Тест-система для обнаружения генома вируса парагриппа 3 типа у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени



Тест-система для обнаружения генома вируса парагриппа 3 типа у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени
Тест-система для обнаружения генома вируса парагриппа 3 типа у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени
Тест-система для обнаружения генома вируса парагриппа 3 типа у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени
Тест-система для обнаружения генома вируса парагриппа 3 типа у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени
Тест-система для обнаружения генома вируса парагриппа 3 типа у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени
Тест-система для обнаружения генома вируса парагриппа 3 типа у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени

Владельцы патента RU 2681473:

Федеральное государственное бюджетное образовательное учреждение высшего образования "Кубанский государственный аграрный университет имени И.Т. Трубилина" (RU)

Изобретение относится к биотехнологии, а именно к средствам диагностики вируса парагриппа 3 типа у животных. Предлагается тест-система для обнаружения генома возбудителя коронавирусной инфекции у животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени. Тест-система включает буфер для проведения полимеразной цепной реакции, праймеры и флуоресцентные зонды, специфичные для коронавируса А и для внутреннего контрольного образца, смесь ферментов из ДНК полимеразы с антителами, ингибирующими активность фермента, TAQ POLYMERASE и обратной транскриптазы MMLV REVERSE TRANSCRIPTASE, буфер для разведения РНК в виде деионизованной воды, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, для внутреннего контрольного образца - суспензию бактериофага MS2, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса BPI 3 и фрагмент генома бактериофага. Изобретение служит для расширения функциональных возможностей и получения достоверной диагностики. 5 табл., 1 пр.

 

Изобретение относится к ветеринарной вирусологии, а именно к средствам диагностики инфекции парагриппа 3 типа у животных, как в практике ветеринарной службы, так и для научных исследований.

Известна тест-система для обнаружения РНК вируса инфекционной болезни, путем проведения полимеразной цепной реакции в реальном времени с использованием специфичных для участка генома возбудителя инфекции олигонуклеотидных праймеров, флуоресцентно-меченного зонда и контрольных образцов (патент РФ №2515916, кл. C12N 15/11, 2014).

Также известна тест-система для обнаружения генома возбудителя вируса парагриппа 3 типа с помощью мультиплексной полимеразной цепной реакции с детекцией в режиме реального времени, включающий буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящая из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов специфичные для парагриппа 3 типа, смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE и обратной транскриптазы MMLV REVERSE TRANSCRIPTASE; буфер для разведения РНК в виде деионизованной воды, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, (патент РФ №2506317, C12Q 1/68, 2014 г. - прототип).

Общим недостатком известных технических решений является отсутствие возможности диагностики инфекции вируса парагриппа 3 типа у КРС.

Техническим результатом является расширение функциональных возможностей и получение достоверной диагностики с помощью ОТ - ПЦР в реальном времени.

Технический результат достигается тем, что в тест-системе для обнаружения генома возбудителя инфекции вируса парагриппа 3 типа у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени, включающий буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящая из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов специфичные для парагриппа 3 типа, смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE и обратной транскриптазы MMLV REVERSE TRANSCRIPTASE; буфер для разведения РНК в виде деионизованной воды, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, согласно изобретению для внутреннего контрольного образца используют суспензию бактериофага MS2, с концентрацией 5×103/мл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса парагриппа 3 типа BPI и фрагмент генома бактериофага MS2, взятых в соотношении 1:1, со следующими нуклеотидными последовательностями:

BPIF 5'-TCGACATCATTGAATTCATAC-3' - прямой праймер

BPIR 5'-TCAAGTTGGTAGATTGTCGTGC-3' - обратный праймер

BPI-z 5'-JOE-TGCCGTGTTCTCTTGGGAGTCG-BHQ1 - зонд

MS2F, 5'-TGGCACTACCCCTCTCCGTATTCAC-3' - прямой праймер

MS2R, 5'-GTACGGGCGACCCCACGATGAC-3'- обратный праймер

MS2P, 5'-Cy5-CACATCGATAGATCAAGGTGCCTACAAGC-3' BHQ2 - зонд.

Новизна заявляемого технического решения заключается в том, что для получения достоверной диагностики инфекции вируса парагриппа-3 типа животных используют тест-систему с использованием специфичных для участка генома парагриппа-3 типа олигонуклеотидных праймеров флуоресцентно-меченного зонда и разных видов контроля для которых используют различные формы материала бактериофага MS2: суспензия и фрагмент генома со с специфическими к нему праймерами и зондом.

Признаки, отличающие заявляемое техническое решение от прототипа, направлены на достижение технического результата и не выявлены при изучении данной и смежной областей науки и техники и, следовательно, соответствуют критерию «изобретательский уровень».

Заявляемый тест-система рекомендовано использовать в ветеринарной вирусологии, а именно в качестве средств диагностики парагриппной-3 типа инфекции у животных, как в практике ветеринарной службы, так и для научных исследований, что соответствует критерию «промышленная применимость».

Использование заявляемых олигонуклеотидных праймеров BPIF и BPIR флуоресцентно-меченного зонда BPIP обеспечивает специфическое выявление РНК парагриппа-3 типа у животных.

Использование разных видов контроля для которых используют различные формы материала бактериофага MS2: суспензия и фрагмент генома со специфическими к нему праймерами и зондом, бактериофага MS2 обусловлено тем, что это позволяет контролировать корректное прохождение реакции в каждой пробирки, а также контролируется этап выделения РНК из образцов.

Выбор последовательности и расчет первичной структуры олигонуклеотидных праймеров и зондов.

Проведен сравнительный анализ доступных в базе данных GenBank нуклеотидных последовательностей Р гена BPI, кодирующего один из шести главных структурных белков вирусов (Phosphoprotein Р) парагриппа, относящихся к роду Respirovirus. Как и другие представители этого семейства Paramyxoviridae, геном BPI представлен однонитевой нефрагментированной РНК негативной полярности, размером порядка 15500 оснований. Р белок является фосфопротеином размером 596 аминокимлотных остатков, который взаимодействуя с геномной РНК образует вирусный нуклеокапсид.

С помощью программы «Bio Edit 7.0» выравнены нуклеотидные последовательности Р гена BPI - представителей рода Respirovirus (1-5 типов) нуклеотидной последовательностью гена Р генома парогриппа изолята 910N (Bovine parainfluenza virus 3 DNA, complete genome (код доступа D84095). В результате анализа построенного элайнмента внутри гена белка Р выбран участок между 1800 и 2000 нуклеотидами, содержащий уникальные нуклеотидные последовательности.

С помощью программы «Oligo 6.0» рассчитаны первичные структуры олигонуклеотидных праймеров, фланкирующих выбранный участок генома. Для детекции продуктов амплификации подобран олигонуклеотидный флуоресцентно-меченный зонд BPIP, комплементарный участку нуклеотидной последовательности, ограниченной позициями отжига праймеров BPIF, и BPIR. Используя программу «Oligo 6.0» описаны основные свойства рассчитанных олигонуклеотидов, определившие возможность их использования в ПЦР.

С помощью программы "Oligo 6.0" проанализирована нуклеотидная последовательность бактериофага MS2 (Enterobacteria phage MS2 isolate ST4, complete genome. ACCESSION EF204940). Бактериофаг MS2 содержит однонитевую позитивно ориентрованную РНК размером 3569 оснований. В результате анализа внутри гена белка 'созревания' (maturation protein) выбран участок между 200 и 350 нуклеотидами, содержащий уникальные нуклеотидные последовательности, рассчитаны первичные структуры олигонуклеотидных праймеров, фланкирующих выбранный участок генома. Для детекции продуктов амплификации подобран олигонуклеотидный флуоресцентно-меченный зонд MS2P, комплементарный участку нуклеотидной последовательности, ограниченной позициями отжига праймеров MS2F и MS2R. Используя программу "Oligo 6.0" описаны основные свойства рассчитанных олигонуклеотидов, определившие возможность их использования в ПЦР.

Пример применения тест-системы для выявления генома возбудителя инфекции вируса парагриппа 3 типа у КРС

Для тест-системы используют набор (ТУ 21 10.60-133-51062356-2017), который позволяет специфически амплифицировать фрагмент генома вируса парагриппа-3 и внутреннего положительного контроля (бактериофага MS2) в мультиплексной полимеразной цепной реакции.

Набор (ИНСТРУКЦИЯ по применению «ПЦР-ПАРАГРИПП-3-КРС-ФАКТОР», набора реагентов для выявления РНК вируса парагриппа-3 крупного рогатого скота (Bovine parainfluenza virus 3) в биологическом материале методом обратной транскрипции и полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени (ОТ-ПЦР-РВ), ТУ 21 10.60-133-51062356-2017, http://www.vetfaktor.ru/), состоит из комплекта реагентов для проведения мультиплексной ОТ-ПЦР РВ, (Таблица 1, Комплект №1) и контрольных образцов (таблица 2, Комплект №2). Набор выпускается в двух вариантах:

1) Для анализа 55 образцов (включая контрольные образцы)

2) Для анализа 110 образцов (включая контрольные образцы).

В набор не входят реактивы для экстракции НК. Выделение РНК может проводиться, например, с помощью наборов на основе сорбционного метода, в состав которых входит силика или микроцентрифужные колонки, наборов на основе фенол-хлороформной экстракции и т.п. Рекомендуется использовать набор «ДНК/РНК-С-ФАКТОР» либо аналогичный.

Состав набора приведен в таблицах 1 и 2.

Для исследования используют следующий биологический материал:

- Выделения из носоглотки и трахеи, мазки со слизистой носовой полости, снимают с помощью стерильного зонда, зонд помещают в пластиковую микропробирку объемом 1,5 мл с 0,5 мл стерильного физиологического раствора/фосфатного буфера/транспортной среды.

- Фарингеальные смывы помещают в стерильный контейнер. Смывы, мазки берут на исследование без предварительной подготовки.

Вязкую по консистенции мокроту обрабатывают реагентами типа муколизин, с целью снижения вязкости.

Далее проводят анализ с помощью набора реагентов «ПЦР-ПАРАГРИПП-3-КРС-ФАКТОР» состоящий из трех этапов:

- экстракция НК;

- проведение реакции ОТ-ПЦР РВ с флуоресцентной детекцией в режиме реального времени;

- учет результатов анализа.

Реакция ОТ-ПЦР РВ проводится в одной пробирке.

Для экстракции (выделения) РНК из исследуемых проб отбирают необходимое количество одноразовых пробирок объемом 1,5 мл, включая отрицательный контроль выделения. Вносят во все пробирки с исследуемыми образцами, включая пробирку для ОКО, по 10 мкл ВКО (внутренний контрольный образец - суспензия бактериофага MS2) BPI.

Далее подготавливают образцы к проведению ПЦР

Общий объем реакционной смеси - 25 мкл, объем РНК-пробы - 10 мкл.

Успешное прохождение реакции контролируют использованием ПКО BPI, ВКО BPI и РНК буфера.

Буфер для проведения ОТ-ПЦР, ПЦР буфер BPI; состав: 2,5(ПЦР-буфер (хлорид калия, 100 мМ, Трис-HCl, рН 8,8 100 мМ, глицерол 1%, Tween-20 0.02%); хлорид магния, 5 мМ; деионизированная вода.

Смесь для проведения ПЦР, ПЦР-смесь BPI состав: эквимолярная смесь дезоксинуклеозидтрифосфатов (дНТФ) в концентрации 0,25 мМ; деионизированная вода, смесь праймеров и флуоресцентного зонда на парагрипп 3 типа (прямой и обратный праймеры BPIF и BPIR в концентрации 0,2 мкМ, зонд BPIP - FAM в концентрации 0,1 мкМ, взятых в соотношении 1:1:0,5), смесь праймеров и флуоресцентного зонда на ПКО (прямой и обратный праймеры MS2F и MS2R в концентрации 0,2 мкМ, зонд MS2P-Cy5 в концентрации 0,1 мкМ, взятых в соотношении 1:1:0,5).

Смесь ферментов, RT PCR ENZ, состав: ДНК полимераза с антителами, ингибирующими активность фермента, TAQ POLYMERASE (5 ед/мкл), обратная транскриптаза MMLV REVERSE TRANSCRIPTASE (100 ед/мкл).

Буфер для разведения РНК, РНК буфер, состав: деионизованная вода.

Внутренний контрольный образец, ВКО BPI состав: суспензия бактериофага MS2 (5×103/мл)

- Отрицательный контрольный образец, ОКО (ТЕ буфер); состав: ТЕ буфер (10 мМ Tris-HCl, 0,5 мМ EDTA, рН 8,0)

- Положительный контрольный образец, ПКО BPI; состав: смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса BPI 3 и фрагмент генома бактериофага MS2, взяты в соотношении 1:1.

В отдельной пробирке смешивают компоненты набора из расчета на каждую реакцию:

5 мкл ПЦР СМЕСЬ BPI;

10 мкл ПЦР БУФЕР BPI;

0,75 мкл смеси ферментов RT PCR ENZ

Перемешивают смесь на вортексе и сбрасывают капли кратковременным центрифугированием. Расчет объемов реагентов на различное количество реакций указан в Таблице 3.

Отбирают необходимое количество пробирок для амплификации НК исследуемых и контрольных проб. Вносят по 15 мкл приготовленной реакционной смеси.

Используя наконечники с фильтром в подготовленные пробирки вносят

а) в пробирку отрицательного контроля ПЦР (К-) 10 мкл РНК буфера;

б) в ряд пробирок для исследуемых проб - в каждую внести по 10 мкл НК соответствующей пробы, включая пробу ВК;

в) в пробирку с положительным контролем ПЦР (К+) 10 мкл ПКО BPI.

Проведение реакции ПЦР с флюоресцентной детекцией

Параметры температурно-временного режима амплификации на приборах «Rotor-Gene Q» и «ДТ-96» указаны в таблице 4.

Интерпретация результатов анализа.

Полученные данные - кривые накопления флуоресцентного сигнала анализируются с помощью программного обеспечения используемого прибора для проведения ПЦР в режиме «реального времени» в соответствии с инструкцией производителя к прибору. Учет результатов ОТ-ПЦР проводится по наличию или отсутствию пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией (что соответствует наличию или отсутствию значения порогового цикла «Ct» для исследуемого образца).

Результат считается достоверным в случае корректного прохождения положительных и отрицательных контролей амплификации и экстракции НК в соответствии с таблицей 5.

Появление любого значения Ct в таблице результатов для отрицательного контроля этапа экстракции ВК- на канале JOE (HEX)/Yellow и для отрицательного контроля этапа ОТ-ПЦР К- на любом из каналов свидетельствует о наличии контаминации реактивов или образцов.

В этом случае результаты анализа по всем пробам считаются недействительными. Требуется повторить анализ всех проб, а также предпринять меры по выявлению и ликвидации источника контаминации.

Образцы, для которых по каналу Cy5/Red значение Ct отсутствует или превышает 35 цикл (при этом по каналу JOE (HEX)/Yellow значение Ct также отсутствует) требуют повторного проведения исследования с этапа ПЦР. Задержка в значениях пороговых циклов для исследуемых образцов на канале Cy5/Red указывает на присутствие ингибиторов в пробах или на ошибки при постановке реакции ОТ-ПЦР. Требуется провести исследование, начиная с этапа экстракции НК.

Образец считается положительным, РНК вируса парагриппа 3 типа присутствует, если наблюдается экспоненциальный рост сигнала на канале JOE (HEX)/Yellow, при этом значения Ct контрольных образцов находятся в пределах нормы (см. Табл. 5). Если для исследуемого образца по каналу JOE (HEX)/Yellow значение Ct определяется позднее 37 цикла при корректном прохождении положительных и отрицательных контролей - он считается спорным и исследуется повторно с этапа выделения НК. Если при повторной постановке наблюдается схожий результат (Ct на канале JOE (HEX)/Yellow более 37), требуется повторное взятие материала от того же животного для проведения ОТ-ПЦР-исследования и (или) использование альтернативных методов диагностики. Образец считается отрицательным (РНК вируса парагриппа-3 КРС отсутствует) если не определяется значение Ct (не наблюдается рост специфического сигнала) на канале JOE (HEX)/Yellow, при этом значения Ct по каналу Cy5/Red и Ct контрольных образцов находятся в пределах нормы (Табл. 5).

Тест-система для обнаружения генома возбудителя инфекции вируса парагриппа 3 типа у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени, включающая буфер для проведения полимеразной цепной реакции, смесь для ее проведения, состоящую из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов, специфичных для парагриппа 3 типа, смесь ферментов из ДНК полимеразы с антителами, ингибирующими активность фермента, TAQ POLYMERASE и обратной транскриптазы MMLV REVERSE TRANSCRIPTASE; буфер для разведения РНК в виде деионизованной воды, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, отличающаяся тем, что для внутреннего контрольного образца используют суспензию бактериофага MS2 с концентрацией 5×103 /мл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса парагриппа 3 типа BPI и фрагмент генома бактериофага MS2, взятых в соотношении 1:1, со следующими нуклеотидными последовательностями:

BPIF 5'-TCGACATCATTGAATTCATAC-3' - прямой праймер

BPIR 5'-ТСAAGTTGGTAGATTGTCGTGC-3' - обратный праймер

BPI-z 5'-JOE-TGCCGTGTTCTCTTGGGAGTCG-BHQ1-зонд

MS2F, 5'-TGGCACTACCCCTCTCCGTATTCAC-3' - прямой праймер

MS2R, 5'-GTACGGGCGACCCCACGATGАС-3'- обратный праймер

MS2P, 5'-Су5-СACATCGATAGATCAAGGTGCCTACAAGC-3' ВНQ2-зонд.



 

Похожие патенты:

Изобретение относится к биохимии, биологии, медицине, онкологии, ветеринарии, и может быть использовано для определения активности теломеразы при диагностике злокачественных новообразований.

Настоящее изобретение относится к области биотехнологии, конкретно к полинуклеотидам, которые кодируют CDR3 в генах TCR-[альфа] и TCR-[бета] цепей CD4+ хелперных Т-клеток, которые специфичны к хелперному пептиду WT1322, и может быть использовано в медицине для индукции иммунного ответа против WT1322-экспрессирующей злокачественной опухоли.

Изобретение относится к биотехнологии. Заявлен способ определения вероятности того, что пациент имеет волчанку в доклинической стадии.

Изобретение относится к области биологии и медицины и предназначено для экспресс-выделения ДНК из размороженной крови. Проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3.

Изобретение относится к биотехнологии. Предложены олигонуклеотидные ДНК-праймеры для выявления и филогенетического анализа провирусной ДНК вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы, отличающиеся тем, что две пары олигонуклеотидных ДНК-праймеров имеют следующие последовательности: внешние (1 fwd: 5'TCCAACGCACCCAAAACCCT3'; 1 rev: 5'GCTTTAGTCCCTGTTCCGAC3'), внутренние (2 fwd: 5'TCCTGCCTATCTACTCCGCA3'; 2 rev: 5'ATGCATGGGGTGAGTCCAGT3').

Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования тяжелой степени сухого керататоконъюнктивита (СКК) при синдроме Шегрена, ассоциированном с ревматоидным артритом.
Изобретение относится к области медицины, а именно к диагностике и гинекологии, и предназначено для выявления риска развития сочетания генитального эндометриоза и гиперпластических процессов эндометрия у женщин русской национальности, уроженок Центрального Черноземья.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития ишемического инсульта. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из венозной крови и проводят анализ полиморфизмов генов цитокинов rs1061624 TNFR2 и rs767455 TNFR1.

Группа изобретений относится к области биотехнологии. Предложен способ и устройство определения нуклеотидной последовательности молекулы нуклеиновой кислоты.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития гипертонической болезни. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из периферической венозной крови и проводят анализ полиморфизмов генов цитокинов rs1800469 TGFβ-1 и rs833061 VEGFА.

Изобретение относится к биотехнологии, а именно к средствам диагностики вируса парагриппа 3 типа у животных. Предлагается тест-система для обнаружения генома возбудителя коронавирусной инфекции у животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени. Тест-система включает буфер для проведения полимеразной цепной реакции, праймеры и флуоресцентные зонды, специфичные для коронавируса А и для внутреннего контрольного образца, смесь ферментов из ДНК полимеразы с антителами, ингибирующими активность фермента, TAQ POLYMERASE и обратной транскриптазы MMLV REVERSE TRANSCRIPTASE, буфер для разведения РНК в виде деионизованной воды, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, для внутреннего контрольного образца - суспензию бактериофага MS2, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса BPI 3 и фрагмент генома бактериофага. Изобретение служит для расширения функциональных возможностей и получения достоверной диагностики. 5 табл., 1 пр.

Наверх