Комбинация генов, конститутивно экспрессирующихся в здоровых и варикозно-измененных венах

Изобретение относится к биотехнологии. Предложена комбинация генов, конститутивно экспрессирующихся в здоровых и варикозно-измененных венах, которые могут быть использованы в дальнейших исследованиях по экспрессии генов в таких образцах. Был проведен поиск и выбор оптимальных генов-нормализаторов, конститутивно экспрессирующихся в венах, а именно в норме и при патологии - варикозной болезни. Полученная комбинация включает в себя два из трех генов: АСТВ, POLR2A и GAPDH (в любом сочетании), конститутивно экспрессирующихся в венах как в норме, так и при варикозной болезни вен, и может быть использована в качестве генов-нормализаторов для количественного определения уровня мРНК генов в здоровых и варикозно-измененных венах. 2 табл.

 

Изобретение относится к области молекулярной биологии, генетике и клинической медицины и может быть использовано для количественного определения уровня мРНК генов в здоровых и варикозно-измененных венах.

Для количественного анализа экспрессии генов, а именно - анализа транскриптома, измерения транскрипционной активности гена, определяют количество его продукта, матричной РНК (мРНК), универсальной для большей части генов. Для измерения количества мРНК разработан надежный метод - количественная полимеразная цепная реакция (ПЦР) в реальном времени, который применяют для анализа уровня экспрессии нескольких генов. Гены домашнего хозяйства - это гены, транскрибирующиеся с относительным постоянством (конститутивно) и использующиеся в качестве нормализаторов (стандартов) в ПЦР, поскольку предполагается, что на их экспрессию не влияют условия эксперимента. Выбор таких генов-нормализаторов является особенно критичным при анализе экспрессии генов в исследуемых биологических образцах, например, в тканях и органах в норме и при патологии. Экспрессия любых генов является специфичной для определенных типов клеток, тканей и органов. Патологическое состояние органа (условие эксперимента в нашем случае) может отражаться на уровне мРНК некоторых генов домашнего хозяйства, в связи с чем они не могут быть использованы в качестве стандартов-нормализаторов при количественном определении уровня мРНК генов в сравниваемых биологических образцах. Это, в частности, объясняет, почему большинство исследователей очень тщательно и осторожно подходят к такому выбору. На сегодняшний день описаны несколько вариантов генов-нормализаторов для некоторых типов клеток, органов и тканей [Hellemans et al., 2007]. Было показано, что использование не одного, а нескольких генов-нормализаторов, является более надежным при количественной оценке уровня мРНК генов в сравниваемых биологических образцах, однако в каждом отдельном случае (типе эксперимента) их количество должно быть оптимально, поскольку от этого зависит точность измерений. Однако до настоящего времени не был проведен поиск и выбор оптимальных генов-нормализаторов, конститутивно экспрессирующихся в венах, а именно в норме и при патологии - варикозной болезни, которые могут быть использованы в дальнейших исследованиях по экспрессии генов в таких образцах.

Данное изобретение может быть использовано для количественного анализа экспрессии генов - определения уровня мРНК генов в здоровых и варикозно-измененных венах.

Отличием предлагаемого изобретения является использование двух из трех генов: АСТВ, POLR2A и GAPDH (в любом сочетании) в качестве оптимальных генов-нормализаторов для количественного определения уровня мРНК генов в здоровых и варикозно-измененных венах.

Изобретение заключается в следующем:

Послеоперационный материал (удаленные варикозно-измененные вены и условно здоровые) для выделения РНК немедленно помещают в жидкий азот, а затем хранят при - °С до времени использования. Общую РНК выделяют из гомогенизированных вен с использованием реагента TRIzol (Invitrogen, США) в соответствии с протоколом производителя. Концентрацию общей РНК в каждом образце количественно определяют спектрофотометрически при λ=260 нм. После электрофореза РНК в 1% агарозном геле ее целостность подтверждают визуализацией интактных 18S и 28S рРНК под ультрафиолетом. Для количественной ПЦР в качестве матрицы используют кДНК, которую синтезируют при помощи системы обратной транскриптазы RevertAid Premium (Fermentas, США) в соответствии с инструкциями производителя.

Дизайн праймеров для количественной ПЦР выполняют с использованием программ Annhyb222 и Oligo Analyzer. Список потенциальных генов-нормализаторов выбран в соответствии со стратегиями, определенными Vandesompele et al. [1]. Последовательности праймеров приведены в таблице 1.

Синтезированные образцы кДНК разбавляют в 10 раз водой без нуклеаз. Амплификационные смеси (20 мкл) содержат приблизительно 25 нг кДНК-матрицы, 300 нМ прямого и обратного праймера и SYBR Green PCR Master Mix. Количественную ПЦР в реальном времени проводят с использованием амплификатора CFX-96 (Bio-Rad, USA). Протокол амплификации включает этапы: 3-минутную инкубацию при 95°С; 40 циклов, состоящих из денатурации при 95°С (6 сек), отжига праймеров при 58-62°С (8 сек), элонгации при 72°С (10 сек); съем сигнала при 80°С (5 сек). Каждое измерение проводят в трех повторах и включют: стандартную кривую четырех серийных точек разведения кДНК смешанных образцов, контроль без матрицы и каждую тестовую кДНК. Результаты CFX-96 Manager экспортируют в виде файлов Excel и импортируют в программное обеспечение qBase+ (Bio-Rad, США) для дальнейшего анализа в соответствии с руководством по программному обеспечению и дополнительной литературой [2, 3].

Для анализа geNorm, используемого с целью определения оптимальных генов-нормализаторов, требуется строгий минимум из 2 неизвестных образцов и 3 потенциальных генов-нормализаторов. В ходе нашего изобретения мы использовали 20 парных тестируемых образцов (а именно: здоровая и варикозно-измененная вена от каждого из 10 пациентов, страдающих варикозной болезнью вен, соответственно) и 6 потенциальных генов-нормализаторов. Мы выбрали 6 известных генов домашнего хозяйства в качестве потенциальных генов-нормализаторов для наших экспериментов и произвели валидацию их экспрессии в тестируемых образцах вен: АСТВ, GAPDH, HPRT1, POLR2A, RPL13A, YWHAZ. Для определения лучших генов-нормализаторов был проведен анализ geNorm с использованием программного обеспечения qBase+.

Все необходимые для такого анализа модели и алгоритмы реализованы в программном обеспечении qBase+, предназначенном для управления и автоматизированного анализа данных количественных ПЦР. В своей работе мы использовали лицензионную версию программы.

Одной из уникальных особенностей qBase+ является возможность нормализовать относительные количества с помощью нескольких генов-нормализаторов, что дает более точные и надежные результаты. Кроме того, qBase+ оценивает стабильность применяемых генов-нормализаторов (и, следовательно, надежность нормализации), вычисляя две меры качества: коэффициент вариации нормированных относительных количеств генов-нормализаторов (CV, где V - попарная вариация, определяющая оптимальное количество генов-нормализаторов) и параметр стабильности (М), согласно анализу geNorm [1, 2]. Оба значения являются либо только значимыми, либо могут быть рассчитаны только в том случае, если определяются количества несколько генов-нормализаторов. Чем ниже эти параметры качества для конкретных генов-нормализаторов, тем стабильнее экспрессируются эти гены в тестируемых образцах.

Стоит обратить внимание, что реализация алгоритмов анализа geNorm в qBase+ позволяет ранжировать кандидаты в гены-нормализаторы до одного наиболее стабильного гена, тогда как его предшественник в Excel не может провести различие между двумя наиболее стабильно экспрессирующимися кандидатами в гены-нормализаторы.

В таблице №2 приведены результаты анализа geNorm М, показывающие ранжирование генов-кандидатов согласно их стабильности (выраженной в значениях geNorm М): от лучших генов-нормализаторов вверху (низкое значение М) до нестабильно экспрессирующегося гена внизу таблицы (высокое значение М).

По результатам этого теста программное обеспечение сделало вывод: «Высокая стабильность экспрессии подтверждается для 5 из 6 проверяемых генов (средняя величина geNorm М≤0,5) [2]. Оптимальное количество генов-нормализаторов в этой экспериментальной ситуации равно 2 (geNorm V<0,15 при сравнении коэффициент нормализации на основе 2 или 3 наиболее стабильных генов-нормализаторов) [2]. Коэффициент оптимальной нормализации можно вычислить как среднее геометрическое двух из трех генов: АСТВ, POLR2A и GAPDH (в любом сочетании)».

Таким образом, данная комбинация генов может быть выбрана в качестве нормализаторов для количественного определения уровня мРНК генов в здоровых и варикозно-измененных венах.

ИСТОЧНИКИ ИНФОРМАЦИИ

1 Vandesompele J, De Preter K, Pattyn F et al. Accurate normalization of realtime quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, RESEARCH0034 (2002).

2 Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 8, R19 (2007).

3 Hellemans J, Vandesompele J. qPCR data analysis - unlocking the secret to successful results. In: Hellemans J, Vandesompele J. PCR Troubleshooting and Optimization: The Essential Guide. Ghent University and Biogazelle, Caister Academic Press, Belgium (2011).

Применение двух из трех генов: АСТВ, POLR2A и GAPDH (в любом сочетании), конститутивно экспрессирующихся в венах как в норме, так и при варикозной болезни вен, в качестве генов-нормализаторов для количественного определения уровня мРНК генов в здоровых и варикозно-измененных венах.



 

Похожие патенты:

Изобретение относится к области медицины, в частности к акушерству, и предназначено для прогнозирования преждевременных родов. Используя показатели концентрации общего количества внеклеточной ДНК (овДНК) и концентрации IL-8 в плазме периферической крови у беременных женщин на 22-36 неделях гестации, определяют переменную Р.

Изобретение относится к биотехнологии и может быть использовано в пищевой промышленности при идентификации осмотолерантных дрожжей Zygosaccharomyces rouxii. Способ включает предварительное обогащение дрожжей, осаждение их центрифугированием, выделение ДНК с проведением ПЦР в реальном времени, причем для амплификации используются праймеры: ZygRux-f GACGTGAACTCTTAACGGAG и ZygRux-r GAGAGCAGAACCCTCCC, а также Taqman зонд ZygRux-p FAM CGGAGGAGATTAAAAACAGCCGCGCA BHQ1, а логарифмическое повышение уровня флюоресценции в канале FAM свидетельствует о наличии штамма дрожжей рода Zygosaccharomyces rouxii.
Изобретение относится к области биотехнологии. Изобретение представляет собой способ определения степени раздражающего действия дезинфекционных средств на кожу человека, заключающийся в том, что культуру клеток Chang conjunctiva рассеивают на 96-луночную панель по 100 мкл в каждую лунку в концентрации 1×105 клеток/мл в питательной среде Игла-MEM с 10% эмбриональной телячьей сывороткой (ЭТС).

Изобретение относится к области биотехнологии. Предложен способ детекции полинуклеотида или полинуклеотидной последовательности в образце.

Изобретение относится к биотехнологии, а именно к средствам диагностики вируса парагриппа 3 типа у животных. Предлагается тест-система для обнаружения генома возбудителя коронавирусной инфекции у животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени.

Изобретение относится к биохимии, биологии, медицине, онкологии, ветеринарии, и может быть использовано для определения активности теломеразы при диагностике злокачественных новообразований.

Настоящее изобретение относится к области биотехнологии, конкретно к полинуклеотидам, которые кодируют CDR3 в генах TCR-[альфа] и TCR-[бета] цепей CD4+ хелперных Т-клеток, которые специфичны к хелперному пептиду WT1322, и может быть использовано в медицине для индукции иммунного ответа против WT1322-экспрессирующей злокачественной опухоли.

Изобретение относится к биотехнологии. Заявлен способ определения вероятности того, что пациент имеет волчанку в доклинической стадии.

Изобретение относится к области биологии и медицины и предназначено для экспресс-выделения ДНК из размороженной крови. Проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3.

Изобретение относится к биотехнологии. Предложены олигонуклеотидные ДНК-праймеры для выявления и филогенетического анализа провирусной ДНК вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы, отличающиеся тем, что две пары олигонуклеотидных ДНК-праймеров имеют следующие последовательности: внешние (1 fwd: 5'TCCAACGCACCCAAAACCCT3'; 1 rev: 5'GCTTTAGTCCCTGTTCCGAC3'), внутренние (2 fwd: 5'TCCTGCCTATCTACTCCGCA3'; 2 rev: 5'ATGCATGGGGTGAGTCCAGT3').

Изобретение относится к области медицины, в частности к онкологии, и предназначено для прогнозирования безметастатической выживаемости у больных раком молочной железы. У пациенток во время операции после проведения неоадъювантной химиотерапии (НХТ) берут ткань опухоли с последующим выделением РНК. Проводят количественную ПЦР в режиме реального времени, определяют уровень экспрессии генов ОСТ3, LAT и LMNB2 по технологии TaqMan с помощью специфических праймеров и проб. Оценивают экспрессию генов ОСТ3, LAT и LMNB2 с помощью метода Pfaff1 относительно гена рефери GAPDH. При уровне экспрессии ОСТ3 ниже 1,3 УЕ, LAT и LMNB2 ниже 1 УЕ определяют их гипоэкспрессию. При уровне значений выше указанных показателей определяют гиперэкспрессию. При одновременной гиперэкспрессии генов ОСТ3, LAT, LMNB2 в остаточной резидуальной опухоли прогнозируют неблагоприятный исход с вероятностью 69%. При гипоэкспрессии хотя бы одного из генов прогнозируют благоприятный исход с вероятностью 94%. Изобретение обеспечивает увеличение точности определения исхода рака молочной железы у больных, получавших НХТ, за счет использования новых маркеров - оценки экспрессии трех генов сомато-стволового перехода ОСТ3, LAT и LMNB2 в остаточной резидуальной опухоли после НХТ. 1 ил., 2 пр.

Изобретение относится к области ветеринарии, микробиологии и биотехнологии. Предложен способ выявления и количественной оценки содержания ДНК U. diversum в материале от взрослого крупного рогатого скота (КРС). Одновременно проводят две реакции ПЦР в реальном времени, причем одна с праймерами к фрагменту гена 16S рРНК метилтрансферазы U. diversum, а вторая к фрагменту гена GAPDH быка домашнего (Bos taurus), с последующим анализом соотношения содержания ДНК U. diversum и ДНК быка домашнего. При значениях соотношения больше нуля и меньше единицы делают вывод об активном инфекционном процессе U. diversum. При значениях больше единицы делают вывод о вялотекущей инфекции или носительстве. Изобретение обеспечивает повышение специфичности и точности диагностики уреалазмоза КРС. 1 табл.

Предложенная группа изобретений относится к области биомедицины, в частности молекулярной и клинической онкологии. Предложен способ диагностики светлоклеточного почечно-клеточного рака (скПКР), при котором у обследуемых лиц берут образцы ткани почки, производят выделение и очистку ДНК из взятых образцов и производят методом МС-ПЦР анализ метилирования фрагментов ДНК с применением праймеров. Диагностируют скПКР по наличию гиперметилирования по крайней мере у двух маркеров из группы генов MIR-132, MIR-125b-1, MIR-137, MIR-375, MIR-193a, MIR-1258, MIR-34b/c. Предложен способ прогнозирования метастазирования скПКР, при котором у обследуемых лиц выполняют диагностику скПКР в соответствии с вышеуказанным способом, и для лиц с установленным диагнозом скПКР производят анализ метилирования фрагментов ДНК методом МС-ПЦР. Прогнозируют метастазирования скПКР по наличию гиперметилирования по крайней мере у трех маркеров из группы генов MIR-125b-1, MIR-375, MIR-107, MIR-1258 и MIR-203. Заявляемые способы позволяют диагностировать скПКР и прогнозировать его метастазирование с высокой специфичностью и чувствительностью. 2 н. и 8 з.п. ф-лы, 2 ил., 4 табл., 3 пр.

Изобретение относится к биотехнологии. Предложена комбинация генов, конститутивно экспрессирующихся в здоровых и варикозно-измененных венах, которые могут быть использованы в дальнейших исследованиях по экспрессии генов в таких образцах. Был проведен поиск и выбор оптимальных генов-нормализаторов, конститутивно экспрессирующихся в венах, а именно в норме и при патологии - варикозной болезни. Полученная комбинация включает в себя два из трех генов: АСТВ, POLR2A и GAPDH, конститутивно экспрессирующихся в венах как в норме, так и при варикозной болезни вен, и может быть использована в качестве генов-нормализаторов для количественного определения уровня мРНК генов в здоровых и варикозно-измененных венах. 2 табл.

Наверх