGCCACCCCCGACAGCCCCCA CCCTGCTCACGGTGCTGGCCTACTCACTGCTGCCCATCGGGGGCCTTTCC CTCATCGTCCTGCTGGCCTTTTGGATGTACCGGCATCGCAAGCCCCCCTA CGGTCATGTGGACATCCATGAGGACCCTGGGCCTCCACCACCATCCCCTC TGGTGGGCCTGAAGCCACTGCAGCTGCTGGAGATCAAGGCTCGGGGGCGC TTTGGCTGTGTCTGGAAGGCCCAGCTCATGAATGACTTTGTAGCTGTCAA GATCTTCCCACTCCAGGACAAGCAGTCGTGGCAGAGTGAACGGGAGATCT TCAGCACACCTGGCATGAAGCACGAGAACCTGCTACAGTTCATTGCTGCC GAGAAGCGAGGCTCCAACCTCGAAGTAGAGCTGTGGCTCATCACGGCCTT CCATGACAAGGGCTCCCTCACGGATTACCTCAAGGGGAACATCATCACAT GGAACGAACTGTGTCATGTAGCAGAGACGATGTCACGAGGCCTCTCATAC CTGCATGAGGATGTGCCCTGGTGCCGTGGCGAGGGCCACAAGCCGTCTAT TGCCCACAGGGACTTTAAAAGTAAGAATGTATTGCTGAAGAGCGACCTCA CAGCCGTGCTGGCTGACTTTGGCTTGGCTGTTCGATTTGAGCCAGGGAAA CCTCCAGGGGACACCCACGGACAGGTAGGCACGAGACGGTACATGGCTCC TGAGGTGCTCGAGGGAGCCATCAACTTCCAGAGAGATGCCTTCCTGCGCA TTGACATGTATGCCATGGGGTTGGTGCTGTGGGAGCTTGTGTCTCGCTGC AAGGCTGCAGACGGACCCGTGGATGAGTACATGCTGCCCTTTGAGGAAGA GATTGGCCAGCACCCTTCGTTGGAGGAGCTGCAGGAGGTGGTGGTGCACA AGAAGATGAGGCCCACCATTAAAGATCACTGGTTGAAACACCCGGGCCTG GCCCAGCTTTGTGTGACCATCGAGGAGTGCTGGGACCATGATGCAGAGGC TCGCTTGTCCGCGGGCTGTGTGGAGGAGCGGGTGTCCCTGATTCGGAGGT CGGTCAACGGCACTACCTCGGACTGTCTCGTTTCCCTGGTGACCTCTGTC ACCAATGTGGACCTGCCCCCTAAAGAGTCAAGCATCTAA
20 Гибридный белок, включающий растворимый внеклеточный домен ActRIIB (A64; SEQ ID NO:17), соединенный с доменом Fc SGRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWANSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPTGGGTHTCPPCPAPELLGGPSVFLFPPKPKDTLMI SRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVV SVLTVLHQDWLNGKEYKCKVSNKALPVPIEKTISKAKGQPREPQVYTLPP SREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGS FFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK
21 Гибридный белок, включающий растворимый внеклеточный домен ActRIIB (A64) с делецией 15 аминокислот с С-конца (SEQ ID NO:18), соединенный с доменом Fc SGRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWANSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGGTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSH EDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKE YKCKVSNKALPVPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLTCL VKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQ QGNVFSCSVMHEALHNHYTQKSLSLSPGK
22 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга с делецией 6 аминокислот с N-конца домена EC и делецией 5 аминокислот с С-конца домена EC (аминокислоты 25-129 SEQ ID NO:28) и с мутацией L79D ETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSGTIELV KKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPEAGGP
EVTYEPP
23 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга с делецией 6 аминокислот с N-конца домена EC и делецией 3 аминокислот с С-конца домена EC (аминокислоты 25-131 SEQ ID NO:28) и с мутацией L79D ETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSGTIELV KKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPEAGGP
EVTYEPPPT
24 Гибридный белок ActRIIB-Fc без процессинга с делецией 6 аминокислот с N-конца домена EC и делецией 3 аминокислот с С-конца домена EC (аминокислоты 25-131 SEQ ID NO:28) и с мутацией L79D и с лидирующей последовательностью TPA MDAMKRGLCCVLLLCGAVFVSPGAAETRECIYYNANWELERTNQSGLERC
EGEQDKRLHCYASWRNSSGTIELVKKGCWDDDFNCYDRQECVATEENPQV
YFCCCEGNFCNERFTHLPEAGGPEVTYEPPPTGGGTHTCPPCPAPELLGG
PSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNA
KTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTIS
KAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQP
ENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYT
QKSLSLSPGK*
25 Гибридный белок ActRIIB-Fc после процессинга с делецией 6 аминокислот с N-конца домена EC и делецией 3 аминокислот с С-конца домена EC (аминокислоты 25-131 SEQ ID NO:28) и с мутацией L79D ETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSGTIELVK KGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPEAGGPEV TYEPPPTGGGTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCV VVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQD
WLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSREEMTKNQ
VSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTV
DKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK*
26 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга (аминокислоты 20-134 SEQ ID NO:16) GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWANSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPT
27 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга с делецией 15 аминокислот с С-конца домена EC (аминокислоты 20-119 SEQ ID NO:16) GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWANSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE A
28 Последовательность белка-предшественника ActRIIB человека (R64) MTAPWVALALLWGSLW PGSGRGEAETRECIYY NANWELERTNQSGLER CEGEQDKRLHCYASWR NSSGTIELVKKGCWLD DFNCYDRQECVATEEN PQVYFCCCEGNFCNER FTHLPEAGGPEVTYEP PPTAPTLLTVLAYSLL PIGGLSLIVLLAFWMY RHRKPPYGHVDIHEDP GPPPPSPLVGLKPLQL LEIKARGRFGCVWKAQ LMNDFVAVKIFPLQDK QSWQSEREIFSTPGMK HENLLQFIAAEKRGSN LEVELWLITAFHDKGS LTDYLKGNIITWNELC HVAETMSRGLSYLHED VPWCRGEGHKPSIAHR DFKSKNVLLKSDLTAV LADFGLAVRFEPGKPP GDTHGQVGTRRYMAPE VLEGAINFQRDAFLRI DMYAMGLVLWELVSRC KAADGPVDEYMLPFEE EIGQHPSLEELQEVVV HKKMRPTIKDHWLKHP GLAQLCVTIEECWDHD AEARLSAGCVEERVSL IRRSVNGTTSDCLVSL VTSVTNVDLPPKESSI
29 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга (аминокислоты 19-134 SEQ ID NO:28) SGRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPT
30 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга с делецией 15 аминокислот с С-конца (аминокислоты 19-119 SEQ ID NO:28) SGRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE A
31 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга (аминокислоты 20-134 SEQ ID NO:28) GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPT
32 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга с делецией 15 аминокислот с С-конца (аминокислоты 20-119 SEQ ID NO:28) GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE A
33 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга с делецией 6 аминокислот с N-конца домена EC и делецией 3 аминокислот с С-конца домена EC (аминокислоты 25-131 SEQ ID NO:16) и с мутацией L79D ETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWANSSGTIELV KKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPEAGGP
EVTYEPPPT
34 Гибридный белок ActRIIB-Fc без процессинга с делецией 6 аминокислот с N-конца домена EC и делецией 3 аминокислот с С-конца домена EC (аминокислоты 25-131 SEQ ID NO:16) и с мутацией L79D и с лидирующей последовательностью TPA MDAMKRGLCCVLLLCGAVFVSPGAAETRECIYYNANWELERTNQSGLERC
EGEQDKRLHCYASWANSSGTIELVKKGCWDDDFNCYDRQECVATEENPQV
YFCCCEGNFCNERFTHLPEAGGPEVTYEPPPTGGGTHTCPPCPAPELLGG
PSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNA
KTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTIS
KAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQP
ENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYT
QKSLSLSPGK*
35 Гибридный белок ActRIIB-Fc после процессинга с делецией 6 аминокислот с N-конца домена EC и делецией 3 аминокислот с С-конца домена EC (аминокислоты 25-131 SEQ ID NO:16) и с мутацией L79D ETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWANSSGTIELVK KGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPEAGGPEV TYEPPPTGGGTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCV VVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQD
WLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSREEMTKNQ
VSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTV
DKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK*
36 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга (аминокислоты 20-134 SEQ ID NO:28) с мутацией L79D GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSG TIELVKKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPT
37 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга (аминокислоты 20-134 SEQ ID NO:16) с мутацией L79D GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWANSSG TIELVKKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPT
38 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга (аминокислоты 20-134 SEQ ID NO:28) с мутацией L79D, соединенная с доменом Fc с помощью линкера GGG GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSG TIELVKKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPTGGGTHTCPPCPAPELLGG
PSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNA
KTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTIS
KAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQP
ENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYT
QKSLSLSPGK*
39 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга (аминокислоты 20-134 SEQ ID NO:16) с мутацией L79D, соединенная с доменом Fc GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWANSSG TIELVKKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPTGGGTHTCPPCPAPELLGG
PSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNA
KTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTIS
KAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQP
ENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYT
QKSLSLSPGK*
40 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга (аминокислоты 20-134 SEQ ID NO:28) с мутацией L79D, соединенная с доменом Fc и с лидирующей последовательностью TPA MDAMKRGLCCVLLLCGAVFVSPGASGRGEAETRECIYYNANWELERTNQSG
LERCEGEQDKRLHCYASWRNSSG TIELVKKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPTGGGTHTCPPCPAPELLGG
PSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNA
KTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTIS
KAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQP
ENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYT
QKSLSLSPGK*
41 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга (аминокислоты 20-134 SEQ ID NO:16) с мутацией L79D, соединенная с доменом Fc и с лидирующей последовательностью TPA MDAMKRGLCCVLLLCGAVFVSPGASGRGEAETRECIYYNANWELERTNQSG
LERCEGEQDKRLHCYASWANSSG TIELVKKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPTGGGTHTCPPCPAPELLGG
PSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNA
KTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTIS
KAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQP
ENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYT
QKSLSLSPGK*
42 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга, имеющая вариант С-концевой последовательности (раскрытый в патенте WO2007/053775) GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSGT
IELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPEA GGPEGPWASTTIPSGGPEATAAAGDQGSGALWLCLEGPAHE
43 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга, имеющая вариант С-концевой последовательности (раскрытый в патенте WO2007/053775), имеющий мутацию L79D GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSGT
IELVKKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPEA GGPEGPWASTTIPSGGPEATAAAGDQGSGALWLCLEGPAHE
44 Последовательность растворимого (внеклеточного) полипептида ActRIIB человека после процессинга, имеющая вариант С-концевой последовательности (раскрытый в патенте WO2007/053775), имеющий мутацию L79D, соединенная с доменом Fc с помощью линкера TGGG GRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSGT
IELVKKGCWDDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPEA GGPEGPWASTTIPSGGPEATAAAGDQGSGALWLCLEGPAHE
TGGGTHTCPPCPAPELLGG
PSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNA
KTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTIS
KAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQP
ENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYT
QKSLSLSPGK*
45 Последовательность нуклеиновой кислоты, кодирующая SEQ ID NO:24 ATGGATGCAA TGAAGAGAGG GCTCTGCTGT GTGCTGCTGC TGTGTGGAGC AGTCTTCGTT TCGCCCGGCG CCGCCGAAAC CCGCGAATGT ATTTATTACA ATGCTAATTG GGAACTCGAA CGGACGAACC AATCCGGGCT CGAACGGTGT GAGGGGGAAC AGGATAAACG CCTCCATTGC TATGCGTCGT GGAGGAACTC CTCCGGGACG ATTGAACTGG TCAAGAAAGG GTGCTGGGAC GACGATTTCA ATTGTTATGA CCGCCAGGAA TGTGTCGCGA CCGAAGAGAA TCCGCAGGTC TATTTCTGTT GTTGCGAGGG GAATTTCTGT AATGAACGGT TTACCCACCT CCCCGAAGCC GGCGGGCCCG AGGTGACCTA TGAACCCCCG CCCACCGGTG GTGGAACTCA CACATGCCCA CCGTGCCCAG CACCTGAACT CCTGGGGGGA CCGTCAGTCT TCCTCTTCCC CCCAAAACCC AAGGACACCC TCATGATCTC CCGGACCCCT GAGGTCACAT GCGTGGTGGT GGACGTGAGC CACGAAGACC CTGAGGTCAA GTTCAACTGG TACGTGGACG GCGTGGAGGT GCATAATGCC AAGACAAAGC CGCGGGAGGA GCAGTACAAC AGCACGTACC GTGTGGTCAG CGTCCTCACC GTCCTGCACC AGGACTGGCT GAATGGCAAG GAGTACAAGT GCAAGGTCTC CAACAAAGCC CTCCCAGCCC CCATCGAGAA AACCATCTCC AAAGCCAAAG GGCAGCCCCG AGAACCACAG GTGTACACCC TGCCCCCATC CCGGGAGGAG ATGACCAAGA ACCAGGTCAG CCTGACCTGC CTGGTCAAAG GCTTCTATCC CAGCGACATC GCCGTGGAGT GGGAGAGCAA TGGGCAGCCG GAGAACAACT ACAAGACCAC GCCTCCCGTG CTGGACTCCG ACGGCTCCTT CTTCCTCTAT AGCAAGCTCA CCGTGGACAA GAGCAGGTGG CAGCAGGGGA ACGTCTTCTC ATGCTCCGTG ATGCATGAGG CTCTGCACAA CCACTACACG CAGAAGAGCC TCTCCCTGTC CCCGGGTAAA TGA
46 Гибридный белок, включающий растворимый, внеклеточный домен ActRIIB (R64; SEQ ID NO:29), соединенный с доменом Fc SGRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGPEVTYEPPPTAPTGGGTHTCPPCPAPELLGGPSVFLFPPKPKDTLMI SRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVV SVLTVLHQDWLNGKEYKCKVSNKALPVPIEKTISKAKGQPREPQVYTLPP SREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGS FFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK
47 Гибридный белок, включающий растворимый, внеклеточный домен ActRIIB (R64) с делецией 15 аминокислот с С-конца (SEQ ID NO:30), соединенный с доменом Fc SGRGEAETRECIYYNANWELERTNQSGLERCEGEQDKRLHCYASWRNSSG TIELVKKGCWLDDFNCYDRQECVATEENPQVYFCCCEGNFCNERFTHLPE AGGGTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSH EDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKE YKCKVSNKALPVPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLTCL VKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQ QGNVFSCSVMHEALHNHYTQKSLSLSPGK
48 Полноразмерный белок-предшественник GDF11 без процессинга, т.е. препробелок GDF11 MVLAAPLLLGFLLLALELRPRGEAAEGPAAAAAAAAAAAAAGVGGERSSRPAP
SVAPEPDGCPVCVWRQHSRELRLESIKSQILSKLRLKEAPNISREVVKQLLPK
APPLQQILDLHDFQGDALQPEDFLEEDEYHATTETVISMAQETDPAVQTDGSP
LCCHFHFSPKVMFTKVLKAQLWVYLRPVPRPATVYLQILRLKPLTGEGTAGGG
GGGRRHIRIRSLKIELHSRSGHWQSIDFKQVLHSWFRQPQSNWGIEINAFDPS
GTDLAVTSLGPGAEGLHPFMELRVLENTKRSRRNLGLDCDEHSSESRCCRYPL
TVDFEAFGWDWIIAPKRYKANYCSGQCEYMFMQKYPHTHLVQQANPRGSAGPC
CTPTKMSPINMLYFNDKQQIIYGKIPGMVVDRCGCS
49 Последовательность нуклеиновой кислоты, кодирующая SEQ ID NO: 48 ATGGTGCTCGCGGCCCCGCTGCTGCTGGGCTTCCTGCTCCTCGCCCTG
GAGCTGCGGCCCCGGGGGGAGGCGGCCGAGGGCCCCGCGGCGGCGGCG
GCGGCGGCGGCGGCGGCGGCAGCGGCGGGGGTCGGGGGGGAGCGCTCC
AGCCGGCCAGCCCCGTCCGTGGCGCCCGAGCCGGACGGCTGCCCCGTG
TGCGTTTGGCGGCAGCACAGCCGCGAGCTGCGCCTAGAGAGCATCAAG
TCGCAGATCTTGAGCAAACTGCGGCTCAAGGAGGCGCCCAACATCAGC
CGCGAGGTGGTGAAGCAGCTGCTGCCCAAGGCGCCGCCGCTGCAGCAG
ATCCTGGACCTACACGACTTCCAGGGCGACGCGCTGCAGCCCGAGGAC
TTCCTGGAGGAGGACGAGTACCACGCCACCACCGAGACCGTCATTAGC
ATGGCCCAGGAGACGGACCCAGCAGTACAGACAGATGGCAGCCCTCTC
TGCTGCCATTTTCACTTCAGCCCCAAGGTGATGTTCACAAAGGTACTG
AAGGCCCAGCTGTGGGTGTACCTACGGCCTGTACCCCGCCCAGCCACA
GTCTACCTGCAGATCTTGCGACTAAAACCCCTAACTGGGGAAGGGACC
GCAGGGGGAGGGGGCGGAGGCCGGCGTCACATCCGTATCCGCTCACTG
AAGATTGAGCTGCACTCACGCTCAGGCCATTGGCAGAGCATCGACTTC
AAGCAAGTGCTACACAGCTGGTTCCGCCAGCCACAGAGCAACTGGGGC
ATCGAGATCAACGCCTTTGATCCCAGTGGCACAGACCTGGCTGTCACC
TCCCTGGGGCCGGGAGCCGAGGGGCTGCATCCATTCATGGAGCTTCGA
GTCCTAGAGAACACAAAACGTTCCCGGCGGAACCTGGGTCTGGACTGC
GACGAGCACTCAAGCGAGTCCCGCTGCTGCCGATATCCCCTCACAGTG
GACTTTGAGGCTTTCGGCTGGGACTGGATCATCGCACCTAAGCGCTAC
AAGGCCAACTACTGCTCCGGCCAGTGCGAGTACATGTTCATGCAAAAA
TATCCGCATACCCATTTGGTGCAGCAGGCCAATCCAAGAGGCTCTGCT
GGGCCCTGTTGTACCCCCACCAAGATGTCCCCAATCAACATGCTCTAC
TTCAATGACAAGCAGCAGATTATCTACGGCAAGATCCCTGGCATGGTG
GTGGATCGCTGTGGCTGCTCT
50 Пропептид GDF11 белка GDF11 человека AEGPAAAAAAAAAAAAAGVGGERSSRPAPSVAPEPDGCPVCVWRQHSR
ELRLESIKSQILSKLRLKEAPNISREVVKQLLPKAPPLQQILDLHDFQ
GDALQPEDFLEEDEYHATTETVISMAQETDPAVQTDGSPLCCHFHFSP
KVMFTKVLKAQLWVYLRPVPRPATVYLQILRLKPLTGEGTAGGGGGGR
RHIRIRSLKIELHSRSGHWQSIDFKQVLHSWFRQPQSNWGIEINAFDP
SGTDLAVTSLGPGAEGLHPFMELRVLENTKRSRR
51 Последовательность нуклеиновой кислоты, кодирующая SEQ ID NO: 50 GCCGAGGGCCCCGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCAGCG
GCGGGGGTCGGGGGGGAGCGCTCCAGCCGGCCAGCCCCGTCCGTGGCG
CCCGAGCCGGACGGCTGCCCCGTGTGCGTTTGGCGGCAGCACAGCCGC
GAGCTGCGCCTAGAGAGCATCAAGTCGCAGATCTTGAGCAAACTGCGG
CTCAAGGAGGCGCCCAACATCAGCCGCGAGGTGGTGAAGCAGCTGCTG
CCCAAGGCGCCGCCGCTGCAGCAGATCCTGGACCTACACGACTTCCAG
GGCGACGCGCTGCAGCCCGAGGACTTCCTGGAGGAGGACGAGTACCAC
GCCACCACCGAGACCGTCATTAGCATGGCCCAGGAGACGGACCCAGCA
GTACAGACAGATGGCAGCCCTCTCTGCTGCCATTTTCACTTCAGCCCC
AAGGTGATGTTCACAAAGGTACTGAAGGCCCAGCTGTGGGTGTACCTA
CGGCCTGTACCCCGCCCAGCCACAGTCTACCTGCAGATCTTGCGACTA
AAACCCCTAACTGGGGAAGGGACCGCAGGGGGAGGGGGCGGAGGCCGG
CGTCACATCCGTATCCGCTCACTGAAGATTGAGCTGCACTCACGCTCA
GGCCATTGGCAGAGCATCGACTTCAAGCAAGTGCTACACAGCTGGTTC
CGCCAGCCACAGAGCAACTGGGGCATCGAGATCAACGCCTTTGATCCC
AGTGGCACAGACCTGGCTGTCACCTCCCTGGGGCCGGGAGCCGAGGGG
CTGCATCCATTCATGGAGCTTCGAGTCCTAGAGAACACAAAACGTTCC
CGGCGG
52 Зрелый белок GDF11 человека NLGLDCDEHSSESRCCRYPLTVDFEAFGWDWIIAPKRYKANYCSGQCE
YMFMQKYPHTHLVQQANPRGSAGPCCTPTKMSPINMLYFNDKQQIIYG
KIPGMVVDRCGCS
53 Последовательность нуклеиновой кислоты, кодирующая SEQ ID NO: 52 AACCTGGGTCTGGACTGCGACGAGCACTCAAGCGAGTCCCGCTGCTGC
CGATATCCCCTCACAGTGGACTTTGAGGCTTTCGGCTGGGACTGGATC
ATCGCACCTAAGCGCTACAAGGCCAACTACTGCTCCGGCCAGTGCGAG
TACATGTTCATGCAAAAATATCCGCATACCCATTTGGTGCAGCAGGCC
AATCCAAGAGGCTCTGCTGGGCCCTGTTGTACCCCCACCAAGATGTCC
CCAATCAACATGCTCTACTTCAATGACAAGCAGCAGATTATCTACGGC
AAGATCCCTGGCATGGTGGTGGATCGCTGTGGCTGCTCT
54 Внеклеточный домен ActRIIA мыши, соединенный с доменом Fc мыши («mActRIIA-Fc») Мышиный аналог SEQ ID NO: 7. Включает IgG2a мыши, соединенный с внеклеточным доменом ActRIIA.

Эквиваленты

Хотя изобретение подробно описано со ссылкой на конкретные варианты его осуществления, должно быть понятно, что изменения, которые являются функционально эквивалентными, находятся в пределах объема настоящего изобретения. Действительно, различные модификации изобретения в дополнение к представленным и описанным в настоящем документе будут очевидны специалистам в данной области техники из предшествующего описания и сопровождающих фигур. Такие модификации предназначены для включения в объем прилагаемой формулы изобретения. Специалистам в данной области техники должно быть понятно, или они способны с использованием не более чем обычных экспериментов создать многочисленные эквиваленты конкретных вариантов осуществления изобретения, описанных в настоящем документе. Такие эквиваленты предназначены для охвата последующей формулой изобретения.

Все публикации, патенты и патентные заявки, упомянутые в настоящем описании, включены в настоящее описание в качестве ссылки в той же степени, как если бы каждая отдельная публикация, патент или патентная заявка были конкретно и индивидуально указаны как включенные в настоящее описание в качестве ссылки в полном объеме.

1. Способ лечения кальцификации сосудов у индивидуума, где способ включает введение терапевтически эффективного количества ингибитора ActRII индивидууму, нуждающемуся в лечении атеросклеротической кальцификации, где ингибитор ActRII представляет собой полипептид, включающий аминокислотную последовательность, выбранную из группы, состоящей из:

a. последовательности, на 95% идентичной SEQ ID NO: 2;

b. последовательности, на 98% идентичной SEQ ID NO: 2;

c. SEQ ID NO: 2;

d. последовательности, на 95% идентичной SEQ ID NO: 3;

e. последовательности, на 98% идентичной SEQ ID NO: 3;

f. SEQ ID NO: 3;

g. последовательности, на 95% идентичной SEQ ID NO: 7;

h. последовательности, на 98% идентичной SEQ ID NO: 7;

i. SEQ ID NO: 7;

j. последовательности, на 95% идентичной SEQ ID NO: 12;

k. последовательности, на 98% идентичной SEQ ID NO: 12;

l. SEQ ID NO: 12;

m. последовательности, на 95% идентичной SEQ ID NO: 17;

n. последовательности, на 98% идентичной SEQ ID NO: 17;

o. SEQ ID NO: 17;

p. последовательности, на 95% идентичной SEQ ID NO: 20;

q. последовательности, на 98% идентичной SEQ ID NO: 20;

r. SEQ ID NO: 20;

s. последовательности, на 95% идентичной SEQ ID NO: 21;

t. последовательности, на 98% идентичной SEQ ID NO: 21;

u. SEQ ID NO: 21;

v. последовательности, на 95% идентичной SEQ ID NO: 23;

w. последовательности, на 98% идентичной SEQ ID NO: 23;

x. SEQ ID NO: 23;

w. последовательности, на 95% идентичной SEQ ID NO: 25;

z. последовательности, на 98% идентичной SEQ ID NO: 25; и

aa. SEQ ID NO: 25.

2. Способ по п.1, где ингибитор ActRII представляет собой полипептид, включающий аминокислотную последовательность SEQ ID NO:25.

3. Способ по п. 1, где ингибитор ActRII представляет собой полипептид, включающий аминокислотную последовательность SEQ ID NO:7.

4. Способ по любому из пп. 1-3, где уровни кальция сосудов у индивидуума являются пониженными после введения указанного ингибитора ActRII.

5. Способ по любому из пп. 1-3, где указанный способ уменьшает или смягчает один или более симптомов кальцификации сосудов у индивидуума, где указанные один или более симптомов представляют собой повышение уровней кальция сосудов, повышенный апоптоз клеток гладких мышц сосудов, потерю эластичности артерий, увеличение скорости пульсовой волны, развитие гипертрофии левого желудочка, снижение перфузии коронарных артерий и ишемию миокарда.

6. Способ по любому из пп. 1-3, где ингибитор ActRII вводят парентерально.

7. Способ по любому из пп. 1-3, где возраст индивидуума меньше 18 лет.

8. Способ по любому из пп. 1-3, где способ увеличивает рост индивидуума.

9. Способ по любому из пп. 1-3, где индивидуум страдает терминальной стадией почечной недостаточности.

10. Способ по любому из пп. 1-3, где индивидуум подвергается диализу.

11. Способ по любому из пп. 1-3, где индивидуум имеет хроническое заболевание почек.

12. Способ по любому из пп. 1-3, где индивидуум имеет гипертонию.

13. Способ по любому из пп. 1-3, где индивидуум имеет гиперхолестеринемию.

14. Способ по любому из пп. 1-3, где индивидуум имеет диабет.



 

Похожие патенты:

Группа изобретений относится к области медицины, а именно к применению в лечении заболеваний вен, характеризующихся расширенными венами, вязкого водного раствора для инъекций, который инъецируют в периваскулярное пространство, при этом он виден при ультразвуковой визуализации, причем указанный раствор содержит от 0,1% до 3% гиалуроновой кислоты с молекулярной массой от 1 миллиона до 8 миллионов Да и характеризуется периодом полужизни в соединительной ткани человека более 1 недели; а также к набору для параваскулярного или периваскулярного введения, включающему катетер и вязкий водный раствор для инъекций, содержащий от 0,1% до 3% гиалуроновой кислоты с молекулярной массой от 1 миллиона до 8 миллионов Да.

Изобретение относится к медицине, а именно к флебологии, и может быть использовано для лечения варикозной болезни вен нижних конечностей. Способ включает пункцию подкожной вены и введение в просвет вены под ультразвуковым контролем микропенной формы натрия тетрадецилсульфата и компрессию склерозируемого участка.
Изобретение относится к медицине и предназначено для лечения и профилактики острого тромбоза геморроидальных узлов. Препарат Сулодексид вводят пациенту в течение 8 дней 1 раз в день в дозе 600 ЛЕ, после окончания парентерального введения препарата пациент с 9 по 30 сутки принимает капсулы Сулодексид 2 раза в сутки по 250 ЛЕ.

Изобретение относится к фармацевтической промышленности, в частности к способу получения стандартизованного сухого экстракта семян Каштана конского обыкновенного (Fructus aesculi hippocastani).

Изобретение относится к новому комбинированному лекарственному препарату, для использования в виде твердой пероральной лекарственной формы, содержащему в качестве одного из трех активных компонентов элсульфавирин натрия.

Группа изобретений относится к медицине и касается применения лигнана, представленного формулой (I), для получения стимулятора клеточной чувствительности к CGRP. Также предложено применение лигнана для получения стимулятора кожного кровообращения, тока крови и кожного метаболизма.

Изобретение относится к фармацевтической промышленности, а именно к средству, влияющему на микроваскуляризацию в ткани головного мозга. Применяется дигидрокверцетин в качестве средства, улучшающего микроваскуляризацию в ткани головного мозга.

Настоящее изобретение относится к новым твердым формам ингибиторов фосфодиэстеразы 5-го типа (ФДЭ-5), а именно к кристаллическим соединениям, состоящим из тадалафила формулы Т и коформера Y, в котором Y выбран из 3-гидроксибензойной кислоты, 2,3-дигидроксибензойной кислоты, 2,5-дигидроксибензойной кислоты, 3,4,5-тригидроксибензойной кислоты, D-яблочной кислоты и L-винной кислоты, особенно к комплексным сокристаллам и к их сольватам, а также к фармацевтическим композициям, содержащим указанные выше соединения в качестве полезного активного ингредиента.

Изобретение относится к фармацевтической промышленности и представляет собой способ лечения сердечно-сосудистого заболевания или состояния у пациента, включающий введение указанному пациенту, перорально или парентерально, фармацевтической композиции, которая самостоятельно образует мицеллы при контакте с водной средой с образованием сферических мицелл, которые имеют средний диаметр от 1 мкм до 10 мкм и обеспечивают абсорбцию сложных эфиров омега-3 жирных кислот практически независимо от любого влияния пищи, или стабильных мицелл, предварительно сформировавшихся из указанной композиции, в количестве, терапевтически эффективном для обеспечения снижения одного или более симптомов указанного сердечно-сосудистого заболевания или состояния, при этом указанная фармацевтическая композиция содержит: (a) от 60% (вес/вес) до 85% (вес/вес) по меньшей мере одного сложного эфира омега-3 жирной кислоты, выбранного из группы, состоящей из сложного эфира (все-Z омега-3)-5,8,11,14,17-эйкозапентаеновых кислот (ЕРА), сложного эфира (все-Z омега-3)-4,7,10,13,16,19-докозагексаеновых кислот (DHA), гексадекатриеновой кислоты ("НТА" или 16:3 (n-3) или все-Z-7,10,13-гексадекатриеновой кислоты), α-линоленовой кислоты ("ALA" или 18:3 (n-3) или все-Z-9,12,15-октадекатриеновой кислоты), стеаридоновой кислоты ("SDA" или 18:4 (n-3) или все-Z-6,9,12,15-октадекатетраеновой кислоты), эйкозатриеновой кислоты ("ЕТЕ" или 20:3 (n-3) или все-Z-11,14,17-эйкозатриеновой кислоты), эйкозатетраеновой кислоты ("ЕТА" или 20:4 (n-3)), генэйкозапентаеновой кислоты ("НРА" или 21:5 (n-3) или все-Z-6,9,12,15,18-генэйкозапентаеновой кислоты), докозапентаеновой кислоты ("DPA", или клупанодоновой кислоты или 22:5 (n-3), или все-Z-7,10,13,16,19-докозапентеновой кислоты); тетракозапентаеновой кислоты (24:5 (n-3) или все-Z-9,12,15,18,21-тетракозапентаеновой кислоты) и тетракозагексаеновой кислоты (низиновой кислоты или 24:6 (n-3) или все-Z-6,9,12,15,18,21-тетракозагексаеновой кислоты); и (b) поверхностно-активное вещество, которое содержит, в комбинации, по меньшей мере один неионный алкиловый эфир полиоксиэтиленгликоля и сорбитана (полисорбат), выбранный из группы, состоящей из полиоксиэтилен(20)сорбитанмонолаурата (полисорбат 20), полиоксиэтилен(20)сорбитанмонопальмитата (полисорбат 40), полиоксиэтилен(20)сорбитанмоностеарата (полисорбат 60) и полиоксиэтилен(20)сорбитанмоноолеата (полисорбат 80); и блок-сополимер полиэтиленгликоля и полипропиленгликоля, имеющий формулу [(НО(C2H4O)64(C3H6O)37(C2H4O)64Н] (Poloxamer 237); где указанный полисорбат присутствует в количестве от 15% (вес/вес) до 31% (вес/вес) от указанной композиции; и где указанный Poloxamer 237 присутствует в количестве от 0,5% (вес/вес) до 5% (вес/вес) от указанной композиции; при этом указанная комбинация поверхностно-активных веществ является эффективной для образования указанных стабильных мицелл при контакте с указанной водной средой, и где указанная композиция для перорального или парентерального введения, которая самостоятельно образует мицеллы, при введении человеку в равной дозировке обеспечивает по существу одинаковую биодоступность при введении с пищей или без пищи указанному человеку, нуждающемуся в таком введении; при этом указанная композиция, которая самостоятельно образует мицеллы, самостоятельно образует мицеллы в водной среде, таким образом формируя сферические мицеллы, имеющие средний диаметр от 1 мкм до 10 мкм, которые обеспечивают абсорбцию указанных сложных эфиров омега-3 жирных кислот практически независимо от любого влияния пищи; и где указанную фармацевтическую композицию вводят перорально или парентерально в количестве, терапевтически эффективном для обеспечения снижения одного или более симптомов указанного сердечно-сосудистого заболевания или состояния.

Изобретение относится к фармацевтической промышленности и представляет собой лечебный крем, обладающий противовоспалительным и венотонизирующим действием, содержащий терапевтически эффективное количество сухого экстракта красных листьев винограда, воск эмульсионный, пропиленгликоль, масло вазелиновое, масло персиковое, глицерин, нипагин, триэтаноламин и воду очищенную, причем компоненты в креме находятся в определенном соотношении, в мас.

Изобретение относится к медицине, а именно к травматологии и ортопедии, и может быть использовано при закрытии дефекта плоских и трубчатых костей. Способ приготовления пломбировочной массы для закрытия дефекта кости у крысы в эксперименте включает измельчение коралла семейства Acropridae до размера гранул не более 145 мкм, которым на две трети объема наполняют желатиновую капсулу, затем капсулу заполняют аутокровью до полного ее объема, причем стенку капсулы предварительно перфорируют отверстиями с диаметром 0,1 мм в количестве 4-х на 1 мм2, далее капсулу имплантируют под кожу крысы в области грудного отдела позвоночника на 14-ть суток, затем извлекают пломбировочную массу и применяют для закрытия дефекта кости.
Предложено применение бензбромарона, или его фармацевтически пригодных кристаллов, солей или клатратов, или фармацевтической композиции, содержащей любое из вышеуказанного, в приготовлении медикамента для лечения или профилактики заболеваний шейных позвонков или грыжи межпозвонкового диска поясничного отдела у человека.

Изобретение относится к медицине, в частности к травматологии и ортопедии, и может быть использовано при лечении несросшихся переломов костей конечностей. Способ включает пункцию крыла подвздошной кости и аспирацию 3-5 мл костного мозга.

Группа изобретений относится к медицине и касается способа лечения повреждений опорно-двигательного аппарата, связанных с нарушением целостности кости, путем стимуляции образования костной мозоли, включающего инъекционное введение хондроитина сульфата внутримышечно.

Изобретение относится к медицине, а именно к экспериментальной хирургии, травматологии и ортопедии, и может быть использовано при лечении остеомиелита с дефектом кости.

Изобретение относится к соединению Оху133, имеющему формулу I, .Изобретение также относится к биоактивной композиции, к способам лечения и к способу индукции остеобластической дифференцировки и/или ингибирования дифференцировки адипоцитов мезенхимальных стволовых клеток млекопитающих.
Изобретение относится к медицине, а именно травматологии и ортопедии, и касается лечения острой стадии диабетической нейроостеоартропатии («стопа Шарко»). Для этого осуществляют разгрузку пораженной конечности и инъекцию обогащенной тромбоцитами аутоплазмы от 2,0 до 4,0 мл в область асептического воспаления и остеодеструкции.

Настоящее изобретение относится к области биотехнологии. Предложено выделенное рекомбинантное или очищенное антитело, которое специфически связывается с рецептором колониестимулирующего фактора-1 (КСФ-1R, CSF-1R), охарактеризованное аминокислотными последовательностями вариабельных доменов.

Изобретение относится к фармацевтической промышленности, а именно к средству для лечения остеомиелита. В качестве средства для лечения остеомиелита предлагается использовать β-аланиламид бетулоновой кислоты формулы (I): Предлагаемое средство эффективно предотвращает генерализацию воспалительного процесса, формирование обширных зон некроза и инфильтрации, остеокластическую резорбцию кости и формирование секвестров, что, в свою очередь, предотвращает хронизацию воспалительного процесса и способствует его разрешению; способствует более раннему и более выраженному образованию рыхлой волокнистой соединительной и грубоволокнистой костной тканей по сравнению с группами без применения бетамида, что свидетельствует о позитивном влиянии препарата на репаративные процессы в кости; вызывает более быстрое наступление фазы функциональной адаптации, способствуя более быстрому завершению репаративного эндохондрального остеогистогенеза с образованием зрелой костной ткани.
Изобретение относится к медицине, а именно к челюстно-лицевой хирургии, и может быть использовано при проведении завершающего этапа операции секвестрэктомии при хроническом одонтогенном остеомиелите у наркозависимых больных.

Изобретение относится к медицине и предназначено для медикаментозного предупреждения и коррекции структурно-функциональных нарушений почечной паренхимы, обусловленных тепловой ишемией и последующей реперфузией во время лапароскопической резекции почки.

Изобретение относится к области биотехнологии, конкретно к применению пептидных ингибиторов ActRIIВ, и может быть использовано в медицине для лечения атеросклеротической кальцификации. Изобретение позволяет уменьшить или ослабить один или более симптомов кальцификации сосудов у индивидуума, таких как повышение уровней кальция сосудов, повышенный апоптоз клеток гладких мышц сосудов, потерю эластичности артерий, увеличение скорости пульсовой волны, развитие гипертрофии левого желудочка, снижение перфузии коронарных артерий и ишемию миокарда. 13 з.п. ф-лы, 11 ил., 6 табл., 1 пр.

Наверх