Способ прогнозирования преждевременных родов путем совместного определения внеклеточной днк и интерлейкина-8 в плазме периферической крови



Способ прогнозирования преждевременных родов путем совместного определения внеклеточной днк и интерлейкина-8 в плазме периферической крови
G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2682713:

Федеральное государственное бюджетное учреждение "Национальный медицинский исследовательский центр акушерства, гинекологии и перинатологии имени академика В.И. Кулакова" Министерства здравоохранения Российской Федерации (RU)

Изобретение относится к области медицины, в частности к акушерству, и предназначено для прогнозирования преждевременных родов. Используя показатели концентрации общего количества внеклеточной ДНК (овДНК) и концентрации IL-8 в плазме периферической крови у беременных женщин на 22-36 неделях гестации, определяют переменную Р. При Р>0,5 преждевременные роды произойдут. При Р≤0,5 преждевременные роды не произойдут. Изобретение обеспечивает эффективное прогнозирование преждевременных родов путем совместного определения овДНК и интерлейкина-8 в плазме периферической крови. 1 ил., 3 пр.

 

Изобретение относится к акушерству и предназначено для прогнозирования преждевременных родов на основании модели логистической регрессии с использованием одновременного измерения общего количества внеклеточной ДНК (овДНК) методом полимеразной цепной реакцией в реальном времени и IL-8 иммуноферментным методом в плазме крови у беременных женщин на 22-36 неделях гестации. Прогнозирование преждевременных родов позволяет своевременно провести комплекс профилактических и лечебных мероприятий, что способствует снижению частоты акушерских осложнений. На сегодняшний день доказано, что в случае пролонгирования беременности на срок равный или более 48 часов, возможно проведение полного курса профилактики респираторного дистресс-синдрома (РДС) плода, а также токолитической терапии. Вышеизложенные мероприятия позволяют улучшить перинатальные исходы на 5% [1, 2].

Было проведено исследование совместное уровней овДНК и IL-8 у 80 женщин. 45 беременных, родоразрешенные преждевременно, составили основную группу. 35 пациенток с угрожающими преждевременными родами, которым была своевременно проведена адекватная терапия, родоразрешенные в срок (группа контроля).

На основании определения уровней овДНК и IL-8 построена модель логистической регрессии:

Где X1 - концентрация IL-8 в плазме периферической крови выраженная в пг/мл; Х2 - концентрация овДНК в плазме периферической крови выраженная в ГЕ/мл.

При Р>0,5 - происходят преждевременные роды.

Чувствительность метода - 75,6%, специфичность метода - 82,9%.

Площадь под ROC кривой составила 0,86, что характеризует качество полученной модели, как очень хорошая.

5,0 мл периферической крови беременных женщин были собраны в вакуумные пробирки, содержащие ЭДТА, и обработаны в течение одного часа после забора. Плазма была выделена центрифугированием в два этапа при 4°С: первый - 10 мин (200 g), второй - 10 мин (4500 g). Образцы плазмы хранили при температуре - 80°С. В работе количество овДНК в плазме крови у женщин была оценена количественным ПНР-анализом путем определения концентрации промотора гена RASSF1A. ДНК выделяли из 300 мкл плазмы с использованием магнитных частиц («Силекс», Россия) согласно рекомендациям изготовителя. Стандарты ДНК изготовили из ДНК, выделенной из плаценты, с использованием набора QIAamp DNA Mini Kit («Qiagen», USA). Концентрацию стандарта ДНК определили с помощью спектрофотометра («DeNovix», USA). Для проведения ПНР использовали амплификатор CFX96 («Вio Rad», USA). Температурный профиль реакции: 95°С 5 мин; 40 циклов: 95°С 10 с, 60°С 30 с. Содержание интерлейкина 8 (IL-8) в образцах плазмы периферической крови определялось методом твердофазного иммуноферментного анализа по методике фирмы-производителя при помощи набора Human IL-8 ELISA «Ray Biotech», (USA). Учет результатов производили на планшетном спектрофотометре Infinite F50, «TECAN». Модель логистической регрессии была построена с помощью программы XLSTAT.

Способ диагностики преждевременных родов по ряду биохимических маркеров используется, как в физиологических так и патологических процессах во время беременности и родов.

Диагностика угрозы прерывания беременности в ранние сроки осуществляется путем определения в периферической крови концентрации фактора угнетающего миграцию лейкоцитов до и после однократной иммунизации донорскими лейкоцитами (патент РФ №2014598, 1994). Данный способ является технологически сложным в исполнении, а также не известна его эффективность для прогнозирования прерывания беременности во II и III триметрах беременности.

Прогнозирование угрозы прерывания беременности производится по определению концентрации эстриола, плацентарного лактогена и интерлейкина -6 в сыворотке крови (патент РФ №2285926, 2006).

Прогнозирование невынашивания беременности путем определения содержания периферических Т-лимфоцитов до и после инкубации с АМГФ (патент РФ №20077727, 1997).

Прогнозирование преждевременных родов инфекционного генеза путем определения экспрессии гена Toll-подобного рецептора-2 (TLR-2) в слизистой цервикального канала (патент РФ №2334233, 2008), однако данный способ не имеет точных пороговых значений. Кроме того, имеется большой разброс абсолютных значений показателей экспрессии TLR-2. Чувствительность метода составляет 70%.

Путем определения концентрации плодового фибронектина в цервико-вагинальном секрете и при значении выше 50нг/мл, уровень интерлейкина-6 в амниотической жидкости ≥20 нг/мл и интерлейкина-8≥450 пг/мл, данные показатели являются диагностически значимыми [16]. Н. Leitich et al. [17] провели мета-анализ 40 исследований, посвященных фибронектину, как предиктору ПР. По данным этих исследований повышение уровня фибронектина в цервикальной слизи было ассоциировано с риском развития ПР, причем наибольшая чувствительность теста проявлялась в отношении развития ПР в ближайшие 7-14 дней (около 71%), а в отношении ПР в ближайшие 21 день оказалась несколько ниже (59%). Также в качестве критерия оценки теста была рассмотрена его способность оценить вероятность ПР ранее 34 и ранее 37 недель, при этом его чувствительность оказалась еще ниже - 53% и 52% соответственно. Таким образом данный метод прогнозирования ПР не может быть использован у пациенток с начальными признаками угрозы прерывания беременности, в связи с его низкой чувствительностью. Это существенно снижает возможность своевременного начала терапии, направленной на пролонгирование беременности.

Способ прогнозирования невынашивания беременности при урогенитальной инфекции путем определения в биологической жидкости уровня ИЛ-12. В цервикальном канале определяют ИЛ-12 и при его значениях 102,0пг/мл и выше прогнозируют высокий риск невынашивания беременности в I и II триместрах (патент РФ №234424, 2008).

Недостатками данных способов является их трудоемкость в исполнении.

Прогнозирование невынашивания беременности путем определения в плазме крови содержания фибрин-мономерных комплексов. По их величине прогнозируют прерывание беременности в I, II, III триместрах (патент РФ №2123698, 1998).

Прогнозирование невынашивания беременности путем определения в сыворотке крови прогестерона, хорионического гонадотропина и уровня альфа-2-микроглобулиина в сыворотке крови (патент РФ №2004135161, 2006).

Прогнозирование исхода беременности, осуществляемый путем исследования в периферической крови относительное содержание СД16+ и СД3+ клеток и при соотношении ≥0,11 прогнозируют наступление преждевременных родов и угрозу преждевременных родов (патент РФ №2132069, 1999).

Недостатками данных способов является их низкая специфичность и необходимость использования дорогостоящих реактантов и колорантов, а также коммерческих наборов, что удлиняет время исследования и ставит результат в зависимость от качества реагентов, определяемого соблюдением ТУ по условиям и срокам хранения, как клинической лабораторией, так и поставщиком.

Прогнозирование преждевременных родов путем исследования определения относительного содержания CD 25+ и IL-2+ лимфоцитам в периферической и венозной крови (патент РФ №2344424, 2009). Технический результат в данном способе достигается за счет определения относительного содержания CD25+ к IL-2+ при значении соотношения равным или более 1,0 прогнозируют угрожающие преждевременные роды (патент РФ №2344424, 2009).

Из вышеизложенного очевидно, что на сегодняшний день основной сложностью в прогнозировании исхода беременности являются неспецифичность и трудоемкость методов, а также необходимость использования дорогостоящего оборудования и высококвалифицированного персонала. Предложенный нами метод прост в использовании, не требует закупки дополнительных реактивов. Данная методика позволяет нам прогнозировать преждевременные роды с высокой специфичностью и достоверностью результатов.

Клинические примеры.

Пример №1.

Беременная С., 29 лет (6371/15) поступила в стационар с диагнозом: «Беременность 26 недель 1 день. Угроза ранних преждевременных родов».

Из анамнеза: Менструальная функция с 11 лет, регулярная через 28 дней, по 7 дней. Данная беременность 3-я, наступила самопроизвольно, в анамнезе 1 неразвивающаяся беременность на сроке 7 недель и 1 самопроизвольный выкидыш на 17 недели. Беременность протекала на фоне токсикоза легкой степени в первой половине беременности. II триместр - угроза преждевременных родов, проведена профилактика РДС плода.

Получены следующие результаты:

IL-8=0,56 пг/мл

овДНК=74061 ГЕ/мл

Р=0,992, что больше, чем 0,5. Таким образом мы диагностировали ПР. На следующий день после госпитализации произошли преждевременные роды в сроке 26 недель 2 дня, родился живой недоношенный мальчик массой 490 г, рост 29 см.

Пример №2.

Беременная Г., 29 лет (4152/14) поступила в стационар с диагнозом: «Беременность 30 недель. Поперечное положение плода. Высокий боковой разрыв плодного пузыря».

Из анамнеза: Менструальная функция с 12 лет, регулярная через 28 дней, по 7 дней. Данная беременность 2-я, наступила самопроизвольно, в анамнезе 1 своевременные самопроизвольные роды. Беременность протекала на фоне угрозы прерывания беременности на 18 неделе, была проведена магнезиальная терапия.

Получены следующие результаты:

IL-8=18,97 пг/мл

овДНК=118862 ГЕ/мл

Р=1, что больше, чем 0,5. Таким образом мы диагностировали ПР. Через два дня после госпитализации произошли преждевременные роды в сроке 30 недель 2 дня, родился живой недоношенный мальчик массой 1370 г, рост 42 см.

Пример №3.

Беременная Д., 34 лет (418/16) поступила в стационар с диагнозом: «Беременность 30 недель. Головное предлежание. Угроза преждевременных родов».

Из анамнеза: Менструальная функция с 15 лет, регулярная через 28 дней, по 5 дней. Данная беременность 1-я, наступила самопроизвольно. Беременность протекала на фоне токсикоза легкой степени.

Получены следующие результаты:

IL-8=0,55 пг/мл

овДНК=7185 ГЕ/мл

Р=0,248, что меньше, чем 0,5. Беременность удалось пролонгировать до доношенного срока, что считается положительным результатом прогнозирования. На основании нашей модели, данная женщина не вошла в группу высокого риска ПР.

Фиг.1 «ROC-кривая, для предложенной модели логистической регрессии».

Список литературы

1. Di Renzo GC. The «Great Obstetrical Syndromes». J. Matern. Fetal Neonatal. Med. 2009; 22 (8): 633-5.

2. , Olausson PO, Sedin G, Serenius F, Svenningsen N, Thiringer K, Tunell R, Wennergren M, Wesstrom G. The Swedish national prospective study on extremely low birthweight (ELBW) infants. Incidence, mortality, morbidity and survival in relation to level of care. Acta Paediatr. 1997; 86 (5): 503-11.

3. Sundrani D, Narang A, Mehendale S, Joshi S, Chavan-Gautam P. Investigating the Expression of MMPs and TIMPs in Preterm Placenta and Role of CpG Methylation in Regulating MMP-9 Expression. IUBMB Life. 2017; 69 (12): 985-93.

4. Сухих Г.Т., Серов B.H., Адамян Л.В., Филиппов О.С., Баев О.Р., Клименченко Н.И., Тетруашвили Н.К., Тютюнник В.Л., Ходжаева З.С., Холин A.M. Преждевременные роды. // Клинические рекомендации (протокол). - МЗ РФ. - Москва, 2014. - 35 с.

5. Osmers RG, Blaser J, Kuhn W, Tschesche H. Interleukin-8 synthesis and the onset of labor. Obstet Gynecol. 1995; 86 (2): 223-9.

6. Иммунология. Практикум. Учебное пособие. Под ред. Л.В. Ковальчука, Г.А. Игнатьевой, Л.В. Ганковской. М.: ГЭОТАР-Медиа, 2012; 176 с.

7. Winkler М, Fischer DC, Ruck Р, Marx Т, Kaiserling Е, Oberpichler A, Tschesche Н, Rath W. Parturition at term: parallel increases in interleukin-8 and proteinase concentrations and neutrophil count in the lower uterine segment. Hum Reprod. 1999; 14 (4): 1096-100.

8. Arntzen KJ, Kjollesdal AM, Halgunset J, Vatten L, Austgulen R. TNF, IL-1, IL-6, IL-8 and soluble TNF receptors in relation to chorioamnionitis and premature labor. J Perinat Med. 1998; 26 (1): 17-26.

9. Chaemsaithong P, Romero R, Korzeniewski SJ, Martinez-Varea A, Dong Z, Yoon BH, Hassan SS, Chaiworapongsa T, Yeo L. A rapid interleukin-6 bedside test for the identification of intra-amniotic inflammation in preterm labor with intact membranes. J Matern Fetal Neonatal Med. 2016; 29 (3): 349-59.

10. Romero R, Grivel JC, Tarca AL, Chaemsaithong P, Xu Z, Fitzgerald W, Hassan SS, Chaiworapongsa T, Margolis L. Evidence of perturbations of the cytokine network in preterm labor. Am J Obstet Gynecol. 2015; 213 (6): 836. e1-836.e18.

11. Illanes S, Gomez R, Fornes R, Figueroa-Diesel H, Schepeler M, Searovic P, Serra R, Perez A, Nien JK. Free fetal DNA levels in patients at risk of preterm labour. Prenat Diagn. 2011; 31 (11): 1082-5.

12. Quezada MS, Francisco C, Dumitrascu-Biris D, Nicolaides KH, Poon LC. Fetal fraction of cell-free DNA in maternal plasma in the prediction of spontaneous preterm delivery. Ultrasound Obstet Gynecol. 2015; 45 (1): 101-5.

13. Jakobsen TR, Clausen FB, Rode L, Dziegiel MH, Tabor A. High levels of fetal DNA are associated with increased risk of spontaneous preterm delivery. Prenat Diagn. 2012; 32 (9): 840-5.

14. Dugoff L, Barberio A, Whittaker PG, Schwartz N, Sehdev H, Bastek JA. Cell-free DNA fetal fraction and preterm birth. Am J Obstet Gynecol. 2016; 215(2): 231.e1-7.

15. L, Khreiss T, El Kebir D, Filep JG. Activation of TLR-9 induces IL-8 secretion through peroxynitrite signaling in human neutrophils. J Immunol. 2006 15; 176 (2): 1195-202.

16. Honest H, Forbes С A, Duree KH, Norman G, Duffy SB, Tsourapas A, Roberts ТЕ, Barton PM, Jowett SM, Hyde CJ, Khan KS. Screening to prevent spontaneous preterm birth: systematic reviews of accuracy and effectiveness literature with economic modelling. Health Technol Assess. 2009; 13 (43): 1-627.

17. Leitich H, Kaider A. Fetal fibronectin - How useful is it in the prediction of preterm birth? Br. J. Obstet. Gynecol. 2003; 110 (20): 66-70.

Способ прогнозирования преждевременных родов путем совместного определения внеклеточной ДНК и интерлейкина-8 в плазме периферической крови, отличающийся тем, что в данном методе используют одновременное измерение общего количества внеклеточной ДНК методом полимеразной цепной реакции в реальном времени и IL-8 иммуноферментным методом в плазме крови у беременных женщин на 22-36 неделях гестации для определения переменной Р по формуле:

,

где X1 - концентрация IL-8 в плазме периферической крови, выраженная в пг/мл;

Х2 - концентрация овДНК в плазме периферической крови, выраженная в ГЕ/мл,

при Р>0,5 преждевременные роды произойдут; при Р≤0,5 преждевременные роды не произойдут.



 

Похожие патенты:
Изобретение относится к медицине, гинекологии и может быть использовано в лечении пациенток с пролапсом гениталий при недифференцированной дисплазии соединительной ткани.

Изобретение относится к способу определения свинца(II) в водных объектах окружающей среды и биологических образцах. Способ включает приготовление полимерной сенсорной пленки, которую помещают в испытуемый образец и по изменению цвета полимерной сенсорной пленки определяют наличие в нем свинца(II), количество которого определяют по калиброванной цветовой шкале, предварительно полученной из не менее 5-ти испытуемых образцов с известными концентрациями свинца.

Изобретение относится к измерительной технике и может быть использовано для тестирования жидкой пробы. Заявлен блок носителя реагентов, представляющий собой картридж сосудов или микропланшет, имеющий множество реакционных сосудов, содержащий соединительную часть для обеспечения разъемного соединения с соединительной частью (18) пипетирующей руки средств пипетирования лабораторного робота (1) для разъемного соединения пипетирующего наконечника.

Изобретение относится к медицине, а именно к офтальмологии, и представляет собой способ оценки эффективности нейроретинопротективного лечения первичной открытоугольной глаукомы с применением препарата Ретиналамина, включающий определение содержания нейронспецифической энолазы (neuron specific enolase или NSE) в слезной жидкости, согласно изобретению ее определяют до и после лечения и при снижении содержания NSE не менее чем на 20% от исходного показателя результат нейроретинопротекции оценивают как эффективный.

Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для оценки эффективности нейроретинопротекции первичной открытоугольной глаукомы.

Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для оценки эффективности нейроретинопротекции первичной открытоугольной глаукомы.

Изобретение относится к медицине, а именно к области диагностики онкогематологических заболеваний, и может быть использовано для дифференциальной диагностики острых лейкозов.

Изобретение относится к сельскому хозяйству, а именно способу контроля инкубации птичьего эмбриона в яйце для получения выборки яиц путем определения пола, стадии развития и/или жизнеспособности птичьего эмбриона.

Изобретение относится к области медицины, а именно педиатрии, кардиологии, и представляет собой способ диагностики поражения сердца при инфекционных заболеваниях у детей и подростков путем оценки электрокардиографических показателей, отличающийся тем, что определяют атриовентрикулярное проведение в соотношении с частотой сердечных сокращений в перцентилях и маркеры инфекционных заболеваний: при выявлении PQ>75 перцентиля для исключения скрытых нарушений АВ-проводимости проводят нагрузочные пробы или холтеровское мониторирование ЭКГ с определением PQ на различных ЧСС и при постоянной атриовентрикулярной блокаде I степени, выявленных скрытых нарушениях атриовентрикулярной проводимости и маркерах острого или перенесенного инфекционного заболевания диагностируют инфекции-ассоциированное поражение проводящей системы сердца.

Изобретение относится к способу количественного определения пептидогликанов (PGN) в образце полимера глюкозы. Способ включает a) обработку образца полимера глюкозы посредством ультразвука, нагревания и/или ощелачивания для фрагментации и разрушения содержащихся в образце PGN и для образования растворимых PGN с размерами между 30 и 5000 кДа; b) приведение обработанного образца в контакт с рекомбинантной клеткой, экспрессирующей экзогенный рецептор TLR2 (Toll-подобный рецептор 2) и репортерный ген при прямой зависимости от сигнального пути, связанного с рецептором TLR2, причем указанный репортерный ген кодирует секретируемую щелочную фосфатазу; c) измерение сигнала репортерного гена и d) определение количества PGN в образце с применением калибровочной кривой на основе зависимости количества PGN от интенсивности сигнала репортерного гена, где калибровочную кривую зависимости количества PGN от интенсивности сигнала репортерного гена стандартизируют или калибруют с использованием трихлоргидрата PAM3Cys-Ser-(Lys)4.

Настоящее изобретение относится к области биотехнологии, конкретно к полинуклеотидам, которые кодируют CDR3 в генах TCR-[альфа] и TCR-[бета] цепей CD4+ хелперных Т-клеток, которые специфичны к хелперному пептиду WT1322, и может быть использовано в медицине для индукции иммунного ответа против WT1322-экспрессирующей злокачественной опухоли.

Изобретение относится к биотехнологии. Заявлен способ определения вероятности того, что пациент имеет волчанку в доклинической стадии.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития ишемического инсульта. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из венозной крови и проводят анализ полиморфизмов генов цитокинов rs1061624 TNFR2 и rs767455 TNFR1.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития гипертонической болезни. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из периферической венозной крови и проводят анализ полиморфизмов генов цитокинов rs1800469 TGFβ-1 и rs833061 VEGFА.

Изобретение относится к области медицины, в частности к кардиологии, и предназначено для прогнозирования типа раннего ремоделирования левого желудочка (РЛЖ) у больных острым инфарктом миокарда.

Изобретение относится к области биохимии, в частности к способу определения присутствия экзогенного донорского полинуклеотида ДНК, вставленного в целевой геномный локус DAS-59132 растения кукурузы.

Изобретение относится к области медицины, молекулярной биологии и микробиологии. Предложен способ определения генетических детерминант резистентности возбудителя туберкулеза к бедаквилину и линезолиду, включающий мультиплексную амплификацию генов Rv0678, atpE, 23S рРНК, rplC, обеспечение олигонуклеотидного микрочипа для установления наличия/отсутствия точечных мутаций, инсерций, делеций в указанных генах, гибридизацию амплифицированных флуоресцентно-меченных продуктов на олигонуклеотидном микрочипе и регистрацию результатов гибридизации.

Изобретение относится к области микробиологии и предназначено для идентификации дрожжей рода Pichia. Осуществляют предварительное обогащение дрожжей, осаждение их центрифугированием, выделение ДНК с проведением ПЦР в реальном времени.

Предложенная группа изобретений относится к области молекулярной биологии и медицины. Предложены способ и набор праймеров и зондов для идентификации иммуногенных несоответствий ДНК в парах донор - реципиент.

Изобретение относится к области медицины. Предложен способ определения маркеров наличия опухолевых Т-лимфобластов.

Изобретение относится к биотехнологии и может быть использовано в пищевой промышленности при идентификации осмотолерантных дрожжей Zygosaccharomyces rouxii. Способ включает предварительное обогащение дрожжей, осаждение их центрифугированием, выделение ДНК с проведением ПЦР в реальном времени, причем для амплификации используются праймеры: ZygRux-f GACGTGAACTCTTAACGGAG и ZygRux-r GAGAGCAGAACCCTCCC, а также Taqman зонд ZygRux-p FAM CGGAGGAGATTAAAAACAGCCGCGCA BHQ1, а логарифмическое повышение уровня флюоресценции в канале FAM свидетельствует о наличии штамма дрожжей рода Zygosaccharomyces rouxii.

Изобретение относится к области медицины, в частности к акушерству, и предназначено для прогнозирования преждевременных родов. Используя показатели концентрации общего количества внеклеточной ДНК и концентрации IL-8 в плазме периферической крови у беременных женщин на 22-36 неделях гестации, определяют переменную Р. При Р>0,5 преждевременные роды произойдут. При Р≤0,5 преждевременные роды не произойдут. Изобретение обеспечивает эффективное прогнозирование преждевременных родов путем совместного определения овДНК и интерлейкина-8 в плазме периферической крови. 1 ил., 3 пр.

Наверх