Способ профилактики и/или лечения зависимости от психоактивных веществ

Изобретение относится к медицине, а именно к психиатрии, и может быть использовано при профилактике и/или лечении зависимости от психоактивных веществ. Способ включает генотипирование по генам дофаминовой, серотониновой, норадреналиновой и гамма-аминомасляной кислоты систем нейромедиаторного обмена, психодиагностическое тестирование с последующим формированием психологических типов в соответствии с полиморфизмами в указанных генах. Затем назначают БАД и/или фармакотерапию с учетом результатов генотипирования и выявленных психологических типов с нарушением нейромедиаторного обмена. Использование изобретения позволяет повысить эффективность лечения за счет коррекции нарушения баланса нейромедиаторов, предрасполагающего к формированию зависимости. 7 з.п. ф-лы, 1 табл.


Изобретение относится к области медицины и может быть использовано для лечения и/или профилактики от психоактивных веществ, в частности наркомании и/или алкоголизма и/или коморбидных расстройств по генетическому нейромедиаторному обмену и психологическому тестированию пациента.

В патогенезе развития зависимости от психоактивных веществ (ПАВ) большое значение придается личностным особенностям. В настоящее время некоторые личностные особенности рассматриваются как предрасполагающие к формированию хронической алкогольной и наркотической зависимостям. Очевидно, что злоупотребление ПАВ может быть обусловлено разными характерологическими особенностями, однако, и в нашей стране и за рубежом в настоящее время разрабатываются методы по выделению типов личности, чаще других связанных с развитием этого заболевания.

Из уровня техники известен способ лечения алкоголизма, включающий воздействие на рефлексогенные зоны переменным электрическим током частотой 5-30 Гц через введенные в них иглы. Воздействие осуществляют на биологически активные точки симметрично с обеих сторон, при этом в точки тоу-цзяо-инь и бай-хуэй вводят иглы, на которые через 10-15 мин от начала воздействия подают электрический ток в течение 10-15 с, иглы извлекают через 5-10 мин после прекращения воздействия электрическим током, после этого в точки нао-ху и шэнь-тин вводят лекарственный препарат - центральный анальгетик (RU 2056110, 20.03.1996).

Известен способ лечения больных с зависимостью от психоактивных веществ, заключающийся в применении наномолекулярного селенотерпенопротеинового средства, представляющее собой две полипептидные α- и β-цепи протеина, соединенные дисульфидным мостиком по остаткам цистеина, селеновыми связями между аминокислотами валином и лейцином, а также глутаминовыми кислотами и двумя диселенидными связями между α- и β-цепью, при этом наномолекула селенопротеина при всех физиологических значениях pH ионизирована, заряженными являются С- и N-концевые группы и связанные с α-углеродными атомами боковые цепи, содержащие карбоксильную или аминогруппы, к наномолекуле селенопротеина присоединен сесквитерпеновый лактон (СТЛ) к карбоксильным группам боковых цепей к остаткам глутаминовой и/или аспарагиновой кислот и/или к С-концевым карбоксильным группам через сложную эфирную связь при молярном соотношении СТЛ : селенопротеин = 4:1. Селенотерпенопротеиновое средство вводят ежедневно, чередуя внутримышечные и внутривенные инъекции в дозе 0,2-0,3 мл (RU 2242235, 20.12.2004).

Наиболее близким аналогом заявленного изобретения является способ профилактики наркомании и/или алкоголизма, или лечения и/или реабилитации больных наркоманией и/или алкоголизмом, заключающийся в выявлении у пациента синдром дефицита удовлетворенности путем осуществления генетического анализа по наличию, по меньшей мере, одного из генов, кодирующих обмен нейромедиаторов и свойства рецепторов, входящих в систему удовлетворения человека, и компенсируют дефицит удовлетворенности путем выполнения, по меньшей мере, одного комплекса физических упражнений, оказывающих эффект, обеспечивающий компенсацию дефицита удовлетворенности. При наличии у пациента патологической аллели гена дофаминового D2 рецептора и/или гена белка обратного захвата дофамина используют комплекс физических упражнений, включающий упражнения, оказывающие седативный эффект, а при наличии у пациента патологической аллели гена белка дофамин-β-гидроксилазы используют комплекс физических упражнений, включающий упражнения, оказывающие активизирующий эффект (RU 2243757, 10.01.2005).

Предлагаемые способы не позволяют в полной мере оптимизировать эффективность лечения больных с зависимостью к психоактивным веществам, в частности наркомании и/или алкоголизма и/или коморбидных расстройств, а также не позволяет правильно подобрать методику лечения.

Задача, на решение которой направлено предложенное изобретение, заключается в разработке диагностических мероприятий, направленных на выявление личностных особенностей, предрасполагающих к аддикциям, а также применение терапевтических и профилактических подходов с учетом фармакогенетического анализа.

Технический результат, достигаемый при реализации данного изобретения, заключается в повышении эффективности лечения зависимости от психоактивных веществ, в частности наркомании и/или алкоголизма и/или коморбидных расстройств по генетическому нейромедиаторному обмену и психологическому тестированию пациента за счет детального выяснения причин зависимости от психоактивных веществ и индивидуального подбора лечения пациента при помощи анализа ДНК и психологического тестирования для определения психологического типа, к которому относится пациент, и проведения оценки адекватности применяемого лечения.

Указанный технический результат достигается в способе профилактики и/или лечения зависимости от психоактивных веществ, включающем генотипирование по генам дофаминовой, серотониновой, норадреналиновой и гамма-аминомасляной кислоты систем нейромедиаторного обмена, психодиагностическое тестирование с последующим формированием психологических типов в соответствии с полиморфизмами в указанных генах и назначение БАД и/или фармакотерапии с учетом результатов генотипирования и выявленных психологических типов с нарушением нейромедиаторного обмена.

При недостаточности дофаминового обмена при выявлении незначительной предрасположенности вводят БАД тирозин, при выявлении средней предрасположенности вводят БАД тирозин и диметиламиноэтанол (ДМАЕ), при выявлении высокой предрасположенности вводят БАД тирозин, ДМАЕ и препарат энерион, а при выявлении максимальной предрасположенности вводят БАД тирозин, ДМАЕ и препарат семакс.

При недостаточности серотонинового обмена при средней предрасположенности вводят БАД мелаксен, при выявлении высокой предрасположенности вводят БАД 5-гидрокситриптофан и мелаксен, а при выявлении максимальной предрасположенности вводят БАД 5-гидроксигрипгофан, мелаксен и препарат асентра.

При избыточности серотонинового обмена при выявлении высокой предрасположенности вводят БАД таурин и ДМАЕ, а при выявлении максимальной предрасположенности вводят БАД таурин, ДМАЕ и препарат пиразидол.

При избыточности норадреналинового обмена при выявлении средней предрасположенности вводят БАД тирозин, а при выявлении максимальной предрасположенности вводят БАД тирозин и препарат ремерон.

При недостаточности дофаминового обмена в сочетании с избыточностью серотонинового обмена выявлении незначительной предрасположенности вводят БАД ДМАЕ, при выявлении средней предрасположенности вводят БАД таурин и ДМАЕ, при выявлении высокой предрасположенности вводят БАД ДМАЕ и препарат пиразидол, а при выявлении максимальной предрасположенности вводят БАД таурин, ДМАЕ и препарат пиразидол.

При недостаточности дофаминового обмена в сочетании с недостаточностью серотонинового обмена при выявлении средней предрасположенности вводят БАД тирозин, при выявлении высокой предрасположенности вводят БАД тирозин и ДМАЕ, а при выявлении максимальной предрасположенности вводят БАД тирозин, ДМАЕ и препарат леривон.

При недостаточности дофаминового обмена в сочетании с недостаточностью обмена гамма-аминомасляной кислоты при выявлении высокой предрасположенности вводят БАД таурин и препарат аминалон, а при выявлении максимальной предрасположенности вводят БАД таурин, ДМАЕ и препарат нейробутал.

Сущность заявленного изобретения поясняется следующим.

Применяется, во-первых, способ генотипирования по генам дофаминовой, серотониновой, норадреналиновой и гамма-аминомасляной кислоты (ГАМК) систем нейромедиаторного обмена.

Кроме того, применяется психодиагностическое тестирование и проведение структурированного клинического интервью. Процедура психодиагностического тестирования и клинического интервьюирования проводится с целью комплексного подхода к формированию «групп риска» - психологических типов с личностными особенностями, предрасполагающими к аддикциям. Кроме того, психодиагностическое тестирование позволяет провести оценку адекватности применяемого лечения.

Многофакторный анализ личности - стандартизированный многофакторный метод исследования личности (СМИЛ) предназначен для многофакторной оценки устойчивых индивидуальных особенностей. Опросник СМИЛ для данного исследования учитывает спектр таких структурных компонентов личности, как отношение к другим людям и положению в обществе, стиль межличностного поведения, черты характера, фон настроения, склонность к агрессии, предрасположенность к алкоголизму.

МЦВ (метод цветовых выборов) - тест Люшера. МЦВ диагностирует не свойства личности, а ее состояние, отражает наиболее значимые характеристики на момент обследования.

Способ назначения пищевых добавок и фармакотерапии обосновывается с учетом результатов генотипирования и выявления специфических психотипов с нарушением нейромедиаторного обмена.

Основными психологическими характеристиками, связанными с формированием зависимого (аддиктивного) поведения являются импульсивность, низкий уровень самоконтроля, тревожно-депрессивные реакции, агрессивное поведение, низкая нормативность социального поведения, неустойчивость к стрессу, низкая чувствительность к опасности и риску, компульсивность и нарушение поведения по гистрионическому типу.

Формирование устойчивых психологических типов зависит от баланса нейромедиаторов. При избыточности или недостаточности основных нейромедиаторов проявляются предрасполагающие к формированию зависимого поведения черты характера.

Взаимосвязи дисбаланса каждого из нейромедиаторов с нарушениями поведения.

Основными нейромедиаторами центральной нервной системы (ЦНС) являются дофамин, серотонин, норадреналин и гамма-аминомасляная кислота.

Дофамин обеспечивает механизмы закрепления положительных и отрицательных эмоций. Дофаминовая недостаточность связана с «синдромом дефицита удовлетворения». Основными личностными характеристиками при дофаминовой недостаточности являются низкий уровень самоконтроля, импульсивность и низкая нормативность социального поведения. Серотонин обеспечивает необходимый уровень седации (спокойствия). Недостаточность серотонинового обмена проявляется неустойчивостью к стрессу, повышенной тревожностью. Избыточность серотонинового обмена проявляется в агрессивном поведении. При этом агрессия может быть внешненаправленной (конфликтное поведение), так и внутренненаправленной (низкая самооценка, самобичевание). Норадреналин обеспечивает уровень активности в состоянии бодрствования. Избыточность норадреналинового обмена проявляется в склонности к меланхолической депрессии, ригидности и высокой истощаемости при психоэмоциональном стрессе.

Дисбаланс основных нейромедиаторов может быть изолированным и выражаться в избыточности, или недостаточности каждого из них.

Кроме того, возможны «смешанные» формы дисбаланса нескольких нейромедиаторов.

В настоящее время методов прямого измерения метаболизма нейромедиаторов в ЦНС не существует. Однако, для дофамина, серотонина, норадреналина и гамма-аминомасляной кислоты известны гены, кодирующие рецепторы, переносчики и ферменты их метаболизма. Полиморфизмы в этих генах связаны с нарушением баланса каждого из нейромедиаторов.

В соответствии с полиморфизмами в генах обмена дофамина, серотонина, норадреналина и гамма-аминомасляной кислоты определяются специфические психологические типы, связанные с формированием зависимого от ПАВ поведения. Всего мы выделяем 7 типов нарушений нейромедиаторного обмена:

1. недостаточность дофаминового обмена;

2. недостаточность серотонинового обмена;

3. избыточность серотонинового обмена;

4. избыточность норадреналинового обмена;

5. недостаточность дофаминового обмена в сочетании с избыточностью серотонинового обмена;

6. недостаточность дофаминового обмена в сочетании с недостаточностью серотонинового обмена;

7. недостаточность дофаминового обмена в сочетании с недостаточностью обмена гамма-аминомасляной кислоты.

Фармакотерапию проводят с учетом известного механизма действия каждого препарата или БАД.

1. Для коррекции недостаточности дофаминового обмена используют БАД тирозин и диметиламиноэтанол (ДМАЕ) и препараты «энерион» и «семакс». Тирозин - аминокислота, метаболический предшественник дофамина, вводимый экзогенно, восполняет дефект в синтезе дофамина. ДМАЭ при попадании в организм превращается в ацетилхолин. Ацетилхолин - нейромедиатор, отвечающий за передачу и регулирование синаптических сигналов. Семакс - синтетический аналог фрагмента кортикотропина, обладающий ноотропными свойствами и лишенный гормональной активности. Влияет на процессы, связанные с формированием памяти и обучением. Способствует сохранению и ускоряет восстановление умственной работоспособности.

2. Для коррекции недостаточности серотонинового обмена используют БАД 5-гидрокситриптофан и препараты «мелаксен» и «асентра». 5-гидрокситриптофан является метаболическими предшественником серотонина. Аминокислота триптофан превращается в 5-гидрокситриптофан (5-НТР), а он, в свою очередь, - в серотонин. Мелаксен - синтетический аналог гормона шишковидной железы (эпифиза), полученный из аминокислот растительного происхождения. Эпифиз производит мелатонин из аминокислоты триптофана в ночное время суток, в дневное время им производится из триптофана нейромедиатор серотонин. Таким образом увеличивается концентрация ГАМК и серотонина в среднем мозге и гипоталамусе, изменяется активность пиридоксалькиназы, участвующей в синтезе ГАМК, дофамина и серотонина. Асентра - антидепрессант, специфический ингибитор обратного захвата серотонина (5-НТ) в нейронах. На метаболизм норадреналина и допамина влияет незначительно. Препарат не оказывает стимулирующего, седативного или антихолинергического действия. Не обладает сродством к серотониновым, допаминовым, гистаминовым, бензодиазепиновым, GABA, холино- и адренорецепторам.

3. Для коррекции избыточности серотонинового обмена используют БАД таурин, ДМАЕ и препарат «пиразидол». Таурин - тормозной нейромедиатор головного мозга, является продуктом метаболизма незаменимой аминокислоты цистеина. Таурин, вводимый экзогенно, восполняет дефицит эндогенного таурина. Пиразидол-избирательно, кратковременно и обратимо ингибирует МАО типа А; в высокой степени блокирует дезаминирование серотонина и норадреналина, в меньшей степени - тирамина. Частично ингибирует обратный захват моноаминов. Стимулирует адренергические структуры; потенцирует эффекты предшественника серотонина 5-окситриптофана (стимулирует серотонинергические структуры).

4. Для коррекции избыточности норадреналинового обмена используют БАД тирозин и препарат «ремерон».

Принцип действия Ремерона отличается от всех известных антидепрессантов (ТЦА, ИОЗС, ингибиторы моноаминооксидазы - ИМАО). Ремерон повышает норадренергическую и серотонинергическую нейротрансмиссии, блокируя центральные а2-ауто и гетероадренорецепторы. При этом серотонин стимулирует только рецепторы типа 5-НТ1, тогда как рецепторы 5-НТ2 и 5-НТЗ блокируются Ремероном. Таким образом, Ремерон правильнее всего определить как Норадренергический и Специфический Серотонинергический Антидепрессант (НаССА).

5. Для коррекции недостаточности дофаминового обмена в сочетании с избыточностью серотонинового обмена используют тирозин, ДМАЕ и препарат «пиразидол».

6. Для коррекции недостаточности дофаминового обмена в сочетании с недостаточностью серотонинового обмена используют тирозин, ДМАЕ и препарат «леривон». Леривон - механизм действия связан с угнетением обратного захвата нейромедиаторных моноаминов пресинаптическими нервными окончаниями, в результате чего происходит накопление медиаторов в синаптической щели и активация синаптической передачи. Препарат одновременно уменьшает захват разных нейромедиаторных аминов (норадреналина, серотонина, дофамина).

7. Для коррекции недостаточности дофаминового обмена в сочетании с недостаточностью обмена гамма-аминомасляной кислоты используют таурин, ДМАЕ и препараты «аминалон» и «нейробутал». Нейробутал обладает ГАМК-миметическим эффектом, коррегирует нарушения обменных процессов ЦНС, повышает устойчивость мозга к гипоксии и воздействию токсических веществ, стимулирует анаболические процессы в нейронах и утилизацию глюкозы и кислорода, Оказывает седативное действие, способствует нормализации сна, улучшает память. Аминалон (ГАМК) принимает участие в нейромедиаторных и метаболических процессах в мозге. ГАМК является основным медиатором, участвующим в процессах центрального торможения. Под влиянием ГАМК активируются также энергетические процессы мозга, повышается дыхательная активность тканей, улучшается утилизация мозгом глюкозы, улучшается кровоснабжение. Действие ГАМК в ЦНС осуществляется путем ее взаимодействия со специфическими ГАМКергическими рецепторами, которые в последнее время подразделяют на ГАМК-А- и ГАМК-Б-рецепторы.

Проведение диагностики психологических типов на основе данных генотипирования и коррекция расстройств поведения. При проведении диагностики психологических типов учитываются данные генотипирования в сочетании с анамнезом и данными психодиагностического обследования, включающими профиль личности СМИЛ, тест ЦМВ и тестирование уровней тревожности и депрессии.

1. Психологический тип «недостаточности дофаминового обмена» с низким уровнем самоконтроля, импульсивностью и низкой нормативностью социального поведения. Выявляется при наличии у пациента предрасполагающих генотипов: 1/1 гена рецептора дофамина D2, 7 аллеля гена рецептора дофамина D4, 9/10 гена переносчика дофамина, 1/1 гена бета-гидроксилазы дофамина.

При выявлении только одного патологического генотипа - рецептора D2 или рецептора D4 предрасположенность определяется как «незначительная». Для коррекции используют БАД тирозин. При выявлении двух предрасполагающих генотипов - одного из рецепторов D2 или D4 в сочетании с генотипом переносчика дофамина предрасположенность определяется как «выраженная в средней степени». Для коррекции используют БАД тирозин и диметиламиноэтанол (ДМАЕ). При выявлении трех предрасполагающих генотипов рецепторов D2 и D4 в сочетании с генотипом переносчика дофамина предрасположенность интерпретируется как «высокая». Для коррекции используют БАД тирозин и ДМАЕ в сочетании с препаратом «энерион». При выявлении всех четырех предрасполагающих генотипов предрасположенность интерпретируется как «максимальная». Для коррекции используют тирозин и ДМАЕ в сочетании с препаратом «семакс».

Пример 1. Денис Т., 30 лет.

Наследственность психопатологически отягощена алкоголизацией отца. Впервые употребил спиртное в 15 лет, в 18 лет героин. Эпизодическое употребление алкоголя с 20 лет, с постепенным нарастанием толерантности, частоты употребления. Систематическое злоупотребление алкоголем около 10 лет. Утрачен защитный рвотный рефлекс. Сформирован абстинентный синдром по сомато-вегетативному типу. Утрачен количественный и ситуационный контроль. Пьянство носит псевдозапойный характер. Запои по 10-14 дней. Светлые промежутки до 1-2 недель, с тенденцией к сокращению. Появились алкогольные палимпсесты. Суточная толерантность до 2,5 литра крепких спиртных напитков в сутки. Алкоголизировался в компании и в одиночку. Спонтанная ремиссия отсутствует, кодировался 3 раза - без эффекта. За наркологической помощью обращается по настоянию родителей. Последнее употребление алкоголя - накануне поступления.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

Профиль имеет "позитивный" наклон, свидетельствующий о большом риске поведенческих реакций. По отношению к другим людям и положению в обществе выявлены стремление к соперничеству, упрямство, скептицизм, отсутствие конформности, трудности адаптации в микросоциальной среде и стремление к доминированию. По отношению к собственной личности выявлены положительная самооценка и трудность переубеждения. Импульсивные черты в характере снижают продуманность и взвешенность принимаемых решений. Это снижает использование пережитого опыта и повышает вероятность повторения уже совершенных ошибок.

Ведущими потребностями являются потребность в свободе, активности, избавлении от каких-либо ограничений.

Результаты теста МЦВ при поступлении в клинику.

Неудовлетворенность потребности в физиологическом комфорте, эмоциональная напряженность с тенденцией к биологизации тревоги (плохое самочувствие). Экспансивность высказываний и поведения, стремление к переживанию сильных ощущений. Оригинальность и творческий подход в решениях. Настойчивость в отстаивании собственной индивидуальности, что несколько усложняет адаптацию. Настойчивая потребность в избавлении от каких бы то ни было ограничений.

Уровни депрессии - 4 (низкий) и тревоги - 6 (средний) при поступлении в клинику.

При генотипировании выявлены три предрасполагающих генотипа генов рецепторов D2 (1/1) и D4 (аллель7) в сочетании с генотипом гена переносчика дофамина (9/10). Результаты интерпретированы как «высокая предрасположенность к недостаточности дофаминового обмена». Определен соответствующий психологический тип с низким уровнем самоконтроля, импульсивностью и низкой нормативностью социального поведения. Для коррекции дезадаптивного поведения были назначены БАД тирозин и ДМАЕ в сочетании с препаратом «энерион».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состоянию - настроение повышено, гиперактивность, бравада. По отношению к собственной личности - высокая самооценка, уверенность в себе, убежденность в собственной правоте.

Результаты теста МЦВ при выписке из клиники.

Потребность в прочной и глубокой привязанности, эмоциональном комфорте и защите от внешних воздействий. Дружелюбие, конформность установок. Сензитивность в отношении критических замечаний в свой адрес. Удовлетворенность физиологических потребностей. Стремление упрочить свою позицию.

Уровни депрессии - 1 (низкий) и тревоги - 5 (низкий) при выписке из клиники.

1. Психологический тип «недостаточности серотонинового обмена» с неустойчивостью к стрессу и повышенной тревожностью. Выявляется при наличии у пациента предрасполагающих генотипов: SS и SL гена переносчика серотонина, с/с и c/g гена ресептора серотонина 2С, 9/10 гена переносчика дофамина. При выявлении только одного патологического генотипа гена переносчика серотонина предрасположенность определяется как «выраженная в средней степени». Для коррекции используют БАД мелаксен. При выявлении предрасполагающих генотипов переносчика серотонина и рецептора серотонина 2С предрасположенность интерпретируется как «высокая». Для коррекции используют 5-гидроксигриптофан и мелаксен. При выявлении предрасполагающих генотипов всех трех генов предрасположенность определяется как «максимальная». Для коррекции используют 5-гидроксигриптофан, мелаксен и препарат «асентра».

Пример 2. Людмила Ч., 55 лет.

Наследственность психопатологически отягощена алкоголизацией отца. Впервые употребила спиртное в 20 лет. Эпизодическое употребление с 30 лет, с постепенным нарастанием толерантности, частоты употребления. Систематическое злоупотребление алкоголем около 6 лет. Утрачен защитный рвотный рефлекс. Сформирован абстинентный синдром по сомато-вегетативному типу. Снижен количественный и ситуационный контроль. Пьянство носит псевдозапойный характер. Запои по 3-4 дня. Светлые промежутки до 1-2 недель, с тенденцией к сокращению. Появились алкогольные палимпсесты. Суточная толерантность до 0,5 литра крепких спиртных напитков в сутки. Алкоголизировалась в одиночку, скрывая от окружающих, прятала спиртное. Спонтанная ремиссия около 4-х месяцев после пребывания в санатории в 2007 г.

За наркологической помощью обращается впервые. Последнее употребление алкоголя - 2 недели назад.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

По эмоциональному состоянию - склонность к пониженному настроению, недовольству ситуацией и собой. Уровень тревоги повышен.

Обеспокоенность своей отгороженностью и трудностями социальной адаптации. По отношению к другим людям и положению в обществе выявлены обеспокоенность своей отгороженностью и трудностями социальной адаптации. По отношению к собственной личности выявлены склонность к пониженной самооценке и неуверенность в себе. Наиболее вероятными реакциями на стресс являются депрессивные реакции, усиление тревоги, страх, дистанцирование и эмоциональное отчуждение.

Результаты теста МЦВ при поступлении в клинику.

Эмоциональная неустойчивость и зависимость от средовых воздействий. Чувство тревоги и неуверенности, физического перенапряжения. Страхи, обостренная мнительность, дискомфорт, потребность в отдыхе и расслаблении. Противоречивое соотношение между оптимистичностью и пессимизмом. Неустойчивое настроение.

Уровни депрессии - 4 (низкий) и тревоги - 2 (низкий) при поступлении в клинику. При генотипировании выявлены предрасполагающие генотипы переносчика серотонина (SL) и рецептора серотонина 2С (с/с). Результаты интерпретированы как «максимальная предрасположенность к недостаточности серотонинового обмена». Определен соответствующий психологический тип с неустойчивостью к стрессу и повышенной тревожностью. Для коррекции эмоциональной лабильности были назначены БАД 5-гидрокситриптофан, мелаксен и препарат «асентра».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По отношению к другим людям и положению в обществе выявлены гибкость, отсутствие злопамятности и застревания на обидах. Миролюбие, дружелюбие, стремление к сглаживанию конфликтов. По отношению к собственной личности - защитная реакция в виде вытеснения информации, занижающей самооценку, смягчение эмоционального напряжения.

Результаты теста МЦВ при выписке из клиники.

Потребность в отстаивании собственных установок, упорство, противодействие обстоятельствам, которое носит защитный характер. Практичность и трезвость суждений, рационализм, тенденция к системному подходу при решении проблем. Ориентировка на собственное мнение, сопротивление внешне-средовым воздействиям. Значимость собственной социальной позиции.

Уровни депрессии - 4 (низкий) и тревоги - 1 (низкий) при выписке из клиники.

3. Психологический тип «избыточности серотонинового обмена» с агрессивным поведением (аутоагрессия или конфликтное поведение).

Выявляется при наличии у пациента предрасполагающих генотипов:

«3-repeat» гена моноаминооксидазы МАО-А и а/а гена моноаминооксидазы МАО-В. При выявлении предрасполагающих генотипов одного из генов моноаминооксидазы предрасположенность интерпретируется как «высокая». Для коррекции используют таурин и ДМАЕ. При выявлении предрасполагающих генотипов двух генов моноаминооксидазы (МАО-А и МАО-В) предрасположенность определяется как «максимальная». Для коррекции используют таурин, ДМАЕ и препарат «пиразидол».

Пример 3. Наталья Р., 19 лет.

Наследственность психопатологически не отягощена. Наркотизируется с подросткового возраста: в 14 лет испытала алкогольное опьянение, в 15-16 лет первые пробы стимуляторов. Систематическое употребление героина около года, в/в практически без пауз. Сформирована психологическая и физическая зависимость. Суточная толерантность до 1,0-2,0 г вещества. В июле 2008 г. пыталась покончить с собой через передозировку. Последнее употребление 28.08.2008 г. Прошла процедуру УБОД.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

По эмоциональному состоянию - настроение снижено, раздражительность.

Противоречивое и дисгармоничное сочетание эмоциональной лабильности с эмоциональной ригидностью. По отношению к другим людям и положению в обществе выявлены конфликтность, упрямство. Повышенная внутренняя агрессивность подавляется повышенным самоконтролем, что смягчает ее внешние проявления. Проявляется в виде критических замечаний, реакций протеста. При близких контактах конфликтность или агрессивность выше, а самоконтроль меньше. Возможна избирательная враждебность или конфликтность по отношению к определенным близким людям при сохранении видимости конформности при более отдаленных контактах. Сдерживаемая внутренняя агрессивность может проявляться в провоцировании своим поведением окружающих на агрессию с последующим обвинением их в недоброжелательном отношении.

Результаты теста МЦВ при поступлении в клинику.

Протестная реакция, сопротивление внешним обстоятельствам, давлению средовых воздействий. Стремление отстоять собственную позицию ограничением контактов, пассивным противодействием. Внешнеобвиняющая реакция, прикрывающая собственное бессилие. Субъективизм и индивидуалистичность утрированы и проявляются в виде негативизма и категоричного критиканства по отношению к любым мнениям и ценностям.

Уровни депрессии - 5 (низкий) и тревоги - 8 (средний) при поступлении в клинику.

При генотипировании выявлены предрасполагающие генотипы двух генов моноаминооксидазы МАО-А («3-repeat») и МАО-В (а/а). Результаты интерпретированы как «максимальная предрасположенность к избыточности серотонинового обмена». Определен соответствующий психологический тип с агрессивным поведением (аутоагрессия или конфликтное поведение). Для коррекции агрессивного поведения были назначены БАД таурин, ДМАЕ и препарат «пиразидол».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состоянию - настроение хорошее, удовлетворенность собой. Выраженность эмоциональных проявлений, глубина переживаний. По отношению к другим людям и положению в обществе выявлены ранимость, упрямство, эмоциональная отгороженность. Эмоциональный подтекст межличностных контактов снижен. Сензитивность. Повышенная чувствительность к критическому или негативному отношению окружающих.

Результаты теста МЦВ при выписке из клиники.

Нешаблонный, самобытный подход к решению проблем, оригинальность мышления, богатое воображение, недостаток практицизма, реалистичности. Индивидуалистичность, создающая трудности в попытках завязывания контактов. Ранимость, сензитивность. Тонкая нюансированность чувств, своеобразие интересов, суждений сочетается с такими особенностями, как потребность в прочной и глубокой привязанности, эмоциональном комфорте и защите от внешних воздействий. Дружелюбие, конформность установок. Потребность в понимании, любви и поддержке.

Уровни депрессии - 2 (низкий) и тревоги - 3 (низкий) при выписке из клиники.

4. Психологический тип «избыточности норадреналинового обмена» с меланхолической депрессией и психосоматической астенизацией. Выявляется при наличии у пациента предрасполагающих генотипов: 9/10 гена переносчика дофамина и 2/2 гена бета-гидроксилазы дофамина. При выявлении патологического генотипа только гена бета-гидроксилазы дофамина предрасположенность интерпретируется как «выраженная в средней степени». Для коррекции используют тирозин. При выявлении предрасполагающих генотипов генов бета-гидроксилазы дофамина и переносчика дофамина предрасположенность определяется как «максимальная». Для коррекции используют тирозин и препарат «ремерон».

Пример 4. Денис В., 27 лет.

Наследственность психопатологически отягощена алкоголизацией отца. Акушерский анамнез неизвестен. Впервые употребил спиртное в 15 лет. Эпизодическое употребление алкоголя с 18 лет, с постепенным нарастанием толерантности, частоты употребления. В 19 лет около года эпизодически наркотизировался - марихуана. Систематическое злоупотребление алкоголем около 5 лет. Утрачен защитный рвотный рефлекс. Сформирован абстинентный синдром по сомато-вегетативному типу. Утрачен количественный и ситуационный контроль. Светлые промежутки до 2 недель, с тенденцией к сокращению. Появились алкогольные палимпсесты. Суточная толерантность до 1,0 литров водки на уровне плато, предпочитает крепкие спиртные напитки. Алкоголизировался в компании и в одиночку. За наркологической помощью обращается в связи с ухудшением здоровья, отношений в семье и на работе. Последнее употребление алкоголя, марихуаны - накануне поступления.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

По эмоциональному состоянию - склонность к "застреванию" на отрицательных эмоциях, эмоциональная ригидность. Легко возникает ощущение угрозы, страх. По отношению к другим людям и положению в обществе выявлены ранимость и обидчивость.

Результаты теста МЦВ при поступлении в клинику.

Пессимистическая оценка ситуации. Ощущение изолированности и одиночества. Потребность в ярких эмоциональных переживаниях, эгоцентрическая сосредоточенность на своих проблемах, обидчивость. Неудовлетворенная потребность в признании, беспокойство, тревога, комплекс собственного несовершенства маскируется демонстративностью поведения.

Уровни депрессии - 9 (средний) и тревоги - 13 (высокий) при поступлении в клинику.

При генотипировании выявлены предрасполагающие генотипы бета-гидроксилазы до фамина (2/2) и переносчика дофамина (9/10). Результаты интерпретированы как «максимальная предрасположенность к избыточности норадреналинового обмена». Определен соответствующий психологический тип с меланхолической депрессией и психосоматической астенизацией. Для коррекции высоких уровней тревожности и депрессии была назначена БАД тирозин и препарат «ремерон».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состоянию - веселое настроение, удовлетворенность собой. Эмоциональное своеобразие со снижением способности к эмоциональным контактам. По отношению к другим людям и положению в обществе - ранимость, обидчивость, недоверчивость, формальность контактов. Эмоциональная отгороженность. Трудности адаптации в больших коллективах. Узкий круг знакомств. Повышенная чувствительность к критическому или негативному отношению окружающих.

Результаты теста МЦВ при выписке из клиники.

Выраженный самоконтроль в сфере чувственности приводит к изоляции. Стремление к завоеванию признания и уважения со стороны значимых других.

Уровни депрессии - 6 (низкий) и тревоги - 7 (средний) при выписке из клиники.

5. Психологический тип «недостаточности дофаминового обмена в сочетании с избыточностью серотонинового обмена» с низким уровнем самоконтроля, импульсивностью, низкой чувствительностью к опасности и риску, асоциальным поведением. Выявляется при наличии у пациента предрасполагающих генотипов: 1/1 гена рецептора дофамина D2, 7 аллеля гена рецептора дофамина D4, 9/10 гена переносчика дофамина DAT, 1/1 гена бета-гидроксилазы дофамина, g/g гена рецептора серотонина 2С, LL гена переносчика серотонина. При выявлении двух генотипов серотониновых генов и одного из предрасполагающих генотипов дофаминовых генов - рецептора D2, или рецептора D4, или переносчика дофамина предрасположенность определяется как «незначительная». Для коррекции используют БАД ДМАЕ. При выявлении двух генотипов серотониновых генов в сочетании с двумя патологическими генотипами дофаминовых генов - рецептора D2, или рецептора D4, и переносчика дофамина предрасположенность определяется как «выраженная в средней степени». Для коррекции используют таурин и ДМАЕ. При выявлении двух генотипов серотониновых генов в сочетании с тремя патологическими генотипами дофаминовых генов - рецептора D2, рецептора D4 и переносчика дофамина предрасположенность определяется как «высокая». Для коррекции используют ДМАЕ и препарат «пиразидол». При выявлении двух генотипов серотониновых генов в сочетании с патологическими генотипами четырех дофаминовых генов - рецептора D2, рецептора D4, переносчика дофамина и бета-гидроксилазы дофамина предрасположенность определяется как «максимальная». Для коррекции используют таурин, ДМАЕ и препарат «пиразидол».

Пример 5. Сергей С., 37 лет.

Наследственность психопатологически отягощена алкоголизацией отца. Получил высшее образование, занимается логистикой, в течении последних лет часто менял работу, не удерживаясь из-за употребления, последние 3 месяца не работает. Судимость - 2 года из-за драки в состоянии алкогольного опьянения. Впервые употребил спиртное в 13 лет, так же пробы марихуаны. Эпизодическое употребление алкоголя с 18 лет, с постепенным нарастанием толерантности, частоты употребления. Систематическое злоупотребление алкоголем около 10 лет. Утрачен защитный рвотный рефлекс. Сформирован абстинентный синдром по сомато-вегетативному типу. Утрачен количественный и ситуационный контроль. Пьянство носит псевдозапойный характер. Запои по 10-14 дней. Светлые промежутки до 1-2 недель, с тенденцией к сокращению. Появились алкогольные палимпсесты. Суточная толерантность до 1,0 литра крепких спиртных напитков в сутки. Алкоголизировался в компании и в одиночку. Спонтанная ремиссия отсутствует, неоднократно детоксикации на дому, кодировался, максимальная ремиссия около 1 года.

За наркологической помощью обращается по настоянию родителей. Последнее употребление алкоголя - накануне поступления.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

По эмоциональному состоянию - эмоциональная холодность. Эмоциональная отгороженность. По отношению к другим людям и положению в обществе выявлены отсутствие конформности, трудности адаптации в микросоциальной среде. Эмоциональный подтекст межличностных контактов снижен. Ведущими являются потребности в реализации интересов, находящихся в стороне от социальной вовлеченности; в свободе, избавлении от каких-либо ограничений. Особенностью личности является выраженное своеобразие.

Результаты теста МЦВ при поступлении в клинику.

Неустойчивая, созерцательная позиция, трудности социальной адаптации, эмоциональность и субъективность пристрастий превалирует над рассудочностью. Нешаблонный, самобытный подход к решению проблем, оригинальность мышления. Индивидуалистичность, создающая трудности в попытках завязывания контактов. Трудно вырабатываются навыки общепринятых норм поведения.

Уровни депрессии - 6 (низкий) и тревоги - 5 (низкий) при поступлении в клинику.

При генотипировании выявлены предрасполагающие генотипы двух генотипов серотониновых генов - SERT (LL) и HTR2C (g/g) в сочетании с патологическими генотипами четырех дофаминовых генов - рецептора D2 (1/1), рецептора D4 (аллель 7), переносчика дофамина (9/10) и бета-гидроксилазы дофамина (1/1). Результаты интерпретированы как «максимальная предрасположенность к недостаточности дофаминового обмена в сочетании с избыточностью серотонинового обмена». Определен соответствующий психологический тип с низким уровнем самоконтроля, импульсивностью, низкой чувствительностью к опасности и риску и асоциальным поведением. Для коррекции дезадаптивного поведения были назначены БАД таурин, ДМАЕ и препарат «пиразидол».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состоянию - веселое настроение, удовлетворенность собой. По отношению к другим людям и положению в обществе - сензитивность. Повышенная чувствительность к критическому или негативному отношению окружающих. По отношению к собственной личности - положительная самооценка, уверенность в себе, убежденность в собственной правоте.

Результаты теста МЦВ при выписке из клиники.

Потребность в действии, эмоциональной вовлеченности, в переменах, в общении. Оптимистичность, эмоциональная неустойчивость, легкое вживание в разные социальные роли, потребность нравиться окружающим, зависимость от средовых воздействий, поиски признания и стремления к сопричастности в межличностном взаимодействии. Любые формальные рамки тесны и плохо переносятся. Выраженная эмоциональная переключаемость без глубины переживаний и непостоянство в привязанностях. Непосредственность чувств, пристрастие к забавам, игровому компоненту в деятельности.

Уровни депрессии - 4 (низкий) и тревоги - 1 (низкий) при выписке из клиники.

6. Психологический тип «недостаточности дофаминового обмена в сочетании с недостаточностью серотонинового обмена» с низким уровнем самоконтроля, импульсивностью, низкой самооценкой и тревожно-депрессивными реакциями. Выявляется при наличии у пациента предрасполагающих генотипов: 1/1 гена рецептора дофамина D2, 7 аллеля гена рецептора дофамина D4, 9/10 гена переносчика дофамина DAT, «4-repeat» гена моноаминооксидазы МАО-А и g/g гена моноаминооксидазы МАО-В. При выявлении одного из генотипов серотониновых генов (МАО-А или МАО-В) в сочетании с патологическим генотипом одного из дофаминовых генов - рецептора D2 или рецептора D4, или переносчика дофамина предрасположенность определяется как «выраженная в средней степени». Для коррекции используют тирозин. При выявлении одного из генотипов серотониновых генов (МАО-А или МАО-В) в сочетании с патологическими генотипами двух дофаминовых генов - рецептора D2 или рецептора D4, или переносчика дофамина предрасположенность определяется как «высокая». Для коррекции используют тирозин и ДМАЕ.

При выявлении двух генотипов серотониновых генов в сочетании с патологическими генотипами трех дофаминовых генов - рецептора D2, рецептора D4 и переносчика дофамина предрасположенность определяется как «максимальная». Для коррекции используют тирозин, ДМАЕ и препарат «леривон».

Пример 6. Эдуард Ш., 38 лет.

Наследственность психопатологически отягощена по линии отца. Впервые употребил спиртное в 14 лет. До 23 лет эпизодическое употребление алкоголя с постепенным нарастанием толерантности, частоты употребления. Систематическое злоупотребление алкоголем около 4 лет. Утрачен защитный рвотный рефлекс. Сформирован абстинентный синдром по сомато-вегетативному типу. Утрачен количественный и ситуационный контроль. Пьянство носит псевдозапойный характер. С 38 лет запои до 10 дней. Светлые промежутки до 1 месяца, с тенденцией к сокращению. Появились алкогольные палимпсесты. Суточная толерантность до 5,0 литра пива, крепкие спиртные напитки употребляет редко. Алкоголизировался в компании и в одиночку. За наркологической помощью обращался неоднократно, в т.ч. в наркологические клиники, последнее - с 8 сентября 2008 г. Последнее употребление алкоголя - около 6 дней назад.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

Данный профиль характерен для депрессивного синдрома. Иногда такой профиль бывает при дезадаптации личности с выраженными тревожными (гипотимными) чертами и склонностью к депрессивным реакциям. Настроение резко снижено до степени депрессивного. Слабость, адинамия, безрадостное восприятие действительности. Высокий уровень тревоги. Легкое попадание в зависимость.

Результаты теста МЦВ при поступлении в клинику.

Эмоциональная неустойчивость, зависимость от средовых воздействий. Тенденция к избеганию ответственности. Любые формальные рамки тесны и плохо переносятся. Выраженная эмоциональная переключаемость без глубины переживаний и непостоянство в привязанностях. Непосредственность чувств, пристрастие к забавам, игровому компоненту в деятельности. Состояние эмоциональной напряженности, физическая усталость, дискомфорт. Эмоциональная неустойчивость усугубляется тревожными ощущениями надвигающейся опасности. Вытеснение психологических причин и соматизация конфликта. Напряженность физиологических потребностей.

Уровни депрессии - 4 (низкий) и тревоги - 5 (низкий) при поступлении в клинику.

При генотипировании выявлены предрасполагающие генотипы двух генотипов серотониновых генов - SERT (SL) и HTR2C (с/с) в сочетании с патологическими генотипами трех дофаминовых генов - рецептора D2 (1/1), рецептора D4 (аллель 7) и переносчика дофамина (9/10). Результаты интерпретированы как «максимальная предрасположенность к недостаточности дофаминового обмена в сочетании с недостаточностью серотонинового обмена». Определен соответствующий психологический тип с низким уровнем самоконтроля, импульсивностью, низкой самооценкой и тревожно-депрессивными реакциями. Для коррекции дезадаптивного поведения и тревожно-депрессивных реакций были назначены БАД тирозин, ДМАЕ и препарат «леривон».

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состоянию - настроение изменчивое вследствие циклотимных колебаний или эмоциональной незрелости. Эмоциональное напряжение. По отношению к другим людям и положению в обществе - недостаток дипломатичности. Скептицизм. Ведущей является потребность в избегании конфликтов и чутком отношении окружающих.

Результаты теста МЦВ при выписке из клиники.

Потребность в отстаивании собственных установок, упорство, противодействие обстоятельствам, которое носит защитный характер. Практичность и трезвость суждений, рационализм, тенденция к системному подходу при решении проблем. Опора на накопленный опыт. Ориентировка на собственное мнение, сопротивление внешне-средовым воздействиям. Установка на избегание конфликта. Повышенная ранимость в отношении критических замечаний со стороны окружающих, уязвимое самолюбие, значимость социального престижа. Потребность в самоуважении и уважении со стороны окружающих.

Уровни депрессии - 2 (низкий) и тревоги - 4 (низкий) при выписке из клиники.

7. Психологический тип «недостаточности дофаминового обмена в сочетании с недостаточностью обмена гамма-аминомасляной кислоты» с периодами употребления ПАВ по «булимическому» типу. Низкий самоконтроль, компульсивность. Выявляется при наличии у пациента предрасполагающих генотипов: 1/1 гена рецептора дофамина D2, 7 аллеля гена рецептора дофамина D4, 9/10 гена переносчика дофамина DAT, a/g гена глутаматдекарбоксилазы. При выявлении двух предрасполагающих генотипов генов дофаминовой системы и a/g гена глутаматдекарбоксилазы предрасположенность определяется как «высокая». Для коррекции используют таурин и препарат «аминолон». При выявлении всех трех предрасполагающих генотипов генов дофаминовой - 1/1 гена рецептора дофамина D2, 7 аллеля гена рецептора дофамина D4, 9/10 гена переносчика дофамина DAT и a/g гена глутаматдекарбоксилазы предрасположенность определяется как «максимальная». Для коррекции используют таурин, ДМАЕ и препарат «нейробутал».

Пример 7. Алексей В., 40 лет.

Наследственность психопатологически не отягощена. Впервые употребил в 16 лет вследствие любопытства, субъективные ощущения приятные. Эпизодическое употребление в течение нескольких лет с нарушением дозы и толерантности. С 27 лет отмечает запои по 3-4 дня. Сформирован похмельный синдром. Суточная толерантность до 1,5 л коньяка. Снижен количественный и ситуационный контроль. С 2003 по 2006 - вынужденная ремиссия в МЛС. Последние полгода пьянство носило постоянный характер. Последнее употребление - накануне.

Интерпретация профиля личности СМИЛ при поступлении в клинику.

По эмоциональному состоянию - веселое настроение, удовлетворенность собой, эмоциональная устойчивость, малая зависимость эмоционального состояния от внешних факторов. Недостаток осторожности. Отсутствие боязливости. По отношению к другим людям и положению в обществе - общительность, стремление к расширению круга знакомств. Большое количество поверхностных контактов. Легкая смена знакомств. Снижена способность к крепкой длительной привязанности. Общительность настолько высока, что граничит с назойливостью.

Результаты теста МЦВ при поступлении в клинику.

Упорство в отстаивании своих позиций. Эгоцентрическая сосредоточенность на своих проблемах. Возбуждение, импульсивность и повышенная раздражительность на фоне выраженного переутомления. Беспокойные поиски новых взаимоотношений, которые могли бы принести радость и спокойствие.

Уровни депрессии - 9 (средний) и тревоги - 12 (средний) при поступлении в клинику.

При генотипировании выявлены предрасполагающие генотипы генов - рецептора дофамина D2 (1/1), рецептора дофамина D4 (аллеля 7), переносчика дофамина DAT (9/10) и глутаматдекарбоксилазы (a/g). Результаты интерпретированы как «максимальная предрасположенность к недостаточности дофаминового обмена в сочетании с недостаточностью обмена гамма-аминомасляной кислоты». Определен соответствующий психологический тип с периодами употребления ПАВ по «булимическому» типу, низким самоконтролем и компульсивностью.

Интерпретация профиля личности СМИЛ при выписке из клиники.

По эмоциональному состояние - настроение повышено. Гиперактивность. Склонность к соперничеству, демонстрации сильных черт характера, выносливости. По отношению к другим людям и положению в обществе - гибкость, отсутствие злопамятности и застревания на обидах. Отсутствие застенчивости. Стремление к лидерству. По отношению к собственной личности - высокая самооценка, уверенность в себе, переоценка собственных возможностей, недооценка объективных трудностей.

Результаты теста МЦВ при выписке из клиники.

Активность позиции, высокая мотивация достижения, потребность в обладании жизненными благами, стремление к доминированию, целенаправленность действий, непосредственность и раскрепощенность поведения, высокая самооценка, потребность в самореализации, противодействие обстоятельствам, препятствующим свободной самореализации личности, черты стеничности (активности) и мужественности, склонность к риску.

Уровни депрессии - 4 (низкий) и тревоги - 6 (низкий) при выписке из клиники.

Генетические методы исследования.

В качестве материала для генотипирования использовали ДНК, извлеченную из клеток слизистой оболочки рта методом фенол-хлороформной экстракции.

Полимеразная цепная реакция синтеза ДНК (ПЦР).

Амплификацию последовательностей в составе исследуемых генов осуществляли следующим образом. В среднем 200 нг геномной ДНК помещали в 25 мкл реакционного буфера, содержащего по 0,1-0,2 мМ каждого дезоксирибонуклеотидтрифосфата, 1 единицу активности Taq ДНК-полимеразы, 15 рМ каждого олигопраймера. Состав реакционного буфера для ПЦР: 16,6 мМ сульфата аммония, 67 мМ Tris-HCl, pH 8,8 при 250 С, 2,0 мМ хлорида магния, 0,1% Twin 20. В пробирку добавляли 2 капли минерального масла для предотвращения испарения и помещали в автоматический термоциклер (Терцик-2) для амплификации изучаемых последовательностей, используя следующую программу:

* Та - температура отжига для пары праймеров, длины фрагментов, последовательности праймеров, и ферменты рестрикции указаны для каждого гена в Таблице 1.

Для идентификации аллелей генов, содержащих однонуклеотидные замены, проводили рестрикцию продуктов амплификации с помощью эндонуклеаз (фирма «СибЭнзим»). Для этого к 25 мкл амплификата добавляли 2 мкл воды, 3 мкл 10× рестрикционного буфера и 2 е.а. фермента, смесь инкубировали 2-3 часа при температуре, оптимальной для каждой рестриктазы.

Таблица 1
Та Gene name Ферменты рестрикции Длины фрагментов Последовательности праймеров
68 SerT VNTR 20-23 bp 485 bp >R=ggc gtt gcc get ctg aat gc
528 bp >F=gag gga ctg age tgg аса асе ас
62 NPY Bse1I (BsrI) 147/141/109/ >F=aagttgcgcgaagttttcaggtggag
(NciI) 65C 288/109 395bp >R=gtgtcgcagcgccgagtagtatctgg
58-62 HTR2C 37C HinfI 174bp >2C-FF=taa ttg gcc tat tgg ttt ggg aat
gantc 152+22 >2C-RR171=gga tgt tgc cac cta ttg tea
62 GAD2 AluI 37C 80+52+47 127+52 >F=cct caa atg ctc tgg ggc tc
agct 178bp >R=ggt gtc acg cag gaa cag aa
58-62 МАОА VNTR 30 bp 2R=179bp >MAOV-F cccagcgtgctccagaaac
3R=209bp >MAOV-R ggacctgggcagttgtgc
5R=269bp 4R=239bp праймеры из статьи
58 MAOB 37C AsuHPI (HphI) 185bp >MAOB-F acactggcaaatagcaaagg
ggtga(n) 155+30 >MAOB-R gtaagcctaatgattggaacctc
58 DRD2 TaqI 65C 88+261 >DRD2-F2 аса tga tgc cct get ttc
tcga 349bp >DRD2-R2 aac tgg act ccc ctg cac
58 DBH TaqI 65C 300+164 >DBH-F=ctg tat ttg gaa ctt ggc ate
tcga 464bp >DBH-R=agg cat ttt act ace cag agg
58-68 DAT VNTR 40 bp 480 bp >T3-5L=tgt ggt gta ggg aac ggc ctg ag
440 bp >T7-3A=ctt cct gga ggt cac ggc tea agg

Проведение электрофореза и визуализация фрагментов ДНК.

Разделение продуктов амплификации и продуктов рестрикции ампликонов проводили в горизонтальном 3% агарозном геле для продуктов размером более 250 п.о. и в вертикальном 7% полиакриламидном геле (ПААГ) продуктов размером менее 250 п.о. По окончании электрофореза гели помещали на 5 мин в кювету с бромистым этидием (0,5 мкг/мл) для окрашивания ДНК.

Результаты электрофоретического разделения фрагментов ДНК регистрировали фотографированием окрашенного геля, помещенного на трансиллюминатор, через красный фильтр в проходящем ультрафиолетовом свете (длина волны 360 нм). Генотип по каждому гену определялся в соответствии с представленными в таблице 1 длинами фрагментов амплифицированной ДНК.

1. Способ профилактики и/или лечения зависимости от психоактивных веществ, включающий генотипирование по генам дофаминовой, серотониновой, норадреналиновой и гаммааминомасляной кислоты систем нейромедиаторного обмена, психодиагностическое тестирование с последующим формированием психологических типов в соответствии с полиморфизмами в указанных генах и назначение БАД и/или фармакотерапии с учетом результатов генотипирования и выявленных психологических типов с нарушением нейромедиаторного обмена.

2. Способ по п.1, характеризующийся тем, что при недостаточности дофаминового обмена при выявлении незначительной предрасположенности вводят БАД тирозин, при выявлении средней предрасположенности вводят БАД тирозин и диметиламиноэтанол (ДМАЕ), при выявлении высокой предрасположенности вводят БАД тирозин, ДМАЕ и препарат энерион, а при выявлении максимальной предрасположенности вводят БАД тирозин, ДМАЕ и препарат семакс.

3. Способ по п.1, характеризующийся тем, что при недостаточности серотонинового обмена при средней предрасположенности вводят БАД мелаксен, при выявлении высокой предрасположенности вводят БАД 5-гидрокситриптофан и мелаксен, а при выявлении максимальной предрасположенности вводят БАД 5-гидрокситриптофан, мелаксен и препарат асентра.

4. Способ по п.1, характеризующийся тем, что при избыточности серотонинового обмена при выявлении высокой предрасположенности вводят БАД таурин и ДМАЕ, а при выявлении максимальной предрасположенности вводят БАД таурин, ДМАЕ и препарат пиразидол.

5. Способ по п.1, характеризующийся тем, что при избыточности норадреналинового обмена при выявлении средней предрасположенности вводят БАД тирозин, а при выявлении максимальной предрасположенности вводят БАД тирозин и препарат ремерон.

6. Способ по п.1, характеризующийся тем, что при недостаточности дофаминового обмена в сочетании с избыточностью серотонинового обмена при выявлении незначительной предрасположенности вводят БАД ДМАЕ, при выявлении средней предрасположенности вводят БАД таурин и ДМАЕ, при выявлении высокой предрасположенности вводят БАД ДМАЕ и препарат пиразидол, а при выявлении максимальной предрасположенности вводят БАД таурин, ДМАЕ и препарат пиразидол.

7. Способ по п.1, характеризующийся тем, что при недостаточности дофаминового обмена в сочетании с недостаточностью серотонинового обмена при выявлении средней предрасположенности вводят БАД тирозин, при выявлении высокой предрасположенности вводят БАД тирозин и ДМАЕ, а при выявлении максимальной предрасположенности вводят БАД тирозин, ДМАЕ и препарат леривон.

8. Способ по п.2, характеризующийся тем, что при недостаточности дофаминового обмена в сочетании с недостаточностью обмена гаммааминомасляной кислоты при выявлении высокой предрасположенности вводят БАД таурин, ДМАЕ и препарат нейробутал.


Похожие патенты:

Изобретение относится к новым соединениям формулы (I) где: А представляет собой арил или 5-членный гетероарил, включающий гетероатом S, возможно замещенные одним-двумя заместителями, выбранными из группы, состоящей из галогено, C 1-6-алкила или C1-6-алкокси; n имеет значение 1 или 2; р имеет значение 1,2,3 или 4; q имеет значение 1; r имеет значение 0 или 1; R1 представляет собой С 2-6-алкинил, замещенный арилом, или представляет собой C1-6-алкил, возможно замещенный одним-пятью заместителями, выбранными из группы, состоящей из галогено, гидрокси, C 1-6-алкила, C1-6-галогеноалкила, -ОС(O)-С 1-6-алкила, С3-10-циклоалкила, C1-6 -алкокси, возможно замещенного одним, двумя или тремя галогено или замещенного арилом, арила, возможно замещенного галогено или C1-6-алкокси, 5-9-членного гетероарила, один, два или три кольцевых атома которого представляют собой гетероатомы, выбранные из N и О, а остальные кольцевые атомы представляют собой С, возможно замещенного C1-6-алкилом, и феноксила, или представляет собой C1-6-алкокси, или представляет собой С3-10-циклоалкил, возможно замещенный одним или более чем одним Ra, или представляет собой 5-6-членный гетероциклоалкил, включающий один, два или три гетероатома, выбранные из атома азота, кислорода или серы, возможно замещенный одним или более чем одним Ra, или представляет собой арил, возможно замещенный одним или более чем одним Ra, или представляет собой 5-10-членный гетероарил, один, два или три кольцевых атома которого представляют собой гетероатомы, выбранные из N, О и S, а остальные кольцевые атомы представляют собой С, возможно замещенный одним или более чем одним R a, или представляет собой -NRbRc, где Rb представляет собой Н или C1-6-алкил и где Rc представляет собой Н, C1-6-алкил или арил, возможно замещенный одним или более чем одним R a, где Ra выбран из: галогено, циано, оксо, гидрокси, галогенобензолсульфонила, C1-6-алкила, возможно замещенного одним, двумя или тремя заместителями, выбранными из группы, состоящей из 5-10-членного гетероциклоалкила и арила, который возможно замещен галогено или C1-6-алкокси, C1-6-галогеноалкила, C1-6-галогеноалкокси, C1-6-алкокси, возможно замещенного арилом или 5-10-членным гетероарилом, один, два или три кольцевых атома которого представляют собой гетероатомы, выбранные из N, О и S, а остальные кольцевые атомы представляют собой С, который возможно замещен C1-6 -алкилом, арилокси, -NH(СО)-С1-6-алкила, -O(CO)-C 1-6-алкила, C1-6-алкилсульфонила, арила, 4-6-членного гетероциклоалкила, включающего один, два или три гетероатома, выбранные из атома азота, кислорода или серы, возможно замещенного гидрокси, C1-6-алкилом или оксо, 5-10-членного гетероарила, один, два или три кольцевых атома которого представляют собой гетероатомы, выбранные из N и О, а остальные кольцевые атомы представляют собой С, возможно замещенного C1-6-алкилом или оксо, и ди(С1-6)алкиламино; R2 представляет собой Н, ОН, C1-6-алкил или галогено; а также к их фармацевтически приемлемым солям.
Изобретение относится к области медицины, а именно к средствам для профилактики и лечения алкоголизма и наркомании. .

Изобретение относится к способу лечения одной или более лекарственной зависимости, никотиновой зависимости и/или ожирения, включающему введение эффективного количества соединения, достаточного для уменьшения продуцирования и/или секреции допамина, причем соединение имеет следующую формулу: или его фармацевтически приемлемых солей, где R1 представляет собой водород или метил, когда R2 представляет собой Су; R2 представляет собой водород или метил, когда R1 представляет собой Су; и где Су представляет собой группу которая необязательно замещена -R, -OR, -NR2 или галогеном, где каждый R независимо является необязательно замещенным низшим алкилом, арилом или гетероарилом.

Изобретение относится к новым соединениям формулы I или к любому его изомеру, или любой смеси его изомеров,или к его фармацевтически приемлемой соли,гдеR1 представляет собой водород или алкил;R2 и R 3 вместе образуют -(СН2)2-, и R 2' и R3' представляют собой водород; m равно 1;n равно 1; Х представляет собой -O-; иQ представляет собой хромен-2-он-7-ил, который возможно замещен одним или более заместителями, независимо выбранными из группы, состоящей из галогено, трифторметила, трифторметокси, циано, гидрокси, амино, нитро, алкокси, циклоалкокси, алкила, циклоалкила, циклоалкилалкила, алкенила и алкинила.

Изобретение относится к новым производным общей формулы (I) в которой А, если он присутствует, означает (С1-С6)-алкил; R1 означает группу NR6R7, (С4-С7)-азациклоалкил, (С5-С 9)-азабициклоалкил, причем эти группы необязательно замещены одним или более заместителями, выбираемыми из (С1-С 5)-алкила или галогена; A-R1 является таким, что азот радикала R1 и азот в положении 1 пиразола обязательно разделены, по меньшей мере, двумя атомами углерода; R3 означает радикал Н, ОН, NH 2, ORc, NHC(O)Ra или NHSO2Ra; R4 означает фенил или гетероарил, необязательно замещенный одним или более заместителями, выбираемыми из галогена, CN, NH2, ОН, ORc, C(O)NH 2, фенила, полифторалкила, линейного или разветвленного (С1-С6)-алкила, причем эти заместители необязательно замещены галогеном, и причем гетероарильные радикалы являются 3-10-членными, содержащими один или более гетероатомов, выбранных из серы и азота; R5 означает радикал Н, линейный или разветвленный (С1-С6)-алкил; Ra означает линейный или разветвленный (С1-С6)-алкил; Rc означает линейный или разветвленный (С1-С6 )-алкил, (поли)фторалкил или фенил; R6 и R7 независимо друг от друга означают водород, (С1-С6)-алкил; R6 и R7 могут образовывать 5-, 6- или 7-членный насыщенный или ненасыщенный цикл, включающий один гетероатом, такой как N, и который необязательно замещен одним или более атомами галогена; к его рацематам, энантиомерам, диастереоизомерам и их смесям, к их таутомерам и их фармацевтически приемлемым солям за исключением 3-(3-пиридинил)-1Н-пиразол-1-бутанамина, 4-(3-пиридинил)-1Н-пиразол-1-бутанамина и N-(диэтил)-4-фенил-1Н-пиразол-1-этиламина.

Изобретение относится к новым сложноэфирным производным 2-амино-бицикло[3.1.0]гексан-2,6-дикарбоновой кислоты формулы [I] или [II] и их фармацевтически приемлемым солям, обладающим свойствами антагониста метаботропных глутаматных рецепторов II группы.
Изобретение относится к медицине и описывает фармацевтическую форму введения через слизистую оболочку, имеющую плоскую конфигурацию, состоящую из твердого раствора биологически активного вещества в фосфатидилхолиновой фракции, в которой остатки жирных кислот, по меньшей мере, на 90% являются насыщенными, и содержит, по меньшей мере, 80 мас.% фосфатидилхолиновой фракции.

Изобретение относится к соединениям общей формулы II в качестве антагониста рецептора нейропептида FF, их фармацевтически приемлемым кислотно-аддитивным солям, лекарственному средству на их основе, а также к их применению.

Изобретение относится к медицине и предназначено для лечения нервно-психической анорексии или булимии. .

Изобретение относится к средству, снижающему влечение к алкоголю, представляющему собой замещенные 1H-бензимидазолы общей формулы 1 или их фармацевтически приемлемые соли и/или гидраты, фармацевтической композиции и лекарственному средству на их основе.

Изобретение относится к новым соединениям общей формулы где R1 представляет собой группу или или или R2 представляет собой морфолин или представляет собой OR' или N(R'')2 ; R' представляет собой низший алкил, низший алкил, замещенный галогеном, или -(СН2)n-циклоалкил; R'' представляет собой низший алкил; R3 представляет собой NO2 или SO2R'; R4 представляет собой водород, гидрокси, галоген, NO2, низший алкокси, SO2R' или C(O)OR''; R5/R 6/R7 представляют собой водород, галоген, низший алкил; Х1/Х1' представляют собой СН или N при условии, что Х1/Х1' одновременно не являются СН; X2 представляет собой О или S; n представляет собой 0 или 1; и к их фармацевтически активным кислотно-аддитивным солям.

Изобретение относится к медицине, а именно к амбулаторной хирургии, и может быть использовано для лечения ногтевого панариция. .

Изобретение относится к соединениям формулы (I): или к его фармацевтически приемлемой соли, где Х представляет собой СН; R1 представляет собой фенил или 6-членный гетероарил, включающий 1 или 2 атома азота в качестве гетероатома, независимо и необязательно замещенный вплоть до пяти группами J; R2 и R3, каждый независимо, представляет собой водород, галоген, -V-R или -V-R a; R5 представляет собой R; R представляет собой Н или необязательно замещенную C1-6алифатическую группу, где заместители выбирают из -ORo, фенила, замещенного Ro, - N(Ro)2; где каждый независимый Ro выбирают из водорода, галогена, C1-6 алифатической группы; Rа представляет собой морфолин; V представляет собой связь или Q; Q представляет собой -NR 5-; каждая группа J независимо представляет собой галоген, -N(R5)2.

Изобретение относится к области медицины и может быть использовано в контрольно-аналитических лабораториях для стандартизации и контроля качества лекарственных средств.

Изобретение относится к новым соединениям формулы к их солям, где R1 и R 2 - каждый, независимо представляет собой водород или С 1-10алкил, который может быть необязательно замещен заместителем, выбранным из группы, включающей гидроксильную группу, NR 4R5, пирролидинил, пиперидинил, морфолинил; R3 представляет собой радикал формулы где n равно 1; R3a представляет собой нитро; Х представляет собой -NR7- или -O-; R 4 и R5 - каждый, независимо представляет собой C1-6алкил; R7 представляет собой водород, C1-6алкил, необязательно замещенный пирролидинилом.

Изобретение относится к области медицины и может быть использовано в контрольно-аналитических лабораториях для стандартизации и контроля качества лекарственных средств.

Изобретение относится к новым соединениям формулы I: где атом углерода, обозначенный *, находится в R- или S-конфигурации; Х означает конденсированный бициклический карбоцикл или гетероцикл, выбранный из группы, состоящей из бензофуранила, бензо[b]тиофенила, бензоизотиазолила, индазолила, индолила, бензооксазолила, бензотиазолила, инденила, инданила, дигидробензоциклогептенила, нафтила, тетрагидронафтила, хинолинила, изохинолинила, хиноксалинила, 2Н-хроменила, имидазо[1,2-а]пиридинила, пиразоло[1,5-а]пиридинила, и конденсированный бициклический карбоцикл или конденсированный бициклический гетероцикл, необязательно замещен заместителями (в количестве от 1 до 4), которые определены ниже для R14 ; R1 означает Н, C1-С6-алкил, С3-С6-циклоалкил, C1-С3 -алкил, замещенный OR11, -NR9R10 или -CN; R2 означает Н, C1-С6 -алкил, или гем-диметил; R3 означает Н, -OR11 , C1-С6-алкил или галоген; R4 означает Н, галоген, -OR11, -CN, C1-С 6-алкил, C1-С6-алкил, замещенный -NR9R10, С3-С6-циклоалкил, замещенный -NR9R10, C(O)R12; или R4 означает морфолинил, пиперидинил, пиримидинил, пиридазинил, пиразинил, пирролил, изоксазолил, пирролидинил, пиперазинил, 2-оксо-2Н-пиридинил, [1,2,4]триазоло[4,3-а]пиридинил, 3-оксо-[1,2,4]триазоло[4,3-а]пиридинил, хиноксалинил, которые необязательно замещены заместителями (в количестве от 1 до 4), которые определены ниже для R14; R5 означает Н или C1-С6-алкил; R6 означает Н, C1-С6-алкил или -OR11; R 7 означает Н; R8 означает Н, -OR9 , C1-С6-алкил, -CN; R9 означает Н или C1-C4-алкил; R10 означает Н или С1-С4-алкил; или R9 и R10, взятые вместе с атомом азота, с которым они связаны, образуют морфолин; R11 означает Н, С1-С 4-алкил; R12 означает С1-С4 -алкил; R14 в каждом случае независимо выбирают из заместителя, выбранного из группы, состоящей из галогена, -OR 11, -NR11R12, C1-С 6-алкила, который необязательно замещен 1-3 заместителями, в каждом случае независимо выбранными из группы, состоящей из C1-С3-алкила, арила; или к их фармацевтически приемлемым солям.

Изобретение относится к медицине, в частности к фармакологии, и касается применения производных гамма-аминомасляной кислоты в виде солей 4-амино-3-фенилбутановой кислоты общей формулы (1) в качестве анксиолитического и церебропротекторного средства, уменьшающего влечение к алкоголю.

Изобретение относится к медицине, а именно к психиатрии, и может быть использовано при профилактике иили лечении зависимости от психоактивных веществ
