Способ получения сиалилированных олигосахаридов

Авторы патента:


Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов
Способ получения сиалилированных олигосахаридов

 


Владельцы патента RU 2473695:

СЕНТР НАСЬОНАЛЬ ДЕ ЛЯ РЕШЕРШ СЬЕНТИФИК (СНРС) (FR)

Изобретение относится к области микробиологии и молекулярной биологии. Предложен способ крупномасштабного синтеза in vivo сиалилированных олигосахаридов и микроорганизм, содержащий гетерологичные гены, кодирующие GlcNAc-синтетазу, синтазу сиаловой кислоты, GlcNAc-6-фосфат-2-эпимеразу и сиалилтрансферазу, при этом эндогенные гены, кодирующие альдолазу сиаловой кислоты (NanA) и ManNac-киназу (NanK) были делегированы или инактивированы. Изобретение может быть использовано в технологиях промышленного синтеза сиалилгалактозы. 4 н. и 50 з.п. ф-лы, 4 табл., 20 ил., 17 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к способу крупномасштабного синтеза in vivo сиалилированных олигосахаридов, к культивированию микроорганизмов в культуральной среде, возможно содержащей экзогенный предшественник, такой как лактоза, причем указанный микроорганизм содержит гетерологичные гены, кодирующие CMP-Neu5Ac-синтетазу, синтазу сиаловой кислоты, GlcNAc-6-фосфат-2-эпимеразу и сиалилтрансферазу, и при этом эндогенные гены, кодирующие альдолазу сиаловой кислоты (NanA) и ManNac-киназу (NanK), были делегированы или инактивированы. Изобретение относится также к этому микроорганизму, который способен продуцировать внутренне активированную сиаловую кислоту.

Предшествующий уровень техники

N-ацетилнейраминовая кислота (Neu5Ac) - это наиболее типичный представитель аминосахаров семейства сиаловых кислот. Neu5Ac часто оказывается оконечным сахаром в комплексе углеводов клеточной поверхности и играет главную роль во многих биологических процессах, таких как адгезия клеток и связывание токсинов и вирусов (Varki, 1993). Neu5Ac является также главным компонентом углеводной части ганглиозидов, которые заметно избыточны в ткани мозга и участвуют в развитии нескольких патологических процессов (Zhang and Kiechle, 2004).

В связи с их важными биологическими функциями содержащие сиаловые кислоты олигосахариды вызывали значительный интерес, и для синтеза этих структур в целях фундаментальных исследований и возможных терапевтических применений были разработаны многие методы. Однако до сих пор крупномасштабное производство сиалилированных олигосахаридов не удавалось осуществить.

Методы химического синтеза нецелесообразны из-за необходимости вводить много этапов защиты и снятия защиты, поэтому много усилий было приложено к разработке ферментативных и биотехнологических методов. Сиалилтрансферазы в качестве активированных сахаро-нуклеотидов используют CMP-Neu5Ac, и разработка эффективных процессов ферментативного синтеза сиалилоолигосахаридов стала возможной благодаря идентификации бактериальных генов сиалилтрансферазы, которые хорошо экспрессируются в E. coli, и конструированию систем со многими ферментами, которые имитируют природный путь биосинтеза сахаро-нуклеотидов (Gilbert et al., 1998).

Позднее значительный успех был достигнут благодаря использованию живых бактериальных клеток для получения сиалилоолигосахаридов (Priem et al, 2002). В этом подходе сиалиллактоза непосредственно продуцировалась растущими клетками метаболически сконструированных штаммов Escherichia coli, сверхэкспрессирующими гены для α-2,3-сиалилтрансферазы Neisseria meningitidis и CMP-Neu5Ac-синтазы. Бактерии выращивали до высокой плотности клеток с глицерином в качестве источника углерода и энергии, тогда как в качестве предшественников в синтезе сиалиллактозы добавляли экзогенные лактозу и Neu5Ac. В ходе роста лактоза и Neu5Ac активно интернализались клетками с помощью пермеаз β-галактозида и Neu5Ac Е. coli. Чтобы предотвратить катаболизм лактозы и Neu5Ac, использовали мутантные штаммы, лишенные активности β-галактозидазы и Neu5Ac-aльдoлaзы. Лактоза и Neu5Ac накапливались в цитоплазме, где Neu5Ac затем превращалась в CMP-Neu5Ac, чтобы быть далее перенесенной на лактозу с образованием сиалиллактозы (Европейский патент заявителей ЕР 1194584). Эта система была применена для продукции углеводной части ганглиозидов GM2 и GM1 путем дополнительной экспрессии соответствующих генов гликозилтрансферазы (Antoine et al., 2003). Полисиалилированные олигосахариды (сахара GD3 и GT3) также были получены этим методом и с использованием гена Campylobacter cstll, кодирующего бифункциональную α-2,3- и α-2,8-сиалилтрансферазу (заявка авторов US 60/690 837 и Antoine et al., 2005).

Для крупномасштабной продукции сиалилоолигосахаридов с помощью этого микробиологического метода требуются большие количества сиаловой кислоты в качестве предшественника. Сиаловую кислоту можно очистить из природных источников, таких как молоко и яичный желток, но ее выходы низки и процедура непригодна для крупномасштабного производства. Сиаловую кислоту в основном получают ферментативным синтезом с помощью альдолазы сиаловой кислоты, используя N-ацетилманнозамин (ManNAc) и пируват в качестве субстрата. Чтобы снизить стоимость, ManNAc обычно получают химической или ферментативной эпимеризацией N-ацетилманнозамина, который является более дешевым субстратом, чем ManNAc (Lee et al., 2004; Maru et al., 1998). Несмотря на эти усовершенствования, стоимость сиаловой кислоты остается относительно высокой, и эта стоимость тормозит разработку экономичной системы для продукции сиалоолигосахаридов.

Кроме того, штаммы, подобные Е. coli K1 и N. meningitidis, способны продуцировать CMP-Neu5Ac, но являются патогенными и не могут использоваться в биотехнологических процессах из соображений безопасности. Большинство других бактерий, в том числе Е. coli К12, не имеют ферментативного аппарата для биосинтеза CMP-Neu5Ac, и целью настоящего изобретения является генно-инженерное конструирование непатогенных штаммов, которые были бы способны продуцировать CMP-Neu5Ac из эндогенного UDP-GlcNAc.

В соответствии с настоящим изобретением авторы сконструировали новую микробиологическую систему для экономичного крупномасштабного производства сиалоолигосахаридов без необходимости внесения экзогенной сиаловой кислоты. Метаболически сконструированные микроорганизмы согласно настоящему изобретению жизнеспособны, непатогенны и могут быть использованы в крупномасштабных и промышленных процессах культивирования. Они имеют оптимизированные модифицированные пути биосинтеза и делецию бесполезных метаболических циклов, и это приводит к биосинтезу активированной CMP-Neu5Ac, которая работает как in situ донор сиаловой кислоты с образованием сиалилированных олигосахаридов.

Краткое изложение сущности изобретения

Настоящее изобретение предоставляет способ продукции сиалилированных олигосахаридов в ходе ферментационного роста микроорганизмов. В частности, изобретение относится к способу синтеза олигосахаридов, содержащих один или несколько остатков сиаловой кислоты, без какого-либо добавления в культуральную среду экзогенной сиаловой кислоты, включающему (но не ограниченному ими):

- олигосахаридные части молекул ганглиозидов, выбранные из GM3 (3'-сиалиллактоза, Neu5Acα-3Galβ-4Glc) и олигосахариды, содержащие мотив GM3

GD3 (Neu5Acα-8Neu5Acα-3Galβ-4Glc)

GT3 (Neu5Acα-8Neu5Acα-8Neu5Acα-3Galβ-4Glc)

GM2 (GalNAcβ-4(Neu5Acα-3)Galβ-4Glc)

GM1 (Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc)

GD1a (Neu5Acα-3Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc)

GT1a (Neu5Acα-8Neu5Acα-3Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc)

GD2 (GalNAcβ-4(Neu5Acα-8Neu5Acα-3)Galβ-4Glc)

GT2 (GalNAcβ-4(Neu5Acα-8Neu5Acα-8Neu5Acα-3)Galβ-4Glc)

GD1b (Galβ-3GalNAcβ-4(Neu5Acα-8Neu5Acα-3)Galβ-4Glc)

GT1b (Neu5Acα-3Galβ-3GalNAcβ-4(Neu5Acα-8Neu5Acα-3)Galβ-4Glc)

GQ1b (Neu5Acα-8Neu5Acα-3Galβ-3GalNAcβ-4(Neu5Acα-8Neu5Acα-3)Galβ-4Glc)

GT1с (Galβ-3GalNAcβ-4(Neu5Acα-8Neu5Acα-8Neu5Acα-3)Galβ-4Glc)

GQ1c (Neu5Acα-3Galβ-3GalNAcβ-4(Neu5Acα-8Neu5Acα-8Neu5Acα-3)Galβ-4Glc)

GP1c(Neu5Acα-8Neu5Acα-3Galβ-3GalNAcβ-4(Neu5Acα-8Neu5Acα-8Neu5Acα-3)Galβ-4Glc)

GD1a (Neu5Acα-3Galβ-3(Neu5Acα-6)GalNAcβ-4Galβ-4Glc)

Фукозил-GM1 (Fuca-2Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc), все из которых могут быть распространены на продукцию соответствующих ганглиозидов путем проведения реакции указанных выше олигосахаридных группировок с церамидом;

- другие сиалилированные сахара, в том числе:

6'-сиалиллактозу (Neu5Acα-6Galβ-4Glc) и олигосахариды, содержащие 6'-сиалиллактозу

гексасахарид SGG (Neu5Acα-3Galβ-3GalNAcβ-3Galα-4Galβ-4Gal)

сиалилированный тетрасахарид (Neu5Acα-3Galβ-4GlcNAcβ-4GlcNAc)

пентасахарид LSTD (Neu5Acα-3Galβ-4GlcNAcβ-3Galβ-4Glc).

В одном конкретном аспекте процесс согласно настоящему изобретению основан на активном захвате экзогенного предшественника, такого как, например, моно-, ди- или трисахарид, более конкретно экзогенного предшественника, выбранного из лактозы, галактозы, β-галактозида и α-галактозида, такого как глоботриоза (Galα-4Galβ-4Glc), в процессе роста клеток на альтернативном углеродном субстрате, таком как глицерин или глюкоза. Подразумевается, что выражение «экзогенный предшественник» обозначает соединение, вовлеченное в путь биосинтеза олигосахарида согласно настоящему изобретению, которое интернализуется клетками (включается внутрь клеток).

Предлагается также метаболически сконструированный микроорганизм, который может специфически продуцировать указанные выше сиалилированные олигосахариды без побочных продуктов, таких как GA1, GA2, СА3, GA4 и GA5, и в котором для специфической продукции GM1 используется ген cstlll, выделенный из штаммов С.jejuni, экспрессирующих липоолигосахаридные структуры, имитирующие ганглиозид GM1, таких как штамм С.jejuni (NCTC, №доступа 11168).

Описание фигур

Фиг.1 показывает продукцию сиалиллактозы метаболически сконструированным штаммом E. coli.

Фиг.2 показывает образование побочных продуктов в ходе продукции сахара GM1 метаболически сконструированными штаммами Е. coli.

Фиг.3 показывает образование побочных продуктов в ходе биосинтеза сахара GM2.

Фиг.4 показывает путь биосинтеза UDP-Gal.

Фиг.5 показывает образование побочных продуктов в ходе биосинтеза сахара GD2.

Фиг.6 показывает стратегию продукции GT1a с использованием сиалилтрансферазы.

Фиг.7 показывает метаболически сконструированный путь продукции сахара LSTD (Neu5Acα-3Galβ-4GlcNacβ-3Galβ-4Glc) из экзогенной лактозы.

Фиг.8 показывает метаболически сконструированный путь продукции гексасахарида SGG (Neu5Acα-3Galβ-3GalNAcβ-3Galα-4Galβ-4Gal) из экзогенной глоботриозы.

Фиг.9 показывает метаболически сконструированный путь продукции сиалилированного тетрасахарида (Neu5Acα-3Galβ-4GlcNAcβ-4GlcNAc).

Фиг.10 представляет результаты анализа с помощью тонкослойной хроматографии (ТСХ) внутриклеточной и внеклеточной фракций клеточной культуры с высокой плотностью клеток штамма DC7 с постоянной подпиткой лактозой. Дорожка 1: стандартный раствор лактозы, лакто-N-неотетраозы (LNnT), лакто-N-неогексаозы (LNnH) (2 мг/мл каждой). Дорожки 2, 3, 4, 5, 6 и 7: внутриклеточные фракции, отобранные через 0, 7, 23, 31, 47 и 54 ч после добавления лактозы. Дорожки 8, 9, 10, 11, 12 и 13: внеклеточные фракции, отобранные через 0, 7, 23, 31, 47 и 54 ч после добавления лактозы. Ранее было показано, что сиалиллактоза (2) движется так же, как тетрасахарид LNnT.

Фиг.11 показывает продукцию сиалиллактозы в клеточной культуре высокой плотности штамма DC7 с постоянной подпиткой лактозой. суммарное количество добавленной лактозы; (□) внутриклеточная сиалиллактоза; (■) внеклеточная сиалиллактоза; (-) рост бактерий.

Фиг.12 представляет результаты анализа с помощью ТСХ олигосахаридов, продуцируемых клеточной культурой с высокой плотностью клеток штамма NF03, содержащего плазмиды pUC18-cstll и pBBR3-SS. Начальная концентрация лактозы была равна 3 г/л. Дорожка 1: стандартный раствор лактозы, лакто-N-неотетраозы (LNnT), лакто-N-неогексаозы (LNnH) (2 мг/мл каждой). Дорожки 2 и 3: внутриклеточные фракции, отобранные через 7 и 24 ч после добавления лактозы. Дорожки 4 и 5: внеклеточные фракции, отобранные через 7 и 24 ч после добавления лактозы.

Фиг.13 представляет результаты анализа с помощью ТСХ олигосахаридов, продуцируемых клеточной культурой с высокой плотностью клеток штамма DC15 (pBS-cgtAll-nst, pBBR3-SS-wbpP, pSU-cgtB). Начальная концентрация лактозы составляла 5 г/л. Дорожка 1: стандартный раствор лактозы, лакто-N-неотетраозы (LNnT), лакто-N-неогексаозы (LNnH) (2 мг/мл каждой). Дорожки 2, 3, 4, 5: внутриклеточные фракции, отобранные через 7, 20, 30 и 44 ч после добавления лактозы. Дорожки 6, 7, 8, 9: внеклеточные фракции, отобранные через 7, 20, 30 и 44 ч после добавления лактозы. Сиалиллактоза (1) и сахар GM1 (3) движутся как соответственно LNnT и LNnH.

Фиг.14 представляет результаты анализа с помощью ТСХ олигосахаридов, продуцируемых клеточной культурой с высокой плотностью клеток штамма DC21 (pBS-cgtAll-nst, pBBR3-SS-gne, pSU-cgtB). Начальная концентрация лактозы составляла 5 г/л. Дорожки 1 и 10: стандартный раствор лактозы, лакто-N-неотетраозы (LNnT), лакто-N-неогексаозы (LNnH) (2 мг/мл каждой). Дорожки 2, 3, 4, 5: внутриклеточные фракции, отобранные через 5, 20, 28 и 44 ч после добавления лактозы. Дорожки 6, 7, 8, 9: внеклеточные фракции, отобранные через 5, 20, 28 и 44 ч после добавления лактозы. Сиалиллактоза (1) и сахар GM1 (3) движутся как соответственно LNnT и LNnH.

Фиг.15 представляет результаты анализа с помощью ТСХ олигосахаридов, продуцируемых клеточной культурой с высокой плотностью клеток штамма DC22 (pBS-cstlll-cgtAll, pBBR3-SS-gne, pSU-cgtB). Начальная концентрация лактозы составляла 5 г/л. Дорожки 1 и 10: стандартный раствор лактозы, лакто-N-неотетраозы (LNnT), лакто-N-неогексаозы (LNnH) (2 мг/мл каждой). Дорожки 2, 3, 4, 5: внутриклеточные фракции, отобранные через 7, 20, 30 и 44 ч после добавления лактозы. Дорожки 6, 7, 8, 9: внеклеточные фракции, отобранные через 7, 20, 30 и 44 ч после добавления лактозы. Сиалиллактоза (1) и сахар GM1 (3) движутся как соответственно LNnT и LNnH.

Фиг.16 представляет результаты анализа с помощью ТСХ олигосахаридов, продуцируемых клеточной культурой с высокой плотностью клеток штамма ZWT (ZLKA, pBS-nst, pBBRS-SS-gne, pWKS-cgtAll). Начальная концентрация лактозы составляла 5 г/л. Дорожка 1: стандартный раствор лактозы, лакто-N-неотетраозы (LNnT), лакто-N-неогексаозы (LNnH) (2 мг/мл каждой). Дорожки 2, 3, 4: внутриклеточные фракции, отобранные через 0, 7 и 22 ч после добавления лактозы. Дорожки 5, 6, 7: внеклеточные фракции, отобранные через 0, 7 и 22 ч после добавления лактозы.

Фиг.17 представляет результаты анализа с помощью ТСХ олигосахаридов, продуцируемых клеточной культурой высокой плотности штамма ZWU2 (ZWU, pBS-nst, pBBRS-SS-gne, pWKS-cgtAll). Начальная концентрация лактозы составляла 5 г/л. Дорожка 1: стандартный раствор лактозы, лакто-N-неотетраозы (LNnT), лакто-N-неотетраозы (LNnH) (2 мг/мл каждой). Дорожки 2, 3, 4 и 5:

внутриклеточные фракции, отобранные через 0, 7, 22 и 30 ч после добавления лактозы. Дорожки 6, 7, 8 и 9: внеклеточные фракции, отобранные через 0, 7, 22 и 30 ч после добавления лактозы.

Фиг.18 показывает спектр масс (масс-спектрометрия с электрораспылением) компонента фракции (2), очищенного из внутриклеточной фракции контрольного штамма ZWT (А) и мутантного по galU штамма ZWU2 (Б). Пик при m/z=835 соответствует сахару GM2, а пик при m/z=794 соответствует галактозилированному аналогу (сахар GA2).

Фиг.19 представляет результаты анализа с помощью ТСХ фракций, полученных после разделения внутриклеточной фракции из культуры объемом 1 л штамма ZWU1. Разделение проводили на смоле Dowex 1 (в форме HCO3-) при градиенте NaHCO3 0-1 М. Объем каждой пробирки составлял 10 мл. Выход фракций А, Б, В и Г был равен соответственно 0,5 г, 0,85 г, 0,6 г и 1,2 г.

Фиг.20 представляет результаты анализа с помощью ТСХ олигосахаридов, продуцируемых клеточной культурой высокой плотности штамма NF17 (ZLKA, pBS-cgtA-cstll, pSU-cgtB, pBBR-SS-gne). Начальная концентрация лактозы составляла 5 г/л. Дорожки 1 и 10: стандартный раствор лактозы, лакто-N-неотетраозы (LNnT), лакто-N-неогексаозы (LNnH) (2 мг/мл каждой). Дорожки 2, 3, 4 и 5: внутриклеточные фракции, отобранные через 7, 22, 30 и 46 ч после добавления лактозы. Дорожки 6, 7, 8 и 9: внеклеточные фракции, отобранные через 7, 22, 30 и 46 ч после добавления лактозы.

Описание происхождения генетического материала

Таблица 1
Использованные в настоящем изобретении гены, плазмиды и штаммы Escherichia coli
Описание Ссылка или источник
Гены
nst α-2,3-сиалилтрансфераза из штамма МС58 N. meningitidis L3 U60660
neuА CMP-NeU5Aс-синтетаза из C.jejuni, штамм АТСС 43438 AF400048
neuВ Синтаза сиаловой кислоты из C.jejuni, штамм АТСС 43438 AF400048
neuС Glc-6-фосфат-2-эпимераза из C.jejuni, штамм АТСС 43438 AF400048
ctgA β-4-GlcNАс-трансфераза из С.jejuni O:19, штамм ОН4384 AF130984
wbpP UDP-GlcNAc-C4-эпимераза из Р. aeruginosa AF035937
gne(Cj1131c) UDP-GlcNAc-С4-эпимераза из С.jejuni O:2, штамм NCTC11168 AL139077
cstlll (Cj1140) α-2,3-сиалилтрансфераза из С.jejuni O:2, штамм NCTC11168 AL139077
cgtAll β-4-GlcNAc-трансфераза из С.jejuni O:36, штамм АТСС 43456 AF401528
cgtB (Cj1139c) β-3-Gal-трансфераза из С.jejuni O:2, штамм NCTC 11168 AL139077
cstll α-2,3-, α-2,8-сиалилтрансфераза из С.jejuni, штамм АТСС 43438 AF400048
nodC N-ацетилглюкозаминилтрансфераза из Azorhizobium caulinodans ААВ51164
IgtB β-1,4-галактозилтрансфераза из Neisseria meningitidis ААС44085
chtA хитиназа из Bacillus circulans ААА81528
Плазмиды
pWKS130 Клонирующий вектор, Kmr, промотор Plac, низкое число копий, репликон р8С101 (Wang and Kushner, 1991)
PSU27-18 Полученный из pACYC184 клонирующий вектор, Cm', промотор Plac (Martinez et al., 1988)
pBAD33 Полученный из pACYC184 клонирующий вектор, Cmr, промотор Para (Guzman et al., 1995)
pBS-nst Производная плазмиды pBluescript II SK, несущая nst (первоначально называвшаяся NST-01) (Priem et al., 2002)
pBBR-IMCS-3 Клонирующий вектор, Tcr, промотор Plac, низкое число копий (Kovach et al., 1995)
pBBR3-SS Производная pBBR1MCS-3, несущая neuАВС данное изобретение
pBBR3-SS-wbpP Производная pBBR1MCS-3, несущая neuАВС и wbpP данное изобретение
pBBR3-SS-gne Производная pBBR1MCS-3, несущая neuАВС и gne данное изобретение
pUC-cstll Производная pUC18, несущая cstll данное изобретение
pBS-cgtAll-nst Производная pBluescript II SK, несущая cgtAll и nst данное изобретение
pBS-cgtA-cstll Производная pBluescript II KS, несущая cgtA и cstll данное изобретение
pSU18-cgtB Производная pSU27 18, несущая cgtB данное изобретение
pBS-cstlll-cgtAll Производная pBluescript II KS, несущая cstlll и cgtAll данное изобретение
pWKS-cgtAll Производная pWKS130, несущая cgtAll данное изобретение
pBAD33-cgtAll Производная pBAD33, несущая cgtAll данное изобретение
pWKS-lgtB-chiA Производная pWKS130, несущая nst и ген хитиназы chiA (Dumon et al., 2005)
pBS-nst-nodC Производная pBluescript II SK, несущая nodC и nst из A. caulinodans данное изобретение
pBS-cstll-cgtB Производная pBluescript II SK, несущая cstll и cgtB данное изобретение
Штаммы
DC DH1 lacZ lacA (Dumon et al., 2005)
GLK DH1 lacZ lacA galK (Dumon et al., 2005)
ZLKA DC ΔnanKETA данное изобретение
AZL DC nanA данное изобретение
AZK DC ΔnanK nanA данное изобретение
ZWU ZLKA galU данное изобретение
GLKA GLK ΔnanKETA данное изобретение
ZW ZLKA melA wcaJ данное изобретение
DC6 DC (pBS-nst, pBBR3-SS) данное изобретение
AW1 AZL (pBS-nst, pBBR3-SS) данное изобретение
DC7 ZLKA (pBS-nst, pBBR3-SS) данное изобретение
DC7 ZLKA (pBS-nst, pBBR3-SS) данное изобретение
DC0 ZLKA (pBS-nst) данное изобретение
AZK1 AZK (pBS-nst, pBBR3-SS) данное изобретение
NFS ZLKA (pUC-cstll, pBBR3-SS) данное изобретение
DC15 ZLKA (pBS-cgtAll-nst, pBBR3-SS-wbpP, pSU-cgtB) данное изобретение
DC21 ZLKA (pBS-cgtAll-nst, pBBR3-SS-gne, pSU-cgtB) данное изобретение
DC22 ZLKA (pBS-cstlll-cgtAll, pBBR3-SS-gne, pSU-cgtB) данное изобретение
ZWT ZLKA (pBS-nst, pBBR-SS-gne, pWKS-cgtAll) данное изобретение
ZWU2 ZWU (pBS-nst, pBBR-SS-gne, pWKS-cgtAll) данное изобретение
NF08 ZLKA(pUC18-cstll, pBBR3-SS-gne, pWKS-cgtAll) данное изобретение
NF09 ZLKA(pUC18-cstll, pBBR3-SS-gne, pBAD33-cgtAll) данное изобретение
ZWU1 ZWU (pUC18-cstll, pBBR3-SS-gne, pBAD33-cgtAll) данное изобретение
NF17 ZLKA(pBS-cgtA-cstll, pSU-cgtB, pBBR-SS-gne) данное изобретение
GLK7 GLKA (pBS-nst, pBBR3-SS) данное изобретение
SN4 ZLKA (pBS-nst-nodC, pBBR3-SS, pWKS-lgtB-chiA) данное изобретение
NF21 ZLKA(pBS-cstll-cgtB, pBBR3-SS-gne, pBAD33-cgtAll) данное изобретение

Детальное описание изобретения

В первом варианте осуществления изобретение относится к способу продукции олигосахаридов, содержащих по меньшей мере один остаток сиаловой кислоты, которые здесь названы сиалилированными олигосахаридами, при этом способ включает этап, состоящий в культивировании микроорганизма в культуральной среде, возможно содержащей экзогенный предшественник, причем указанный микроорганизм способен продуцировать внутренне активированную сиаловую кислоту и содержит гетерологичные гены, кодирующие CMP-Neu5Ac-синтетазу, синтазу сиаловой кислоты, GlcNAc-6-фосфат-2-эпимеразу и сиалилтрансферазу, и при этом эндогенные гены, кодирующие альдолазу сиаловой кислоты (NanA) и ManNac-киназу (NanK), были делегированы или инактивированы.

В указанном выше способе и в зависимости от конечного пункта, гетерологичный ген сиалилтрансферазы может быть выбран из генов для α-2,3-сиалилтрансферазы (например, кодируемой nst), α-2,3-, α-2,8-сиалилтрансферазы (cstll) и α-2,3-сиалилтрансферазы (cstlll) или α-2,6-сиалилтрансферазы. Геном для гетерологичной CMP-Neu5F-синтетазы может быть neuА, геном гетерологичной синтазы сиаловой кислоты может быть neuВ, а геном гетерологичной GlcNAc-6-фосфат-2-эпимеразы может быть neuС. Гены neuА, neuВ и neuС могут быть выделены из бактериальных штаммов, имеющих в своей клеточной оболочке сиалилированную структуру, таких как С.jejuni из коллекции АТСС, № доступа 43438.

Гены лап Т, nanА, nanК и nanЕ являются частями одного и того же оперона, который регулируется связывающимся с ДНК белком NanR и индуцируется Neu5Ac (Kalivoda et al., 2003). Поэтому микроорганизмы согласно настоящему изобретению могут быть также nanКЕАT-. Таким образом, продукция Neu5Ac как промежуточного соединения в ходе синтеза CMP-Neu5Ac генетически сконструированным штаммом, сверхэкспрессирующим гены neuВСА, может индуцировать путь катаболизма сиаловой кислоты и создать два ненужных цикла, которые будут снижать продуктивность биосинтеза бактерией CMP-Neu5Ac. Первый бесполезный цикл может быть результатом объединения активностей синтазы сиаловой кислоты NeuB и альдолазы сиаловой кислоты NanA. Второй бесполезный цикл может быть результатом совместного действия UDP-GlcNAc-2-эпимеразы NeuC, 4 ферментов: NanK, NanE, NanA и GlmM, - и GlmU, который катализирует образование UDP-GlcNAc из ManNAc. Согласно предлагаемому здесь способу предотвращается разрушение Neu5Ac и ManNAc. Это может быть сделано выгодным образом путем разрушения генов nanА и nanК в штаммах, которые будут использованы в продукции сиалилоолигосахаридов. В одном из конкретных вариантов осуществления изобретения гены nanТ, nanА, nanК и nanЕ делегированы или инактивированы. Это можно осуществить, например, удалением всего оперона.

В предпочтительном варианте осуществления изобретения указанный выше микроорганизм кодирует белок, который способствует захвату клетками лактозы, и не содержит ферментов, метаболизирующих лактозу. Например, у Е. coli клетки предпочтительно являются LacZ- (β-галактозид-пермеаза), LacZ- (β-галактозидаза) и, возможно, NelA- (α-галактозидаза).

В другом предпочтительном варианте осуществления изобретения среда содержит экзогенный предшественник, который выбран, например, из лактозы, галактозы, β-галактозида и α-галактозида, такого как глоботриоза (Galα-4Galβ-4Glc).

Изобретение относится также к указанному выше микроорганизму и к культуральной среде для клеток, содержащей указанный выше микрорганизм, и к экзогенному предшественнику, выбранному из лактозы, галактозы, β-галактозида и α-галактозида, такого как глоботриоза (Galα-4Galβ-4Glc).

Определения

Термин «сиаловая кислота» относится к любому представителю семейства содержащих 9 атомов углерода карбоксилированных Сахаров. Наиболее типичным представителем семейства сиаловых кислот является N-ацетил-нейраминовая кислота (2-кето-5-ацетамидо-3,5-дидезокси-D-глицеро-D-галактононулопираноз-1-оновая кислота (часто используемые аббревиатуры NeuAc, Neu5Ac или NANA). Вторым представителем семейства является N-гликолил-нейраминовая кислота (Neu5Gc или NeuGc), в которой N-ацетильная группа Neu5Ac гидроксилирована. Третьим представителем семейства сиаловых кислот является 2-кето-3-дезоксинонулосоновая кислота (KDN) (Nadano et al. II J. Biol. Chem. 1986. Т. 261. С.11550-11557; Kanamori et al. II J. Biol. Chem. 1990. Т. 265. С.21811-21819). Сюда входят также 9-замещенные сиаловые кислоты, такие как 9-O-С16-ацил-Neu5Ac (подобные 9-О-лактил-Neu5Ac или 9-О-ацетил-Neu5Ac, 9-дезокси-9-фтор-Neu5Ac и 9-азидо-9-дезокси-Neu5Ac). Обзоры, касающиеся семейства сиаловых кислот, представлены, например, в Varki // Glycobilogy. 1992. Т. 2. С.25-40; «Sialic Acids:

Chemistry, Metabolism and Function». Под ред. R. Schauer. Springer-Verlag, New York, 1992). Синтез и использование соединений сиаловых кислот в процессе сиалилирования раскрыт в международной патентной заявке WO 92/16640, опубликованной 1 октября 1992 г.

Термин «бифункциональная сиалилтрансфераза Cstll из Campylobacter jejuni» относится к сиалилтрансферазе, которая обладает и α-2,3-, и α-2,8-сиалилтрансферазной активностью. В некоторых вариантах осуществления используют сиалилтрансферазу Cstll из коллекции АТСС, № доступа 43438.

«Акцепторный субстрат» или «акцепторный сахарид» для гликозилтрансферазы - это олигосахаридная группировка (часть молекулы), которая может служить акцептором для конкретной гликозилтрансферазы. Когда акцепторный субстрат контактирует с соответствующей гликозилтрансферазой и сахар-донорным субстратом, а также с другими необходимыми компонентами реакционной смеси, а реакционную смесь инкубируют в течение необходимого периода времени, гликозилтрансфераза переносит остаток сахара с сахар-донорного субстрата на акцепторный субстрат. Например, акцепторным субстратом для сиалилтрансфераз, используемых в способах согласно настоящему изобретению, является лактоза Galβ-1,4-Glc.

«Донорный субстрат» для гликозилтрансфераз - это активированный нуклеотидный сахар. Такие активированные сахара, как правило, представляют собой уридин-, гуанозин- и цитидин-монофосфатные (соответственно UMP, GMP и CMP) производные Сахаров или дифосфатные (соответственно UDP, GDP и CDP) производные Сахаров, в которых нуклеозид-монофосфат или нуклеозид-дифосфат является отщепляемой группой. Например, донорным субстратом для сиалилтрансфераз, используемых в способах согласно настоящему изобретению, является CMP-Neu5Ac.

«Культуральная среда» относится к любой жидкой, полужидкой или твердой среде, которую можно использовать для поддержания роста микроорганизма, используемого в способах согласно настоящему изобретению. В некоторых вариантах осуществления изобретения микроорганизмом является бактерия, например Е. coli. Среды для роста микроорганизмов хорошо известны (см., например, Sambrook et al. и «Current Protocols in Molecular Biology). Под ред. F.M.Ausubel et al. Current Protocols, совместный проект Greene Publishing Associates, Inc. и John Wiley and Sons, Inc., (1998 Supplement) (Ausubel). Средами могут быть богатые среды, например: бульоны Luria broth или terrific broth, или синтетическая или полусинтетическая среда, например среда М9. В некоторых предпочтительных вариантах осуществления изобретения ростовая среда содержит лактозу и сиаловую кислоту.

«Коммерческий масштаб» относится к продукции граммовых количеств продукта - сиалилированного сахарида в одной реакции. В предпочтительных вариантах осуществления изобретения коммерческий масштаб относится к продукции количеств, больших чем приблизительно 50, 75, 80, 90 или 100, 125, 150, 175 или 200 г.

Термин «действенно соединенный» относится к функциональной связи между контрольной последовательностью для экспрессии ДНК (такой, как промотор, сигнальная последовательность или набор сайтов связывания фактора транскрипции) и второй последовательностью нуклеиновой кислоты, причем контрольная последовательность для экспрессии влияет на транскрипцию и/или трансляцию нуклеиновой кислоты, соответствующей второй последовательности.

Термины «гетерологичный полинуклеотид» или «гетерологичный ген», как они использованы здесь, обозначают полинуклеотид или ген, происходящий из источника, чужеродного по отношению к конкретной хозяйской клетке, или, если он происходит из того же самого источника, полученного путем модификации его исходной формы. Так, гетерологичный ген сиалилтрансферазы в клетке включает ген, эндогенный по отношению к конкретной клетке-хозяину, но модифицированный. Модификация гетерологичной последовательности может быть осуществлена, например, путем обработки ДНК рестрикционным ферментом, чтобы получить фрагмент ДНК, который можно действенно соединить с промотором. Такая техника, как сайт-специфический мутагенез, также может быть применена для модификации гетерологичной последовательности.

«Рекомбинантная экспрессионная кассета» или просто «экспрессионная кассета» - это конструкция из нуклеиновой кислоты, созданная рекомбинантным методом или синтетически, с элементами нуклеиновой кислоты, которые способны экспрессировать или влияют на экспрессию структурного гена в хозяевах, совместимых с такими последовательностями. Экспрессионные кассеты включают по меньшей мере промоторы и, возможно, сигналы терминации транскрипции. Обычно рекомбинантная экспрессионная кассета включает подлежащую транскрипции нуклеиновую кислоту (например, нуклеиновую кислоту, кодирующую требуемый полипептид) и промотор. Могут быть также использованы дополнительные факторы, необходимые или полезные для воздействия на экспрессию. В экспрессионную кассету могут быть также введены сигналы терминации транскрипции, энхансеры и другие нуклеотидные последовательности, которые влияют на экспрессию гена. Если в микроорганизме экспрессируют более одного гетерологичного белка, кодирующие белки гены могут экспрессироваться в одной экспрессионной кассете или в нескольких экспрессионных кассетах, которые совместимы и могут поддерживаться в одной и той же клетке. Термин «экспрессионная кассета», как он использован здесь, охватывает также конструкции нуклеиновой кислоты, которые внедрены в хромосому микроорганизма-хозяина. Имеющие опыт в данной области знают, что внедрение нуклеиновой кислоты в хромосому может происходить, например, путем гомологичной рекомбинации. Экспрессионная кассета может быть сконструирована для продукции более чем одного белка. Экспрессия белков может регулироваться одной промоторной последовательностью, как, например, в опероне, или же несколько белков могут кодироваться нуклеиновыми кислотами с индивидуальными промоторами и сайтами связывания с рибосомами.

Термин «изолированный» относится к материалу, который в основном или по существу не содержит компонентов, наносящих вред активности биологической молекулы. Для клеток, сахаридов, нуклеиновых кислот и полипептидов настоящего изобретения термин «изолированный» относится к материалу, который в основном или по существу не содержит компонентов, которые в норме сопровождают материал, когда он находится в своем нативном состоянии. Как правило, изолированные сахариды, олигосахариды, белки или нуклеиновые кислоты являются чистыми по меньшей мере приблизительно на 50%, 55%, 60%, 65%, 70%, 75%, 80% или 85%, обычно по меньшей мере приблизительно на 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99%, как измерено по интенсивности линий в окрашенном серебром геле или другим методом определения чистоты. Чистоту или гомогенность можно указать различными способами, хорошо известными в данной области, - такими как электрофорез образца белка или нуклеиновой кислоты в полиакриламидном геле с последующей визуализацией окрашиванием. Для некоторых целей требуется высокое разрешение, и для очистки используют ВЭЖХ или подобные приемы. Для олигосахаридов (например, сиалилированных продуктов) чистоту можно определять, используя, например, тонкослойную хроматографию, ВЭЖХ или масс-спектроскопию.

Термины «идентичный» или «процент идентичности», относящиеся к двум или более последовательностям нуклеиновых кислот или белков, относятся к двум или более последовательностям или фрагментам последовательностей, которые являются одинаковыми или имеют определенный процент аминокислотных остатков или нуклеотидов, которые являются одинаковыми, когда они сопоставляются и выравниваются для максимального соответствия, что измеряют с использованием одного из указанных далее алгоритмов сравнения последовательностей или путем визуального обследования.

Термин «в основном (существенно) идентичные» в отношении двух нуклеиновых кислот или полипептидов относится к двум или более последовательностям или фрагментам последовательностей, которые имеют степень идентичности нуклеотидов или аминокислот по меньшей мере 60%, предпочтительно 80% или 85%, наиболее предпочтительно по меньшей мере 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99%, когда они сопоставляются и выравниваются для максимального соответствия, что измеряют с использованием одного из указанных далее алгоритмов сравнения последовательностей или путем визуального обследования. Предпочтительно, чтобы существенная идентичность распространялась на участок последовательностей, имеющий длину по меньшей мере приблизительно 50 остатков, более предпочтительно на участок длиной по меньшей мере приблизительно 100 остатков и наиболее предпочтительно, чтобы последовательности были существенно (в основном) идентичны на протяжении по меньшей мере приблизительно 150 остатков. В наиболее предпочтительном варианте осуществления изобретения последовательности существенно идентичны на протяжении всей длины кодирующих областей.

При сравнении последовательностей обычно одна последовательность служит референсной последовательностью, с которой сравнивают испытуемые последовательности. Если используют алгоритм сравнения последовательностей, испытуемую и референсную последовательности вводят в компьютер, при необходимости определяя координаты последовательностей, и задают параметры программы алгоритма сравнения последовательностей. 3атем с помощью алгоритма сравнения последовательностей на основании заданных параметров программы вычисляют процент идентичности последовательности для испытуемой последовательности (испытуемых последовательностей) по отношению к референсной последовательности.

Оптимальное выравнивание последовательностей для из сравнения может быть осуществлено, например, с помощью алгоритма локальной гомологии (Smith and Waterman // Adv. Appl. Math. 1981. Т.2. С.482), алгоритма выравнивания гомологии (Needleman and Wunsch // J. Mol. Biol. 1970. Т.48. С.443), метода поиска подобий (Pearson and Lipman // Proc. Natl. Acad. Sci. USA. 1988. Т.85. С.2444), компьютеризованных реализации этих алгоритмов (GAP, BESTFIT, FASTA и TFASTA в пакетах программ Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, W1), или путем визуального обследования (см. общий обзор в «Current Protocols in Molecular Biology». Под ред. F.M.Ausubel et al. «Current Protocols», совместный проект Greene Publishing Associates, Inc. и John Wiley and Sons, Inc., (1995 Supplement) (Ausubel)).

Примерами алгоритмов, пригодных для определения процента идентичности последовательностей и подобия последовательностей, являются алгоритмы BLAST и BLAST 2.0, описанные соответственно в работах Altschul et al. II J. Mol. Biol. 1990. Т.215. С.403-410; и Altschuel et al. II Nucleic Acids Res. 1977. Т.25. С.3389-3402. Программное обеспечение для проведения анализов с алгоритмом BLAST можно свободно получить в National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/). Этот алгоритм включает первоначальную идентификацию дающих высокий отсчет пар последовательностей (HSP) путем идентификации коротких слов длиной W в опрашиваемой последовательности, которые при выравнивании со словом такой же длины в последовательности из банка данных либо полностью соответствуют ему, либо удовлетворяют некоторому пороговому отсчету с положительным значением Т. Т называют порогом регистрации соседствующего слова (Altschul et al, см. выше). Эти начальные фиксации соседствующих слов служат затравками для инициирования поиска содержащих их более длинных HSP. 3атем фиксированные слова продлевают в обе стороны вдоль каждой последовательности, пока увеличивается кумулятивный отсчет выравнивания. Для нуклеотидных последовательностей кумулятивные отсчеты рассчитывают с использованием параметров М (поощрительный отсчет для пары совпадающих остатков, всегда >0) и N (штрафной отсчет для несовпадающих остатков, всегда <0). Для аминокислотных последовательностей для вычисления кумулятивного отсчета применяют регистрирующую матрицу. Продление фиксированных слов в каждом направлении прекращается, когда кумулятивный отсчет выравнивания падает ниже своего максимального достигнутого значения на величину X, когда кумулятивный отсчет падает до нуля или ниже (из-за накопления одного или нескольких выравниваний остатков с отрицательным значением) или когда достигнут конец какой-либо из последовательностей. Параметры W, Т и Х алгоритма BLAST определяют чувствительность и скорость выравнивания. В программе BLASTN (для нуклеотидных последовательностей) используют в качестве предела штрафа для длины слов (W) значение 11, ожидание (Е), равное 10, М=5, М=-4 и сравнивают обе нити. Для аминокислотных последовательностей в программе BLASTP используют в качестве предела штрафа для длины слов (W) значение 3, ожидание (Е), равное 10, и матрицу отсчета BLOSUM62 (см. Henikoff and Henikoff // Proc. Natl. Acad. Sci. USA. 1989. Т.89. С.10915).

Кроме расчета процента идентичности последовательностей алгоритм BLAST также осуществляет статистический анализ подобия двух последовательностей (см., например, Karlin and Altschul // Proc. Natl Acad. Sci. USA. 1993. Т.90. С.5873-5787). Одной из мер подобия, предоставляемой алгоритмом BLAST, является вероятность наименьшей суммы (Р(N)), которая указывает на вероятность, с которой совпадение между двумя нуклеотидными или аминокислотными последовательностями будет случайным. Например, нуклеиновая кислота считается подобной референсной последовательности, если вероятность наименьшей суммы в сравнении испытуемой нуклеиновой кислоты с референсной нуклеиновой кислотой меньше, чем приблизительно 0,1, более предпочтительно - меньше, чем приблизительно 0,01, и наиболее предпочтительно - меньше, чем приблизительно 0,001.

Термин «консервативно модифицированные вариации» конкретной полинуклеотидной последовательности относится к тем полинуклеотидам, которые кодируют идентичные или существенно идентичные аминокислотные последовательности, или же, если полинуклеотид не кодирует аминокислотную последовательность, то к существенно идентичным последовательностям. Благодаря вырожденности генетического кода каждый данный полипептид может кодировать большое число функционально идентичных нуклеиновых кислот. Например, кодоны CGU, CGC, CGA, CGG, AGA и AGG все кодируют аминокислоту аргинин. Поэтому в каждом положении, где кодоном определен аргинин, этот кодон можно заменить на любой из описанных соответствующих кодонов без изменения кодируемого полипептида. Такие вариации нуклеиновой кислоты являются «молчащими замещениями» или «молчащими вариациями», которые являются одним из видов «консервативно модифицированных вариаций». Каждая описанная здесь полинуклеотидная последовательность, которая кодирует полипептид, также описывает каждую возможную молчащую вариацию, если только не указано иное. Поэтому молчащие замещения являются подразумевающейся особенностью каждой последовательности нуклеиновой кислоты, которая кодирует аминокислотную последовательность. Опытный специалист поймет, что каждый кодон в нуклеиновой кислоте (за исключением AUG, который обычно является единственным кодоном для метионина) может быть модифицирован, давая с помощью стандартной техники функционально идентичную молекулу. В некоторых вариантах осуществления изобретения нуклеотидные последовательности, кодирующие ферменты, предпочтительно оптимизируют для экспрессии в конкретном хозяине.

Подобным же образом, «консервативные аминокислотные замещения» в одной аминокислоте или нескольких аминокислотах аминокислотной последовательности, выполненные путем замещений различными аминокислотами, имеющими в высокой степени подобные свойства, легко идентифицируются как в высокой степени подобные конкретной аминокислотной последовательности или конкретной нуклеотидной последовательности, кодирующей аминокислотную последовательность. Такие консервативно замещенные вариации любой конкретной последовательности являются особенностью настоящего изобретения. Индивидуальные замещения, делеции или добавки, которые изменяют, дополняют или исключают одиночную аминокислоту или малый процент аминокислот (обычно менее 5%, чаще менее 1%) в кодируемой последовательности, являются «консервативно модифицированными вариациями», где изменения выражаются в замещениях аминокислоты химически подобной аминокислотой. Таблицы консервативных замещений, предоставляющие функционально подобные аминокислоты, хорошо известны в данной области (см., например, Creighton «Proteins». W.H.Freeman and Company, 1984.

Бифункциональные сиалилтрансферазы

Как указано выше, в способах согласно настоящему изобретению используются бифункциональные сиалилтрансферазы. Нуклеиновые кислоты, кодирующие такие ферменты, были выделены из С.jejuni и раскрыты в патентах США №6 699 705 и 6 503 744 и в заявке № WO/02074942. В качестве примера штаммы С.jejuni, которые могут быть использованы как источники бифункциональных сиалилтрансфераз, включают ОН4384 (последовательности нуклеиновой кислоты имеются в GenBank, № доступа AR271700 и АХ934425), ОН4382, 0:10 (последовательности нуклеиновой кислоты имеются в GenBank, № доступа AR271701 (SEQ ID No 1), АХ934427 (SEQ ID No 2), 0:23, и 0:41 (последовательности нуклеиновой кислоты имеются в GenBank, № доступа AR271702 (SEQ ID No 3) и АХ934429 (SEQ ID No 4)). Понятно, что здесь могут быть применены консервативно модифицированные вариации, как они определены выше в последовательностях SEQ ID No 1, SEQ ID No 2, SEQ ID No 3 и SEQ ID No 4.

Клетки-хозяева

Рекомбинантные клетки согласно настоящему изобретению обычно получают путем создания или получения иным образом полинуклеотида, который кодирует конкретный целевой фермент (конкретные ферменты), помещения полинуклеотида в экспрессионную кассету под контролем промотора и других подходящих сигналов контроля и введения экспрессионной кассеты в клетку. В одной и той же клетке-хозяине с помощью различных методов можно экспрессировать более одного фермента. Например, один внехромосомный вектор может включать несколько экспрессионных кассет, или же в клетке-хозяине можно использовать несколько внехромосомных векторов, поддерживающих экспрессионную кассету. Экспрессионные кассеты могут быть также внедрены в хромосому клетки-хозяина с помощью методов, известных специалистам в данной области. Специалистам в данной области понятно, что можно использовать также комбинации экспрессионных кассет во внехромосомных векторах и экспрессионные кассеты, введенные в хромосому клетки-хозяина. Для усиления продукции необходимого олигосахарида могут быть использованы другие модификации клетки-хозяина, детально описанные далее. Например, можно использовать микроорганизм LacY+, имеющий активный транспорт лактозы. Нет необходимости, чтобы клетки-хозяева были NanT+, поскольку активированная сиаловая кислота продуцируется внутри клеток согласно настоящему изобретению.

Рекомбинантными клетками согласно настоящему изобретению обычно являются микроорганизмы, такие как, например, клетки дрожжей, клетки бактерий или клетки грибов. Примеры подходящих клеток включают, например, среди многих прочих / Azototoactersp.(например, A. vinelandii), Pseudomonas sp., Rhizobium sp., Erwinia sp., Bacillus sp., Streptomyces sp., Escherichia sp. (например, Е. coli) и Klebsiella sp. Клетками могут быть любые клетки из различных родов, в том числе Saccharomyces (например, S. cerevisiae), Candida (например: С.utilis, С.parapsilosis, С.krusei, С.versatilis, С.lipolytica, С.zeylanoides, С.guilliermondii, С.altolcans и С.humicola), Pichia (например, Р.fannosa и Р.ohmeri), Torulopsis (например: Т.Candida, Т.sphaerjca, Т.xylinus, T.famata и Т.versatilis), Debaryomyces (например: D.subglobosus, D.cantarellii, D.globosus, D.hansenii и D.japonicus), Zygosaccharomyces (например, Z.rouxii и Z.bailii), Kluyveromyces (например, К.marxianus), Hansenula (например, Н.anomala и Н.jadinii) и Brettanomyces (например, В.lambicus и В.anomalus).

Промоторы для использования в E. coli включают промоторы Т7, tip или лямбда. Вводят также сайт связывания с рибосомами и предпочтительно сигнал терминации транскрипции. Для экспрессии гетерологичных белков в прокариотных клетках (кроме E. coli) необходим промотор, действующий в конкретных видах прокариот. Такие промоторы можно получить из генов, клонированных из соответствующих видов, или же можно использовать гетерологичные промоторы. Например, гибридный промотор trp-lac, кроме E. coli, функционирует в Bacillus. Методы трансформации других прокариот, кроме E. coli, хорошо известны. Например, методы трансформации клеток видов Bacillus и промоторы, которые можно использовать для экспрессии белков, содержатся в патенте США №6 255 076 и патенте США №6 770 475.

Для дрожжей удобные промоторы включают GAL1-10 (Johnson and Davies // Mol. Cell. Biol. 1984. Т.4. С.1440-1448), ADH2 (Russell et al. // J. Biol. Chem. 1983. Т.258. С.2674-2682), РН05 (// EMBO J. 1982. Т.6. С.675-680) и MFa (Herskowitz and Oshima // В «The Molecular Biology of the Yeast Saccharomyces» (по ред. Strathern, Jones, and Broach). Cold Spring Harbor Lab., Cold Spring Harbor, N. Y., 1982. С.181-209). Другим подходящим для использования в дрожжах промотором является гибридный промотор ADH2/GAPDH, описанный в работе Cousens et al. II Gene. 1987. Т.61:. С.265-275. Для нитевидных грибов, таких как, например, штаммы грибов Aspergillus (McKnight et al., патент США №4 935 349), примеры подходящих промоторов включают промоторы, происходящие из генов гликолиза Aspergillus nidulans,, такие как промотор ADH3 (McKnight et al. II EMBO J. 1985. Т.4. С.2093-2099; и промотор fp/A. Примером подходящего терминатора является терминатор ADH3 (McKnight et al.).

В некоторых вариантах осуществления изобретения полинуклеотиды помещают под контроль индуцибельного промотора, которым является промотор, направляющий экспрессию гена, когда уровень экспрессии изменяется под действием факторов окружающей среды или развития, таких как, например, температура, рН, анаэробные или аэробные условия, свет, факторы транскрипции и химические вещества. Такие промоторы называются здесь «индуцибельными» промоторами, которые позволяют контролировать ход во времени экспрессии гликозилтрансферазы или фермента, участвующего в синтезе нуклеотидных Сахаров. Специалистам известны индуцибельные промоторы для E. coli и других бактериальных клеток-хозяев. Они включают, например, промотор lac. Особенно предпочтительным индуцибельным промотором для экспрессии в прокариотах является двойной промотор, который включает компонент промотора tac, присоединенный к компоненту промотора, полученному из гена или генов, которые кодируют ферменты, участвующие в метаболизме галактозы (например, промотор из гена UDPгалактозо-4-эпимеразы (galЕ)).

Индуцибельные промоторы для других организмов также хорошо известны специалистам в данной области. Они включают, например, промотор арабинозы, промотор lacZ, промотор металлотионеина и промотор теплового шока, а также многие другие промоторы.

Для создания полинуклеотидных конструкций обычно необходимо использовать векторы, способные реплицироваться в бактериях. Для очистки плазмид из бактерий существует множество коммерчески доступных наборов. Для их правильного применения необходимо следовать рекомендациям производителей (см., например, наборы EasyPrepJ, FlexiPrepJ, оба от фирмы Pharmacia Biotech; StrataCleanJ от фирмы Stratagene и QIAexpress Expression System от Qiagen). Выделенные и очищенные плазмиды можно далее использовать для получения других плазмид и для трансфекции клеток. Возможно также клонирование в Streptomyces или Bacillus.

Часто в экспрессирующие векторы, используемые для конструирования клеток согласно настоящему изобретению, включают селектирующие маркеры. Эти гены могут кодировать генный продукт, такой как белок, необходимый для жизнеспособности или роста трансформированных клеток-хозяев, выращиваемых в селективной ростовой среде. Клетки-хозяева, не трансформированные вектором, содержащим селектирующий ген, не выживут в культуральной среде. Типичные селектирующие гены кодируют белки, которые придают устойчивость к антибиотикам или другим токсинам, таким как: ампициллин, неомицин, хлорамфеникол или тетрациклин. В качестве альтернативы селектирующие маркеры могут кодировать белки, которые восполняют ауксотрофные дефекты или снабжают клетки важными питательными веществами, не получаемыми из сложной среды. Это, например, ген, кодирующий D-аланин-рацемазу для Bacilli. Часто вектор содержит один селектирующий маркер, который функционален, например, в E. coli или в других клетках, в которых вектор реплицируется перед внедрением в клетку-мишень. Специалистам в данной области известно большое число селектирующих маркеров, они описаны, например, в книге Sambrook et al. (см. выше). Предпочтительным маркером для использования в бактериальных клетках является маркер устойчивости к канамицину (Vieira and Messing // Gene. 1982. Т.19. С.259). Использование селекции по канамицину удобнее, чем, например, селекция по ампициллину, поскольку ампициллин быстро разрушается в культуральной среде β-лактамазой, что снимает селективную нагрузку и приводит к обогащению культуры клетками, не содержащими вектор.

В конструировании подходящих векторов, содержащих один или более из перечисленных выше компонентов, применяется стандартная техника лигирования (сшивки лигазой), как это описано в цитированных выше работах. Выделенные плазмиды или фрагменты ДНК расщепляются, составляются и заново сшиваются в форме, необходимой для создания требуемых плазмид. Чтобы подтвердить правильность последовательностей в сконструированных плазмидах, плазмиды можно анализировать стандартными методами, такими как расщепление рестрикционными эндонуклеазами и/или секвенирование известными методами. Техника молекулярного кпонирования для достижения этих конечных целей известна в данной области. Специалистам в данной области хорошо известно множество методов клонирования и амплификации in vitro, пригодных для конструирования рекомбинантных нуклеиновых кислот.

В данной области хорошо известны многие векторы, пригодные для конструирования рекомбинантных клеток согласно настоящему изобретению. Для клонирования в бактериях обычные векторы включают векторы на основе pBR322, такие как pBLUESCRIPT™, и полученные на основе фага λ векторы. Для дрожжей векторы включают Yeast Integrating plasmids (например Ylp5) и Yeast Replicating plasmids (серия плазмид YRp), а также pGPD-2.

Методы внедрения экспрессирующих векторов в выбранную клетку-хозяина не особенно критичны, и такие методы известны специалистам в данной области. Например, экспрессирующие векторы можно вводить в прокариотные клетки, в том числе в Е. coli, трансформацией с хлоридом кальция, а в клетки эукариот - с помощью обработки фосфатом кальция или электропорации. Пригодны также другие методы трансформации.

Предпочтительные варианты осуществления изобретения

Продукция 3'-сиалиллактозы

Продукцию 3'-сиалиллактозы можно осуществить в определенном выше метаболически сконструированном штамме, экспрессирущем ген А, который кодирует фермент, обладающий α-2,3-сиалилтрансферазной активностью,, такой как α-2,3-сиалилтрансфераза или бифункциональная α-2,3- и α-2,8-сиалилтрансфераза, которые используют лактозу в качестве акцептора. Как указано выше, этот штамм не имеет активности альдолазы сиаловой кислоты, ManNAc-киназы и β-галактозидазы и экспрессирует гетерологичные гены, кодирующие CMP-Neu5Ac-синтетазу, синтазу сиаловой кислоты и GlcNAc-6-фосфат-2-эпимеразу. Для крупномасштабной продукции сиалиллактозы этот штамм можно культивировать при высокой плотности клеток на недорогом субстрате, таком как глюкоза или глицерин, и вводить в среду лактозу, которая будет интернализоваться с помощью лактозо-пермеазы и сиалилироваться рекомбинантной сиалилтрансферазой с использованием CMP-Neu5Ac, получающимся эндогенно из UDP-GlcNAc, как показано на фиг.1.

Продукция 6'-сиалиллактозы

Здесь сиалилтрансферазным геном является ген, кодирующий α-2,6-сиалилтрансферазу, такой как ген из Photobacterium damsela (Yamamoto et al., 1998), дающий продукцию 8'-сиалиллактозы (Neu5Acα-6Galβ-4Glc).

Продукция Сахаров GD3 и GT3

GD3 (Neu5Acα-8Neu5Acα-3Galβ-4GlcCer) - это минорный ганглиозид, имеющийся в большинстве нормальных тканей высших позвоночных, включая человека. Было установлено, что уровень GD3 повышается при некоторых патологических ситуациях, таких как рак (глиома, меланома), и играет важную роль в ангиогенезе опухолей (Zeng et al. II Cancer Res. 2000. Т.60. С.6670). Поэтому крупномасштабная экономически выгодная продукция GD3 представляет особенный интерес. Для достижения этой конечной цели в качестве указанного выше гетерологичного гена сиалилтрансферазы выбран ген, кодирующий бифункциональную α-2,3- и α-2,8-сиалилтрансферазу, - например, такой, как ген cstll из Campylobacter jejuni (описан у Gilbert et al., 2002 и депонирован в АТСС с № доступа 43438), который обеспечивает продукцию Сахаров GD3 и GT3. Полипептид бифункциональной сиалилтрансферазы катализирует перенос сиалильной группировки с продуцируемой внутри клетки молекулы активированной сиаловой кислоты на Neu5Acα-3Galβ-4Glc (GM3), образуя Neu5Acα-8Neu5Acα-3Galβ-4Glc. Эта реакция может быть далее продолжена до получения GT3, предшественника серии С ганглиозидов, которые являются главными составляющими в мозгу взрослых рыб и находятся в избыточном количестве в мозгу зародышей высших позвоночных (Letinic et al. II Neuroscience. 1998. Т.86. С.1). Они обнаруживаются также в различных опухолях нейроэктодермы, и поэтому потенциально крайне интересно легкое получение олигосахарида GT3. Для этой конечной цели представленный здесь способ дополнительно включает культивирование микроорганизма таким образом, чтобы полипептид бифункциональной сиалилтрансферазы Campylobacter jejuni катализировал перенос продуцируемой внутри клетки сиалильной группировки на Neu5Acα-8Neu5Acα-3Galβ-4Glc (GD3), образуя Neu5Ac5a-8Neu5Acα-8Neu5Acα-3Galβ-4Glc (GT3).

Продукция сахара GM1

Как показано на фиг.2, представленная выше (см. также фиг.1) система продукции сиалиллактозы может быть распространена на продукцию углеводной части ганглиозида GM1 путем экспрессии дополнительных генов для β-1,4GalNAc-трансферазы и для β-1,3-галактозилтрансферазы. 3десь микроорганизм согласно настоящему изобретению таков, как он представлен на фиг.1, и дополнительно содержит гетерологичные последовательности, кодирующие β-1,4-GalNAc-трансферазу, а также β-1,3-галактозилтрансферазу. В этом варианте осуществления изобретения β-1,4-GalМАс-трансфераза переносит остаток UDP-GalNac молекулы на сиалиллактозу (GM3), образуя GM2, а β-1,3-галактозилтрансфераза переносит галактозильный остаток на GM2, образуя GM1. Штаммы могут не быть способными в естественном состоянии продуцировать UDP-GalNAc (как штаммы Е coli К12). В этом случае штамм согласно настоящему изобретению может быть дополнен геном, кодирующим UDP-GlcNAc-4-эпимеразу, - таким как, например, ген wbpP из Р. aeruginosa (Creuzenet et at., 2000) и ген one из С.jejuni (Bernatchez et al., 2005). Сахар GM1 имеет на конце невосстанавливающую галактозу, и эта структура может использоваться α-2,3-сиалилтрансферазой как акцептор для получения сахара GD1a. Сахар GD1a имеет такую же конечную структуру из невосстанавливающего дисахарида, как и сиалиллактоза, и может использоваться как акцептор β-1,4GalМАс-трансферазой для образования гептасахаридного промежуточного соединения, которое может быть галактозилировано в октасахарид, представленный как GA1 (Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc) на фиг.2.

Образование GD1a и его более крупных производных снижает уровень продукции сахара GM1, и одно из конкретных вариантов осуществления изобретения состоит в снижении или упразднении образования этих побочных продуктов. Для этой конечной цели авторы открыли α-2,3-сиалилтрансферазу, которая не способна использовать сахар GM1 в качестве акцептора. Штамм С.jejuni NCTC 11168 экспрессирует липоолигосахаридные структуры, имитирующие ганглиозид GM1 (Linton et al., 2000). Linton et al. (2000) назвали эту липоолигосахаридную структуру внешней поверхности сердцевины как Outer core "VI". Штамм С.jejuni NCTC 11168 содержит ген, обозначенный cstlll, который кодирует белок, имеющий степень идентичности последовательности 53% с сиалилтрансферазой (Cstll) из других штаммов С.jejuni, которые экспрессируют имитацию GD1a (Gilbert er al., 2002). Сиалилтрансферазная активность белка Cstlll позволяет полезным образом продуцировать сахар GM1 как единственный олигосахаридный продукт. Поэтому в одном из предпочтительных вариантов осуществления изобретение предусматривает применение указанного выше способа для специфической продукции GM1, где гетерологичной сиалилтрансферазой является α-2,3-сиалилтрансфераза, кодируемая геном csrlll, выделенным из штаммов С.jejuni, экспрессирующих липоолигосахаридные структуры, которые имитируют ганглиозид GM1, таких как штамм С.jejuni из NCTC, № доступа 11168.

Продукция сахара GM2

Система продукции сиалиллактозы, как она описана выше, может быть распространена на продукцию углеводной части ганглиозида GM2 путем экспрессирования дополнительных генов для β-1,4-GalNАс-трансферазы и для UDP-GlcNAc-4-эпимеразы. Ранее было отмечено, что β-1,4-GalNАс-трансфераза CgtA из С.jejuni проявляет побочную активность Р-1,4-галактозилтрансферазы, что приводит к продукции аналога сахара GM2, обозначенного как GA2 на фиг.3 (Antoine et at., 2003). Сахар GA2 содержит концевую невосстанавливающую галактозу, и авторы обнаружили, что эта галактоза может служить акцептором для сиалилтрансферазы, что приводит к образованию дисиалилированного тетрасахарида (GA5, фиг.3), который в свою очередь может быть преобразован в пентасахарид GA4 или GА3 (фиг.3) с помощью очень активной β-1,4-GalNAc-трансферазы CgtAll.

Образование побочных продуктов GA2, GА3, GA4 и GA5 снижает выход продукции сахара GM2 и затрудняет его очистку. Поэтому задача избежать образования этих побочных продуктов находится в пределах охвата настоящего изобретения. Побочную активность β-1,4-галактозилтрансферазы можно полезным образом подавить, используя мутант, неспособный продуцировать UDP-Gal. Как показано на фиг.4, такой мутант можно получить, нарушая активность одного из трех следующих генов; гена galЕ, кодирующего UDP-глюкозо-эпимеразу, гена galil, кодирующего UDP-Glc-пирофосфорилазу, и гена pgm, кодирующего фосфоглюкомутазу. Таким образом, изобретение направлено на способ продукции сиалилированных олигосахаридов, как он определен выше, который распространен на продукцию углеводной части ганглиозида GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GM2), причем микроорганизм дополнительно содержит гетерологичные последовательности, кодирующие β-1,4-GalNAc-трансферазу, такие как ген CgtAll из С.jejuni 0:36 штамм АТСС, №доступа 43456, и UDP-GlcNAc-4-эпимеразу, и при этом у микроорганизма для нарушения эндогенной продукции UDP-Gal делегирован или инактивирован по меньшей мере один из следующих трех генов: ген galЕ, кодирующий UDP-глюкозо-эпимеразу, ген galU, кодирующий UDP-Glc-пирофосфорилазу, и ген pgm, кодирующий фосфоглюкомутазу. Указанное нарушение исключает появление побочных продуктов, таких как GA2, GA3, GA4 и GA5.

Продукция сахара GD2

Систему продукции сахара GD3 можно распространить на продукцию углеводной части ганглиозида GD2 путем экспрессии дополнительных гетерологичных генов, кодирующих UDP-GlcNAc-4-эпимеразу и β-1,4-GalNAc-трансферазу, которые используют в качестве акцептора сахар GD3, такие как белок CgtAll из С.jejuni 0:36 штамм АТСС, №доступа 43456.

В этой системе и сиалилтрансфераза Cstll, и GalNAc-трансфераза CgtAll конкурируют за использование сиалиллактозы в качестве акцептора (фиг.5). Чтобы усилить продукцию сахара GD2, авторы подавили экспрессию гена cgtAll в первой фазе культивирования (чтобы сиалиллактоза в основном превратилась в сахар GD3) и затем повысили экспрессию cgtAll во второй фазе, чтобы GD3 превратился в GD2. Это можно осуществить, помещая ген cgtAll под контроль промотора, который регулируется независимо от промоторов, контролирующих другие гены. Побочная активность β-1,4-галактозилтрансферазы у белка CgtAll может привести к продукции галактозилированных аналогов, таких как соединения GA2, GA5 и GA6, представленные на фиг.5. Хотя эти олигосахариды могут представлять интерес, также в пределах охвата настоящего изобретения находится предотвращение образования этих побочных продуктов путем использования мутантного штамма, не способного продуцировать UDP-Gal, как описано выше, для продукции GM2, чтобы обеспечить специфическую продукцию GD2.

Продукция Сахаров GD1b, GT1c, GT1b, GQ1b, GQ1c и GP1c

Продукцию сахара GD1b (Galβ-3GalNAcβ-4(Neu5Acα-8Neu5Acα-3)Galβ-4Glc) и сахара GT1c (Galβ-3GalNAcβ-4(Neu5Acα-8Neu5Acα-8Neu5Acα3)Galβ-4Glc) можно осуществить, используя ту же самую комбинацию генов, как и в описанной выше системе продукции сахара GD2, и дополнительно экспрессируя ген β-3-Gal-трансферазы. 3десь микроорганизм дополнительно содержит гетерологичные последовательности, кодирующие UDP-GlcNAc-4-эпимеразу, β-1,4-GalNAc-трансферазу, использующую сахара GD3 и GT3 в качестве акцептора, такую как белок CgtAll из С.jejuni 0:36 штамм АТСС, № доступа 43456, и β-1,3-галактозилтрансферазу, такие как кодируемая геном cgtB из С.jejuni 0:2 штамм NCTC, № доступа 11168. Система для продукции GD1b и GT1c может быть распространена на продукцию GT1b, GQ1c, GQ1b и GP1c путем экспрессии гена, кодирующего сиалилтрансферазу, способную использовать в качестве акцепторов GD1bnGT1c.

Продукция Сахаров GD1a и GT1a

Стратегия продукции сахара GT1a показана на фиг.6 и основана на совместной экспрессии гена cstll для бифункциональной сиалилтрансферазы с геном cgtA, кодирующим β-1,4GalNАс-трансферазу, которая не использует сахар GD3 в качестве акцептора, при этом конечными продуктами являются сахара GD3, GD1a и GT1a. 3десь изобретение относится к способу, соответствующему тому, который описан выше для продукции сиалилированных олигосахаридов, примененному для специфической продукции Neu5Acα-3Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GD1a) и Neu5Acα-8Neu5Acα-3Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GT1a), причем микроорганизм содержит гетерологичные последовательности, кодирующие бифункциональную α-2,3-, α-2,8-сиалилтрансферазу, такую последовательность, как ген cstll из С.jejuni штамм АТСС, №доступа 43438, β-1,4-GalNАс-трансферазу, такую как ген cgtAll из С.jejuni 0:36 штамм АТСС, №доступа 43456, которая не использует сахар GD3 в качестве акцептора, и β-3-Gal-трансферазу, как ген cgtB из С.jejuni O:2 штамм NCTC, № доступа 11168.

Продукция олигосахаридов LSTD (сиалил-LNnT) и сиалил-lewis Х

Ранее уже было описано, что тетрасахарид LNnT (Galβ-4GlcNacβ-3Galβ-4Glc) может быть продуцирован из экзогенной лактозы метаболически сконструированным штаммом, экспрессирующим гены IgtA и IgtB, кодирующие соответственно β-1,3-С1 сМАс-трансферазу и β-1,4-галактозилтрансферазу (Priem et al., 2002). Приведенная выше система для продукции сиалилированных олигосахаридов может быть распространена на продукцию пентасахарида LSTo (Neu5Acα-3Galβ-4GlcNacβ-3Galβ-4Glc) путем экспрессирования дополнительных генов nst и neuВСА в штамме nanК-, nanА-, как показано на фиг.7. Система для синтеза LSTD может быть объединена с системой фукозилирования, которая была описана для продукции олигосахарида Lewis X (Dumon et al., 2004), чтобы продуцировать олигосахариды, содержащие лейтмотив сиалил-lewis Х (Neu5Acα-3Galβ-4(Fuca-3)GlcNacβ-) на своем невосстанавливающем конце. В связи с этим микроорганизм дополнительно содержит гетерологичную последовательность, кодирующую α-1,3-фукозил-трансферазу, такую как ген futA Helicobacter pylori (например, SEQ ID No 18 - из Helicobacter pylori АТСС, № доступа 26695) и ген futB (например, SEQ ID No 19 - из Helicobacter pylori АТСС, № доступа 26695).

Продукция гексасахарида сиалозил-галактозил-глобозида (SGG)

Было установлено, что сиалозил-галактозил-глобозид (Neu5Acα-3Galβ-3GalNAcβ-3Galα-4Galβ3-4Gal) является предпочтительным связывающим рецептором для уропатогенной Escherichia coli (Stapleton et al., 1998) и потенциально может быть использован как антиинфекционное средство. Недавно была описана продукция гексасахарида SGG из глоботриозы с использованием добавляемой экзогенно сиаловой кислоты (эффективная продукция Сахаров глобозидов при использовании метаболически сконструированных микроорганизмов была описана авторами в заявке на патент США № US 60/711 406). Продукцию гексасахарида SGG проводили с помощью штамма nanА- melA-, экспрессирующего (i) ген IgtD Haemophilus influenzae (штамм rd), кодирующий и GalNAc-трансферазу, и галактозилтрансферазу, (ii) ген nst сиалилтрансферазы (α-2,3-сиалилтрансфераза, такая как, например, из N. meningitidis, например, из штамма МС58, GenBank, №доступа U60660 - SEQ ID No 5, белок protein_id=AAC44541.1 - SEQ ID No 6), катализирующей перенос сиалильной группировки с молекулы активированной сиаловой кислоты на глобопентаозу с образованием гексасахарида сиалозил-галактозил-глобозида (SGG), (iii) ген neuА для CMP-Neu5Ас-синтазы и (iv) ген wbpP для UDP-GlcNAc-эпимеразы.

Эта система была модифицирована так, чтобы работать без добавления сиаловой кислоты, путем использования штамма nanK- nanA- melA-, дополнительно экспрессирующего гены neuАВС, как показано на фиг.8.

В некоторых вариантах осуществления изобретения микроорганизмы преобразовывали так, чтобы усилить транспорт в клетки акцепторного сахарида. 3десь, если акцепторными сахаридами являются лактоза или глоботриоза, можно использовать клетки Е. coli, которые сверхэкспрессируют пермеазу LacY.

Таким образом, настоящее изобретение включает указанный выше способ, где микроорганизм культивируют в среде с глоботриозой, он представляет собой lacY+, melA-, nanТ+, nanА-, nanK- и содержит гетерологичные гены IgtD для α-2,3-сиалилтрансферазы и UGP-GlcNAc-C4-эпимеразы, а также гены neuАВС.

Изобретение предоставляет также способ сопряжения, в котором первый микроорганизм использован для приготовления глобозидов. Как указано выше, культуральная среда может содержать лактозу или глоботриозу, но в данном формате нет необходимости в добавлении в среду сиаловой кислоты, поскольку она продуцируется внутри клеток. Если используется глоботриоза, изобретение предусматривает также набор из двух различных микроорганизмов, причем указанный первый микроорганизм культивируют в среде с лактозой, он является lacY+, lacZ-, melA- и содержит гетерологичный ген IgtC для продукции глоботриозы (фермент α-1,4-Gal-трансфраза может быть кодирован, например, генами IgtC N. meningitidis, N. gonorrhoeae или Haemophilus influenzae, более конкретно геном IgtC Neisseria meningititis LI (126E), № доступа в GenBank U65788 - SEQ ID No 7, белок protein=id AAB48385 - SEQ ID No 8); а второй микроорганизм культивируют в среде с глоботриозой, он является lacY+, melA-, nanТ+, nanА-, nanК- и содержит гетерологичные гены IgtD, wbpP и nst, а также гены neuАВС. Ген IgtD кодирует β-3-GalNAc-трансферазу, чтобы катализировать перенос галактозной группировки с UDP-Gal на глоботетраозу с образованием глобопентаозы (β-3-Gal-трансферазная активность). Например, может быть использован ген IgtD из Haemophilus influenzae НII 578, № доступа в Gen Ban К U32832 - SEQ ID No 9, protein_id=AAC23227 - SEQ ID No 10.

Продукция сиалилгалактозы

Недавно было показано, что мутант по galК с утраченной галактокиназной активностью может использовать экзогенную галактозу в качестве акцептора для синтеза олигосахаридов с концевой восстанавливающей галактозой (Dumon et al., 2005). Способ продукции сиалилированных олигосахаридов, описанный выше, может быть с пользой применен для продукции дисахарида сиалилгалактозы (Neu5Acα-3Gal) микроорганизмом galК-, nanА- и nanК- (или nanКЕАТ-), экспрессирующим ген для сиалилтрансферазы и гены neuВСА и культивируемым в среде с галактозой.

Продукция сиалилированных олигосахаридов с концевой восстанавливающей галактозой

Способ синтеза сиалилгалактозы может быть приспособлен для продукции аналогов всех указанных выше сиалилированных структур. Использование галактозы в качестве акцептора вместо лактозы приводит к образованию аналогов, лишенных концевого глюкозного остатка.

Продукция сиалилированных олигосахаридов с концевой лактозой или галактозой, имеющих скрытые химические функции

Широкую специфичность пермеазы Сахаров можно использовать для интернализации производных лактозы или галактозы, имеющих скрытые химические функции, для продукции пригодных для конъюгации олигосахаридов.

Эта стратегия была с успехом применена для синтеза олигосахаридных частей ганглиозидов GM2 и GM3 с аллильным или пропаргильным агликоном (Fort et al., 2005). Алкиновая функция делает возможным присоединение азидной группы в водных условиях, а алкеновая функция может быть либо преобразована в альдегид, подлежащий связыванию с белками путем восстанавливающего аминирования, либо трансформирована в изменчивую аминогруппу путем добавления цистеамина. Могут быть также использованы другие функции, такие как азидная группа или аминогруппа. Все эти производные лактозы или галактозы могут быть полезным образом использованы для продукции пригодных для конъюгации аналогов всех указанных выше сиалилированных структур.

Продукция сиалилированных олигосахаридов с хитоолигосахаридной структурой на их восстанавливающем конце

Было установлено, что штаммы Е coli, сверхэкспрессирующие ген nodC Azorhizobium caulinodans для хитин-олигосахарид-синтазы, продуцируют более 2 г/л хитинпентаозы при культивировании с высокой плотностью клеток (Samain et al., 1997). Будучи продуцированной в цитоплазме, хитинпентаоза может служить акцептором для гликозилтрансфераз, которые распознают конечный невосстанавливающий остаток GlcNAc. Эта стратегия была использована для синтеза гексасахарида Galβ-4[GlcNAcβ-4]4GlcNAc штаммом Е. coli, в котором идет совместная экспрессия гена nodC Azorhizobium caulinodans и гена IgtB Neisseria meningitidis для [3-1,4-галактозилтрансферазы (Bettler et at., 1999). Конечный лейтмотив этого гексасахарида М-ацетиллактозамин является акцептором для сиалилтрансферазы. Поэтому сиалилированный гептасахарид Neu5Acα-3Galβ-4[GlcNAcβ-4]4GlcNAc может быть полезным образом продуцирован в мутантных по генам nanК, nanА штаммах, совместно экспрессирующих nodC, IgtB, nst и neuВСА. Разработанная недавно стратегия снижения размера состоит в ферментативном гидролизе хитиназой хитинпентаозы в живых бактериях, как только она возникла в результате действия NodC (Cottaz and Samain, 2005). Авторы установили, что в рамках способа согласно настоящему изобретению можно избежать образования длинного хитинпентаозного праймера, значительно увеличивающего молекулярный вес целевых структур, используя, например, хитиназный ген из Bacillus circulans.

Как показано на фиг.9, способ согласно настоящему изобретению обеспечивает образование сиалилированного тетрасахарида Neu5Acα-3Galβ-4GlcNAcβ-4GlcNAc штаммами nanК-, nanА-, совместно экспрессирующих nodC, chiA, IgtB, nst и neuВСА. Поэтому изобретение относится к изложенному выше способу или, в качестве альтернативы, к способу, в котором в культуральную среду не добавляют экзогенную, для продукции сиалилированных олигосахаридов с хитоолигосахаридной структурой на их восстановленном конце, таких как сиалилированный гептасахарид Neu5Acα-3Galβ-4[GlcNAcβ-4]4GlcNAc, где сиалилтрансферазой является α-2,3-сиалилтрансфераза, такая, как кодируется геном nst Neisseria, и микроорганизм дополнительно содержит ген хитин-олигосахарид-синтазы, такой как ген nodC Azorhizobium caulinodans, и ген β-1,4-галактозил-трансферазы, такой как ген IgtB Neisseria meningitidis. Он может быть распространен на продукцию сиалилированного тетрасахарида Neu5Acα-3Galβ-4GlcNAcβ-4GlcNAc, где микроорганизм дополнительно содержит гетерологичную последовательность, кодирующую хитиназу, - такую как ген chiA.

Еще в одном аспекте изобретение направлено на микроорганизм, как он определен выше, а также на среду для культивирования клеток, содержащую экзогенный предшественник, выбранный из лактозы, галактозы, β-галактозида и α-галактозида, такой как глоботриоза (Galα-4Galβ-4Glc), и указанный микроорганизм.

Примеры

Пример 1. Конструирование мутантов nanА, nanКА и nanКЕТА

Все мутанты конструировали из штамма DC (Dumon et al., 2005), который был производным штамма DH1, имеющим мутации lacZ и lacA. Поскольку все производные штамма DH1 являются мутантами recА, их трансформировали низкокопийной плазмидой рЕХТ22 (Dykxhoorn et al., 1996), несущей функциональный ген recА и устойчивость к канамицину, чтобы осуществить преходящий фенотип RecA+ для процедуры инактивации гена, в которой участвует рекомбинация ДНК. Как только ген был выведен из строя, плазмида была вылечена путем роста клеток без канамицина и отбором фенотипа RecA-.

Штамм AZL конструировали из штамма DC, инактивируя ген nanА с помощью самоубийственной плазмиды рМАК705 (Hamilton et al., 1989), как было описано ранее (Priem et al., 2002).

Для конструирования штамма ZLKA из штамма DC гены nanКЕТА разрушали, удаляя из хромосомной ДНК сегмент длиной 3339 тысяч пар нуклеотидов (т.п.н.), используя описанную ранее одноступенчатую процедуру, в которой для внесения гомологии в целевую последовательность применены ПЦР-праймеры (Datsenko and Wanner, 2000). Последовательность восходящего праймера была следующей:

5'GCAATTATTGATTCGGCGGATGGTTTGCCGATGGTGGTGTAGGCTGGAGCTGCT

ТС

(SEQ ID No 11), а последовательность нисходящего праймера была следующей:

5'CTCGTCACCCTGCCCGGCGCGCGTGAAAATAGTTTTCGCATATGAATATCCTCCT

TAG (SEQ ID No 12).

Такую же процедуру использовали для инактивации гена nanК в штамме AZL, чтобы получить штамм AZK, за исключением того, что размер делетированного фрагмента был 0,537 т.п.н., а последовательность восходящего праймера была следующей:

5'CACTGGCGATTGATATCGGCGGTACTAAACTTGCCGCCGTGTAGGCTGGAGCTG

СТТС

(SEQ ID No 13).

Пример 2. Клонирование генов neuВСА

Фрагмент ДНК длиной 2995 т.п.н., содержащий последовательность генов neuВСА, амплифицировали в ПЦР, используя в качестве матрицы геномную ДНК Campylobacter jejuni штамм АТСС 43438.

В левый праймер вводили сайт Kpnl:

5'GGTACCTAAGGAGGAAAATAAATGAAAGAAATAAAAATACAA (SEQ ID NO 14), а в правый праймер добавляли сайт Xhol:

5'CTCGAGTTAAGTCTCTAATCGATTGTTTTCCAATG (SEQ ID NO 15).

Амплифицированный фрагмент сначала клонировали в вектор pCR4Blunt-ТОРО (Invitrogen), а затем субклонировали в сайты Kpnl и Xhol вектора pBBRI-MCS3, чтобы получить pBBR3-SS.

Пример 3: Продукция сиалиллактозы метаболически сконструированными штаммами Е. coli

Продукцию сиалиллактозы исследовали в различных мутантных штаммах, содержащих ген nst N. meningitidis для α-2,3-сиалилтрансферазы, и плазмиду pBBR3-SS, которая содержала гены neuС, neuВ и neuА С.jejuni, кодирующие соответственно N-ацетилглюкозамин-6-фосфат-эпимеразу, синтазу сиаловой кислоты и CMP-Neu5Ac-синтазу. Продукцию сиалиллактозы оценивали с помощью колориметрического количественного определения сиаловой кислоты как во внутриклеточных, так и во внеклеточных фракциях (таблица 2). Результаты показали, что мутант AW1 по гену nanА и штамм DC6, не содержавший мутации в опероне сиаловой кислоты, продуцировали малые количества сиалиллактозы с похожим выходом. Оба мутанта AZK1 и DC7, не содержавшие мутаций в nanК и nanА, продуцировали в 4 раза большие количества сиалиллактозы. В контрольной культуре DC7, инкубированной без лактозы, сиаловая кислота не обнаружена, что указывает на то, что высокий уровень общей сиаловой кислоты соответствует образованию сиалиллактозы.

Повышение продукции сиалиллактозы было подтверждено также анализом методом ТСХ, где было показано, что соответствующая сиалиллактозе зона была намного интенсивнее в экстрактах DC7 и AZK1, чем в экстрактах DC6 и AW1.

Общую сиаловую кислоту определяли количественно дифениламиновым методом (Werner and Odin, 1952). Культуры инкубировали в течение 30 ч после добавления лактозы при концентрации 7,5 г/л. Контрольную культуру DC7 инкубировали без лактозы.

Пример 4. Крупномасштабная продукция сиалиллактозы с постоянным введением лактозы

При этой продукции выход повышали продлением времени культивации до 71 ч. Лактозу добавляли при концентрации 2 г/л в начале каждой фазы подпитки. Сначала ее добавляли непрерывно со скоростью подачи 0,52 г/л·ч в течение 5 ч в фазе с высоким содержанием глицерина. 3атем скорость подачи лактозы снижали до 0,3 г/л·ч во второй фазе с низким содержанием глицерина. Анализ методом ТСХ показал, что сиалиллактоза (соединение 2 на фиг.10) постоянно продуцировалась вплоть до конца культивирования и продукция сиалиллактозы не лимитировалась подачей лактозы (соединение 1), которую все время удавалось обнаруживать в ходе культивирования во внутриклеточной фракции.

Колориметрическое определение сиаловой кислоты показало, что сиалиллактоза накапливалась в основном во внутриклеточной фракции в течение первого этапа культивирования. 3атем концентрация сиалиллактозы выходила на плато при приблизительно 10 г/л, и дополнительно продуцируемая сиалиллактоза секретировалась во внеклеточную среду, где она накапливалась при конечной концентрации 15,5 г/л (фиг.11).

Пример 5. Очистка сиалиллактозы

Очистку сиалиллактозы производили из 1 литра культуры DC7, как описано в примере 4. По окончании культивирования внеклеточную фракцию отделяли от клеток центрифугированием. Понижали рН внеклеточной фракции до 3,00 добавлением сильной катионообменной смолы (Amberlite 1R120 в Н+-форме). Это приводило к осаждению белков, которые удаляли центрифугированием. 3атем доводили рН прозрачной надосадочной жидкости до 6,0 добавлением слабой анионообменной смолы (Dowex 66 в форме свободного основания) и половину надосадочной жидкости наносили на колонку (5×20 см) со смолой Dowex 1 (в НСО3-форме). Сиалиллактоза задерживалась на смоле Dowex 1, после промывки дистиллированной водой ее элюировали непрерывным градиентом 0-500 мМ NaHCO3. Эту же процедуру повторяли со второй половиной надосадочной жидкости. Фракции, содержащие сиалиллактозу, объединяли, NaHCO3 удаляли обработкой смолой Amberlite IRI 20 (в Н+-форме) до достижения рН 3,0. Доводили рН до 6,0 добавлением NaOH, сиалиллактозу сушили из замороженного состояния.

Для очистки внутриклеточной фракции проницаемость клеток обеспечивали нагреванием (100°С, 45 мин), клетки ресуспендировали в таком же объеме, как и объем исходной культуральной среды. Олигосахариды свободно диффундировали из клеток и обнаруживались после центрифугирования в надосадочной жидкости. Очистку сиалиллактозы производили так же, как и очистку из внеклеточной фракции.

Выход очищеной сиалиллактозы из 1 л культуры штамма DC7 составил 9 г из внеклеточной фракции и 6 г из внутриклеточной фракции. Очищенный продукт был идентифицирован как сиалиллактоза с помощью масс-спектрометрического анализа.

Пример 6. Продукция Сахаров GD3 и GT3

Продукция Сахаров GD3 и GT3 из экзогенной лактозы и Neu5Ac была ранее описана при использовании метаболически сконструированного штамма, экспрессирующего ген cstll Campylobacter jejuni для бифункциональной α-2,3- и α-2,8-сиалилтрансферазы (Antoine et al., 2005). 3десь авторы исследовали продукцию этих двух олигосахаридов без введения экзогенной сиаловой кислоты путем использования системы, описанной в примере 3. Продуцирующий GD3 штамм NF3 был мутантом nanКЕАТ, экспрессирующим совместно cstll и neuВСА (таблица 1). Штамм NF3 культивировали при высокой плотности клеток в присутствии 3 г/л лактозы. Анализ методом ТСХ (фиг.12) показал, что лактоза полностью превращалась в три соединения, которые предположительно были сахарами GM3 (1) GD3 (2) и GT3 (3).

Внутриклеточную фракцию из культуры штамма NF03 очищали ионообменной хроматографией на смоле Dowex 1, как описано в примере 4, и выделяли 3 фракции олигосахаридов, содержащие соответственно сахара GM3, GD3 и GT3. Выход фракций трех Сахаров был равен соответственно 0,16 г, 0,75 г и 1,26 г. Их идентификация была подтверждена масс-спектрометрическим анализом очищенных фракций.

Пример 7. Продукция сахара GM1 с использованием сиалилтрансферазы N. meningitidis и UDP-GlcN Ас-С4-эпимеразы Р. aeruginosa

Продукция сахара GM1 из экзогенной лактозы и Neu5Ac была ранее описана с использованием метаболически сконструированного штамма, экспрессирующего: (i) ген nst N. meningitidis для α-2,3-сиалилтрансферазы; (ii) ген cgtA из С.jejuni 0:19 штамм ОН4384, кодирующий β-1,4-GalNAс-трансферазу; (iii) ген cgtB из Camylobacter jejuni штамм NCTC 11168, кодирующий β-1,4-галактозилтрансферазу, (iv) ген wbpP из Р. aeruginosa, кодирующий UDP-GlcNAc-С4-эпимеразу (Antoine et al., 2003). Первые попытки продуцировать сахар GM1 без добавления экзогенной сиаловой кислоты путем совместной экспрессии cgtA, cgtB и nst с neuВСА показали, что лимитирующей стадией было превращение сиалиллактозы в сахар GM2 GalNAc-трансферазой CgtA. Было установлено, что GalNAc-трансферазы существуют в различных версиях, в зависимости от штамма Campylobacter. Было установлено, что версия cgtA, клонированная из штамма ОН4384, имеет удельную активность, намного меньшую, чем активность версий из штаммов АТСС 4356 или NTCC 11168 (Gilbert et al., 2002; Varki, 1993). Поэтому ген cgtAll был клонирован с помощью ПЦР из геномной ДНК штамма АТСС 4356 и субклонирован с геном nst в плазмиду pBluescript, что дало плазмиду pBS-cgtAll-nst (таблица 1). Ген wbpP клонировали из плазмиды pBBRwbpP (Antoine et al, 2003) в плазмиду pBBR3-SS ниже гена neuВСА, получая плазмиду pBBR-SS-wbpP. Ген cgtB клонировали из плазмиды pACT3cgtAB (Antoine et al., 2003) в плазмиду pSU27-18, получая плазмиду p8U18-cgtB. Штамм DC 15 конструировали путем трансформации мутантного по nanКЕАТ штамма ZLKA тремя плазмидами: pBS-cgtAll-nst, pBBR-SS-wbpP и pSU18-cgtB (таблица 1).

Как показано на фиг.13, штамм DC 15 не накапливал сахар GM3 (1), и это указывало на то, что активность CgtAll из штамма АТСС 4356 было намного ниже активности CgtA из штамма ОН4384. В конце культивирования основными продуктами были соединение (5) с подвижностью, меньшей чем у сахара GM1, и соединение (2') с такой же подвижностью, как и у сахара GM2. После очистки на Dowex 1 масс-спектрометрический анализ показал, что соединение (2') - это аналог сахара GM2, который имеет вместо GalNAc остаток Gal, оно в дальнейшем было обозначено как сахар GA2 (таблица 3). Его структура была следующей: Galβ-4(Neu5Acα-3)Galβ4Glc. Масс-спектр соединения (5) позволил предположить, что это дисиалилированный олигосахарид, получающийся при переносе двух сахарных остатков (одного HexNAc и одного Hex) на сахар GD1a. Поскольку эти два сахара скорее всего добавляются ферментами CgtAll и CgtB, структура соединения (5), которое далее было обозначено как сахар GA1, была, по-видимому, следующая: Galβ-3GalNAcβ-4Neu5Acα-3Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (таблица 3).

Таблица 3
Структура аналогов сахара ганглиозида, образующихся как побочные продукты в ходе синтеза сахара ганглиозида вследствие β-1,4-галактозилтрансферазной активности
β-1,4-GalNAc-трансферазы CgtA
Структура Наименование в тексте
Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc GA1
Galβ-4(Neu5Acα-3)Galβ-4Glc GA2
GalNAcβ-4(Neu5Acα-3)Galβ-4(Neu5Acα-3)Galβ-4Glc GA3
Galβ-4(Neu5Acα-3)Galβ-4(Neu5Acα-3)Galβ-4Glc GA4
Neu5Acα-3Galβ-4(Neu5Acα-3)Galβ-4Glc GA5
Galβ-4(Neu5Acα-8Neu5Acα-3)Galβ-4Glc GA6

Пример 8. Продукция сахара GM1 с использованием сиалилтрансферазы N. meninaitidis и UDP-Gal-С4-эпимеразы (GNE) Campylobacter

Сахар GA2 продуцировался культурой DC 15, так как CgtAll чрезвычайно активна и может использовать в качестве донора сахара UDP-Gal вместо UDP-GalNAc при недостатке UDP-GalNAc. Поскольку этот недостаток может быть следствием недостаточной активности UDP-GlcNАс-С4-эпимеразы, кодируемой геном wbpP, была исследована возможность использования эпимеразы, кодируемой геном gne С.jejuni. Недавно было показано, что продукт этого гена более активен, чем WbpP (Bernatchez et at., 2005). Ген gne был клонирован с помощью ПЦР из геномной ДНК С.jejuni штамм NCTC 11168 и субклонирован в плазмиду pBBR-SS вниз от генов neuВСА. Полученную плазмиду pBBR-SS-gne использовали для конструирования штамма DC21, который был подобен штамму DC 15 за исключением того, что он экспрессирует gne вместо wbpP (таблица 1).

Как показано на фиг.14, дополнительная экспрессия gne почти полностью ликвидировала накопление сахара isoGM2, а двумя основными продуктами были сахар GM1 (3) и сахар GA1 (5). Накопление GM1 было временным, его внутриклеточная концентрация достигала максимума через 28 ч после добавления лактозы и затем снижалась вследствие образования соединения (5).

Пример 9. Продукция сахара GM1 с помощью сиалилтрансферазы Cstlll С.jejuni

Ген csttll клонировали с помощью ПЦР, используя в качестве матрицы геномную ДНК из С.jejuni O:2 штамм NCTC 11168. 3атем ген cstlll субклонировали в плазмиду pBluescript вверх от cgtAll. Полученную плазмиду pBS-cstlll-cgtAll использовали для конструирования штамма DC22, который экспрессировал также гены cgtB и neuВСА для биосинтеза CMP-Neu5Ac.

Анализ методом ТСХ (фиг.15) показал, что сахар GM1 (3) был почти единственным олигосахаридом, который обнаруживался во внеклеточной фракции штамма DC22 к концу культивирования. Сиалиллактоза (1) и сахар GM2 (2) едва обнаруживались как промежуточные соединения. После очистки на смоле Dowex 1, как описано в примере 5, выход сахара GM1 составил 6 г из 1 л культуры.

Пример 10. Продукция сахара GM2

Продукцию сахара GM2 исследовали в штамме ZWT, который был подобен продуцирующему GM1 штамму DC21, с тем исключением, что он не экспрессировал ген cgtB. Как показано на фиг.16, лактоза быстро превращалась штаммом ZWT в соединения (2), подвижность которых была равна подвижности GM2. Неожиданным было то, что продуцировалось также соединение (3), которое двигалось медленнее, чем GM2.

Соединения (2) и (3) очищали из внутриклеточной фракции культуры штамма ZWT хроматографией на Dowex 1. Масс-спектрометрический анализ показал, что очищенное соединение (2) состояло из сахара GM2 и аналога сахара GA2.

В масс-спектре ESI- фракции В были два пика при m/z 1310 и 1269.

Пик при m/z 1310 соответствует, по-видимому, квазимолекулярным ионам [(M+Na-H)-H]-, полученным из гексасахарида GalNAcβ-4(Neu5Acα-3)Galβ-4(Neu5Acα-3)Galβ-4Glc, который далее был обозначен как сахар GA3 (таблица 3). Второй пик при m/z 1269 соответствует квазимолекулярным ионам [(M+Na-H)-H]-, полученным из структуры Galβ-4(Neu5Acα-3)Galβ-4(Neu5Acα-3)Galβ-4Glc (обозначена далее как сахар GA4).

Образование Сахаров GA3 и GA4 объяснено, как проиллюстрировано на фиг.11, побочной активностью сиалилтрансферазы Nst, которая, как оказывается, способна сиалилировать концевую невосстанавливающую Gal сахара GA2. Получающийся дисиалилированный пентасахарид (сахар GA6) может служить акцептором для CgtAll, подлежащим превращению в сахара GА3 или GA4.

Пример 11. Конструирование мутантов galU

Чтобы сконструировать мутант galU, фрагмент ДНК длиной 1,88 т.п.н., содержащий последовательность galU, амплифицировали в ПЦР, используя в качестве матрицы геномную ДНК E. coli К12 и два следующих праймера: 5'CAATGCCAAATATGGGGAAC (SEQ ID No 16) и 5'GCGGCCGCGTCTTTTCTGGCTAA (SEQ ID No 17). Амплифицированный фрагмент клонировали в вектор pCR4blunt-TOPO (Invitrogen), и фрагмент 0,244 т.п.н., расположенный между двумя сайтами Ndel, имеющимися в последовательности galU, вырезали расщеплением Ndel. Усеченный ген galU субклонировали в сайты Sall Notl вектора рКО3. Разрушение galU в штамме ZLKA проводили согласно протоколу замещения гена рКО3 (Link et al., 1997), получая хозяйский штамм ZWU.

Пример 12. Продукция сахара GM2 мутантами galU

Штамм ZWU2 был подобен штамму ZWT, использованному для продукции сахара GM2 в примере 10, за исключением того, что в качестве штамма-хозяина вместо штамма ZLKA использовали штамм ZWU с мутацией в гене galU (таблица 1). Как показано на фиг.17, к концу культивирования ZWU2 не обнаруживалось побочных продуктов (3). В добавление к этому масс-спектрометрический анализ показал, что соединение (2) состояло только из сахара GM2, а аналог сахара GA2, который имелся в соединении (2), очищенном из культуры ZWT, не обнаруживался (фиг.18).

Пример 13. Продукция сахара GD2

Первые попытки продукции сахара GD2 были предприняты со штаммом NF08, который был сконструирован путем трансформации штамма-хозяина ZLBCA тремя плазмидами: pUC18-cstll, pBBRS-SS-gne, pWKS-cgtAll (таблица 1). Изучение характеристик олигосахаридов, продуцируемых штаммом NF08, показало, что основными продуктами были сахар GM2 и его галактозилированный аналог - сахар GA2. Образовывалось также небольшое количество сахара GD2, но в результате очистки он получался в виде смеси с галактозилированными аналогами GA5 и GA6 (фиг.5).

Ген cgtAll субклонировали в плазмиду pBAD33 под контролем арабинозного промотора (Para). Таким образом, экспрессия cgtAll могла регулироваться независимо от других генов, которые были под контролем промотора Plac. Штамм NF09, содержавший плазмиду pBAD33-cgtAll вместо pWKS-cgtAll, культивировали без арабинозы в течение первых 24 ч, следующих за добавлением лактозы (3 г/л). 3атем добавляли арабинозу и культивировали штамм еще в течение 24 ч. Эта стратегия эффективно приводила к снижению продукции сахара GM2 с одновременным повышением выхода сахара GD2. Однако галактозилированные аналоги GA5 или GA6 все еще продуцировались в значительных количествах. Чтобы предотвратить образование этих аналогов, которые очень трудно отделить от GD2, исследовали продукцию GD2 в мутантном по galU штамме ZWUI.

Штамм ZWU1 был подобен штамму NF09, с тем отличием, что в качестве штамма-хозяина вместо штамма ZLKA был использован galU штамм ZWU (таблица 1). После культивирования в течение 25 ч добавили арабинозу для усиления экспрессии cgtAll, после чего почти вся сиалиллактоза исчезла. Очистка внутриклеточной фракции на Dowex 1 привела к выделению 4 фракций (фиг.19).

Масс-спектрометрический анализ показал, что фракция А состояла из сахара GM2, а фракция Б состояла из сахара GD2. Фракция В состояла в основном из сахара GD3, а фракция Г содержала сахар GT2. Никакие галактозилированные аналоги не были обнаружены, и в качестве основного продукта был получен сахар GD2.

Пример 14. Продукция GD1b и GT1

Оба гена cstll и cgtB были клонированы в одну и ту же плазмиду pBluescript (pBS-cstll-cgtB). Штамм NF21 конструировали, трансформируя штамм-хозяин ZLKA плазмидой pBS-cstll-cgtB и двумя плазмидами pBBR-SS-gne и pBAD33-cgtAll. Штамм NF21 культивировали при высокой плотности клеток, как описано для штамма NF09 в примере 13, в условиях, способствующих образованию GD2. Продуцированные в 1 л культуры штамма NF21 олигосахариды сначала очищали на смоле Dowex 1 (HCO3), 3 фракции (А, Б и В) элюировали градиентом NaHCO3 (0-1 М). Масс-спектрометрический анализ показал, что фракция А (490 мг) содержала сахар GD1, фракция Б (870 мг) содержала смесь сахара GD1 с аналогом GA5 или GA6, а фракция В (960 мг) содержала сахар GT1. Сахара GD1 и GT1 очищали из фракций А и В гель-проникающей хроматографией на колонке с Toyopearl HW40S, используя в качестве элюента 100 мМ NaHCO3. Как показано в таблице 4, анализ 1H-NMR показал, что химические сдвиги протона в положении Н-1 концевой галактозы и GD1, и GT1 были очень близки к сдвигам Н-1 в сахаре GM1a, в котором концевая галактоза не замещена. Напротив, сигнал Н-1 в концевой галактозе GD1 а и GT1 а сдвигался к 4,62 ppm вследствие его замещения сиаловой кислотой. Эти результаты ясно указывают, что сахара GD1 и GT1, продуцируемые штаммом NF21, имеют структуру GD1b и GT1с.

Пример 15. Продукция сахара GT1a

Два гена cstll и cgtA клонировали в одну и ту же плазмиду pBluescript, чтобы они совместно экспрессировались с генами cgtB и neuАВС в хозяйском штамме ZLKA - мутанте nanКЕАТ (таблица 1). Ген cstll клонировали в положении вниз от cgtA, чтобы иметь максимальную экспрессию cgtA и меньшую экспрессию cstll для минимизации образования GD3. Как показано на фиг.20, анализ методом ТСХ культуры NF 17 показал, что временно продуцируются соединения, движущиеся подобно сиалиллактозе (1), и сахар GM1 (3). К концу культивирования обнаруживалось небольшое количество соединения (2), двигавшееся как GD3, но основными конечными продуктами были соединения (4) и (5), двигавшиеся медленнее, чем GM1. Масс-спектрометрический анализ очищенных соединений показал, что соединения (4) и (5) имеют молекулярный вес, соответствующий GD1a и GT1a.

Пример 16. Продукция сиалилгалактозы

Штамм GLKA конструировали, удаляя гены nanКЕАТ из хромосомы мутантного по GalK штамма GLK (Dumon et al., 2005). Штамм GLK7 получали, трансформируя штамм GLKA плазмидами pBS-nst и pBBRS-SS (таблица 1). Культивирование штамма GLK7 при высокой плотности клеток в присутствии 3 г/л галактозы приводило к образованию дисахарида, который был идентифицирован как сиалилгалактоза с помощью масс-спектрометрического анализа. Выход продукции сиалилгалактозы был оценен в 6 г/л на основании колориметрического количественного определения общей сиаловой кислоты.

Пример 17. Продукция тетрасахарида Neu5Acα-3GalB-4GlcNAcB-4GlcNAc

Плазмиду pBS-nst-nodC конструировали путем клонирования гена nodC A. caulinodans из плазмиды pBS-nodC (Cottaz and Samain, 2005) в сайты EcoRV и Kpnl плазмиды pBS-nst. Штамм SN4 получали, трансформируя штамм ZLKA тремя плазмидами: pBS-nst-nodC, pBBR3-SS, pWKS-lgtB-chiA (таблица 1). Культивирование штамма SN4 при высокой плотности клеток приводило к продукции основного олигосахарида, который с помощью масс-спектрометрического анализа был идентифицирован как Neu5Aco-3Gal3-4GlcNAcB-4GlcNAc.

Литература

Antoine, T., Priem, B., Heyraud, A., Greffe, L., Gilbert, M., Wakarchuk, W.W., Lam, J.S. and Samain, E. (2003). Large-scale in vivo synthesis of the carbohydrate moieties of gangliosides GMI and GM2 by metabolically engineered Escherichia coli. Chembiochem 4, 406-412.

Antoine, T., Heyraud, A., Bosso, C. and Samain, E. (2005). Highly efficient biosynthesis of the oligosaccharide moiety of the GD3 ganglioside by using metabolically engineered Escherichia coli. Angew Chem Int Ed Engl 44, 1350-1352.

Bernatchez, S., Szymanski, C.M., Ishiyama, N., Li, J., Jarrell, H.C, Lau, P.C, Berghuis, A.M., Young, N.M. and Wakarchuk, W.W. (2005). A single bifunctional UDP-GlcNAc/Glc 4-epimerase supports the synthesis of three cell surface glycoconjugates in Campylobacterjejuni. J Biol Chem 280, 4792-4802.

Bettler, E., Samain, E., Chazalet, V., Bosso, C, Heyraud, A., Joziasse, D.H., Wakarchuk, W.W., Imberty, A. and Geremia, A.R. (1999). The living factory: in vivo production of N-acetyllactosamine containing carbohydrates in E.coli. Glycoconj J 16, 205-212.

Cottaz, S. and Samain, E. (2005). Genetic engineering of Escherichia coli for the production of N(I),N(II)-diacetylchitobiose (chitinbiose) and its utilization as a primer for the synthesis of complex carbohydrates. Metab Eng 7, 311-317.

Creuzenet, C, Belanger, M., Wakarchuk, W.W. and Lam, J.S. (2000). Expression, purification, and biochemical characterization of WbpP, a new UDP-GlcNAc C4 epimerase from Pseudomonas aeruginosa serotype 06. J Biol Chem 275, 19060-19067.

Datsenko, K. A. and Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97, 6640-6645.

Dumon, C, Samain, E. and Priem, B. (2004). Assessment of the two Helicobacter pylori alpha-1, 3-fucosyi transferase ortholog genes for the large-scale synthesis of LewisX human milk oligosaccharides by metabolically engineered Escherichia coli. Biotechnol Prog 20, 412-419.

Dumon, C, Bosso, C, Utille, J.P., Heyraud, A. and Samain, E. (2005). Production of Lewis x Tetrasaccharides by Metabolically Engineered Escherichia coli. Chembiochem 7, 359-365.

Dykxhoorn, D. M., St Pierre, R. and Linn, T. (1996). A set of compatible tac promoter expression vectors. Gene 177, 133-136.

Fort, S., Birikaki, L., Dubois, M. P., Antoine, T., Samain, E. and Driguez, H. (2005).

Biosynthesis of conjugatable saccharidic moieties of GM2 and GM3 gangliosides by engineered E.coli. Chem Commun (Camb), 2558-2560.

Ganguli, S., Zapata, G., Wallis, T., Reid, C, Boulnois, G., Vann, W.F. and Roberts, I. S. (1994). Molecular cloning and analysis of genes for sialic acid synthesis in Neisseria meningitidis group B and purification of the meningococcal CMP-NeuNAc synthetase enzyme. J Bacteriol 176, 4583-4589.

Gilbert, M., Bayer, R., Cunningham, A.M., DeFrees, S., Gao, Y., Watson, D. C, Young, N. M. and Wakarchuk, W. W. (1998). The synthesis of sialylated oligosaccharides using a CMP-Neu5Ac synthetase/sialyltransferase fusion. Nat Biotechnol 16, 769-772.

Gilbert, M., Karwaski, M.F., Bernatchez, S., Young, N.M., Taboada, E., Michniewicz, J., Cunningham, A.M. and Wakarchuk, W.W. (2002). The genetic bases for the variation in the lipo-oligosaccharide of the mucosal pathogen, Campylobacter jejuni. Biosynthesis of sialylated ganglioside mimics in the core oligosaccharide. J Biol Chem 277, 327-337.

Hamilton, C. M., Aldea, M., Washburn, B.K., Babitzke, P. and Kushner, S. R. (1989).

New method for generating deletions and gene replacements in Escherichia coli. J Bacteriol 171, 4617-4622.

Kalivoda, K.A., Steenbergen, S.M., Vimr, E.R. and Plumbridge, J. (2003).

Regulation of sialic acid catabolism by the DNA binding protein NanR in Escherichia coli. J Bacteriol 185, 4806-4815.

Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop, R.M., 2nd and Peterson, K.M. (1995). Four new derivatives of the broad-host-range cloning vector pBBRIMCS, carrying different antibiotic-resistance cassettes. Gene 166, 175-176.

Lee, J., Yi, J., Lee, S., Takahashi, S. and Kim, B. (2004). Production of N-acetylneuraminic acid from N acetylglucosamineand pyruvate using recombinant human renin binding protein and sialic aldolase in one pot. Enzyme Microb Technol 35, 121-125.

Link, A.J., Phillips, D. and Church, G.M. (1997). Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J Bacteriol 119, 6228-6237.

Linton, D., Gilbert, M., Hitchen, P.G., Dell, A., Morris, H. R., Wakarchuk, W.W., Gregson, N.A. and Wren, B.W. (2000). Phase variation of a beta-1,3 galactosyltransferase involved in generation of the ganglioside GMI -like lipo-oligosaccharide of Campylobacter jejuni. Mol Microbiol 31, 501-514.

Martinez, E., Bartolome, B. and de la Cruz, F. (1988). pACYC184-derived cloning vectors containing the multiple cloning site and lacZ alpha reporter gene of pUC8/9 and pUC18/19 plasmids. Gene 68, 159-162.

Maru, I., Ohnishi, J., Ohta, Y. and Tsukada, Y. (1998). Simple and large-scale production of N-acetylneuraminic acid from N-acetyl-D-glucosamine and pyruvate using N-acyl-D-glucosamine 2-epimerase and N-acetylneuraminate lyase. Carbohydr Res 306, 575-578.

Plumbridge, J. and Vimr, E. (1999). Convergent pathways for utilization of the amino sugars N-acetylglucosamine, N-acetylmannosamine, and N-acetylneuraminic acid by Escherichia coli. J Bacteriol 181, 47-54.

Priem, B., Gilbert, M., Wakarchuk, W. W., Heyraud, A. and Samain, E. (2002). A new fermentation process allows large-scale production of human milk oligosaccharides by metabolically engineered bacteria. Glycobiology 12, 235-240.

Samain, E., Drouillard, S., Heyraud, A., Driguez, H. and Geremia, R.A. (1997).

Gram-scale synthesis of recombinant chitooligosaccharides in Escherichia coli. Carbohydr Res 302, 35-42.

Stapleton, A.E., Stroud, M.R., Hakomori, S.I. and Stamm, W.E. (1998). The globoseries glycosphingolipid sialosyi galactosyi globoside is found in urinary tract tissues and is a preferred binding receptor In vitro for uropathogenic Escherichia coli expressing pap-encoded adhesins. Infect Immun 66, 3856-3861.

Vann, W.F., Tavarez, J.J., Crowley, J., Vimr, E. and Silver, R. P. (1997). Purification and characterization of the Escherichia coli Kl neuB gene product N-acetylneuraminic acid synthetase. Glycobiology 7, 697-701.

Vann, W.F., Daines, D.A., Murkin, A.S., Tanner, M.E., Chaffin, D.O., Rubens, C.E., Vionnet, J. and Silver, R.P. (2004). The NeuC protein of Escherichia coli Kl is a UDP N-acetylglucosamine 2-epimerase. J Bacteriol 186, 706-712.

Varki, A. (1993). Biological roles of oligosaccharides: all of the theories are correct. Glycobiology 3, 97-130.

Vimr, E.R. and Troy, F.A. (1985). Identification of an inducible catabolic system for sialic acids (nan) in Escherichia coli. J Bacteriol 164, 845-853.

Wang, R.F. and Kushner, S.R. (1991). Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100, 195-199.

Werner, I. and Odin, L. (1952). On the presence of sialic acid in certain glycoproteins and in gangliosides. Acta Soc Med Ups 57, 230-241.

Yamamoto, T., Nakashizuka, M. and Terada, I. (1998). Cloning and expression of a marine bacterial beta-galactoside alpha2,6-sialyltransferase gene from Photobacterium damsela JTO 160. J Biochem (Tokyo) 123, 94-100.

Zhang, X. and Kiechle, F.L. (2004). Review: Glycosphingolipids in health and disease. Ann Clin Lab Sci 34, 3-13.

1. Способ продукции олигосахаридов, содержащих по меньшей мере один остаток сиаловой кислоты, включающий предоставление микроорганизма, представляющего собой Е.сoli, который содержит гетерологичные гены, кодирующие СМР-Neu5Ac-синтетазу, синтазу сиаловой кислоты, GlcNAc-6-фосфат-2-эпимеразу и сиалилтрансферазу, в котором были делетированы или инактивированы эндогенные гены, кодирующие альдолазу сиаловой кислоты (NanA) и ManNac-киназу (NanK), причем указанный микроорганизм способен внутри клетки продуцировать активированную сиаловую кислоту в качестве донорного субстрата для сиалилтрансферазы; и культивирование указанного микроорганизма в культуральной среде, содержащей экзогенный предшественник, выбранный из группы, состоящей из лактозы, галактозы, β-галактозида и α-галактозида, при этом происходит активный захват указанного экзогенного предшественника внутрь микроорганизма, и указанный экзогенный предшественник является акцепторным субстратом для продукции сиалилированных олигосахаридов сиалилтрансферазой.

2. Способ п.1, где гетерологичный ген сиалилтрансферазы выбран из генов для α-2,3-сиалилтрансферазы, α-2,3- и α-2,8-сиалилтрансферазы (cstll) и α-2,6-сиалилтрансферазы.

3. Способ по п.1, где гетерологичный ген СМР-Neu5Ас-синтетазы - это neuA, гетерологичный ген синтазы сиаловой кислоты - это neuB, a гетерологичный ген С1 сМАс-6-фосфат-2-эпимеразы - это neuC.

4. Способ по п.3, где гены neuA, neuB и neuC выделены из бактериальных штаммов, содержащих сиалилированную структуру в клеточной оболочке, в том числе C.jejuni ATCC 43438.

5. Способ по п.1, где гены nanT, nanA, nanK и nanE делетированы или инактивированы (nanKEAT).

6. Способ по п.1, где указанный микроорганизм дополнительно кодирует белок, который способствует включению в клетки лактозы, и не имеет ферментов, метаболизирующих лактозу.

7. Способ по п.1, где указанный микроорганизм представляет собой клетку Е.coli, которая является lacY+(кодирует β-галактозид-пермеазу), lacZ- (кодирует β-галактозидазу) и, возможно, melA- (кодирует α-галактозидазу).

8. Способ по п.1, где экзогенный предшественник выбран из лактозы, галактозы, β-галактозида и α-галактозида, такого как глоботриоза (Galα-4Galβ-4Glc).

9. Способ по одному из пп.1-8, для продукции 3′-сиалиллактозы или 6′-сиалиллактозы, причем микроорганизм культивируют при высокой плотности клеток на углеродном субстрате, таком как глюкоза или глицерин, и подпитывают лактозой, которая интернализуется лактозо-пермеазой и сиалилируется указанной рекомбинантной сиалилтрансферазой с использованием CMP-Neu5Ac, создаваемой экзогенно из UDP-GlcNAc.

10. Способ по одному из пп.1-8, для продукции GD3, где гетерологичный ген сиалилтрансферазы - это ген бифункциональной α-2,3- и α-2,8-сиалилтрансферазы, которая катализирует перенос сиалильной группировки с активированной молекулы сиаловой кислоты, продуцируемой внутри клетки, на Neu5Acα-3Galβ-4Glc (GM3) с образованием Neu5Acα-8Neu5Acα-3Galβ-4Glc (GD3), такой как ген cstll из штамма Campylobacter jejuni ATCC 43438.

11. Способ по п.10, который распространен на продукцию GT3, причем микроорганизм дополнительно культивируют так, что бифункциональная сиалилтрансфераза катализирует перенос сиалильной группировки с активированной молекулы сиаловой кислоты, продуцируемой внутри клетки, на Neu5Acα-8Neu5Acα-3Galβ-4Glc (GD3) с образованием Neu5Ac5α-8Neu5Acα-8Neu5Acα-3Galβ-4Glc (GT3).

12. Способ по п.9, который включает продукцию углеводной части ганглиозида Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GM1), где микроорганизм дополнительно содержит гетерологичные последовательности, кодирующие β-1,4CalNAc-трансферазу и β-1,3-галактозилтрансферазу, причем β-1,4CalNAc-трансфераза переносит остаток UDP-GalNAc на сиалиллактозу (GM3) с образованием GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GM2), а β-1,3-галактозилтрансфераза переносит остаток галактозила на GM2 с образованием GM1.

13. Способ по п.12, где микроорганизм дополнительно содержит гетерологичную последовательность, кодирующую UDP-GlcNAc-4-эпимеразу, такую как ген wbpP из P.aeruginosa, или ген gne из С.jejuni.

14. Способ по п.13, который включает продукцию NeuSAcα-3Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GD1a) and Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GA1).

15. Способ по п.12 или 13 для специфической продукции GM1, где гетерологичная сиалилтрансфераза представляет собой α-2,3-сиалилтрансферазу, кодируемую геном cstlll, выделенным из штаммов C.jejuni, экспрессирующих липоолигосахаридные структуры, которые имитируют ганглиозид GM1, таких как штамм C.jejuni NCTC 111168.

16. Способ по п.9, который распространен на продукцию углеводной части ганглиозида GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GM2), причем микроорганизм дополнительно содержит гетерологичные последовательности, кодирующие β-1,4-CalMAc-трансферазу, такие как ген cgtAll из штамма C.jejuni 0:36 АТСС 43456, и UDP-GlcNAc-4-эпимеразу, и при этом в микроорганизме один из трех следующих генов делегирован или инактивирован, чтобы нарушить эндогенную продукцию UDP-Gal: ген galE, кодирующий UDP-глюкозо-эпимеразу, ген galU, кодирующий UDP-Glc-пирофосфорилазу, и ген pgm, кодирующий фосфоглюкомутазу.

17. Способ по п.9, который включает продукцию углеводной части ганглиозида GD2:

где микроорганизм дополнительно содержит гетерологичные последовательности, кодирующие UDP-GlcNAc-4-эпимеразу и β-1,4-GalMAc-трансферазу, которая использует сахар GD3 в качестве акцептора, такую, как белок CgtAll из штамма C.jejuni 0:36 АТСС 43456.

18. Способ по п.17, который включает продукцию сахара GDlb (Galβ-3GalNAcβ-4(Neu5Acα-8Neu5Acα-3)Galβ-4Glc) и сахара GTlc (Galβ-3GalNAcβ-4(Neu5Acα-8Neu5Acα-8Neu5Acα-3)Galβ-4Glc), причем микроорганизм дополнительно содержит гетерологичную последовательность, кодирующую β-3-Gal-трансферазу, такую как ген cgtB из штамма C.jejuni 0:2 NCTC 11168.

19. Способ по п.17, где в микроорганизме для нарушения эндогенной продукции UDP-Gal делетирован или инактивирован по меньшей мере один из трех генов: ген galE, кодирующий UDP-глюкозо-эпимеразу, ген galU, кодирующий UDP-Glc-пирофосфорилазу, и ген pgm.

20. Способ по п.9, который включает продукцию углеводной части ганглиозида GTlb:

где микроорганизм дополнительно содержит гетерологичные последовательности, кодирующие UDP-GlcNAc-4-эпимеразу, β-1,4-GalMAc-трансферазу, которая использует сахар GD3 в качестве акцептора, такую как белок CgtAll из штамма C.jejuni 0:36 АТСС 43456, и β-1,3-галактозилтрансферазу, как ген cgtB из штамма C.jejuni 0:2 NCTC 11168.

21. Способ по одному из пп.1-8 для продукции Neu5Acα-3Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GDlα) и Neu5Acα-8Neu5Aca-3Galβ-3GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GTlα), где микроорганизм содержит гетерологичные последовательности, кодирующие бифункциональную α-2,3-, α-2,8-сиалилтрансферазу, как ген cstll из штамма C.jejuni АТСС 43438, β-1,4-CalMAc-трансферазу, как ген cgtAll из штамма C.jejuni 0:36 АТСС 43456, которая не использует сахар GD3 в качестве акцептора, и β-1,3-галактозилтрансферазу, как ген cgtB из штамма C.jejuni 0:2 NCTC 111168.

22. Способ по одному из пп.1-8, для продукции пентасахарида LSTD (Neu5Acα-3Galβ-4GlcNacβ-3Galβ-4Glc), где сиалилтрансфераза представляет собой α-2,3-сиалилтрансферазу, в том числе кодируемую геном nst, и при этом микроорганизм дополнительно содержит гетерологичные гены IgtA и IgtB, кодирующие соответственно β-1,3-GlcNAc-трансферазу и β-1,4-галактозилтрансферазу.

23. Способ по п.20 для продукции олигосахаридов сиалил-lewis Х, где микроорганизм дополнительно содержит гетерологичную последовательность, кодирующую α-1,3-фукозил-трансферазу, в том числе кодируемая геном futA (SED ID No 18) или геном ovfutB (SED ID No 19) H.pylori.

24. Способ по одному из пп.1-8 для продукции сиалозил-галактозил-глобозида (Neu5Acα-3Gal(3-3GalNAcβ-3Galα-4Gal(3-4Gal), где микроорганизм культивируют в среде с глоботриозой, он является lacY+, melA-, nanT+, nanA-, nanK- и содержит гетерологичный ген IgtD, такой как ген IgtD из Haemophilus influenzae HI 1578, GenBanK U32832, гены для α-2,3-сиалилтрансферазы и UGP-GlcMAc-С4-эпимеразы, а также гены neuABC.

25. Способ по одному из пп.1-8 для продукции сиалозил-галактозы (Neu5Acα-3Gal) и сиалилированных олигосахаридов с концевой редуцированной галактозой, где микроорганизм является galK-, nanA- и nanK- (или nanKEAT-), экспрессирует ген для сиалилтрансферазы и гены neuBCA и культивируется в среде с галактозой.

26. Способ по п.1 для продукции сиалилированных олигосахаридов с хитоолигосахаридной структурой на их восстанавливающем конце, таких как сиалилированный гептасахарид Neu5Acα-3Galβ-4[GlcNAcβ-4]4GlcNAc, где сиалилтрансфераза является α-2,3-сиалилтрансферазой, такой как кодируемая геном nst Neisseria, и микроорганизм дополнительно содержит ген синтазы хитинового олигосахарида, такой как ген nodC Azorhizobium caulinodans и ген β-1,4-галактозилтрансферазы, такой как ген IgtB Neisseria meningitidis.

27. Способ по п.26 для продукции сиалилированного тетрасахарида Neu5Acα-3Galβ-4GlcNAcβ-4GlcNAc, где микроорганизм дополнительно содержит гетерологичную последовательность, кодирующую хитиназу, такую как ген chiA.

28. Способ по п.26 или 27, где в культуральную среду не добавляется экзогенный предшественник.

29. Способ по п.9, где микроорганизмы выращивают на глицерине или глюкозе в качестве источника углерода.

30. Микроорганизм, представляющий собой Е.coli, способный продуцировать сиалилированные олигосахариды из продуцируемой внутри клетки сиаловой кислоты, содержащей гетерологичные гены, кодирующие СМР-Neu5Ac-синтетазу, синтазу сиаловой кислоты, GlcNAc-6-фосфат-2-эпимеразу и сиалилтрансферазу, в котором были делетированы или инактивированы эндогенные гены, кодирующие альдолазу сиаловой кислоты (NanA) и ManNac-киназу (NanK).

31. Микроорганизм по п.30, где гетерологичный ген сиалилтрансферазы выбран из генов α-2,3-сиалилтрансферазы, α-2,3- и α-2,8-сиалилтрансферазы (cstll) и α-2,6-сиалилтрансферазы.

32. Микроорганизм по п.30, где гетерологичный ген CMP-Neu5Ac-синтетазы - это neuA, гетерологичный ген синтазы сиаловой кислоты - это neuB, а гетерологичный ген GlcMAc-6-фосфат-2-эпимеразы - это neuC.

33. Микроорганизм по п.32, где гены neuA, neuB и neuC выделены из бактериальных штаммов, содержащих сиалилированную структуру, включая штамм C.jejuni ATCC 43438.

34. Микроорганизм по п.30, где гены nanT, nanA, nanK и nanE делетированы или инактивированы (nanKEAT-).

35. Микроорганизм по п.30, где указанный микроорганизм дополнительно кодирует белок, который способствует включению в клетки лактозы, и не имеет ферментов, метаболизирующих лактозу.

36. Микроорганизм по п.30, где указанный микроорганизм представляет собой клетку Е.coli, которая является lacY+(кодирует β-галактозид-пермеазу), lacZ- (кодирует β-галактозидазу) и, возможно, melA- (кодирует α-галактозидазу).

37. Микроорганизм по одному из пп.30-36, для продукции GD3, где гетерологичный ген сиалилтрансферазы - это ген бифункциональной α-2,3- и α-2,8-сиалилтрансферазы, которая катализирует перенос сиалильной группировки с активированной молекулы сиаловой кислоты, продуцируемой внутри клетки, на Neu5Acα-3Galβ-4Glc (GM3) с образованием Neu5Acα-8Neu5Acα-3Galβ-4Glc (GD3), в частности ген cstll из штамма Campylobacter jejuni ATCC 43438.

38. Микроорганизм по п.30, который дополнительно содержит гетерологичные последовательности, кодирующие β-1,4CalNAc-трансферазу и β-1,3-галактозилтрансферазу, причем β-1,4CalNAc-трансфераза переносит остаток UDP-GalNAc на сиалиллактозу (GM3) с образованием GalNAcβ-4(Neu5Acα-3)Galβ-4Glc (GM2), а β-1,3-галактозилтрансфераза переносит остаток галактозила на GM2 с образованием GM1.

39. Микроорганизм по п.38, который дополнительно содержит гетерологичную последовательность, кодирующую UDP-GlcNAc-4-эпимеразу, такую как ген wbpP из P.aeruginosa, или ген gne из С.jejuni.

40. Микроорганизм по п.38 или 39 для специфической продукции GM1, где гетерологичная сиалилтрансфераза представляет собой α-2,3-сиалилтрансферазу, кодируемую геном cstlll, выделенным из штаммов C.jejuni, экспрессирующих липоолигосахаридные структуры, которые имитируют ганглиозид GM1, таких как штамм C.jejuni NCTC 111168.

41. Микроорганизм по п.30, который дополнительно содержит гетерологичные последовательности, кодирующие β-1,4-GalMAc-трансферазу, такие как ген cgtAll из штамма C.jejuni 0:36 АТСС 43456, и UDP-GlcNAc-4-эпимеразу, и при этом в микроорганизме один из трех следующих генов делетирован или инактивирован, чтобы нарушить эндогенную продукцию UDP-Gal: ген galE, кодирующий UDP-глюкозо-эпимеразу, ген galU, кодирующий UDP-Glc-пирофосфорилазу, и ген pgm, кодирующий фосфоглюкомутазу.

42. Микроорганизм по п.30, который дополнительно содержит гетерологичные последовательности, кодирующие UDP-GlcNAc-4-эпимеразу и β-1,4-GalMAc-трансферазу, которая использует сахар GD3 в качестве акцептора, такую как белок CgtAll из штамма C.jejuni 0:36 АТСС 43456.

43. Микроорганизм по п.42, который дополнительно содержит гетерологичную последовательность, кодирующую β-3-Gal-трансферазу, такую как ген cgtB из штамма C.jejuni 0:2 NCTC 11168.

44. Микроорганизм по п.42, в котором для нарушения эндогенной продукции UDP-Gal делетирован или инактивирован по меньшей мере один из трех генов: ген galE, кодирующий UDP-глюкозо-эпимеразу, ген galU, кодирующий UDP-Glc-пирофосфорилазу, и ген pgm.

45. Микроорганизм по п.30, который дополнительно содержит гетерологичные последовательности, кодирующие UDP-GlcNAc-4-эпимеразу, β-1,4-CalMAc-трансферазу, которая использует сахар GD3 в качестве акцептора, такую как белок CgtAll из штамма C.jejuni 0:36 АТСС 43456, и β-1,3-галактозилтрансферазу, как ген cgtB из C.jejuni 0:2 штамм NCTC, № доступа 11168.

46. Микроорганизм по одному из пп.30-36, который содержит гетерологичные последовательности, кодирующие бифункциональную α-2,3-, α-2,8-сиалилтрансферазу, в частности cstll из штамма C.jejuni АТСС 43438, β-1,4-GalMAc-трансферазу, в том числе ген cgtAll из штамма C.jejuni 0:36 АТСС 43456, которая не использует сахар GD3 в качестве акцептора, и β-1,3-галактозилтрансферазу, в том числе ген cgtB из штамма C.jejuni 0:2 NCTC 111168.

47. Микроорганизм по одному из пп.30-36, который дополнительно содержит гетерологичные гены IgtA и IgtB, кодирующие соответственно β-1,3-GlcNAc-трансферазу и β-1,4-галактозилтрансферазу.

48. Микроорганизм по п.45, который дополнительно содержит гетерологичную последовательность, кодирующую α-1,3-фукозил-трансферазу, такую как кодируемая геном futA (SED ID No 18) или геном ovfutB (SED ID No 19) H.pylori.

49. Микроорганизм по одному из пп.30-36, который является lacY+, melA-, nanT+, nanA-, nanK- и содержит гетерологичный ген IgtD, в том числе ген IgtD из Haemophilus influenzae HI 1578, GenBanK U32832, гены для α-2,3-сиалилтрансферазы и UGP-GlcMAc-C4-эпимеразы, а также гены neuABC.

50. Микроорганизм по одному из пп.30-36, который является galK-, nanA- и nanK- (или nanKEAT), экспрессирует ген для сиалилтрансферазы и гены neuBCA и культивируется в среде с галактозой.

51. Микроорганизм по п.30, который дополнительно содержит ген синтазы хитинового олигосахарида, такой как ген nodC Azorhizobium caulinodans и ген β-1,4-галактозилтрансферазы, в том числе ген IgtB Neisseria meningitidis.

52. Микроорганизм по п.51, который дополнительно содержит гетерологичную последовательность, кодирующую хитиназу, в том числе ген chiA.

53. Среда для продукции сиалилированных олигосахаридов, включающая культуральную среду, содержащую лактозу, и микроорганизм, представляющий собой Е.coli, содержащий гетерологичные гены, кодирующие СМР-Neu5Ac-синтетазу, синтазу сиаловой кислоты, GlcNAc-6-фосфат-2-эпимеразу и сиалилтрансферазу, в котором были делетированы или инактивированы эндогенные гены, кодирующие альдолазу сиаловой кислоты (NanA) и ManNac-киназу (NanK).

54. Микроорганизм, предназначенный для продукции сиалилированных олигосахаридов, представляющий собой Е.coli, содержащий гетерологичные гены, кодирующие СМР-Neu5Ac-синтетазу, синтазу сиаловой кислоты, GlcNAc-6-фосфат-2-эпимеразу и сиалилтрансферазу, при этом эндогенные гены, кодирующие альдолазу сиаловой кислоты (NanA) и ManNac-киназу (NanK), делетированы или инактивированы, указанный микроорганизм способен внутри клетки продуцировать активированную сиаловую кислоту в качестве донорного субстрата для сиалилтрансферазы, при этом клетка Е.coli является lacY+ (кодирует β-галактозид-пермеазу), lacZ- (кодирует β-галактозидазу) и, возможно, melA- (кодирует α-галактозидазу).



 

Похожие патенты:

Изобретение относится к области биохимического синтеза. .

Изобретение относится к биотехнологии и пищевой промышленности и касается способа ферментативного гидролиза зернистого крахмала в растворимый гидролизат крахмала при температуре ниже, чем начальная температура желатинизации указанного зернистого крахмала.

Изобретение относится к генной инженерии и может быть использовано для получения линейных -1,4 глюканов в растениях. .
Изобретение относится к биотехнологии, может быть использовано в пищевой промышленности для получения циклодекстринов и циклодекстринглюканотрансферазы (ЦГТ-азы), применяемых в различных отраслях промышленности.

Изобретение относится к биотехнологии и предназначено для получения фукозилированных углеводов. .

Изобретение относится к области биотехнологии. Предложен способ получения β-циклодекстрина. Способ предусматривает приготовление суспензии мальтодекстрина, проведение процесса циклизации ферментным препаратом ЦГТ-азы в присутствии комплексанта трихлорэтилена. Далее проводят удаление комплексанта кипячением, очистку полученного продукта активным углем, отделение активного угля фильтрованием и уваривание сиропа и его кристаллизацию при перемешивании и снижении температуры. В завершении осуществляют центрифугирование и промывку холодной водой кристаллов β-циклодекстрина, их сушку и упаковку. Предложенное изобретение может быть использовано для получения циклических комплексообразователей, в частности β-циклодекстрина. 2 ил.

Группа изобретений относится к области биотехнологии. Предложен способ получения смеси глюкоолигосахаридов, содержащих две или более последовательных (α1→6) гликозидных связей и две или более последовательных (α1→4) гликозидных связей. Вводят в контакт поли- и/или олигосахарид, включающий на невосстанавливающем конце по меньшей мере две (α-1→4)-связанные единицы D-глюкозы, с ферментом α-глюканотрансферазой. Указанный фермент является GTFB типом фермента и расщепляет (α1→4) и создает новые (α1→4) и (α1→6) гликозидные связи. Предложены выделенные линейные глюкоолигосахариды и их смеси, получаемые указанным способом, их применение в качестве волокна-пребиотика, в том числе в пищевой композиции. Также предложен генетически модифицированный GTFA-подобный глюкансахаразный фермент, включающий по меньшей мере две мутации, указанные в формуле изобретения, и обладающий GTFB-подобной активностью. Указанный модифицированный фермент расщепляет (α1→4) и создает новые (α1→4) и (α1→6) гликозидные связи, используя в качестве субстрата поли- и/или олигосахариды, включающие (α1→4)-связанные единицы D-глюкозы на своем невосстанавливающем конце. Изобретения позволяют получать частично неперевариваемые производные крахмала, без введения точек ветвления (α1→6), (α1→2) или (α1→3) связи. 8 н. и 11 з.п. ф-лы, 2 табл., 8 ил.

Группа изобретений относится к генетически модифицированной клетке для продуцирования фукозилированных олигосахаридов, способу ее получения и способу получения фукозилированных олигосахаридов. Генетически модифицированную клетку получают трансформированием клетки геном, кодирующим фукозокиназу, геном, кодирующим фукозо-1-фосфатгуанилилтрансферазу, геном, кодирующим фукозилтрансферазу. Катаболический путь для фукозы инактивирован в указанной клетке путем инактивации одного или нескольких генов, которые выбирают из группы, состоящей из гена фукозо-1-фосфат-альдолазы, гена фукозоизомеразы и гена фуколозокиназы. При этом клетка представляет собой микроорганизм, который выбирают из группы, состоящей из родов Escherichia, Klebsiella, Helicobacter, Bacillus, Lactobacillus, Streptococcus, Lactococcus, Pichia, Saccharomyces и Kluyveromyces. С использованием указанной генетически модифицированной клетки получают фукозилированные олигосахариды путем ее культивирования в подходящих условиях в среде, включающей фукозу и субстрат-акцептор, в котором субстрат-акцептор представляет собой моно-, ди- или олигосахарид или пептид. 3 н. и 6 з.п. ф-лы, 12 ил., 3 табл., 11 пр.

Настоящее изобретение относится к способу получения изомальтоолигосахаридной композиции и может быть использовано в пищевой промышленности. Предложенный способ включает стадии взаимодействия крахмальной суспензии, содержащей от 15% до 45% крахмала по весу, с 0,0001-10% (массовая доля твердых веществ) амилазного ожижающего фермента при температуре от около 95°С до около 125°С и pH около 5-7 в течение 60-210 мин; взаимодействия полученного продукта с 0,0001-10% (массовая доля) бета-амилазного мальтогенного фермента или грибкового альфа-амилазного мальтогенного фермента и 0,0001-10% (массовая доля) инвертазы, обладающей трансглюкозидазной активностью, при температуре выше 10°С и ниже 85°С и при pH выше 2 и ниже 10, где мальтогенный фермент и инвертазу вводят во взаимодействие одновременно с указанным продуктом, для получения изомальтоолигосахаридов. Предложен новый эффективный способ получения ценных углеводов. 12 з.п. ф-лы, 4 пр., 1 табл., 2 ил.
Наверх