Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества



Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества
Пептид или пептидный комплекс, связывающийся с альфа2-интегрином, способы его получения и применения указанного вещества

 


Владельцы патента RU 2588668:

САНОФИ (FR)

Изобретение относится к биохимии. Описаны выделенное моноклональное антитело или его антигенсвязывающий фрагмент, где указанное антитело или фрагмент специфически связывается с I-доменом α2-интегрина человека, нуклеиновая кислота, кодирующая данное антитело, и клетка, содержащая данную нуклеиновую кислоту. Представлен способ получения данного антитела, фармацевтическая композиция и наборы, содержащие данное антитело. Также представлены способы диагностики и лечения, использующие данное антитело. Изобретение представляет специфический ингибитор α2-интегрина. 11 н. и 36 з.п. ф-лы, 14 ил., 14 табл., 10 пр.

 

Настоящее изобретение относится к пептиду или пептидному комплексу, связывающемуся с α2-интегрином, который предназначен для лечения, профилактики или диагностики, к одной или нескольким нуклеиновым кислотам, кодирующим указанный пептид или пептидный комплекс, к рекомбинантной клетке, продуцирующей указанный пептид или пептидный комплекс, к способу получения указанного пептида или пептидного комплекса, к фармацевтической композиции, включающей указанный пептид, пептидный комплекс или нуклеиновые кислоты, которая предназначена для применения в качестве лекарственного средства, к способу обнаружения α2-интегрина и способу скрининга.

Уровень техники

Интегрины являются трансмембранными белками, опосредующими взаимодействие между адгезивными молекулами на смежных клетках и/или во внеклеточном матриксе (ЕСМ). Интегрины выполняют разные функции в нескольких биологических процессах, включающих миграцию клеток в процессе роста и заживления ран, дифференцировки и апоптоза клеток. Интегрины также могут регулировать метастатический и инвазивный потенциал опухолевых клеток. Интегрины существуют в виде гетеродимеров, состоящих из α и β субъединиц. Некоторые α и β субъединицы обладают специфичностью в отношении друг друга и могут быть определены в качестве члена VLA (очень позднего антигена). Гетеродимеры часто предпочтительно связываются с определенными адгезивными молекулами клеток или компонентами ЕСМ. Несмотря на отсутствие каталитической активности, интегрины могут быть частью мультимолекулярных сигнальных комплексов, известных как фокальные адгезии.

При связывании с лигандами интегрины передают внутриклеточные сигналы цитоскелету, которые изменяют активность клетки в ответ на адгезивные события клетки, при этом данный процесс определяется как передача сигнала внутрь клетки. Такая передача сигнала может также активировать интегрины других подтипов, экспрессированные на той же клетке, при этом данный процесс определяется как передача сигнала из клетки. Передача сигнала из клетки далее происходит при помощи регуляторных сигналов, возникающих в цитоплазме клетки вследствие разрыва сцепления между α и β субъединицами, которые затем передаются в наружный лигандсвязывающий домен рецептора. Интегрины могут играть важную роль в адгезивных событиях клетки, регулирующих рост, морфогенез, физиологию и патологию органа, а также гомеостаз нормальной ткани, иммунные и тромботические реакции, и, кроме того, интегрины являются сенсорами окружающей среды для клетки.

Одним из гетеродимеров интегринов является α2β1-интегрин. α2β1-Интегрин экспрессирован на клетках нескольких разных типов, включающих эндотелиальные и эпителиальные клетки, фибробласты, лимфоциты и тромбоциты. Специфичность α2β1-интегрина к лиганду изменяется в зависимости от типа клетки. Указанный интегрин является рецептором коллагена на тромбоцитах и фибробластах и в то же время может быть рецептором коллагена и ламинина на эндотелиальных и эпителиальных клетках.

α2β1-Интегрин представляет собой молекулу, состоящую из субъединицы α2-интегрина из семейства α-интегринов и субъединицы β1-интегрина из семейства β-интегринов. Последовательности α2 и β1 интегрина известны в данной области и рассмотрены, например, в публикациях Takada and Hemler, J. Cell Biol. 109(1):397-407, 1989, и Argraves, W.S., J. Cell Biol. Sep 105(3):1183-90 (1987). Примеры последовательностей приведены на фигуре 9, другие последовательности представлены в базе данных Национального центра биотехнологической информации (NCBI), например, под номерами доступа NCBI NP_002194, NM_002203, NM_002211, NP_002202 (изоформа 1А β1-интегрина) для α2- и β1-интегрина homo sapiens, см. также ниже.

В данной области известны альтернативные сплайсированные варианты, изоформы, а также последовательности, отличные от человеческих (например, принадлежащие грызунам, таким как мышь, крыса и т.д., обезьянам или другим животным), которые представляют собой возможные альтернативные варианты, если они выполняют по меньшей мере одну из известных функций α2- или β1-интегрина.

Субъединица α2-интегрина является членом субпопуляции субъединиц α-интегрина, содержащих домен, состоящий примерно из 200 аминокислот, который расположен около аминоконца и часто определяется как I-домен (или введенный домен). Многие I-домены, включая I-домен субъединицы α2-интегрина, содержат дополнительный катионсвязывающий сайт, фрагмент адгезивного сайта, зависящего от иона металла (MIDAS). Структура I-домена α2-интегрина описана, например, в публикации Dickenson et al., J. Biol. Chemistry, 272, 7661-7668 (1997). I-Домены являются важными детерминантами связывания с лигандами. Аминокислотная последовательность I-домена α2-интегрина показана на фигуре 9, где она отмечена в последовательности α2-интегрина (SEQ ID NO:20).

α2β1-Интегрин (очень поздний антиген 2; VLA-2) экспрессирован на клетках разных типов, включая тромбоциты, эндотелиальные клетки сосудов, эпителиальные клетки, активированные моноциты/макрофаги, фибробласты, лейкоциты, лимфоциты, активированные нейтрофилы и мастоциты. Природными лигандами для α2β1-интегрина являются коллаген и ламинин, обнаруженные во внеклеточном матриксе. α2β1-Интегрин участвует в нескольких биологических и патологических процессах, включающих вызываемую коллагеном агрегацию тромбоцитов, миграцию клеток в коллагене, клеточнозависимую реорганизацию коллагеновых волокон, а также коллагензависимые реакции клетки, вызывающие увеличение экспрессии и пролиферации цитокинов, изменение функции Т-клеток, мастоцитов и нейтрофилов, аллергическую реакцию замедленного типа, контактную аллергию, коллагеновый артрит, морфогенез протоков молочной железы, заживление ран эпидермиса и процессы, ассоциированные с VEGF-индуцированным развитием кровеносных сосудов.

Тромбоциты обычно циркулируют в крови в состоянии покоя, однако, они быстро реагируют на целый ряд агонистов в местах возникновения повреждения. Стимулированные тромбоциты резко изменяются и активно взаимодействуют с белками плазмы, такими как фибриноген и фактор Виллебранда (vWf), другими тромбоцитами и эндотелиальной выстилкой стенок сосудов. Все указанные взаимодействия облегчают быстрое образование гемостатической массы из тромбоцитов фибрина (Cramer, 2002, in Hemostasis and Thrombosis, 4th edition). При связывании с лигандов рецепторы тромбоцитов передают сигнал внутрь клетки, которая в свою очередь передает сигнал наружу, в результате чего активируются вторичные рецепторы, такие как рецептор фибриногена тромбоцитов, αIIbβ3-интегрин, вызывающие агрегацию тромбоцитов. Даже незначительная активация тромбоцитов может вызвать тромботические реакции, тромбоцитопению и геморрагические осложнения.

α2-Интегрин является единственным коллагенсвязывающим интегрином, экспрессированным на тромбоцитах, и предположительно играет некоторую роль в адгезии тромбоцитов с коллагеном и гемостазе (Santoro et al., Thromb. Haemost. 74:813-821 (1995); Vanhoorelbeke et al., Curr. Drug Targets Cardiovasc. Haematol. Disord. 3(2):125-40 (2003); Sarratt et al., Blood 106(4):1268-1277 (2005)). Поэтому желательно инактивировать функцию алфа2-интегрина с целью негативного воздействия на агрегацию тромбоцитов. Одним типом такого ингибирования может быть, например, аллостерическое ингибирование, которое блокирует интегрин в неактивном состоянии.

Взаимодействие интегрина с лигандом может облегчать транссудацию лейкоцитов в воспаленные ткани (Jackson et al., J. Med. Chem. 40:3359-3368 (1997); Gadek et al., Science 295(5557):1086-9 (2002), Sircar et al., Bioorg. Med. Chem. 10:2051-2066 (2002)) и играть определенную роль в событиях, следующих за начальной транссудацией лейкоцитов из кровотока в ткани в ответ на воспалительные раздражители, включая миграцию, рекрутинг и активацию провоспалительных клеток в месте воспаления (Eble J. A., Curr. Pharm. Des. 11(7):867-880 (2005)).

Как отмечалось в научной литературе, блокирование α2-интегрина влияет на аллергические реакции замедленного типа и эффективность лечения ревматоидного артрита в мышиной модели и модели воспалительного заболевания кишечника (Kriegelstein et al., J. Clin. Invest. 110(12):1773-82 (2002); de Fougerolles et al., J. Clin. Invest. 105:721-720 (2000)) и ослабляет пролиферацию и миграцию эндотелиальных клеток in vitro (Senger et al., Am. J. Pathol. 160(1):195-204 (2002), из чего следует, что блокирование α2-интегрина может предотвращать/ингибировать анормальное или более интенсивное развитие кровеносных сосудов, имеющее место в разных типах рака. Кроме того, было установлено, что ингибирование α2-интегрина в модели хирургического удаления колоректального рака у крыс оказывает эффективное антиметастатическое действие (van der Bji et al., Hepatology 47(2):532-543 (2008)). Подобным образом также можно воспрепятствовать коммитированию клеток колоректального рака с образованием злокачественного фенотипа (Kirkland et al., J. Biol. Chem. 283(41):27612-27619 (2008)). Так как установлено, что α2-интегрин опосредует злокачественный фенотип рака поджелудочной железы (Grzesiak and Bouvet, Br. J. Cancer 94:1311-1319 (2006)), то в настоящее время ведутся исследования по терапевтическому воздействию на указанную мишень при лечении агрессивного рака такого типа. Кроме того, α2β1-интегрин взаимодействует с гликосфинголипидами при прогрессировании рака предстательной железы, из чего следует, что блокирование такого взаимодействия позволит терапевтически воздействовать на рак данного типа (van Slambrouck et al., Int. J. Onco. 345:693-699 (2009)). α2-Интегрин, по-видимому, играет важную роль в экспериментальном аутоиммунном энцефалите (ЕАЕ), мышиной модели рассеянного склероза (MS), так как лечение антителом против α2-интегрина, проведенное сразу же после возникновения данного заболевания, подавляло клинические признаки и воспаление центральной нервной системы (Tsunoda et al., Brain Pathol. 17:45-55 (2007)). Механизм терапевтически благоприятного воздействия антитела против α2-интегрина, вероятнее всего, связан с ингибированием взаимодействия α2β1-интегрина с белком комплемента C1q. Указанное взаимодействие является первой стадией дегрануляции и активации мастоцитов, опосредующих аутоиммунные и воспалительные заболевания, такие как рассеянный склероз, системная красная волчанка, гломерулонефрит (McCall-Culbreath et al., Blood 111 (3562-3570) 2008).

Таким образом, α2-интегрин является интересной мишенью для медицинского воздействия. Так как интегрины являются трудными мишенями для создания специфических ингибиторов и, принимая во внимание различные возможные терапевтические показания, существует потребность в альтернативных ингибиторах, связывающихся с α2-интегрином, в частности, ингибиторах альфа2-интегрина, обладающих свойствами, отличающимися от свойств существующих ингибиторов α2-интегрина, которые могут быть использованы при лечении нарушений, ассоциированных с α2-интегрином.

Сущность изобретения

Настоящее изобретение относится к антителам против α2-интегрина, антигенсвязывающим фрагментам и другим связывающим молекулам, предназначенным для лечения, профилактики или диагностики, к одной или нескольким нуклеиновым кислотам, кодирующим связывающую молекулу, к рекомбинантной клетке, продуцирующей связывающую молекулу, к способу получения связывающей молекулы, к фармацевтической композиции, включающей связывающую молекулу или нуклеиновые кислоты, которая предназначена для применения в качестве лекарственного средства, к способу обнаружения α2-интегрина и способу скрининга.

В данной связи было создано и испытано моноклональное антитело против α2-интегрина. Указанное антитело обладает благоприятными характеристиками, рассмотренными в примерах. В частности, антитело против α2-интегрина и его моновалентные фрагменты или производные были исследованы в отношении констант связывания, перекрестной реактивности, было произведено картирование доменов и получены данные функционирования in vitro.

Установлено, что моноклональное антитело (mAb) связывается с I-доменом α2-интегрина со сродством в нМ диапазоне, при этом связывание происходит в эпитопе I-домена, отличающемся от эпитопа, с которым связывается антитело-компаратор, известное в данной области, которое также направленно воздействует на I-домен альфа2-интегрина. Все созданные молекулы антитела по настоящему изобретению (mAb IgG4, Fab) характеризуются сравнимыми скоростями ассоциации и диссоциации при выполнении экспериментов методом Biacore. Указанные антитела обладают перекрестной реактивностью с α2β1-интегрином приматов, при этом не было обнаружено перекрестной реактивности с α2β1-интегрином мышей, крыс, собак, морских свинок или кроликов при исследовании с использованием тромбоцитов, полученных у соответствующих видов животных.

Исследованные молекулы ингибируют взаимодействие рекомбинантного α2-интегрина с коллагеном in vitro при низких значениях нМ IC50. Помимо ингибирования коллагена, моноклональное антитело против α2β1-интегрина или его Fab-фрагменты способны ингибировать адгезию тромбоцитов с коллагеном при использовании выделенных тромбоцитов человека и плазмы человека с высоким содержанием тромбоцитов в статических условиях. Указанные антитела также способны ингибировать образование тромбов на поверхности, покрытой коллагеном, в текучем состоянии. Способность блокировать связывание с коллагеном и, таким образом, предотвращать адгезию тромбоцитов с коллагеном является одной из ранних стадий устранения образования тромба.

И наконец, моноклональные антитела или Fab-фрагменты не вызывают активации тромбоцитов, поскольку не было обнаружено увеличения активации GPIIbIIIa или поверхностной экспрессии Р-селектина у ~30 доноров указанного моноклонального антитела. Таким образом, настоящее изобретение относится к моновалентным антителам, фрагментам или производным указанных антител и их применению для приготовления исследовательских, диагностических и терапевтических агентов, предназначенных для лечения указанных ниже нарушений, связанных с α2-интегрином; конкретные примеры нарушений включают тромбоз, другие сосудистые заболевания, рак и патологические последствия развития кровеносных сосудов, аутовоспалительные заболевания, такие как рассеянный склероз.

Как должно быть известно квалифицированному специалисту, характеристики связывания антител определяются вариабельными доменами. В антителах, связывающихся с антигеном, обычно присутствует вариабельный домен из тяжелой цепи и совместно действующий вариабельный домен из легкой цепи, которые расположены с возможностью достижения совместного действия. Вариабельный домен также определяется как FV-область. В частности, за связывание с антигеном отвечают вариабельные петли, по три в легкой (VL) и тяжелой (VH) цепи. Указанные петли именуются областями, определяющими комплементарность (CDR), LCDR1, LCDR2 и LCDR3 для VL и HCDR1, HCDR2 и HCDR3 для VH. В данной области известен целый ряд разных расположений вариабельного домена в тяжелой цепи и совместно действующего вариабельного домена в легкой цепи. Поэтому важно идентифицировать один или несколько приемлемых вариабельных доменов в тяжелой цепи и один или несколько совместно действующих вариабельных доменов в легкой цепи. В результате выполнения сравнительного анализа последовательностей были идентифицированы CDR-области тяжелой и легкой цепей для вышеуказанного антитела против α2-интегрина.

Первым объектом настоящего изобретения являются пептид или пептидный комплекс, предпочтительно выделенное моноклональное антитело или его антигенсвязывающий фрагмент, которые специфически связываются с I-доменом α2-интегрина человека, при этом указанное антитело или его фрагмент включает домен вариабельной области тяжелой цепи (VH) и домен вариабельной области легкой цепи (VL) и обладает перекрестной реактивностью с α2-интегрином примата кроме человека, и не обладает перекрестной реактивностью с α2-интегрином вида, отличного от примата.

Вторым объектом настоящего изобретения являются пептид или пептидный комплекс, предпочтительно выделенное моноклональное антитело или его антигенсвязывающий фрагмент, которые специфически связываются с I-доменом α2-интегрина человека, при этом указанное антитело или его фрагмент включает домен вариабельной области тяжелой цепи (VH) и домен вариабельной области легкой цепи (VL) и конкурирует с эталонным антителом за связывание с эпитопом эталонного антитела, включающего легкую цепь, кодированную плазмидой, депонированной в DSMZ под номером доступа DSM 23944, и тяжелую цепь, кодированную (i) плазмидой, депонированной в DSMZ под номером доступа DSM 23946, или (ii) плазмидой, депонированной в DSMZ под номером доступа DSM 23945.

Третьим объектом настоящего изобретения является пептид или пептидный комплекс, включающий один или несколько нижеследующих компонентов а-f:

(а) LCDR1, где LDR1 является последовательностью RASESVESYGNSFIY (SEQ ID NO:6) или ее функционально активным вариантом;

(b) LCDR2, где LDR2 является последовательностью LASNLAS (SEQ ID NO:7) или ее функционально активным вариантом;

(с) LCDR3, где LDR3 является последовательностью QQNNEDPYT (SEQ ID NO:8) или ее функционально активным вариантом;

(d) HCDR1, где HDR1 является последовательностью GYTFTSYWMN (SEQ ID NO:3) или ее функционально активным вариантом;

(е) HCDR2, где HDR2 является последовательностью RIDPSDSETHYNQKFK (SEQ ID NO:4) или ее функционально активным вариантом; и

(f) HCDR3, где HDR3 является последовательностью VGRGYFDY (SEQ ID NO:5) или ее функционально активным вариантом;

при этом один или несколько компонентов а)-f) расположены с возможностью связывания пептида или пептидного комплекса с α2-интегрином.

Четвертым объектом настоящего изобретения является вышеуказанный пептид или пептидный комплекс, предназначенный для лечения, профилактики или диагностики нарушения или заболевания, связанного с α2-интегрином.

Пятым объектом настоящего изобретения является одна или несколько нуклеиновых кислот, кодирующих пептид или пептидный комплекс по настоящему изобретению.

Шестым объектом настоящего изобретения является клетка, гетерологично экспрессирующая одну из нуклеиновых кислот по настоящему изобретению.

Седьмым объектом настоящего изобретения является способ получения пептида или пептидного комплекса по настоящему изобретению, который включает культивирование клетки по настоящему изобретению в условиях, обеспечивающих экспрессию пептида или пептидного комплекса, и необязательно выделение указанного пептида или пептидного комплекса из клетки-хозяина.

Восьмым объектом настоящего изобретения является фармацевтическая композиция, включающая по меньшей мере один пептид или пептидный комплекс по настоящему изобретению и/или по меньшей мере одну нуклеиновую кислоту по настоящему изобретению, которая предназначена для использования в качестве лекарственного средства.

Девятым объектом настоящего изобретения является способ диагностики заболевания, ассоциированного с измененным α2-интегрином, который включает:

а) контактирование образца, включающего α2-интегрин, с пептидом или пептидным комплексом по любому из пунктов 1-3;

b) обнаружение связывания α2-интегрина с пептидом или пептидным комплексом; и

с) сравнение связывания, обнаруженного на стадии b), с эталонным образцом,

при этом связывание измененного α2-интегрина в исследуемом образце по сравнению с эталонным образцом указывает на наличие заболевания.

Десятым объектом настоящего изобретения является изделие, включающее:

а) упаковочный материал,

b) пептид или пептидный комплекс по любому из пунктов 1-3 или его фармацевтически приемлемую соль,

с) этикетку или вкладыш, находящийся внутри упаковочного материала, с информацией о том, что указанный пептид или пептидный комплекс позволяет эффективно лечить заболевание или нарушение, в частности, заболевание или нарушение, связанное с α2-интегрином.

Одиннадцатым объектом настоящего изобретения является диагностический набор, предназначенный для диагностики нарушения или заболевания, связанного с α2-интегрином, который включает пептид или пептидный комплекс по настоящему изобретению, приемлемую упаковку и, возможно, соответствующие инструкции по использованию указанного пептида или пептидного комплекса для обнаружения α2-интегрина.

Двенадцатым объектом настоящего изобретения является способ лечения или диагностики нарушения или заболевания, связанного с α2-интегрином, который включает использование одного или нескольких пептидов или пептидных комплексов по настоящему изобретению и/или одной или нескольких нуклеиновых кислот по настоящему изобретению или одной из фармацевтических композиций по настоящему изобретению.

Тринадцатым объектом настоящего изобретения является способ диагностики заболевания, ассоциированного с измененным α2-интегрином, который включает:

а) контактирование образца, полученного у субъекта, с пептидом или пептидным комплексом по настоящему изобретению;

b) обнаружение связывания α2-интегрина с пептидом или пептидным комплексом; и

с) сравнение связывания, обнаруженного на стадии b), со связыванием α2-интегрина с пептидом или пептидным комплексом в одном или нескольких эталонных образцах;

при этом связывание в полученном образце, отличающееся от связывания, обнаруженного в одном или нескольких эталонных образцах, указывает на наличие заболевания.

Определенные варианты осуществления настоящего изобретения относятся к выделенному моноклональному антителу или его антигенсвязывающему фрагменту, которые специфически связываются с I-доменом α2-интегрина человека, при этом указанное антитело или фрагмент включает домен вариабельной области тяжелой цепи (VH) и домен вариабельной области легкой цепи (VL) и обладает перекрестной реактивностью с α2-интегрином примата кроме человека и не обладает перекрестной реактивностью с α2-интегрином вида, отличного от примата.

Другие варианты осуществления настоящего изобретения относятся к выделенному моноклональному антителу или его антигенсвязывающему фрагменту, которые специфически связываются с I-доменом α2-интегрина человека, при этом указанное антитело или его фрагмент включает домен вариабельной области тяжелой цепи (VH) и домен вариабельной области легкой цепи (VL) и конкурирует с эталонным антителом за связывание с эпитопом эталонного антитела, включающего легкую цепь, кодированную плазмидой, депонированной в DSMZ под номером доступа DSM 23944, и тяжелую цепь, кодированную (i) плазмидой, депонированной в DSMZ под номером доступа DSM 23946, или (ii) плазмидой, депонированной в DSMZ под номером доступа DSM 23945.

В одном варианте осуществления изобретения указанное антитело или его фрагмент специфически связывается с I-доменом α2-интегрина человека со сродством связывания в нМ диапазоне. В другом варианте осуществления изобретения указанное антитело или его фрагмент ингибирует взаимодействие α2-интегрина человека с коллагеном in vitro, подавляя, таким образом, активацию тромбоцитов вследствие адгезии указанных тромбоцитов с указанным коллагеном.

В одном варианте осуществления изобретения указанный домен вариабельной области тяжелой цепи включает HCDR3 тяжелой цепи SEQ ID NO:5. В другом варианте осуществления изобретения указанный домен вариабельной области тяжелой цепи включает CDR-области тяжелой цепи SEQ ID NO:3 (HCDR1), SEQ ID NO:4 (HCDR2) и SEQ ID NO:5 (HCDR3) или их функционально активные варианты. В одном варианте осуществления изобретения функционально активный вариант HCDR2 включает мутацию Asp→Glu в положении аминокислоты 6.

В одном варианте осуществления изобретения домен вариабельной области легкой цепи включает LCDR3 легкой цепи SEQ ID NO:8. В другом варианте осуществления изобретения домен вариабельной области легкой цепи включает CDR-области легкой цепи SEQ ID NO:6 (LCDR1), SEQ ID NO:7 (LCDR2) и SEQ ID NO:8 (LCDR3) или их функционально активные варианты. В одном варианте осуществления изобретения функционально активный вариант LCDR1 включает мутацию Asn→Gln в положении аминокислоты 11.

В одном варианте осуществления изобретения последовательность домена вариабельной области тяжелой цепи (VH) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VH SEQ ID NO:2. В другом варианте осуществления изобретения указанный домен вариабельной области тяжелой цепи (VH) включает последовательность SEQ ID NO:2 или ее функционально активный вариант.

В одном варианте осуществления изобретения последовательность домена вариабельной области легкой цепи (VL) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VL SEQ ID NO:1. В другом варианте осуществления изобретения указанный домен вариабельной области легкой цепи (VL) включает последовательность SEQ ID NO:1 или ее функционально активный вариант.

В одном варианте осуществления изобретения домен вариабельной области тяжелой цепи (VH) включает одну или несколько замен аминокислот в положениях, выбираемых из группы, состоящей из Н5, Н7, Н11, Н12, Н17, Н20, Н38, Н40, Н43, Н55, Н61, Н65, Н66, Н67, Н76, Н81, Н82, Н87, Н91, Н93, Н112, Н113 и Н116. В одном варианте осуществления изобретения одну или несколько замен аминокислот выбирают из группы, состоящей из 5His→Val, 7Pro→Ser, 11Leu→Val, 12Val→Lys, 17Pro→Ser, 20Leu→Val, 38Lys→Arg, 40Arg→Ala, 43Arg→Gln, 55Asp→Glu, 61Asn→Ala, 65Lys→Gln, 66Asp→Gly, 67Lys→Arg, 76Ser→Thr, 81Ile→Met, 82Gln→Glu, 87Thr→Arg, 91Ser→Thr, 93Val→Lys, 112Thr→Leu, 113Leu→Val и 116Ser→Val.

В одном варианте осуществления изобретения домен вариабельной области легкой цепи (VL) включает одну или несколько замен аминокислот в положениях, выбираемых из группы, состоящей из L9, L12, L15, L22, L34, L46, L47, L80, L83, L85, L87 и L89. В одном варианте осуществления изобретения одну или несколько замен аминокислот выбирают из группы, состоящей из 9Ala→Ser, 12Ala→Ser, 15Leu→Val, 15Leu→Pro, 22Ser→Thr, 34Asn→Gln, 46Gln→Lys, 47Ala→Pro, 80Asp→Asn, 83Glu→Gln, 85Asp→Glu, 87Ala→Thr и 89Thr→Asn.

В одном варианте осуществления изобретения последовательность домена вариабельной области тяжелой цепи (VH) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VH, выбираемой из группы, состоящей из SEQ ID NO:38 (НС1), SEQ ID NO:39 (НС2), SEQ ID NO:40 (НС3), SEQ ID NO:41 (НС4), SEQ ID NO:42 (НС5), SEQ ID NO:43 (НС6) и SEQ ID NO:44 (НС7). В другом варианте осуществления изобретения домен вариабельной области тяжелой цепи (VH) включает последовательность HV, выбираемую из группы, состоящей из SEQ ID NO:38 (НС1), SEQ ID NO:39 (НС2), SEQ ID NO:40 (НС3), SEQ ID NO:41 (НС4), SEQ ID NO:42 (НС5), SEQ ID NO:43 (НС6) и SEQ ID NO:44 (НС7).

В одном варианте осуществления изобретения последовательность домена вариабельной области легкой цепи (VL) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VL, выбираемой из группы, состоящей из SEQ ID NO:33 (LC1), SEQ ID NO:34 (LC2), SEQ ID NO:35 (LC3), SEQ ID NO:36 (LC4) и SEQ ID NO:37 (LC5). В другом варианте осуществления изобретения домен вариабельной области легкой цепи (VL) включает последовательность VL, выбираемую из группы, состоящей из SEQ ID NO:33 (LC1), SEQ ID NO:34 (LC2), SEQ ID NO:35 (LC3), SEQ ID NO:36 (LC4) и SEQ ID NO:37 (LC5).

В одном варианте осуществления изобретения антитело или его антигенсвязывающая часть является химерным антителом или гуманизированным антителом. В другом варианте осуществления изобретения антигенсвязывающую часть выбирают из группы, состоящей из Fab, Fab', F(ab')2, Fv, Fv с дисульфидной связью, scFv и (scFv)2. В другом варианте осуществления изобретения антитело или его антигенсвязывающую часть выбирают из группы, состоящей из мультиспецифического антитела, двуспецифического антитела, изотипически сходного антитела, антитела с двумя вариабельными доменами и биспецифического антитела. В другом варианте осуществления изобретения антитело или его антигенсвязывающая часть включает константный домен тяжелой цепи иммуноглобулина, выбираемый из группы, состоящей из константного домена IgM человека, константного домена IgG1 человека, константного домена IgG2 человека, константного домена IgG3 человека, константного домена IgG4 человека, константного домена IgE человека и константного домена IgA человека. В одном варианте осуществления изобретения антитело или его антигенсвязывающая часть включает константный домен IgG4 человека.

Еще одним объектом изобретения является нуклеиновая кислота, кодирующая аминокислотную последовательность антитела или его антигенсвязывающей части по настоящему изобретению. Другим объектом изобретения является рекомбинантный экспрессирующий вектор, включающий указанную нуклеиновую кислоту. Другим объектом изобретения является клетка-хозяин, включающая рекомбинантный экспрессирующий вектор. Другим объектом изобретения является способ получения антитела или его антигенсвязывающего фрагмента, который включает культивирование клетки-хозяина в условиях, обеспечивающих продуцирование антитела клеткой-хозяином.

Еще одним объектом изобретения является фармацевтическая композиция, включающая антитело или его антигенсвязывающую часть и один или несколько фармацевтически приемлемых носителей. Другим объектом изобретения является способ лечения, профилактики или диагностики нарушения или заболевания, связанного с α2-интегрином, который включает введение нуждающемуся субъекту указанной фармацевтической композиции. В одном варианте осуществления изобретения заболевание или нарушение, связанное с α2-интегрином, выбирают из группы, состоящей из тромбоза, сосудистого заболевания, рака, включающего развитие кровеносных сосудов и метастазирование, воспаления, воспалительного заболевания, аутоиммунного заболевания и заболевания, характеризующегося анормальным или повышенным развитием кровеносных сосудов, воспалительного заболевания кишечника, болезни Крона, неспецифического язвенного колита, реакций на трансплантат, ретробульбарного неврита, травмы спинного мозга, ревматоидного артрита, системной красной волчанки (SLE), рассеянного склероза, синдрома Рейнауда, экспериментального аутоиммунного энцефаломиелита, синдрома Шегрена, склеродермии, сердечно-сосудистого заболевания, псориаза и инфекций, вызывающих воспалительную реакцию. В другом варианте осуществления изобретения заболевание или нарушение, связанное с α2-интегрином, выбирают из группы, состоящей из острого коронарного синдрома, окклюзии коронарной артерии, ишемического инсульта, стеноза сонной артерии или окклюзии периферических артерий.

Подробное описание изобретения

Определения терминов

Прежде чем перейти к подробному описанию настоящего изобретения, следует отметить, что данное изобретение не ограничено рассмотренными ниже конкретными методами, процедурами и реагентами, которые могут изменяться. Также следует отметить, что термины, использованные в настоящем описании изобретения, служат только для описания конкретных вариантов осуществления изобретения и не ограничивают объем настоящего изобретения, который ограничен только прилагаемой формулой изобретения. За исключением особо оговоренных случаев все технические и научные термины, использованные в настоящем описании изобретения, имеют значения, известные специалистам в той области, к которой относится данное изобретение.

Термины, использованные в настоящем описании изобретения, предпочтительно имеют значения, приведенные в словаре “A multilingual glossary of biotechnological terms: (IUPAC Recomendations)”, Leuenberger, H.G.W., Nagel, B. and Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland).

В приведенном ниже описании изобретения и формуле изобретения, если из контекста не следует обратное, слово “включать” и его варианты, такие как “включает” и “включающий”, предполагают включение указанного целого числа, стадии, группы целых чисел или стадий, а не исключение любого целого числа, стадии, группы целых чисел или стадий.

В тексте настоящего описания изобретения процитировано несколько документов (например, патентов, заявок на патент, научных публикаций, спецификаций производителей, инструкций, последовательностей под номерами доступа, зарегистрированными в Genbank и т.д.). Следует отметить, что в описании изобретения допустимо упоминание ранее известных изобретений. Некоторые документы, приведенные в настоящем изобретении, “включены в настоящее описание изобретение в качестве ссылки”. В случае возникновения противоречия между определениями или положениями, приведенными в таких ссылках, и определениями или положениями, приведенными в настоящем описании изобретения, приоритет принадлежит тексту настоящего описания изобретения.

Последовательности. Все последовательности, приведенные в настоящем описании изобретения, представлены в прилагаемом списке последовательностей, полное содержание которого является частью настоящего описания изобретения.

Термин “примерно” применительно к числовому значению означает числовые значения в диапазоне, нижний предел которого на 5% меньше указанного числового значения и верхний предел на 5% больше указанного числового значения.

Термин “альфа2-интегрин” или “α2-интегрин” в использованном здесь значении означает альфа2-интегрин, известный в данной области, предпочтительно альфа2-интегрин человека и, в частности, альфа2-интегрин человека, содержащий последовательность нуклеиновой кислоты, показанную в SEQ ID NO:21, и аминокислотную последовательность SEQ ID NO:20 или ее биологически активный фрагмент. Термин “I-домен” означает часть альфа2-интегрина, которая подчеркнута и выделена жирным шрифтом в SEQ ID NO:20.

Термины “специфически связывается”, “специфическое связывание” или тому подобные означают, что пептид или пептидный комплекс, например, антитело или его антигенсвязывающий фрагмент, образует с антигеном комплекс, который является относительно устойчивым в физиологических условиях. Специфическое связывание может быть охарактеризовано константой равновесной диссоциации, равной по меньшей мере примерно 1×10-6 М или меньше (например, меньшее значение KD означает более прочное связывание). В данной области хорошо известны методы определения специфического связывания двух молекул, которые включают, например, равновесный диализ, резонанс поверхностных плазмонов и тому подобные. Выделенное антитело, которое специфически связывается с альфа2-интегрином, однако, может обладать перекрестной реактивностью с другими антигенами, такими как молекулы альфа2-интегрина других видов. Например, в определенных вариантах осуществления изобретения антитела по настоящему изобретению, специфичные к α2-интегрину, связываются с α2-интегрином человека и приматов кроме человека со сродством, которое по меньшей мере в два раза больше сродства связывания с неспецифическим антигеном (например, с α2-интегрином животных, отличных от приматов). Кроме того, мультиспецифические антитела (например, биспецифические антитела), связывающиеся с альфа2-интегрином и одним или несколькими дополнительными антигенами, тем не менее, считаются антителами, которые “специфически связываются” с альфа2-интегрином в значении, использованном в настоящем описании изобретения.

Термин “KD” в использованном здесь значении означает константу равновесной диссоциации при взаимодействии определенного пептида/пептидного комплекса с молекулой-мишенью или антитела с антигеном. Константу равновесной диссоциации обычно измеряют в “моль/л” (сокращенное обозначение “M”).

Термин “медленная скорость диссоциации”, “Koff” или “kd” означает диссоциацию пептида/пептидного комплекса или антитела с альфа2-интегрином с константой скорости, равной 1×10-3 с-1 или меньше, предпочтительно 1×10-4 с-1 или меньше, при определении методом резонанса поверхностных плазмонов, например, BIACORE™.

Термин “высокоаффинное” антитело означает моноклональные антитела, обладающие сродством связывания к альфа2-интегрину человека, равным по меньшей мере 10-10 М, предпочтительно 10-11 М, еще предпочтительнее 10-12 М, при измерении методом резонанса поверхностных плазмонов, например, BIACORE™, методом ELISA определения сродства в растворе.

Термин “резонанс поверхностных плазмонов” в использованном здесь значении означает оптическое явление, позволяющее анализировать специфические биологические взаимодействия в реальном времени путем обнаружения изменений концентрации белка в биосенсорной матрице, например, при использовании системы BIACORE™ (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, N.J.).

“Эпитоп”, также известный как антигенная детерминанта, представляет собой область антигена, узнаваемую иммунной системой, в частности, антителами, В-клетками или Т-клетками. В использованном здесь значении термин “эпитоп” означает часть антигена, способную связываться с антителом или его антигенсвязывающим фрагментом по настоящему изобретению. В данном контексте термин “связывание” предпочтительно означает “специфическое связывание” в значении, использованном в настоящем описании изобретения. Эпитопы обычно состоят из химически активных поверхностных групп молекул, таких как аминокислоты, боковые цепи сахара, фосфорильные группы или сульфонильные группы, и могут иметь определенную трехмерную структуру и/или определенный заряд. Конформационные и неконформационные эпитопы отличаются тем, что конформационные эпитопы утрачивают способность связываться в присутствии денатурирующих растворителей в отличие от неконформационных эпитопов.

“Паратоп” является частью антитела, которая специфически связывается с эпитопом.

Термин “антитело” в использованном здесь значении означает молекулы иммуноглобулина, состоящие из четырех полипептидных цепей, двух тяжелых (Н) цепей и двух легких (L) цепей, связанных дисульфидными связями. В определение термина “антитело” также входят все рекомбинантные формы антител, в частности, антител по настоящему изобретению, например, антитела, экспрессированные в прокариотах, негликозилированные антитела, любые антигенсвязывающие фрагменты антител и их производные, описанные ниже. Каждая тяжелая цепь состоит из вариабельной области тяжелой цепи (”HCVR” или “VH”) и константной области тяжелой цепи (состоящей из доменов СН1, СН2 и СН3). Каждая легкая цепь состоит из вариабельной области легкой цепи (”LCVR” или “VL”) и константной области легкой цепи (CL). VH и VL области могут быть далее подразделены на гипервариабельные участка, именуемые областями, определяющими комплементарность (CDR), которые перемежаются более консервативными областями, именуемыми каркасными областями (FR). Каждая VH и VL область состоит из трех CDR-областей и четырех FR-областей, расположенных в направлении от аминоконца к карбоксиконцу в следующем порядке: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Вариабельные области тяжелых и легких цепей содержат связывающий домен, который взаимодействует с антигеном. Константные области антител могут опосредовать связывание иммуноглобулина с тканями или факторами хозяина, включая разные клетки иммунной системы (например, эффекторные клетки) и первый компонент (C1q) классической системы комплементов.

Термины “антитело против альфа2”, “антитело против а2”, “антитело против α2”, “антитело против альфа2-интегрина”, “антитело против а2-интегрина”, “антитело против α2-интегрина” являются синонимами в настоящем изобретении и предпочтительно означают ингибирующее антитело, то есть антитело против (альфа2, а2, α2, альфа2-интегрина, а2-интегрина, α2-интегрина).

Также возможна замена одного или нескольких остатков CDR или отсутствие одной или нескольких CDR-областей. В научной литературе описаны антитела, в которых одна или две CDR-области могут не участвовать в связывании. В публикации Padlan et al. (1995, FASEB J. 9:133-139) были исследованы области контактирования антител с антигенами на основании опубликованных кристаллических структур, в результате чего были сделаны выводы о том, что только от одной пятой до одной третьей части остатков CDR фактически контактируют с антигеном. В приведенной выше публикации Padlan также были описаны многие антитела, в которых в одной или двух CDR-областях отсутствовали аминокислоты, контактирующие с антигеном (см. также публикацию Vajdos et al., 2002, J. Mol. Biol. 320:415-428).

Остатки CDR, не контактирующие с антигеном, можно идентифицировать на основании предшествующих исследований (например, остатки Н60-Н65 в CDRH2 часто не требутся) в областях CDR Кабата, лежащих за пределами CDR-областей Хотиа, путем моделирования молекул и/или эмпирически. Отсутствующая CDR или остаток обычно заменяется аминокислотой, занимающей соответствующее положение в другой последовательности человеческого антитела или консенсусной части таких последовательностей. Положения замены остатков в CDR-областях и заменяющие аминокислоты также могут быть выбраны эмпирически. Замены, произведенные эмпирически, могут быть консервативными или неконсервативными заменами.

Термин “антигенсвязывающий фрагмент” антитела (или просто “связывающая часть”) в использованном здесь значении означает один или несколько фрагментов антитела, сохраняющих способность специфически связываться с альфа2-интегрином. Установлено, что антигенсвязывающая функция антитела может быть выполнена фрагментами полноразмерного антитела. Примеры антигенсвязывающих фрагментов, входящих в определение термина “антигенсвязывающий фрагмент” антитела, включают (i) Fab-фрагменты, моновалентные фрагменты, состоящие из VL, VH, CL и СН доменов; (ii) F(ab')2-фрагменты, двухвалентные фрагменты, включающие два Fab-фрагмента, связанных дисульфидным мостиком в шарнирной области; (iii) Fd-фрагменты, состоящие из VH и СН доменов; (iv) Fv-фрагменты, состоящие из VL и VH доменов одного плеча антитела; (v) фрагменты dAb (Ward et al., (1989) Nature 341:544-546), состоящие из VH домена; (vi) выделенные области, определяющие комплементарность (CDR); и (vii) комбинации двух или более выделенных CDR-областей, которые могут быть необязательно соединены синтетическим линкером. Кроме того, хотя два домена Fv-фрагмента, VL и VH, кодированы разными генами, они могут быть соединены методами рекомбинантных ДНК при помощи синтетического линкера, позволяющего образовать одну белковую цепь, в которой VL и VH области спариваются с образованием моновалентных молекул (известных как одноцепочечный Fv-фрагмент (scFv); см., например, публикации Bird et al., (1988) Science 242:423-426, и Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Такие одноцепочечные антитела также входят в определение термина “антигенсвязывающий фрагмент” антитела. Другим примером является белок, слитый со связывающим доменом иммуноглобулина, который включает (i) полипептид связывающего домена, слитый с полипептидом шарнирной области иммуноглобулина, (ii) константную область СН2 тяжелой цепи иммуноглобулина, слитую с шарнирной областью, и (iii) константную область СН3 тяжелой цепи иммуноглобулина, слитую с константной областью СН2. Полипептид связывающего домена может представлять собой вариабельную область тяжелой цепи или вариабельную область легкой цепи. Белки, слитые со связывающим доменом иммуноглобулина, рассмотрены в заявках на патент США 2003/0118592 и 2003/0133939. Указанные фрагменты антител получают стандартными методами, известными специалистам в данной области, и исследуют в отношении пригодности аналогично интактным антителам. Другими примерами “антигенсвязывающих фрагментов” являются так называемые микроантитела, выделяемые из отдельных CDR-областей. Например, в публикации Heap et al. описано микроантитело, состоящее из 17 аминокислотных остатков, которое было выделено из CDR3 тяжелой цепи антитела против гликопротеина оболочки gp120 вируса ВИЧ-1 (Heap C.J. et al., (2005) J. Gen. Virol. 86:1791-1800). Другие примеры включают мелкие антитела-миметики, включающие две или более CDR-областей, слитых друг с другом, предпочтительно при помощи родственных каркасных областей. Такое мелкое антитело-миметик, включающее CDR1 VH и CDR3 VL, связанные родственной областью FR2 VH, описаны в публикации Qiu et al. (Qiu X-Q, et al. (2007) Nature biotechnology 25(8):921-929).

Таким образом, термин “антитело или его антигенсвязывающий фрагмент” в использованном здесь значении означает молекулы иммуноглобулина и иммунологически активные части молекул иммуноглобулина, то есть молекулы, содержащие антигенсвязывающий центр, который иммуноспецифически связывается с антигеном.

Антитела и их антигенсвязывающие фрагменты, используемые в настоящем изобретении, могут иметь любое животное происхождение, включая птиц и млекопитающих. Указанные антитела или их фрагменты предпочтительно принадлежат человеку, шимпанзе, грызуну (например, мыши, крысе, морской свинке или кролику), цыпленку, индюшке, поросенку, овце, козе, верблюду, корове, лошади, ослу, кошке или собаке. Особенно предпочтительными антителами являются человеческие или мышиные антитела. Антитела по настоящему изобретению также включают химерные молекулы, в которых константная область антитела, выделенная у одного вида, предпочтительно человека, объединена с антигенсвязывающим центром, выделенным у другого вида, например, мыши. Кроме того, антитела по настоящему изобретению включают гуманизированные молекулы, в которых антигенсвязывающие центры антитела, выделенного у вида, отличного от человека (например, у мыши), объединены с константными и каркасными областями человека.

Как показано в настоящем описании изобретения, антитела по настоящему изобретению могут быть получены непосредственно из гибридом, экспрессирующих данное антитело, или могут быть клонированы и рекомбинантно экспрессированы в клетке-хозяине (например, в клетке СНО или лимфоците). Другими примерами клеток-хозяев являются микроорганизмы, такие как E. coli, и грибы, такие как дрожжи. Альтернативно, антитела могут быть продуцированы методами рекомбинантных ДНК в трансгенном животном, отличном от человека, или в растении.

Термин “химерное антитело” означает антитела, в которых одна часть каждой аминокислотной последовательности тяжелых и легких цепей гомологична соответствующим последовательностям в антителах, выделенных из конкретного вида или относящихся к определенному классу, в то время как остальной сегмент цепи гомологичен соответствующим последовательностям другого вида или класса. Вариабельная область легких и тяжелых цепей обычно имитирует вариабельные области антител, выделенных из одного вида млекопитающих, в то время как константные части гомологичны последовательностям антител, выделенных из другого вида. Одним преимуществом таких химерных форм является то, что вариабельная область может быть выделена из известных источников при использовании легко доступных В-клеток или гибридом из организмов-хозяев, отличных от человека, и использована в комбинации с константными областями, выделенными, например, из препаратов человеческих клеток. Если преимуществом вариабельной области является простота получения, на специфичность которой не влияет источник происхождения, то константная область, принадлежащая человеку, по-видимому, в меньшей степени вызывает иммунную реакцию у человека при введении ему антител по сравнению с константной областью, полученной из источника, отличного от человека. Однако определение данного термина не ограничивается приведенным примером.

Термин “гуманизированное антитело” означает молекулу, содержащую антигенсвязывающий сайт, выделенный из иммуноглобулина вида, отличного от человека, при этом остальная структура иммуноглобулина молекулы создана на основе структуры и/или последовательности иммуноглобулина человека. Антигенсвязывающий сайт может включать полные вариабельные домены, слитые с константными доменами, или только области, определяющие комплементарность (CDR), слитые с соответствующими каркасными областями в вариабельных доменах. Антигенсвязывающие центры могут относиться к дикому типу или могут быть модифицированы путем одной или нескольких замен аминокислот, например, для более близкого соответствия иммуноглобулинам человека. Некоторые формы гуманизированных антител сохраняют все последовательности CDR (например, гуманизированное мышиное антитело, которое содержит все шесть CDR-областей из мышиного антитела). Другие формы содержат одну или несколько CDR-областей, измененных по сравнению с исходным антителом.

Квалифицированному специалисту должны быть известны разные методы гуманизации антител, рассмотренные в публикации Almagro and Fransson, которая полностью включена в настоящее описание изобретения в качестве ссылки (Almagro JC and Fransson J. (2008) Frontiers in Bioscience 13:1619-1633). В публикации Almagro and Fransson представлены различия между рациональными методами и эмпирическими методами. Рациональные методы характеризуются получением небольшого числа вариантов созданного антитела, которые оценивают в отношении связывающей способности или любого другого представляющего интерес свойства. Если созданные варианты не позволяют получить ожидаемых результатов, выполняется новый цикл создания антитела и оценки его связывания. Рациональные методы включают трансплантацию CDR, восстановление поверхности, супергуманизацию и оптимизацию генной нити человека. В отличие от этого эмпирические методы основаны на создании больших библиотек гуманизированных вариантов и отборе лучших клонов при помощи методов обогащения или высокопроизводительного скрининга. Таким образом, эмпирические методы зависят от надежной системы отбора и/или скрининга, позволяющей вести поиск в огромной массе вариантов антител. Вышеуказанным требованиям удовлетворяют методы отображения in vitro, такие как отображение на фаге и отображение на рибосоме, хорошо известные квалифицированным специалистам. Эмпирические методы включают библиотеки каркасных областей, направленный отбор, перестановку каркасных областей и гуманизацию.

Термин “человеческое антитело” в использованном здесь значении означает антитела, содержащие вариабельные и константные области, выделенные из последовательностей иммуноглобулина зародышевой линии клеток человека. Человеческие моноклональные антитела по настоящему изобретению могут включать аминокислотные остатки, не кодированные последовательностями иммуноглобулина зародышевой линии клеток человека (например, мутации, введенные путем неспецифического или сайт-специфического мутагенеза in vitro или путем соматической мутации in vivo), например, в CDR-областях и, в частности, в CDR3. Однако в определение термина “человеческое антитело” в использованном здесь значении не входят моноклональные антитела, в которых последовательности CDR, выделенные из зародышевой линии клеток другого вида млекопитающих (например, мыши), были трансплантированы в последовательности каркасных областей человека. Человеческие антитела по настоящему изобретению включают антитела, выделенные из библиотек иммуноглобулина человека или у трансгенных животных, которые содержат один или несколько иммуноглобулинов человека и не экспрессируют эндогенные иммуноглобулины, как описано, например, в патенте США № 5939598, выданном Kucherlapati и Jakobovits.

Термин “моноклональное антитело” в использованном здесь значении означает молекулы антитела, имеющие одинаковый молекулярный состав. Моноклональное антитело обладает одной специфичностью связывания и сродством к определенному эпитопу. В одном варианте осуществления изобретения моноклональные антитела продуцированы гибридомой, включающей В-клетку, полученную у животного, отличного от человека, например, мыши, которая гибридизирована с иммортализованной клеткой.

Термин “рекомбинантное антитело” в использованном здесь значении означает все антитела, полученные, экспрессированные, созданные или выделенные методами рекомбинантных ДНК, такие как (а) антитела, выделенные у животного (например, мыши), которое является трансгенным или трансхромосомным в отношении генов иммуноглобулина или полученной из них гибридомы, (b) антитела, выделенные из клетки-хозяина, трансформированной с возможностью экспрессии антитела, например, из трансфектомы, (с) антитела, выделенные из комбинаторной библиотеки рекомбинантных антител, и (d) антитела, полученные, экспрессированные, созданные или выделенные любым другим способом, включающим сплайсинг последовательностей генов иммуноглобулина и введение в другие последовательности ДНК.

Термин “трансфектома” в использованном здесь значении означает рекомбинантные эукариотические клетки-хозяева, экспрессирующие антитело, такие как клетки СНО, клетки NS/0, клетки НЕК293, клетки НЕК293Т, растительные клетки или грибы, в том числе дрожжевые клетки.

В использованном здесь значении термин “гетерологичное антитело” использован применительно к трансгенному организму, продуцирующему такое антитело. Указанный термин означает антитело, содержащее аминокислотную последовательность или кодирующую последовательность нуклеиновой кислоты, соответствующую последовательности, обнаруженной в организме, не являющемся трансгенным организмом, и обычно выделяемое из вида, отличного от трансгенного организма.

В использованном здесь значении термин “гетерогибридное антитело” означает антитело, содержащее легкие и тяжелые цепи из разных организмов. Например, антитело, содержащее тяжелую цепь человека, ассоциированную с легкой цепью мыши, является гетерогибридным антителом.

Таким образом, “антитела и их антигенсвязывающие фрагменты”, пригодные для использования в настоящем изобретении, включают, не ограничиваясь ими, поликлональные, моноклональные, моновалентные, биспецифические, гетероконъюгатные, мультиспецифические, рекомбинантные, гетерологичные, гетерогибридные, химерные, гуманизированные (в частности, CDR-трансплантированные), деиммунизированные или человеческие антитела, Fab-фрагменты, Fab'-фрагменты, F(ab')2-фрагменты, фрагменты, продуцированные в Fab-экспрессирующей библиотеке, Fd, Fv, Fv-фрагменты, связанные дисульфидной связью (dsFv), одноцепочечные антитела (например, scFv), диатела или тетратела (Holliger P. et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90(14), 6444-6448), нанотела (также известные как однодоменные антитела), антиидиотипические (анти-Id) антитела (включающие, например, анти-Id антитела к антителам по настоящему изобретению) и эпитопсвязывающие фрагменты любого из вышеуказанных антител.

Антитела по настоящему изобретению предпочтительно являются выделенными антителами. Термин “выделенное антитело” в использованном здесь значении означает антитело, по существу свободное от других моноклональных антител, обладающих другими антигенными специфичностями (например, выделенное антитело, которое специфически связывается с альфа2-интегрином, по существу свободно от моноклональных антител, специфически связывающихся с антигенами, отличными от альфа-интегрина). Выделенное антитело, которое специфически связывается с альфа2-интегрином, однако, может обладать перекрестной реактивностью с другими антигенами, такими как молекулы альфа2-интегрина другого вида.

Термины “биологическая функция или функция альфа2-интегрина” в использованном здесь значении являются синонимами и означают любые функции альфа2-интегрина, которые включают, не ограничиваясь ими, связывание и образование комплекса с бета1-интегрином, связывание с любыми известными лигандами, например, связывание с коллагеном, ламинином, агрегацию тромбоцитов, вызванную коллагеном, индукцию тромботических реакций, тромбоцитопению, миграцию клеток в коллагене, клеточнозависимую реорганизацию коллагеновых волокон, коллагензависимые реакции клетки, вызывающие повышение экспрессии и пролиферации цитокина, зависящие от альфа2-интегрина или коллагена функции Т-клеток, мастоцитов или нейтрофилов, зависящую от альфа2-интегрина или коллагена аллергическую реакцию замедленного типа, зависящую от альфа2-интегрина или коллагена контактную аллергию, вызываемый коллагеном артрит, морфогенез протоков молочной железы, заживление ран эпидермиса и процессы, ассоциированные с VEGF-индуцированным развитием кровеносных сосудов.

В использованном здесь значении термин “антагонист альфа2-интегрина” означает соединение, которое ингибирует по меньшей мере одну биологическую активность альфа2-интегрина, предпочтительно активность альфа2-интегрина, присутствующего на тромбоцитах, эндотелиальных клетках сосудов, эпителиальных клетках, активированных моноцитах/макрофагах, фибробластах, лейкоцитах, лимфоцитах, активированных нейтрофилах и/или мастоцитах, особенно при использовании в стехиометрических количествах. Предпочтительными антагонистами альфа2-интегрина по настоящему изобретению являются нейтрализующие антитела.

Термин “нейтрализующее антитело” в использованном здесь значении (или “антитело, нейтрализующее активность альфа2-интегрина”) означает антитело, связывание которого с альфа2-интегрином вызывает ингибирование по меньшей мере одной биологической активности альфа2-интегрина, предпочтительно ингибирование активации тромбоцитов альфа2-интегрином. Ингибирование указанной биологической активности альфа2-интегрина можно оценить, производя измерение одного или нескольких индикаторов биологической активности альфа2-интегрина при помощи одного или нескольких стандартных анализов in vitro или in vivo, известных в данной области. Примеры таких анализов представлены, например, в разделе “Примеры” настоящего описания изобретения.

Благодаря наличию вышеуказанных функций альфа2-интегрин влияет на некоторые заболевания, ассоциированные с повышенной активностью тромбоцитов. Поэтому антагонисты альфа2-интегрина, в частности, ингибирующие пептиды или пептидные комплексы, направленно воздействующие на альфа2-интегрин, нейтрализующие антитела против альфа2-интегрина или их антигенсвязывающие фрагменты, позволяют уменьшить или подавить воздействие альфа2-интегрина на активность тромбоцитов. Следовательно, антагонисты альфа2-интегрина могут быть использованы для ослабления симптомов, ингибирования или предотвращения возникновения нескольких заболеваний, которые включают, не ограничиваясь ими, тромбоз, сосудистое заболевание, рак, включая развитие кровеносных сосудов и метастазирование, воспаление, воспалительное заболевание, аутоиммунное заболевание и заболевание, характеризующееся анормальным или повышенным развитием кровеносных сосудов, воспалительное заболевание кишечника, болезнь Крона, неспецифический язвенный колит, реакции на трансплантат, ретробульбарный неврит, травму спинного мозга, ревматоидный артрит, системную красную волчанку (SLE), рассеянный склероз, синдром Рейнауда, экспериментальный аутоиммунный энцефаломиелит, синдром Шегрена, склеродермию, сердечно-сосудистое заболевание, псориаз и инфекции, вызывающие воспалительную реакцию.

В конкретных вариантах осуществления изобретения антитела против альфа2-интегрина или их антигенсвязывающие фрагменты по настоящему изобретению могут быть конъюгированы с терапевтической частью (“иммуноконъюгат”), такой как цитотоксин, химиотерапевтическое средство, иммунодепрессант или радиоактивный изотоп.

Термин “консервативная замена аминокислоты” означает такую замену, при выполнении которой аминокислотный остаток заменяется другим аминокислотным остатком, боковая цепь которого (R группа) обладает подобными химическими свойствами (например, зарядом или гидрофобностью). Как правило, консервативная замена аминокислоты по существу не изменяет функциональные свойства белка. В тех случаях, когда две или более аминокислотные последовательности отличаются друг от друга консервативными заменами, процентное значение или степень подобия могут быть скорректированы для улучшения консервативной природы замены. Способы такой коррекции хорошо известны специалистам в данной области. См., например, публикацию Pearson (1994) Methods Mol. Biol. 24:307-331. Примеры групп аминокислот, имеющих боковые цепи с подобными химическими свойствами, включают:

1) алифатические боковые цепи: глицин, аланин, валин, лейцин и изолейцин;

2) алифатические гидроксильные боковые цепи: серин и треонин;

3) амидсодержащие боковые цепи: аспарагин и глутамин;

4) ароматические боковые цепи: фенилаланин, тирозин и триптофан;

5) основные боковые цепи: лизин, аргинин и гистидин;

6) кислотные боковые цепи: аспартат и глутамат;

7) серосодержащие боковые цепи: цистеин и метионин.

Предпочтительными группами для консервативных замен аминокислот являются: валин-лейцин-изолейцин, фенилаланин-тирозин, лизин-аргинин, аланин-валин, глутамат-аспартат и аспарагин-глутамин. Альтернативно консервативная замена является любой заменой, имеющей положительное значение в матрице log-подобия PAM250, описанной в публикации Gonnet et al. (1992) Science 256:1443-45. “Умеренно консервативная” замена является любой заменой, не имеющей отрицательного значения в матрице log-подобия РАМ250. При наличии известного генетического кода, с помощью методов рекомбинантных и синтетических ДНК, квалифицированный специалист может легко создать ДНК, кодирующие консервативные варианты аминокислот.

В использованном здесь значении термины “неконсервативные замены” или “неконсервативные замены аминокислот” означают замену аминокислоты другой аминокислотой, относящейся к другой группе из вышеуказанных семи стандартных групп аминокислот 1)-7).

Термин “значительная идентичность” или “по существу идентичный” применительно к нуклеиновой кислоте или ее фрагменту означает, что при выполнении сравнительного анализа вставок или делеций соответствующих нуклеотидов одной нуклеиновой кислоты с другой нуклеиновой кислотой (или ее комплементарной цепью) оптимальная идентичность нуклеотидной последовательности равна по меньшей мере примерно 90% и более предпочтительно по меньшей мере примерно 95%, 96%, 97%, 98% или 99% нуклеотидных оснований при выполнении измерения с использованием любого хорошо известного алгоритма идентичности последовательности, такого как FASTA, BLAST или GAP, рассмотренного ниже.

Применительно к полипептидам термин “значительное подобие” или “по существу подобный” означает, что при выполнении сравнительного анализа с помощью программы GAP или BESTFIT при использовании величин разрывов по умолчанию две пептидные последовательности идентичны друг другу по меньшей мере на 90%, более предпочтительно по меньшей мере на 95%, 98% или 99%. Положения остатков, не являющихся идентичными, предпочтительно отличаются консервативными заменами аминокислот.

Подобие последовательностей полипептидов обычно измеряют при помощи программного обеспечения для анализа последовательностей. Программное обеспечение для анализа белков совмещает подобные последовательности, используя единицы измерения подобия, присваемые разным заменам, делециям и другим модификациям, включая консервативные замены аминокислот. Например, программное обеспечение GCG содержит такие программы, как GAP и BESTFIT, которые могут быть использованы с параметрами по умолчанию для определения гомологии или идентичности последовательностей родственных полипептидов, таких как гомологичные полипептиды из разных видов организмов или из белка дикого типа и его мутанта. См., например, GCG, версия 6.1. Полипептидные последовательности также могут быть подвергнуты сравнению при помощи программы FASTA с использованием параметров по умолчанию или рекомендованных параметров; программа в GCG, версия 6.1. Программа FASTA (например, FASTA2 и FASTA3) выполняет сравнительный анализ и определяет процентное значение идентичности последовательностей в областях, которые лучше всего перекрываются в запрашиваемых и искомых последовательностях (Pearson (2000), см. выше). Еще одним предпочтительным алгоритмом сравнения последовательности по настоящему изобретению с базой данных, содержащей большое число последовательностей из разных организмов, является компьютерная программа BLAST, в частности, BLASTP или TBLASTN, с использованием параметров по умолчанию. См., например, публикации Altschul et al. (1990) J. Mol. Biol. 215:403-410 и (1997) Nucleic Acids Res. 25:3389-402, которые включены в настоящее описание изобретения в качестве ссылки.

Процентные значения идентичности последовательностей, приведенные в настоящем описании изобретения, вычислены в отношении всей длины более длинной последовательности, за исключением особо оговоренных случаев. Принцип вычисления в отношении всей длины более длинной последовательности относится как к последовательностям нуклеиновых кислот, так и к полипептидным последовательностям.

В использованном здесь значении термин “лечить” или “лечение” заболевания или нарушения означает достижение одного или нескольких следующих результатов: (а) уменьшение тяжести и/или продолжительности нарушения; (b) ограничение или предотвращение развития симптомов, характерных для подвергаемого лечению нарушения; (с) ингибирование ухудшения симптомов, характерных для подвергаемого лечению нарушения; (d) ограничение или предотвращение рецидива нарушения у субъектов, ранее страдавших указанным нарушением; и (е) ограничение или предотвращение рецидива симптомов у субъектов, у которые ранее были обнаружены симптомы указанного нарушения.

В использованном здесь значении термин “предотвращать”, “предотвращение” или “профилактика” заболевания или нарушения означает предотвращение возникновения нарушения у субъекта.

В использованном здесь значении выражения “пригодно для введения” и “может быть введено” имеют такое же значение, что и выражение “готово для введения”. Другими словами, заявление о том, что активное соединение “пригодно для введения” следует понимать так, что указанное активное соединение было приготовлено и разделено на дозы, благодаря чему указанное активное соединение находится в терапевтически активном состоянии.

Термины “терапевтически эффективное количество” или “терапевтическое количество” означают такое количество лекарственного средства или фармацевтического агента, которое оказывает биологическое или медицинское воздействие на ткань, систему, животное или человека, предполагаемое научным работником, ветеринаром, лечащим врачом или другим клиницистом. Термин “профилактически эффективное количество” означает такое количество фармацевтического средства, которое предотвращает или уменьшает риск возникновения биологического или медицинского явления в ткани, системе, животном или человеке, против которого направлены усилия научного работника, ветеринара, лечащего врача или другого клинициста. В частности, доза, назначаемая субъекту, может быть выбрана с учетом достижения такого количества пептида или пептидного комплекса, которое обеспечивает ингибирование функции альфа2-интегрина, достаточное для профилактической или лечебной терапии (предотвращения, улучшения или излечивания) заболевания или нарушения, ассоциированного с α2-интегрином, предпочтительно выбираемого из группы, состоящей из тромбоза, сосудистого заболевания, рака, включающего развитие кровеносных сосудов и метастазирование, воспаления, воспалительного заболевания, аутоиммунного заболевания и заболевания, характеризующегося анормальным или повышенным развитием кровеносных сосудов, воспалительного заболевания кишечника, болезни Крона, неспецифического язвенного колита, реакций на трансплантат, ретробульбарного неврита, травмы спинного мозга, ревматоидного артрита, системной красной волчанки (SLE), рассеянного склероза, синдрома Рейнауда, экспериментального аутоиммунного энцефаломиелита, синдрома Шегрена, склеродермии, сердечно-сосудистого заболевания, псориаза и инфекций, вызывающих воспалительную реакцию.

В использованном здесь значении термин “субъект” означает любое млекопитающее или птицу, при лечении которых антителами или их антигенсвязывающими фрагментами по настоящему изобретению может быть достигнут благоприятный результат. “Субъект” может быть предпочтительно выбран из группы, состоящей из лабораторных животных (например, мыши или крысы), домашних животных (таких как, например, морская свинка, кролик, цыпленок, индюшка, поросенок, овца, коза, верблюд, корова, лошадь, осел, кошка или собака) или приматов, включающих шимпанзе и людей. В особенно предпочтительном случае “субъект” является человеком.

Термин “фармацевтически приемлемый” означает препарат, одобренный регулятивным агентством федерального правительства или правительства штата, или указанный в Фармакопее США (United States Pharmacopeia-33/National Formulary-28 Reissue, published by the United States Pharmacopeial Convention, Inc., Rockville Md, дата публикации: апрель 2010 г.) или в другой общепризнанной фармакопее для применения при лечении животных и, в частности, людей.

Конкретные группы субъектов, подлежащих лечению терапевтическими методами по настоящему изобретению, включают субъектов, имеющих мутации, активирующие альфа2-интегрин (мутации, вызывающие усиление функции, “GOF”), субъектов, страдающих заболеванием или нарушением, ассоциированным с α2-интегрином, предпочтительно выбираемым из группы, состоящей из тромбоза, сосудистого заболевания, рака, включающего развитие кровеносных сосудов и метастазирование, воспаления, воспалительного заболевания, аутоиммунного заболевания и заболевания, характеризующегося анормальным или повышенным развитием кровеносных сосудов, воспалительного заболевания кишечника, болезни Крона, неспецифического язвенного колита, реакций на трансплантат, ретробульбарного неврита, травмы спинного мозга, ревматоидного артрита, системной красной волчанки (SLE), рассеянного склероза, синдрома Рейнауда, экспериментального аутоиммунного энцефаломиелита, синдрома Шегрена, склеродермии, сердечно-сосудистого заболевания, псориаза и инфекций, вызывающих воспалительную реакцию.

Варианты осуществления изобретения

Ниже приведено более подробное описание настоящего изобретения. В нижеследующих абзацах более подробно описаны разные объекты настоящего изобретения. Каждый объект изобретения может быть объединен с любым другим объектом или объектами за исключением особо оговоренных случаев. В частности, любой предпочтительный или благоприятный признак может быть объединен с любым другим признаком или признаками, также являющимися предпочтительными или благоприятными, за исключением особо оговоренных случаев.

Таким образом, первым объектом настоящего изобретения является пептид или пептидный комплекс, предпочтительно выделенное моноклональное антитело или его антигенсвязывающий фрагмент, которые специфически связываются с I-доменом α2-интегрина человека, при этом указанное антитело или его фрагмент включает домен вариабельной области тяжелой цепи (VH) и домен вариабельной области легкой цепи (VL) и обладает перекрестной реактивностью с α2-интегрином примата кроме человека и не обладает перекрестной реактивностью с α2-интегрином вида, отличного от примата.

Вторым объектом настоящего изобретения является пептид или пептидный комплекс, предпочтительно выделенное моноклональное антитело или его антигенсвязывающий фрагмент, которые специфически связываются с I-доменом α2-интегрина человека, при этом указанное антитело или его фрагмент включает домен вариабельной области тяжелой цепи (VH) и домен вариабельной области легкой цепи (VL) и конкурирует с эталонным антителом за связывание с эпитопом эталонного антитела, которое включает легкую цепь, кодированную плазмидой, депонированной в DSMZ под номером доступа DSM 23944, и тяжелую цепь, кодированную (i) плазмидой, депонированной в DSMZ под номером доступа DSM 23946, или (ii) плазмидой, депонированной в DSMZ под номером доступа DSM 23945.

Третьим объектом настоящего изобретения является пептид или пептидный комплекс, включающий один или несколько нижеследующих компонентов а-f:

a) LCDR1, где LCDR1 является последовательностью RASESVESYGNSFIY (SEQ ID NO:6) или ее функционально активным вариантом;

b) LCDR2, где LCDR2 является последовательностью LASNLAS (SEQ ID NO:7) или ее функционально активным вариантом;

c) LCDR3, где LCDR3 является последовательностью QQNNEDPYT (SEQ ID NO:8) или ее функционально активным вариантом;

d) HCDR1, где HCDR1 является последовательностью GYTFTSYWMN (SEQ ID NO:3) или ее функционально активным вариантом;

e) HCDR2, где HCDR2 является последовательностью RIDPSDSETHYNQKFK (SEQ ID NO:4) или ее функционально активным вариантом; и

f) HCDR3, где HCDR3 является последовательностью VGRGYFDY (SEQ ID NO:5) или ее функционально активным вариантом;

при этом один или несколько компонентов а)-f) расположены с возможностью связывания пептида или пептидного комплекса с α2-интегрином или гетеродимерным α2β1-интегрином.

Четвертым объектом настоящего изобретения является вышеуказанный пептид или пептидный комплекс, предназначенный для лечения, профилактики или диагностики нарушения или заболевания, связанного с α2-интегрином.

Последовательности SEQ ID NO:6-8 представляют собой CDR-области легких цепей? и последовательности SEQ ID NO:3-5 представляют собой CDR-области тяжелых цепей анализируемого антитела (определенные в результате анализа последовательностей). В соответствии с настоящим изобретением пептид или пептидный комплекс включает одну из вышеуказанных CDR-областей легкой цепи или ее функционально активный вариант и/или одну из CDR-областей тяжелой цепи или ее функционально активный вариант. В качестве примеров можно привести пептид или пептидный комплекс, включающий одну, две или три вышеуказанные HCDR и/или одну, две или три вышеуказанные LCDR в любых приемлемых комбинациях. Один вариант осуществления настоящего изобретения относится к пептиду или пептидному комплексу, включающему 3 LCDR и 3 HCDR, при этом по меньшей мере одна из указанных областей является одной из вышеуказанных CDR-областей а-f.

В контексте настоящего изобретения термины LCDR и LDR являются синонимами. Такое же толкование относится к терминам HCDR и HDR.

Правильное расположение вышеуказанных CDR-областей делает возможным специфическое связывание с α2-интегрином. В данной области известно приемлемое расположение CDR-областей, обеспечивающее связывание с антигеном. В настоящее время созданы или идентифицированы разные формы антител или параметров связывания. В полипептиде или полипептидном комплексе по настоящему изобретению может быть использовано любое из вышеуказанных расположений или любое другое приемлемое расположение, если данная форма или расположение обеспечивает специфическое связывание с α2-интегрином.

Последовательности CDR, представленные приведенными выше SEQ ID NO или их вариантами, могут быть расположены в одной (поли)пептидной цепи или в полипептиде или пептидном комплексе. При расположении в одной (поли)пептидной цепи указанные последовательности могут быть соединены одной или несколькими линкерными последовательностями, предпочтительно пептидным линкером, например, в виде слитого белка. В соответствии с одним вариантом осуществления изобретения указанные последовательности могут быть введены в каркас или остов природного или искусственного антитела методами, известными в данной области. В природных антителах CDR-области удерживаются в вариабельных доменах консервативными каркасными областями. Каркас может быть модифицирован с целью получения искусственных антител, таких как Fab-фрагменты, одноцепочечные антитела и т.д., которые более подробно описаны ниже.

Если CDR-области расположены в пептидном комплексе, два или более (поли)пептида связываются друг с другом нековалентной связью, включающей водородные связи, ионные связи, ван-дер-ваальсовы силы и гидрофобные взаимодействия.

Пептид является органическим соединением, образованным двумя или более α-аминокислотами, расположенными в линейной цепи. Аминокислоты соединены вместе пептидными связями между карбоксильными и аминогруппами смежных аминокислотных остатков. Генетический код обычно определяет 20 стандартных аминокислот. После или даже во время синтеза остатки в белке могут быть химически модифицированы в результате посттрансляционных модификаций, изменяющих физические и химические свойства, укладку цепи, устойчивость, активность и, наконец, функцию белков. Пептиды в соответствии с разными объектами настоящего изобретения могут быть модифицированы или не модифицированы при наличии способности связываться с α2-интегрином.

В данной области термин “полипептид” означает молекулу, содержащую примерно 20, примерно 25, примерно 30 или более аминокислот, линейно связанных друг с другом пептидными связями с образованием полипептидной цепи. Более короткие молекулы такого типа, содержащие по меньшей мере 2 аминокислоты, обычно определяются как пептиды. Термин “белок” обычно означает молекулы, содержащие одну или несколько полипептидных цепей. В контексте настоящего изобретения термины “пептид”, “полипептид” и “белок” являются синонимами.

В контексте настоящего изобретения термин “пептид” или “полипептид” в соответствии с разными объектами настоящего изобретения означает вышеуказанные пептиды или полипептиды, и термин “пептидный комплекс” означает комплексы молекул, содержащие один или несколько вышеуказанных пептидов и/или полипептидов (например, антитела, антигенсвязывающие фрагменты и другие связывающие молекулы по настоящему изобретению).

Пептид и его пептидные комплексы по настоящему изобретению избирательно узнают и специфически связываются с антигеном α2-интегрина. В контексте настоящего изобретения термин “специфическое связывание с α2-интегрином” означает способность пептида или пептидного комплекса по настоящему изобретению специфически связываться с α2-интегрином, I-доменом α2-интегрина или α2-интегрином в комплексе с любым другим полипептидом, например, в гетеродимерном комплексе с другой субъединицей интегрина, таком как комплекс α2β1-интегрина. В предпочтительном варианте осуществления изобретения пептид или пептидные комплексы по настоящему изобретению включают, состоят из или представляют собой выделенное моноклональное антитело или его антигенсвязывающий фрагмент.

Термины “избирательный” или “специфический”, используемые для описания характеристик связывания пептида или пептидного комплекса по настоящему изобретению, означают, что рассматриваемые пептиды или пептидные комплексы не связываются в значительной степени с белками, отличными от α2-интегрина, за исключением конкретных случаев, когда части пептида/комплекса, специфически связывающейся с α2-интегрином, сообщается дополнительная, отличающаяся специфичность (как, например, в биспецифических или бифункциональных молекулах, выполняющих две функции, из которых по меньшей мере одна функция является специфическим связыванием с α2-интегрином). В конкретных вариантах осуществления изобретения пептиды или их комплексы, специфичные к α2-интегрину, связываются с α2-интегрином человека со значением KD, равным по меньшей мере 1,2×10-6. В конкретных вариантах осуществления изобретения пептиды или их комплексы, специфичные к α2-интегрину, связываются α2-интегрином человека со значением KD, равным 5×10-7 или больше, 2×10-7 или больше или 1×10-7 или больше. В дополнительных вариантах осуществления изобретения пептиды или их комплексы, специфичные к α2-интегрину, связываются с α2-интегрином человека со значением KD, равным 1×10-8 или больше. В других вариантах осуществления изобретения пептиды или их комплексы, специфичные к α2-интегрину, связываются с α2-интегрином человека со значением KD, равным 5×10-9 или больше или 1×10-9 или больше. В других вариантах осуществления изобретения пептиды или их комплексы, специфичные к α2-интегрину, связываются с α2-интегрином человека со значением KD, равным 2×10-10 или больше. В конкретных вариантах осуществления изобретения пептиды или их комплексы, специфичные к α2-интегрину, не связываются с другими белками с вышеуказанными значениями KD. В других вариантах осуществления изобретения пептиды или их комплексы, специфичные к α2-интегрину, связываются с α2-интегрином (например, с α2-интегрином человека и/или приматов кроме человека) со сродством, которое по меньшей мере в два раза больше сродства в отношении неспецифического антигена.

KD означает константу диссоциации, полученную из отношения kd (скорость диссоциации при взаимодействии определенной связывающей молекулы с белком-мишенью, которая также определяется как koff) к ka (скорость ассоциации при взаимодействии определенной связывающей молекулы с белком-мишенью, которая также определяется как kon) или из отношения kd/ka, значение которого выражено в виде молярной концентрации (М). Значения KD могут быть определены методами, хорошо известными в данной области. Предпочтительный метод определения KD связывающей молекулы описан в примере 1D.

Установлено, что пептиды или их комплексы, специфичные к α2-интегрину, ингибируют взаимодействие α2-интегрина/лиганда в зависимости от дозы (см. фиг. 2 и примеры). Таким образом, пептиды или их комплексы, специфичные к α2-интегрину, могут быть охарактеризованы с учетом их способности противодействовать связыванию коллагена с α2-интегрином. Степень ингибирования любого пептида или его комплекса, специфичного к α2-интегрину, может быть измерена в количественном отношении при выполнении статистического сравнения с контрольным образцом или любым альтернативным методом, известным в данной области. В конкретных вариантах осуществления изобретения указанное ингибирование составляет примерно 10% или больше от ингибирования контрольного образца. В других вариантах осуществления изобретения указанное ингибирование равно 20% или больше, 30% или больше, 40% или больше, 50% или больше, 60% или больше, 70% или больше, 80% или больше, 90% или больше или 95% или больше.

Пептид или пептидный комплекс может также включать функционально активный вариант вышеуказанных последовательностей. Функционально активный вариант пептидов или пептидных комплексов по настоящему изобретению характеризуется наличием биологической активности, подобной биологической активности полного пептида, включая способность связываться с α2-интегрином и необязательно ингибировать α2-интегрин. Вариант является функционально активным в контексте настоящего изобретения, если активность (например, активность связывания, необязательно выраженная в виде KD) указанного варианта составляет 10% или больше, 25% или больше, 50% или больше, 70% или больше, 80% или больше, 90% или больше, 95% или больше или 99% или больше от активности пептида/комплекса без изменения последовательности. Приемлемые методы определения активности связывания с α2-интегрином представлены в примерах. Функционально активный вариант может быть получен в результате выполнения ограниченного числа замен, делеций и/или инсерций аминокислот.

В предпочтительных вариантах осуществления настоящего изобретения пептид или пептидный комплекс по настоящему изобретению далее характеризуется наличием одного или нескольких следующих признаков:

(i) вариабельный домен легкой цепи (VL) включает один, два или три компонента а)-с);

(ii) вариабельный домен тяжелой цепи включает один, два или три компонента d)-f);

(iii) пептид или пептидный комплекс является антителом;

(iv) пептид или пептидный комплекс представляет собой Fab, Fab', F(ab')2, Fv, Fv с дисульфидной связью, scFv, (scFv)2, биспецифическое антитело, мультиспецифическое антитело, диатело, триатело, тетратело или минитело, моноклональное антитело, химерное антитело или гуманизированное антитело;

(v) пептид или пептидный комплекс включает константный домен тяжелой цепи иммуноглобулина, выбираемый из группы, состоящей из константного домена IgM человека, константного домена IgG1 человека, константного домена IgG2 человека, константного домена IgG3 человека, константного домена IgG4 человека, константного домена IgE человека и константного домена IgA человека;

(vi) функционально активный вариант является функционально активным фрагментом, состоящим из 60% или больше, 70% или больше, 80% или больше, 90% или больше, 95% или больше или 99% или больше аминокислотной последовательности любой из SEQ ID NO:3-8;

(vii) функционально активный вариант является функционально активным вариантом, последовательность которого на 60% или больше, 70% или больше, 80% или больше, 90% или больше, 95% или больше или 99% или больше идентична аминокислотной последовательности любой из SEQ ID NO:3-8, особенно в тех случаях, когда функционально активный вариант получен из аминокислотной последовательности любой из SEQ ID NO:3-8 в результате выполнения одной или нескольких консервативных замен аминокислот;

(viii) пептид или пептидный комплекс включает аминокислотную последовательность

- SEQ ID NO:1 или ее функционально активный вариант,

- SEQ ID NO:2 или ее функционально активный вариант,

- SEQ ID NO:9 или ее функционально активный вариант,

- SEQ ID NO:10 или ее функционально активный вариант,

- SEQ ID NO:11 или ее функционально активный вариант;

(ix) пептид или пептидный комплекс состоит из аминокислотной последовательности

- SEQ ID NO:9 или ее функционально активного варианта,

- SEQ ID NO:10 или ее функционально активного варианта,

- необязательно из 50 или меньше дополнительных аминокислотных остатков, 1-40, 1-30, 1-25, 1-15, 1-10 или 5, 4, 3, 2 или 1 дополнительного аминокислотного остатка;

(х) пептид или пептидный комплекс состоит из аминокислотной последовательности

- SEQ ID NO:9 или ее функционально активного варианта,

- SEQ ID NO:11 или ее функционально активного варианта,

- необязательно из 50 или меньше дополнительных аминокислотных остатков, 1-40, 1-30, 1-25, 1-15, 1-10 или 5, 4, 3, 2 или 1 дополнительного аминокислотного остатка.

SEQ ID NO:1 и 2 представлены на фигуре 5: SEQ ID NO:1 является аминокислотной последовательностью вариабельной области легкой цепи антитела против α2-интегрина. SEQ ID NO:2 является аминокислотной последовательностью вариабельной области тяжелой цепи.

SEQ ID NO:9, 10 и 11 представлены на фигуре 7: SEQ ID NO:9 является аминокислотной последовательностью легкой цепи химерного антитела, полученного в виде IgG4 (CDR-области подчеркнуты), SEQ ID NO:10 является аминокислотной последовательностью тяжелой цепи химерного антитела, полученного в виде IgG4 (CDR-области подчеркнуты), и SEQ ID NO:11 является аминокислотной последовательностью тяжелой цепи Fab-фрагмента химерного антитела с 6xhis меткой. Константные области были получены из остовных последовательностей человека (см. примеры). Настоящее изобретение также относится к любым конструкциям или фрагментам антител, пептиду или пептидным комплексам без his метки.

В соответствии с одним вариантом осуществления изобретения вариабельные домены НС и LC связаны с соответствующими константными областями с образованием химерных конструкций НС или LC. Конкретные варианты осуществления изобретения относятся к вариабельной области LC химерного антитела против α2-интегрина, слитой с константной областью белка IGKC (такой как, например, в SEQ ID NO:9), к вариабельной области НС химерного антитела против α2-интегрина, слитой с константной областью IGHG4 (такой как, например, в SEQ ID NO:10) или к вариабельной области НС химерного антитела против α2-интегрина, слитой с СН1 доменом константной области IGHG1 (такой как, например, в SEQ ID NO:11).

Как было подробно описано выше, компоненты а)-с) (CDR-области LC) и d)-f) (CDR-области НС) были получены путем секвенирования вариабельного домена легкой цепи (VL) и вариабельного домена тяжелой цепи (VH) полученного и испытанного моноклонального антитела. Указанная область может быть любой природной каркасной областью VL или VH либо искусственной каркасной областью VL или VH. В одном варианте осуществления настоящего изобретения одна или несколько CDR-областей (LCDR1, LCDR2, LCDR3, HCDR1, HCDR2 и HCDR3) расположены в каркасной области главного вариабельного домена, то есть LCDR1, LCDR2 и LCDR3 в каркасной области VL и HCDR1, HCDR2 и HCDR3 в каркасной области VH. Из вышеизложенного следует, что CDR-области, идентифицированные любым вышеописанным приемлемым методом (сравни SEQ ID NO:1 и 2) отдельно, вместе или в любой комбинации, могут быть удалены из обнаруженного соседства и перенесены в каркасную область другого (второго) вариабельного домена, заменяя таким образом CDR-области второго вариабельного домена. В данной области известны разные вариабельные домены или последовательности антител, которые могут быть использованы для указанной цели. Например, вариабельные домены, в которые могут быть вставлены представляющие интерес CDR-области, могут быть получены из любой зародышевой линии клеток или реаранжированного вариабельного домена человека. Вариабельные домены могут быть также получены синтетическим путем. CDR-области могут быть введены в соответствующие вариабельные домены методами рекомбинантных ДНК. Один способ введения CDR-областей описан в публикации Marks et al., 1992, Bio/Technology, 10:779-783. Вариабельный домен тяжелой цепи может быть спарен с вариабельным доменом легкой цепи с образованием антигенсвязывающего центра. Кроме того, для связывания антигена могут быть использованы независимые области (например, только вариабельный домен тяжелой цепи).

Также возможны комбинации вышеописанных химер тяжелых или легких цепей с искусственно созданными легкими или тяжелыми цепями, полученные путем трансплантации CDR, описанной в предшествующем абзаце, если такие комбинации обладают специфичностью связывания с α2-интегрином.

Пептиды или пептидные комплексы по настоящему изобретению могут быть гликозилированы. Гликозирование белков и физиологический эффект гликозилирования известны в данной области. Олигосахаридный компонент может в значительной степени (положительно или отрицательно) влиять на свойства, определяющие эффективность терапевтического гликопротеина, такие как физическая стабильность, устойчивость к воздействию протеазы, взаимодействие с иммунной системой, фармакокинетика и специфическая биологическая активность. Для экспрессии гликозилированных белков в данной области обычно используют клетки млекопитающих (Cumming et al., 1991, Glycobiology 1:115-130; Jenkins et al., 1996, Nature Biotechn. 14:975-981). Примеры таких клеток включают клетки яичника китайского хомячка (СНО), клетки почки детеныша хомячка (ВНК), миеломные клетки NSO и SP2/0 мыши. В научной литературе также описано продуцирование гликозилированных белков трансгенными животными (Jenkins et al., 1996, см/ выше). Кроме того, в данной области известны генетически созданные рекомбинантные клетки-хозяева, гетерологически экспрессирующие/сверхэкспрессирующие гены гликозилтрансферазы (Bailey, 1991, Science 252:1668-1675). В публикации WO 9954342 (А1) описаны методы получения гликозилированных белков с использованием клеток-хозяев, экспрессирующих целый ряд гликозилтрансфераз, модифицирующих гликопротеины, активность которых повышает комплексообразование N-связанных олигосахаридов, содержащих разделяющий GlcNAc, которые, как указано в научной литературе, обладают лучшими функциональными свойствами.

В соответствии с одним вариантом осуществления настоящего изобретения пептид или пептидный комплекс может быть связан с одной или несколькими молекулами, которые не идентичны пептиду или пептидному комплексу по настоящему изобретению (дополнительные части), при этом весь комплекс является “конъюгатом”. Примеры дополнительных частей включают, например, одну или несколько других биомолекул, таких как пептиды или пептидные комплексы, нуклеиновые кислоты (например, олигонуклеотиды или молекулы РНК, такие как иРНК), органические (мелкие) молекулы или радиоактивные части. Указанные дополнительные части могут обладать собственной функцией, например, цитотоксичностью, терапевтической активностью, иммуносупрессорной активностью и т.д., или могут оказывать благоприятное воздействие на весь конъюгат по другой причине (например, повышать или уменьшать устойчивость конъюгата и т.д.). В объем настоящего изобретения входят пептиды или пептидные комплексы, конъюгированные с одной или несколькими дополнительными частями. В том случае, если пептид или пептидный комплекс является антителом или его фрагментом, указанный конъюгат представляет собой иммуноконъюгат. В данной области известны примеры иммуноконъюгатов (см., например, WO05/103081), например, включающих одно или несколько химиотерапевтических средств, пролекарства, цитотоксины, радиоактивные изотопы или радиоактивные нуклеотиды, иммуносупрессорные части, терапевтические олигонуклеотиды, ингибирующую РНК (иРНК).

В соответствии с одним вариантом осуществления изобретения пептид или пептидный комплекс является антителом. Природные антитела являются глобулярными плазматическими белками (~150 кДа), которые также известны как иммуноглобулины, имеющие основную структуру. Указанные белки, к аминокислотным остаткам которых добавлены сахарные цепи, являются гликопротеинами. Основным функциональным звеном каждого антитела является мономер иммуноглобулина (Ig) (содержащий только одно звено Ig); секретированные антитела также могут быть димерными с двумя звеньями Ig, как в случае IgA, тетрамерными с четырьмя звеньями Ig подобно IgM рыбы телеоста, или пентамерными с пятью звеньями Ig подобно IgM млекопитающих. В настоящем изобретении примеры приемлемых форм включают природные антитела, в том числе изотипы антител, известные как IgA, IgD, IgE, IgG и IgM.

Мономер Ig является “Y”-образной молекулой, состоящей из четырех полипептидных цепей: двух идентичных тяжелых цепей и двух идентичных легких цепей, соединенных дисульфидными связями между остатками цистеина. Каждая тяжелая цепь состоит примерно из 440 аминокислот; каждая легкая цепь состоит примерно из 220 аминокислот. Тяжелые и легкие цепи имеют внутрицепные дисульфидные связи, стабилизирующие укладку цепи. Каждая цепь состоит из структурных доменов, именуемых доменами Ig. Указанные домены содержат примерно 70-110 аминокислот и относятся к разным категориям (таким как, например, вариабельные домены или V и константные домены или С) в зависимости от размера и выполняемой функции. Указанные домены имеют характерную для иммуноглобулина укладку цепи, в которой две β-складки образуют “сэндвич”, сохраняющийся в результате взаимодействия между консервативными остатками цистеина и другими заряженными аминокислотами.

Существует пять типов тяжелых цепей Ig млекопитающих, обозначаемых α, δ, ε, γ и µ. Тип тяжелой цепи определяет изотип антитела; указанные цепи имеют место соответственно в антителах IgA, IgD, IgE, IgG и IgM.

Разные тяжелые цепи отличаются размером и составом; α и γ содержат примерно 450 аминокислот, δ содержит примерно 500 аминокислот, в то время как µ и ε имеют примерно 550 аминокислот. Каждая тяжелая цепь имеет две области: константную область (СН) и вариабельную область (VH). В одном виде константная область по существу идентична во всех антителах одного изотипа, но отличается в антителах других изотипов. В тяжелых цепях γ, α и δ константная область состоит из трех последовательно расположенных доменов Ig и шарнирной области, придающей дополнительную гибкость; в тяжелых цепях µ и ε константная область состоит из четырех доменов иммуноглобулина. Вариабельная область тяжелой цепи отличается в антителах, продуцированных разными В-клетками, но является одинаковой во всех антителах, продуцированных В-клеткой или клоном В-клеток одного типа. Вариабельная область каждой тяжелой цепи имеет длину, равную примерно 100 аминокислотам, и состоит из одного домена Ig.

Млекопитающие имеют легкую цепь иммуноглобулина двух типов, обозначаемых λ и κ. Легкая цепь имеет два последовательных домена: один константный домен (CL) и один вариабельный домен (VL). Примерная длина легкой цепи равна 211-217 аминокислотам. Каждое антитело содержит две легкие цепи, которые всегда являются идентичными; в антителе млекопитающих присутствует легкая цепь только одного типа, κ или λ. Легкие цепи других типов, такие как ι-цепь, обнаружены у низших позвоночных, таких как Chondrichthyes и Teleostei.

Помимо природных антител, были созданы искусственные антитела, в том числе фрагменты антител. Некоторые такие тела описаны ниже. Однако в объем настоящего изобретения также входят любые другие антитела, включающие или состоящие из вышеуказанных полипептидов и характеризующиеся специфическим связыванием с α2-интегринами.

Хотя общая структура всех антител весьма схожа, уникальное свойство конкретного антитела определяется вариабельными (V) областями, подробно рассмотренными выше. В частности, вариабельные петли, три в каждой легкой цепи (VL) и три в тяжелой цепи (VH), отвечают за связывание с антигеном, то есть определяют антигенную специфичность. Указанные петли именуются областями, определяющими комплементарность (CDR). Так как антигенсвязывающий центр образуют CDR-области из VH и VL доменов, то конечную антигенную специфичность определяет комбинация тяжелых и легких цепей, а не отдельно одна из указанных цепей.

Таким образом, термин “антитело” в использованном здесь значении означает любой полипептид, который в структурном отношении подобен природному антителу и способен специфически связываться с α2-интегринами, при этом специфичность связывания определяется CDR-областями в SEQ ID NO:3-8. Следовательно, предполагается, что “антитело” имеет структуру иммуноглобулина, специфически связываясь с α2-интегрином, и включает, не ограничиваясь ими, полноразмерное или полное антитело, антигенсвязывающий фрагмент (фрагмент, выделенный физически или концептуально из структуры антитела), производное любого из вышеуказанных антител, химерную молекулу, гибрид любого из вышеуказанных антител с другим полипептидом или любую альтернативную структуру/композицию, которая избирательно связывается с α2-интегрином и необязательно ингибирует функцию α2-интегрина. Антитело может быть любым полипептидом, включающим по меньшей мере один антигенсвязывающий фрагмент. Антигенсвязывающие фрагменты состоят по меньшей мере из вариабельного домена тяжелой цепи и вариабельного домена легкой цепи, расположенных таким образом, что оба домена вместе могут связываться со специфическим антигеном.

”Полноразмерные” или “полные” антитела являются белками, состоящими из двух тяжелых (Н) и двух легких (L) цепей, связанных дисульфидными связями, из которых: (1) тяжелые цепи содержат вариабельную область и константную область, включающую три домена СН1, СН2 и СН3; (2) легкие цепи содержат вариабельную область и константную область, включающую один домен CL. Термин “полное антитело” означает любое антитело, имеющее типичную структуру доменов природного антитела (то есть включающее три или четыре константных домена тяжелой цепи и один константный домен легкой цепи, а также соответствующие вариабельные домена), даже если каждый домен включает дополнительные модификации, такие как мутации, делеции или инсерции, которые не изменяют общую структуру доменов.

“Фрагмент антитела” также содержит по меньшей мере один вышеописанный антигенсвязывающий фрагмент и выполняет по существу такую же функцию и обладает такой же специфичностью, что и полное антитело, из которого был выделен указанный фрагмент. Прототип Ig в результате ограниченного протеолитического расщепления папаином распадается на три фрагмента. Два идентичных аминоконцевых фрагмента, каждый из которых содержит одну полную легкую цепь и примерно половину тяжелой цепи, являются антигенсвязывающими фрагментами (Fab). Третий фрагмент, имеющий аналогичную длину, но содержащий карбоксиконцевую половину обеих тяжелых цепей с межцепной дисульфидной связью, является кристаллизуемым фрагментом (Fc). Fc-фрагмент содержит углеводы, комплементсвязывающий участок и FcR-связывающие сайты. В результате ограниченного расщепления пепсином образуется один F(ab')2-фрагмент, содержащий оба Fab-фрагмента и шарнирную область, включающую дисульфидную связь между тяжелыми цепями. F(ab')2 является двухвалентным фрагментом, связывающимся с антигеном. Дисульфидная связь F(ab')2-фрагмента может быть расщеплена для получения Fab'-фрагмента. Кроме того, вариабельные области тяжелых и легких цепей могут быть гибридизированы с образованием одноцепочечного вариабельного фрагмента (scFv).

Так как полные антитела первого поколения создавали определенные проблемы, многие антитела второго поколения включали только фрагменты антитела. Вариабельные домены (Fv) являются наименьшими фрагментами с интактным антигенсвязывающим доменом, состоящим из одной VL и одной VH. Такие фрагменты, содержащие только связывающие домены, могут быть получены ферментативными методами или путем экспрессии фрагментов соответствующего гена, например, в бактериальных и эукариотических клетках. Могут быть использованы разные методы, позволяющие получить, например, только Fv-фрагмент или Fab'-фрагменты, включающие одно из верхних плеч “Y”, которое содержит Fv и первые константные домены. Указанные фрагменты обычно стабилизируют путем введения полипептидной связи между двумя цепями, в результате чего образуется одноцепочечный Fv-фрагмент (scFv). Альтернативно могут быть использованы Fv-фрагменты с дисульфидной связью (dsFv). Связывающие домены фрагментов могут быть объединены с любым константным доменом с образованием полных антител или могут быть слиты с другими белками и полипептидами.

Фрагмент рекомбинантного антитела является одноцепочечным Fv-фрагментом (scFv). Такой фрагмент обычно характеризуется высоким сродством к своему антигену и может быть экспрессирован в разных хозяевах. Вышеуказанные и другие свойства делают scFv-фрагменты не только пригодными для использования в медицине, но также потенциально приемлемыми для биотехнологических целей. Как было подробно описано выше, в scFv-фрагменте VH и VL домены соединены гидрофильным и гибким пептидным линкером, который улучшает эффективность экспрессии и укладки цепи. Обычно используют линкеры, состоящие примерно из 15 аминокислот, из которых чаще всего используют линкер (Gly4Ser)3. Молекулы scFv могут быть легко расщеплены протеолитическим путем в зависимости от использованного линкера. Благодаря совершенствованию методов генетической инженерии указанные ограничения могут быть практически преодолены в результате выполнения исследований, направленных на улучшение функции и устойчивости. В качестве примера можно привести Fv-фрагменты, стабилизированные дисульфидной связью (или связанные дисульфидной связью), в которых VH-VL димер стабилизирован межцепной дисульфидной связью. Цистеины, вводимые на границе между VL и VH доменами, образуют дисульфидный мостик, удерживающий два домена вместе.

В результате диссоциации scFv образуются мономерные scFv-фрагменты, из которых могут быть созданы димеры (диатела или (scFv)2), тримеры (триатела) или более крупные агрегаты, такие как TandAb и Flexibody.

Антитела с двумя связывающими доменами могут быть созданы путем связывания двух scFv простым пептидным линкером (scFv)2 или путем димеризации двух мономеров (диатела). Самой простой конструкцией являются диатела, имеющие два функциональных антигенсвязывающих домена, которые могут быть одинаковыми, подобными (двухвалентные диатела) или могут обладать специфичностью к разным антигенам (биспецифические диатела). Биспецифические антитела, например, позволяют сообщать новые эффекторные функции клеткам-мишеням (таким как цитотоксические Т-клетки), что делает их очень полезными для применения в медицине.

Недавно были созданы антитела, включающие четыре вариабельных домена тяжелых цепей и четыре вариабельных домена легких цепей. Примеры таких антител включают четырехвалентные биспецифические антитела (TandAb и Flexibody, Affimed Therapeutics AG, Heidelberg, Germany). В отличие от биспецифического диатела, биспецифическое антитело TandAb является гомодимером, состоящим только из одного полипептида. Антитела Flexibody представляют собой комбинацию scFv с мультимерным фрагментом диатела, в результате чего образуется многовалентная молекула с высокой степенью гибкости, позволяющей соединять на поверхности клетки две достаточно удаленные друг от друга молекулы. Антитело является мультиспецифическим при наличии в нем более двух функциональных антигенсвязывающих доменов, обладающих специфичностью к разным антигенам.

Молекулы определенных антител, которые включают, не ограничиваясь ими, Fv, scFv, диатела или доменные антитела (Domantis), могут быть стабилизированы путем введения дисульфидных мостиков, соединяющих VH и VL домены. Биспецифические антитела могут быть созданы стандартными методами, включающими получение антител путем химического синтеза или из гибридом, и другими методами, которые включают, не ограничиваясь ими, метод BiTE™ (молекулы, содержащие антигенсвязывающие области с разной специфичностью связывают при помощи пептидного линкера) и метод совмещения выступов с отверстиями.

Антитело предпочтительно является Fab, Fab', F(ab')2, Fv, Fv с дисульфидной связью, scFv, (scFv)2, биспецифическим антителом, мультиспецифическим антителом, диателом, триателом, тетрателом или минителом.

В одном варианте осуществления изобретения антитело является моноклональным антителом, химерным антителом или гуманизированным антителом. Моноклональные антитела являются идентичными моноспецифическими антителами, будучи продуцированными иммунокомпетентными клетками одного типа, которые являются клонами одной родительской клетки. Химерное антитело является антителом, в котором по меньшей мере одна область иммуноглобулина одного вида слита с другой областью иммуноглобулина другого вида методами рекомбинантных ДНК для уменьшения иммуногенности. Например, мышиные VL и VH области могут быть слиты с остальной частью иммуноглобулина человека. Химерное антитело конкретного типа является гуманизированным антителом. Гуманизированные антитела получают путем слияния ДНК, кодирующей CDR-области антитела, отличного от человеческого, c антителопродуцирующей ДНК человека (или наоборот). Полученная конструкция ДНК может быть использована для экспрессии и продуцирования антител, которые обычно являются не такими иммуногенными как исходное антитело, отличное от человеческого, или химерное антитело, так как только CDR-области являются отличными от человеческих.

В соответствии с одним вариантом осуществления разных объектов настоящего изобретения могут быть использованы человеческие или гуманизированные антитела или их фрагменты. Таким образом, пептид или пептидный комплекс может включать константный домен тяжелой цепи иммуноглобулина, выбираемый из группы, состоящей из константного домена IgM человека, константного домена IgG1 человека, константного домена IgG2 человека, константного домена IgG3 человека, константного домена IgG4 человека, константного домена IgE человека и константного домена IgA человека. В контексте настоящего изобретения антитело против α2-интегрина было гуманизировано методом, ранее описанным в публикации WO2009/032661, но может быть использован любой приемлемый метод гуманизации, известный в данной области.

Как было подробно описано выше, CDR также может быть функционально активным вариантом любых CDR-областей, представленных в формуле изобретения. В одном варианте осуществления изобретения функционально активный вариант является функционально активным фрагментом, последовательность которого на 90% или больше идентична аминокислотной последовательности любой SEQ ID NO:3-8. Альтернативно, функционально активный вариант является функционально активным вариантом, последовательность которого на 70% или больше, предпочтительно на 80% или больше, более предпочтительно на 90%, 95% или больше идентична аминокислотной последовательности любой SEQ ID NO:3-8, в частности, когда функционально активный вариант получен из аминокислотной последовательности любой SEQ ID NO:3-8 путем выполнения одной или нескольких консервативных замен аминокислот (см. ниже).

В одном варианте осуществления разных объектов настоящего изобретения пептид или пептидный комплекс включает аминокислотную последовательность

- SEQ ID NO:1 или ее функционально активный вариант, и/или

- SEQ ID NO:2 или ее функционально активный вариант, и/или

- SEQ ID NO:9 или ее функционально активный вариант, и/или

- SEQ ID NO:10 или ее функционально активный вариант, и/или

- SEQ ID NO:11 или ее функционально активный вариант.

Альтернативно, пептид или пептидный комплекс состоит из аминокислотной последовательности

- SEQ ID NO:9 или ее функционально активного варианта, и

- SEQ ID NO:10 или ее функционально активного варианта, и

- необязательно из 50 дополнительных аминокислотных остатков или из 1-40, 1-30, 1-25, 1-15, 1-10 или 1, 2, 3, 4 или 5 дополнительных аминокислотных остатков.

Альтернативно, пептид или пептидный комплекс состоит из аминокислотной последовательности

- SEQ ID NO:9 или ее функционально активного варианта, и

- SEQ ID NO:11 или ее функционально активного варианта, и

- необязательно из 50 дополнительных аминокислотных остатков или из 1-40, 1-30, 1-25, 1-15, 1-10 или 1, 2, 3, 4 или 5 дополнительных аминокислотных остатков.

Функционально активный вариант может быть фрагментом, полученным из любых последовательностей SEQ ID NO:1, 2, 9, 10 или 11 в результате выполнения одной или нескольких делеций. Делеции могут быть С-концевыми, N-концевыми и/или внутренними. Указанный фрагмент может быть получен, например, в результате выполнения 10 или меньшего числа делеций, например, 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 делеций, в результате выполнения 5 или меньшего числа делеций, например, 1, 2, 3, 4 или 5 делеций, в результате выполнения 3 или меньшего числа делеций, например, 1, 2 или 3 делеций, в результате выполнения 2 или меньшего числа делеций, например, 1 или 2 делеций, или в результате выполнения 1 делеции. Функционально активный фрагмент по настоящему изобретению обладает биологической активностью, подобной биологической активности полного белка, включая способность связываться с α2-интегрином и/или α2β1-интегрином и необязательно ингибировать α2- и/или α2β1-интегрин. Фрагмент антигена является функционально активным в контексте настоящего изобретения, если активность данного фрагмента составляет 10% или больше, предпочтительно 25% или больше, более предпочтительно 50% или больше, еще предпочтительнее 70% или больше, еще предпочтительнее 80% или больше, еще предпочтительнее 90% или больше, еще предпочтительнее 95% или больше, наиболее предпочтительно 99% или больше от активности аминокислотной последовательности без внесения в нее изменений. Приемлемые методы определения активности связывания с α2β1-интегрином приведены в примерах, в частности, в примере 1D.

Вариант может быть получен из любых последовательностей SEQ ID NO:1, 2, 9, 10 или 11 в результате выполнения одной или нескольких модификаций аминокислот, включающих делеции, добавления и/или замены. Модификации могут быть С-концевыми, N-концевыми и/или внутренними. Указанный фрагмент может быть получен, например, в результате выполнения 10 или меньшего числа делеций, например, 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 делеций, в результате выполнения 5 или меньшего числа делеций, например, 1, 2, 3, 4 или 5 делеций, в результате выполнения 3 или меньшего числа делеций, например, 1, 2 или 3 делеций, в результате выполнения 2 или меньшего числа делеций, например, 1 или 2 делеций, или в результате выполнения 1 делеции. Функционально активный вариант по настоящему изобретению обладает биологической активностью, подобной биологической активности полного белка, включая способность связываться с α2-интегрином и/или α2β1-интегрином и необязательно ингибировать α2- и/или α2β1-интегрин. Вариант является функционально активным в контексте настоящего изобретения, если активность данного варианта составляет 10% или больше, предпочтительно 25% или больше, более предпочтительно 50% или больше, еще предпочтительнее 70% или больше, еще предпочтительнее 80% или больше, особенно предпочтительно 90% или больше, в частности, 95% или больше, наиболее предпочтительно 99% или больше от активности аминокислотной последовательности без внесения в нее изменений.

Дополнительные аминокислоты (ix, x или xi) могут быть локализованы у С-конца, N-конца и/или внутри последовательности. В соответствии с одним вариантом осуществления изобретения может быть выполнено 50 или меньше добавлений, 40 или меньше добавлений, 30 или меньше добавлений, 20 или меньше добавлений, 10 или меньше добавлений, например, 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 добавлений, 5 или меньше добавлений, например, 1, 2, 3, 4 или 5 добавлений, 3 или меньше добавлений, например, 1, 2 или 3 добавления, 2 или меньше добавлений, например, 1 или 2 добавления, или только 1 добавление.

Дополнительный аминокислотный остаток может быть любой аминокислотой, например, L- и/или D-аминокислотой, природной или искусственной. Аминокислота предпочтительно является любой природной аминокислотой, такой как аланин, цистеин, аспарагиновая кислота, глутаминовая кислота, фенилаланин, глицин, гистидин, изолейцин, лизин, лейцин, метионин, аспарагин, пролин, глутамин, аргинин, серин, треонин, валин, триптофан или тирозин.

Аминокислота также может быть модифицированной или необычной аминокислотой. Примерами таких аминокислот являются 2-аминоадипиновая кислота, 3-аминоадипиновая кислота, β-аланин, 2-аминомасляная кислота, 4-аминомасляная кислота, 6-аминокапроновая кислота, 2-аминогептановая кислота, 2-аминоизомасляная кислота, 3-аминоизомасляная кислота, 2-аминопимелиновая кислота, 2,4-диаминомасляная кислота, десмозин, 2,2'-диаминопимелиновая кислота, 2,3-диаминопропионовая кислота, N-этилглицин-N-этиласпарагин, гидроксилизин, аллогидроксилизин, 3-гидроксипролоин, 4-гидроксипролоин, изодесмозин, аллоизолейцин, N-метилглицин, N-метилизолейцин, 6-N-метиллизин, N-метилвалин, норвалин, норлейцин или орнитин. Кроме того, аминокислота может быть подвергнута таким модификациям, как посттрансляционные модификации. Примеры модификаций включают ацетилирование, амидирование, блокирование, формилирование, гидроксилирование γ-карбоксиглутаминовой кислоты, гликозилирование, метилировавние, фосфорилирование и сульфатацию. При наличии в пептиде более одного дополнительного или гетерологичного аминокислотного остатка, такие аминокислотные остатки могут быть одинаковыми или разными.

Процентное значение идентичности последовательности можно определить, например, выполняя сравнительный анализ последовательностей. В данной области хорошо известны методы сравнительного анализа последовательностей. Разные программы и алгоритмы сравнительного анализа описаны, например, в публикациях Smith and Waterman, Adv. Appl. Math. 2:482, 1981 или Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85:2444, 1988.

Основные программные средства локального поиска сходства NCBI (BLAST) (Altschul et al., J. Mol. Biol. 215:403-410, 1990) можно приобрести из нескольких источников, включая Национальный центр биотехнологической информации (NCBI, Bethesda, MD) и Интернет, и использовать вместе с программами анализа последовательностей blastp, blastn, blastx, tblastn и tblastx. Варианты любых последовательностей SEQ ID NO:1-8 обычно исследуют, используя программу Blast 2.0 NCBI с параметрами по умолчанию. Для сравнения аминокислотных последовательностей, состоящих по меньшей мере из 30 аминокислот, используют функцию сравнения последовательностей программы Blast 2 с матрицей BLOSUM62, включающей параметры по умолчанию (стоимость разрыва равна 11 и стоимость разрыва в один остаток равна 1). При сравнении коротких пептидов (меньше примерно 30 аминокислот) сравнительный анализ выполняют, используя функцию сравнения последовательностей программы Blast 2 с матрицей РАМ30, включающей параметры по умолчанию (штраф за открытый разрыв равен 9, штраф за удлиняющий разрыв равен 1). Методы определения идентичности последовательности в таких коротких окнах как 15 аминокислот или меньше описаны на Web-сайте Национального центра биотехнологической информации, Bethesda, Maryland.

В другом варианте осуществления разных объектов настоящего изобретения вышеуказанный функциональный вариант получают из аминокислотной последовательности любых SEQ ID NO:1, 2, 9, 10 или 11 в результате выполнения одной или нескольких консервативных замен аминокислот.

Как известно специалистам в данной области, консервативные замены аминокислот являются такими заменами, в результате которых аминокислотный остаток заменяется остатком, обладающим подобными или лучшими (для предполагаемой цели) функциональными и/или химическими характеристиками. Например, консервативные замены аминокислот часто являются такими заменами, при которых аминокислотный остаток заменяется аминокислотным остатком, имеющим подобную боковую цепь. В данной области определены семейства аминокислотных остатков, имеющих подобные боковые цепи. Указанные семейства включают аминокислоты с основными боковыми цепями (например, лизин, аргинин, гистидин), с кислотными боковыми цепями (например, аспарагиновая кислота, глутаминовая кислота), с незаряженными полярными боковыми цепями (например, глицин, аспарагин, глутамин, серин, треонин, тирозин, цистеин, триптофан), с неполярными боковыми цепями (например, аланин, валин, лейцин, изолейцин, пролин, фенилаланин, метионин), с β-разветвленными боковыми цепями (например, треонин, валин, изолейцин) и с ароматическими боковыми цепями (например, тирозин, фенилаланин, триптофан, гистидин). Такие модификации не вызывают значительного ослабления или изменения характеристик связывания или функционального ингибирования полипептида (комплекса) и даже могут улучшить такие свойства. Такая замена не является существенной и может включать, не ограничиваясь ими, замену остатка другим остатком, способным лучше сохранять или усиливать структуру молекулы, заряд или гидрофобность молекулы или размер молекулы. Например, иногда может быть желательно, просто заменить менее желательный остаток другим остатком с такой же полярностью или зарядом. Такие модификации могут быть произведены стандартными методами, известными в данной области, такими как сайт-направленный мутагенез или ПЦР-опосредованный мутагенез. Одним конкретным способом выполнения консервативных замен аминокислот является мутагенез методом сканирования аланином. Измененные полипептиды затем исследуют в отношении сохранения или улучшения функциональности при помощи функциональных анализов, известных в данной области или описанных в примерах. В более предпочтительном варианте осуществления настоящего изобретения число консервативных замен в любых последовательностях SEQ ID NO:1, 2, 9, 10 или 20 составляет 20 или меньше, например, 20, 19, 18, 17, 16, 15, 14, 13, 12 или 11 замен, предпочтительно 10 или меньше, например, 10, 9, 8, 7 или 6 замен, более предпочтительно 5 или меньше, например, 5, 4, 3, в частности, 2 или 1 замену.

В другом варианте осуществления разных объектов настоящего изобретения пептид или пептидный комплекс включает один или несколько функционально активных вариантов, из которых

- функционально активный вариант LDR1 включает мутацию в положении аминокислоты 11, в частности, 11Asn→Gln;

- функционально активный вариант HDR2 включат мутацию в положении аминокислоты 6, в частности, 6Asp→Glu;

- функционально активный вариант SEQ ID NO:1 включает одну или несколько мутаций в положениях аминокислот 9, 12, 15, 22, 34, 46, 47, 80, 83, 85, 87 и/или 89, предпочтительно выбираемых из группы, состоящей из 9Ala→Ser, 12Ala→Ser, 15Leu→Val, 15Leu→Pro, 22Ser→Thr, 34Asn→Gln, 46Gln→Lys, 47Ala→Pro, 80Asp→Asn, 83Glu→Gln, 85Asp→Glu, 87Ala→Thr и 89Thr→Asn, или функционально активный вариант SEQ ID NO:1 включает следующие мутации (LC1), а именно 9Ala→Ser или 15Leu→Val или 46Gln→Lys или 83Glu→Gln или 9Ala→Ser и 15Leu→Val или 9Ala→Ser и 46Gln→Lys или 9Ala→Ser и 83Glu→Gln или 15Leu→Val и 46Gln→Lys или 15Leu→Val и 83Glu→Gln или 46Gln→Lys и 83Glu→Gln или 9Ala→Ser и 15Leu→Val и 46Gln→Lys или 9Ala→Ser и 15Leu→Val и 83Glu→Gln или 9Ala→Ser и 46Gln→Lys и 83Glu→Gln или 15Leu→Val и 46Gln→Lys и 83Glu→Gln или LC1 в таблице 5: 9Ala→Ser, 15Leu→Val, 46Gln→Lys и 83Glu→Gln, или функционально активный вариант SEQ ID NO:1 включает следующие мутации (LC2), а именно 9Ala→Ser или 15Leu→Val или 34Asn→Gln или 46Gln→Lys или 83Glu→Gln или 9Ala→Ser и 15Leu→Val или 9Ala→Ser и 34Asn→Gln или 9Ala→Ser и 46Gln→Lys или 9Ala→Ser и 83Glu→Gln или 15Leu→Val и 34Asn→Gln или 15Leu→Val и 46Gln→Lys или 15Leu→Val и 83Glu→Gln или 34Asn→Gln и 46Gln→Lys или 34Asn→Gln и 83Glu→Gln или 9Ala→Ser и 15Leu→Val и 34Asn→Gln или 9Ala→Ser и 15Leu→Val и 46Gln→Lys или 9Ala→Ser и 15Leu→Val и 83Glu→Gln или 9Ala→Ser и 34Asp→Gln и 46Gln→Lys или 9Ala→Ser и 34Asn→Gln и 83Glu→Gln или 9Ala→Ser и 46Gln→Lys и 83Glu→Gln или 15Leu→Val и 34Asn→Gln и 46Gln→Lys или 15Leu→Val и 34Asn→Gln и 83Glu→Gln или 15Leu→Val и 46Gln→Lys и 83Glu→Gln или 34Asn→Gln и 46Gln→Lys и 83Glu→Gln или 9Ala→Ser и 15Leu→Val и 34Asn→Gln и 46Gln→Lys или 9Ala→Ser и 15Leu→Val и 34Asn→Gln и 83Glu→Gln или 9Ala→Ser и 15Leu→Val и 46Gln→Lys и 83Glu→Gln или 9Ala→Ser и 34Asn→Gln и 46Gln→Lys и 83Glu→Gln или 15Leu→Val и 34Asn→Gln и 46Gln→Lys и 83Glu→Gln или LC2 в таблице 5: 9Ala→Ser, 15Leu→Val, 34Asn→Gln, 46Gln→Lys и 83Glu→Gln, или функционально активный вариант SEQ ID NO:1 включает следующие мутации (LC3), а именно 9Ala→Ser или 12Ala→Ser или 15Leu→Val или 83Glu→Gln или 85Asp→Glu или 9Ala→Ser и 12Ala→Ser или 9Ala→Ser и 15Leu→Val или 9Ala→Ser и 83Glu→Gln или 9Ala→Ser и 85Asp→Glu или 12Ala→Ser и 15Leu→Val или 12Ala→Ser и 83Glu→Gln или 12Ala→Ser и 85Asp→Glu или 15Leu→Val и 83Glu→Gln или 15Leu→Val и 85Asp→Glu или 83Glu→Gln и 85Asp→Glu или 9Ala→Ser и 12Ala→Ser и 15Leu→Val или 9Ala→Ser и 12Ala→Ser и 83Glu→Gln или 9Ala→Ser и 12Ala→Ser и 85Asp→Glu или 9Ala→Ser и 15Leu→Val и 83Glu→Gln или 9Ala→Ser и 15Leu→Val и 85Asp→Glu или 9Ala→Ser и 83Glu→Gln и 85Asp→Glu или 12Ala→Ser и 15Leu→Val и 83Glu→Gln или 12Ala→Ser и 15Leu→Val и 85Asp→Glu или 12Ala→Ser и 83Glu→Gln и 85Asp→Glu или 15Leu→Val и 83Glu→Gln и 85Asp→Glu или 9Ala→Ser и 12Ala→Ser и 15Leu→Val и 83Glu→Gln или 9Ala→Ser и 12Ala→Ser и 15Leu→Val и 85Asp→Glu или 9Ala→Ser и 12Ala→Ser и 83Glu→Gln и 85Asp→Glu или 9Ala→Ser и 15Leu→Val и 83Glu→Gln и 85Asp→Glu или 12Ala→Ser и 15Leu→Val и 83Glu→Gln и 85Asp→Glu или (LC3) в соответствии с таблицей 5: 9Ala→Ser, 12Ala→Ser, 15Leu→Val, 83Glu→Gln и 85Asp→Glu, или функционально активный вариант SEQ ID NO:1 включает следующие мутации (LC4), а именно 9Ala→Ser или 12Ala→Ser или 15Leu→Val или 34Asn→Gln или 83Glu→Gln или 85Asp→Glu или 9Ala→Ser и 12Ala→Ser или 9Ala→Ser и 15Leu→Val или 9Ala→Ser и 34Asn→Gln или 9Ala→Ser и 83Glu→Gln или 9Ala→Ser и 85Asp→Glu или 12Ala→Ser и 15Leu→Val или 12Ala→Ser и 34Asn→Gln или 12Ala→Ser и 83Glu→Gln или 12Ala→Ser и 85Asp→Glu или 15Leu→Val и 34Asn→Gln или 15Leu→Val и 83Glu→Gln или 15Leu→Val и 85Asp→Glu или 34Asn→Gln и 83Glu→Gln или 34Asn→Gln и 85Asp→Glu или 83Glu→Gln и 85Asp→Glu или 9Ala→Ser и 12Ala→Ser и 15Leu→Val или 9Ala→Ser и 12Ala→Ser и 34Asn→Gln или 9Ala→Ser и 12Ala→Ser и 83Glu→Gln или 9Ala→Ser и 12Ala→Ser и 85Asp→Glu или 9Ala→Ser и 15Leu→Val и 34Asn→Gln или 9Ala→Ser и 15Leu→Val и 83Glu→Gln или 9Ala→Ser и 15Leu→Val и 85Asp→Glu или 9Ala→Ser и 34Asn→Gln и 83Glu→Gln или 9Ala→Ser и 34Asn→Gln и 85Asp→Glu или 9Ala→Ser и 83Glu→Gln и 85Asp→Glu или 12Ala→Ser и 15Leu→Val и 34Asn→Gln или 12Ala→Ser и 15Leu→Val и 83Glu→Gln или 12Ala→Ser и 15Leu→Val и 85Asp→Glu или 12Ala→Ser и 34Asn→Gln и 83Glu→Gln или 12Ala→Ser и 34Asn→Gln и 85Asp→Glu или 12Ala→Ser и 83Glu→Gln и 85Asp→Glu или 15Leu→Val и 34Asn→Gln и 83Glu→Gln или 15Leu→Val и 34Asn→Gln и 85Asp→Glu или 15Leu→Val и 83Glu→Gln и 85Asp→Glu или 34Asn→Gln и 83Glu→Gln и 85Asp→Glu или 9Ala→Ser и 12Ala→Ser и 15Leu→Val и 34Asn→Gln или 9Ala→Ser и 12Ala→Ser и 15Leu→Val и 83Glu→Gln или 9Ala→Ser и 12Ala→Ser и 15Leu→Val и 85Asp→Glu или 9Ala→Ser и 12Ala→Ser и 34Asn→Gln и 83Glu→Gln или 9Ala→Ser и 12Ala→Ser и 34Asn→Gln и 85Asp→Glu или 9Ala→Ser и 12Ala→Ser и 83Glu→Gln и 85Asp→Glu или 9Ala→Ser и 15Leu→Val и 34Asn→Gln и 83Glu→Gln или 9Ala→Ser и 15Leu→Val и 34Asn→Gln и 85Asp→Glu или 9Ala→Ser и 15Leu→Val и 83Glu→Gln и 85Asp→Glu или 9Ala→Ser и 34Asn→Gln и 83Glu→Gln и 85Asp→Glu или 12Ala→Ser и 15Leu→Val и 34Asn→Gln и 83Glu→Gln или 12Ala→Ser и 15Leu→Val и 34Asn→Gln и 85Asp→Glu или 12Ala→Ser и 15Leu→Val и 83Glu→Gln и 85Asp→Glu или 12Ala→Ser и 34Asn→Gln и 83Glu→Gln и 85Asp→Glu или 9Ala→Ser и 12Ala→Ser и 15Leu→Val и 34Asn→Gln и 83Glu→Gln или 9Ala→Ser и 12Ala→Ser и 15Leu→Val и 34Asn→Gln и 85Asp→Glu или 9Ala→Ser и 12Ala→Ser и 34Asn→Gln и 83Glu→Gln и 85Asp→Glu или 9Ala→Ser и 15Leu→Val и 34Asn→Gln и 83Glu→Gln и 85Asp-Glu или 12Ala→Ser и 15Leu→Val и 34Asn→Gln и 83Glu→Gln и 85Asp→Glu или (LC4) в соответствии с таблицей 5: 9Ala→Ser, 12Ala→Ser, 15Leu→Val, 34Asn→Gln, 83Glu→Gln и 85Asp→Glu, или функционально активный вариант SEQ ID NO:1 включает следующие мутации (LC5), а именно 15Leu→Pro, 22Ser→Thr, 47Ala→Pro, 80Asp→Asn, 87Ala→Thr, 89Thr→Asn или 15Leu→Pro и 22Ser→Thr или 15Leu→Pro и 47Ala→Pro или 15Leu→Pro и 80Asp→Asn или 15Leu→Pro и 87Ala→Thr или 15Leu→Pro и 89Thr→Asn или 232Ser→Thr и 47Ala→Pro или 22Ser→Thr и 80Asp→Asn или 22Ser→Thr и 87Ala→Thr или 22Ser→Thr и 89Thr→Asn или 47Ala→Pro и 80Asp→Asn или 47Ala→Pro и 87Ala→Thr или 47Ala→Pro и 89Thr→Asn или 80Asp→Asn и 87Ala→Thr или 80Asp→Asn и 89Thr→Asn или 87Ala→Thr и 89Thr→Asn или 15Leu→Pro и 22Ser→Thr и 47Ala→Pro или 15Leu→Pro и 22Ser→Thr и 80Asp→Asn или 15Leu→Pro и 22Ser→Thr и 87Ala→Thr или 15Leu→Pro и 22Ser→Thr и 89Thr→Asn или 15Leu→Pro и 47Ala→Pro и 80Asp→Asn или 15Leu→Pro и 47Ala→Pro и 87Ala→Thr или 15Leu→Pro и 47Ala→Pro и 89Thr→Asn или 15Leu→Pro и 80Asp→Asn и 87Ala→Thr или 15Leu→Pro и 80Asp→Asn и 89Thr→Asn или 15Leu→Pro и 87Ala→Thr и 89Thr→Asn или 22Ser→Thr и 47Ala→Pro и 80Asp→Asn или 22Ser→Thr и 47Ala→Pro и 87Ala→Thr или 22Ser→Thr и 47Ala→Pro и 89Thr→Asn или 22Ser→Thr и 80Asp→Asn и 87Ala→Thr или 22Ser→Thr и 80Asp→Asn и 89Thr→Asn или 22Ser→Thr и 87Ala→Thr и 89Thr→Asn или 47Ala→Pro и 80Asp→Asn и 87Ala→Thr или 47Ala→Pro и 80Asp→Asn и 89Thr→Asn или 47Ala→Pro и 87Ala→Thr и 89Thr→Asn или 80Asp→Asn и 87Ala→Thr и 89Thr→Asn или 15Leu→Pro и 22Ser→Thr и 47Ala→Pro и 80Asp→Asn или 15Leu→Pro и 22Ser→Thr и 47Ala→Pro и 87Ala→Thr или 15Leu→Pro и 22Ser→Thr и 47Ala→Pro и 89Thr→Asn или 15Leu→Pro и 22Ser→Thr и 80Asp→Asn и 87Ala→Thr или 15Leu→Pro и 22Ser→Thr и 80Asp→Asn и 89Thr→Asn или 15Leu→Pro и 22Ser→Thr и 87Ala→Thr и 89Thr→Asn или 15Leu→Pro и 47Ala→Pro и 80Asp→Asn и 87Ala→Thr или 15Leu→Pro и 47Ala→Pro и 80Asp→Asn и 89Thr→Asn или 15Leu→Pro и 47Ala→Pro и 87Ala→Thr и 89Thr→Asn или 15Leu→Pro и 80Asp→Asn и 87Ala→Thr и 89Thr→Asn или 22Ser→Thr и 47Ala→Pro и 80Asp→Asn и 87Ala→Thr или 22Ser→Thr и 47Ala→Pro и 80Asp→Asn и 89Thr→Asn или 22Ser→Thr и 47Ala→Pro и 87Ala→Thr и 89Thr→Asn или 22Ser→Thr и 80Asp→Asn и 87Ala→Thr и 89Thr→Asn или 47Ala→Pro и 80Asp→Asn и 87Ala→Thr и 89Thr→Asn или 15Leu→Pro и 22Ser→Thr и 47Ala→Pro и 80Asp→Asn и 87Ala→Thr или 15Leu→Pro и 22Ser→Thr и 47Ala→Pro и 80Asp→Asn и 89Thr→Asn или 15Leu→Pro и 22Ser→Thr и 47Ala→Pro и 87Ala→Thr и 89Thr→Asn или 15Leu→Pro и 22Ser→Thr и 80Asp→Asn и 87Ala→Thr и 89Thr→Asn или 15Leu→Pro и 47Ala→Pro и 80Asp→Asn и 87Ala→Thr и 89Thr→Asn или 22Ser→Thr и 47Ala→Pro и 80Asp→Asn и 87Ala→Thr и 89Thr→Asn или (LC5) в соответствии таблицей 5: 15Leu→Pro, 22Ser→Thr, 47Ala→Pro, 80Asp→Asn, 87Ala→Thr и 89Thr→Asn и/или функционально активный вариант SEQ ID NO:2 включает одну или несколько мутаций в положениях аминокислот 5, 7, 11, 12, 17, 20, 38, 40, 43, 55, 61, 65, 66, 67, 76, 81, 82, 87, 91, 93, 112, 113 и/или 116, в частности, выбираемых из группы, состоящей из 5His→Val, 7Pro→Ser, 11Leu→Val, 12Val→Lys, 17Pro→Ser, 20Leu→Val, 38Lys→Arg, 40Arg→Ala, 43Arg→Gln, 55Asp→Glu, 61Asn→Ala, 65Lys→Gln, 66Asp→Gly, 67Lys→Arg, 76Ser→Thr, 81Ile→Met, 82Gln→Glu, 87Thr→Arg, 91Ser→Thr, 93Val→Lys, 112Thr→Leu, 113Leu→Val и 116Ser→Val, или функционально активный вариант SEQ ID NO:2 включает следующие мутации (НС1), а именно 43Arg→Gln или 67Lys→Arg или 116Ser→Val или 43Arg→Gln и 67Lys→Arg или 43Arg→Gln и 116Ser→Val или 67Lys→Arg и 116Ser→Val или (НС1) в соответствии с таблицей 6: 43Arg→Gln, 67Lys→Arg и 116Ser→Val, или функционально активный вариант SEQ ID NO:2 включает следующие мутации (НС2), а именно 43Arg→Gln или 55Asp→Glu или 67Lys→Arg или 116Ser→Val или 43Arg→Gln и 55Asp→Glu или 43Arg→Gln и 67Lys→Arg или 43Arg→Gln и 116Ser→Val или 55Asp→Glu и 67Lys→Arg или 55Asp→Glu и 116Ser→Val или 67Lys→Arg и 116Ser→Val или 43Arg→Gln и 55Asp→Glu и 67Lys→Arg или 43Arg→Gln и 55Asp→Glu и 116Ser→Val или 43Arg→Gln и 67Lys→Arg и 116Ser→Val или 55Asp→Glu и 67Lys→Arg и 116Ser→Val или (НС2) в соответствии с таблице 6: 43Arg→Gln, 55Asp→Glu, 67Lys→Arg и 116Ser→Val, или функционально активный вариант SEQ ID NO:2 включает следующие мутации (НС3), а именно 17Pro→Ser или 116Ser→Val или (НС3) в соответствии с таблицей 6: 17Pro→Ser и 116Ser→Val, или функционально активный вариант SEQ ID NO:2 включает следующие мутации (НС4), а именно: 17Pro→Ser или 93Val→Lys или 116Ser→Val или 17Pro→Ser и 93Val→Lys или 17Pro→Ser и 116Ser→Val или 93Val→Lys и 116Ser→Val или (НС4) в соответствии с таблицей 6: 17Pro→Ser, 93Val→Lys и 116Ser→Val, или функционально активный вариант SEQ ID NO:2 включает следующие мутации (НС5), а именно: 17Pro→Ser или 55Asp→Glu или 116Ser→Val или 17Pro→Ser и 55Asp→Glu или 17Pro→Ser и 116Ser→Val или 55Asp→Glu и 116Ser→Val; или (НС5) в соответствии с таблицей 6: 17Pro→Ser, 55Asp→Glu и 116Ser→Val, или функционально активный вариант SEQ ID NO:2 включает следующие мутации (НС6), а именно 12Val→Lys или 55Asp→Glu или 93Val→Lys или 116Ser→Val или 12Val→Lys и 55Asp→Glu или 12Val→Lys и 93Val→Lys или 12Val→Lys и 116Ser→Val или 55Asp→Glu и 93Val→Lys или 55Asp→Glu и 116Ser→Val или 93Val→Lys и 116Ser→Val или 12Val→Lys и 55Asp→Glu и 93Val→Lys или 12Val→Lys и 55Asp→Glu и 116Ser→Val или 12Val→Lys и 93Val→Lys и 116Ser→Val или 55Asp→Glu и 93Val→Lys и 116Ser→Val или (НС6) в соответствии с таблицей 6: 12Val→Lys, 55Asp→Glu, 93Val→Lys и 116Ser→Val, или функционально активный вариант SEQ ID NO:2 включает 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или все следующие мутации (НС6): 5His→Val, 7Pro→Ser, 11Leu→Val, 12Val→Lys, 17Pro→Ser, 20Leu→Val, 38Lys→Arg, 40Arg→Ala, 43Arg→Gln, 61Asn→Ala, 65Lys→Gln, 66Asp→Gly, 67Lys→Arg, 76Ser→Thr, 81Ile→Met, 82Gln→Glu, 87Thr→Arg, 91Ser→Thr, 112Thr→Leu, 113Leu→Val.

Положения и мутации были выбраны на основании соображений, описанных в примерах, включающих таблицы 4, 5 и 6. Может быть выполнена только одна мутация или комбинация мутаций, в частности, любые комбинации, представленные в таблицах 4, 5 и 6. Кроме того, пептид или пептидный комплекс может включать одну или несколько вышеуказанных мутаций одной из вариантных легких цепей вместе с одной или несколькими вышеуказанными мутациями вариантных тяжелых цепей, например, может включать одну из следующих комбинаций мутаций/функциональных вариантов: LC1 и НС1, LC1 и НС2, LC1 и НС3, LC1 и НС4, LC1 и НС5, LC1 и НС6, LC1 и НС7, LC2 и НС1, LC2 и НС2, LC2 и НС3, LC2 и НС4, LC2 и НС5, LC2 и НС6, LC2 и НС7, LC3 и НС1, LC3 и НС2, LC3 и НС3, LC3 и НС4, LC3 и НС5, LC3 и НС6, LC3 и НС7, LC4 и НС1, LC4 и НС2, LC4 и НС3, LC4 и НС4, LC4 и НС5, LC4 и НС6, LC4 и НС7, LC5 и НС1, LC5 и НС2, LC5 и НС3, LC5 и НС4, LC5 и НС5, LC5 и НС6, LC5 и НС7.

Кроме того, может быть желательно добавить маркер, например, для обнаружения или очистки пептида или пептидного комплекса по настоящему изобретению. Приемлемые маркеры включают, не ограничиваясь ими, метки (например, 6His или HexaHis), 7His, 8His, GlyGlyGlyGlySer, (GlyGlyGlyGlySer)2, Strep, НА, с-myc или глутатион-S-трансферазу (GST)), флуоресцентный маркер (например, FITS, флуоресцеин, родамин, красители Cy или Alexa), ферментативную метку (например, пенициллиназу, пероксидазу из хрена и щелочную фосфатазу), радиоактивную метку (например, 3Н, 32Р, 35S, 125I или 14С). Кроме того, полипептид (комплекс) может быть нанесен на подложку, в частности, на твердую подложку, такую как матрица, шарик (например, стеклянный или магнитный), волокно, пленку и т.д. Специалист в данной области может адаптировать связывающую молекулу, включающую полипептид или полипептидный комплекс по настоящему изобретению, и другой компонент к предполагаемому применению, выбирая соответствующий другой компонент.

В соответствии с другим вариантом осуществления настоящего изобретения пептид или пептидный комплекс обладает одной или несколькими следующими характеристиками А-Е (а именно А, В, С, D или Е либо А и В либо А и С либо А и D либо А и Е либо В и С либо В и D либо В и Е либо С и D либо С и Е либо А, В и С либо А, В и D либо А, В и D либо А, В и Е либо А, С и D либо А, С и Е либо А, D и Е либо В, С и D либо В, С и Е либо В, D и Е либо А, В, С и D либо А, В, С и Е либо А, С, D и Е либо В, С, D и Е либо А, В, С и Е:

А) константы скорости реакции связывания (определенные методом резонанса поверхностных плазмонов, например, методом Biacore), соответствуют данным, приведенным в таблице 11;

В) молекулярная масса легкой цепи имеет следующие значения: 23,73±0,05 кДа или 23,73 кДа (LC1), 23,74±0,05 кДа или 23,7 кДа (LC2), 23,75±0,05 кДа или 23,8 кДа (LC3), 23,77±0,05 кДа или 23,77 кДа (LC4), 23,79±0,05 кДа или 23,79 кДа (LC5), 50,31±0,05 кДа, и/или молекулярная масса тяжелой цепи имеет следующие значения: 50,31 кДа (НС1), 50,33±0,05 кДа или 50,33 кДа (НС2), 50,30±0,05 кДа или 50,30 кДа (НС3), 50,33±0,05 кДа или 50,33 кДа (НС4), 50,32±0,05 кДа или 50,32 кДа (НС5), 50,35±0,05 кДа или 50,35 кДа (НС6) или 50,19±0,05 кДа или 50,19 кДа (НС7);

С) ингибирование связывания промытых тромбоцитов человека с коллагеном при значениях IC50 в мкг/мл <0,1, <0,09, <0,08, <0,07, <0,06, <0,05, <0,04, <0,03, <0,02 или <0,01, определенных статистическими методами;

D) ингибирование связывания тромбоцитов человека из плазмы с высоким содержанием тромбоцитов с коллагеном при значениях IC50 в мкг/мл <0,3, <0,2, <0,1, <0,15, <0,14 или <0,13, определенных статистическими методами;

Е) процентные значения агрегации, определенные при помощи вытеснительной хроматографии, составляют <10, <9, <8, <7, <6, <5, <4, <3, <2,5, <2, <1,5, <1 или <0,5%.

Пятым объектом настоящего изобретения являются одна или несколько нуклеиновых кислот, кодирующих пептид или пептидный комплекс по настоящему изобретению.

Молекулы нуклеиновых кислот по настоящему изобретению могут иметь форму РНК, такую как мРНК или кРНК, или форму ДНК, включающую, например, кДНК и геномную ДНК, полученную методами клонирования или продуцирования путем химического синтеза или комбинацией указанных методов. ДНК может быть трехцепочечной, двухцепочечной или одноцепочечной. Одноцепочечная ДНК может представлять собой кодирующую цепь, известную также как смысловая цепь, или может представлять собой некодирующую цепь, определяемую также как антисмысловая цепь. Термин “молекула нуклеиновой кислоты” в использованном здесь значении также означает одно- и двухцепочечную ДНК, ДНК, являющуюся смесью одно- и двухцепочечной РНК, и РНК, являющуюся смесью одно- и двухцепочечных областей, гибридные молекулы, включающие ДНК и РНК, которые могут быть одноцепочечными, чаще двухцепочечными или трехцепочечными или смесью одно- и двухцепочечных областей. Кроме того, термин “молекула нуклеиновой кислоты” в использованном здесь значении означает трехцепочечные области, включающие РНК или ДНК либо как РНК, так и ДНК.

Кроме того, нуклеиновая кислота может содержать одно или несколько модифицированных оснований. Такие нуклеиновые кислоты могут также включать модификации в рибозофосфатном остове, например, улучшающие устойчивость и время полужизни таких молекул в физиологических условиях. Таким образом, “молекулой нуклеиновой кислоты” являются ДНК или РНК, остовы которых модифицированы с целью повышения устойчивости или по другим причинам. Кроме того, молекулой нуклеиновой кислоты в контексте настоящего изобретения являются ДНК или РНК, включающие необычные основания, такие как инозин, или модифицированные основания, такие как тритилированные основания. Следует отметить, что в ДНК и РНК было внесено большое число модификаций, способствующих достижению многих полезных целей, известных специалистам в данной области. В определение термина “молекула нуклеиновой кислоты” в использованном здесь значении входят химически, ферментативно или метаболически модифицированные формы молекулы нуклеиновой кислоты, а также химические формы ДНК и РНК, характерные для вирусов и клеток, включая, наряду с прочими, простые и сложные клетки. Например, могут быть произведены замены нуклеотидов, не влияющие на полипептид, кодированный нуклеиновой кислотой, и, таким образом, любая молекула нуклеиновой кислоты, кодирующая антиген, его фрагмент или функционально активный вариант, входит в объем настоящего изобретения.

Кроме того, любые молекулы нуклеиновых кислот, кодирующие один или несколько полипептидов по настоящему изобретению, в том числе их фрагменты или функционально активные варианты, могут быть функционально связаны стандартными методами, такими как стандартные методы клонирования, с любой желаемой регуляторной последовательностью, лидерной последовательностью, гетерологичной маркерной последовательностью или гетерологичной кодирующей последовательностью с образованием слитого белка.

Нуклеиновая кислота по настоящему изобретению может быть образована in vitro или в клетке культуры путем манипуляции нуклеиновыми кислотами с помощью эндонуклеаз, экзонуклеаз, полимераз, лигаз и/или рекомбиназ или другими методами, известными специалистам в области создания нуклеиновых кислот.

В другом варианте осуществления разных объектов настоящего изобретения нуклеиновые кислоты могут быть локализованы в векторе. Вектор может дополнительно включать последовательности нуклеиновых кислот, позволяющие ему реплицировать в клетке-хозяине, такие как ориджин репликации, один или несколько терапевтических генов и/или гены селектируемых маркеров и другие генетические элементы, известные в данной области, такие как регуляторные элементы, управляющие транскрипцией, трансляцией и/или секрецией кодированного белка. Вектор может быть использован для трансдукции, трансформации или инфицирования клетки, в результате чего клетка экспрессирует нуклеиновые кислоты и/или белки, отличные от нативных белков данной клетки. Вектор необязательно включает вещества, способствующие проникновению нуклеиновой кислоты в клетку, такие как вирусная частица, липосома, белковое покрытие или тому подобные. В данной области известны соответствующие экспрессирующие векторы многих типов, используемые для экспрессии белка стандартными методами молекулярной биологии. Такие векторы выбирают из стандартных векторов разных типов, включающих насекомых, дрожжевые, грибные, бактериальные или вирусные экспрессирующие системы, например, бакуловирусы. Для указанной цели могут быть использованы другие соответствующие экспрессирующие векторы, многие типы которых известны в данной области. Методы получения таких экспрессирующих векторов хорошо известны (см., например, публикацию Sambrook et al., Molecular Cloning. A Laboratory Manual, 2d edition, Cold Spring Harbor Laboratory, New York (1989)). В одном варианте осуществления изобретения вектор является вирусным вектором. Вирусные векторы включают, не ограничиваясь ими, ретровирусные и аденовирусные векторы.

Приемлемыми клетками-хозяевами или линиями клеток для трансфекции указанным методом являются бактериальные клетки. Например, в области биотехнологии в качестве клеток-хозяев хорошо известны разные штаммы E. coli. При осуществлении указанного метода также могут быть использованы разные штаммы B. subtilis, Pseudomonas, Streptomyces, других бактерий и тому подобные. Многие штаммы дрожжевых клеток, известные специалистам в данной области, также могут быть использованы в качестве клеток-хозяев для экспрессии пептидов по настоящему изобретению. В качестве экспрессирующих систем также могут быть использованы другие клетки грибов или насекомых, такие как Spodoptera frugipedera (Sf9). Альтернативно могут быть использованы клетки млекопитающих, такие как клетки 293 человека, клетки яичника китайского хомячка (СНО), линия клеток COS-1 обезьян или мышиные клетки 3Т3, выделенные у мышей BALB/c или NIH в Швейцарии. В данной области известны другие приемлемые клетки-хозяева, а также методы трансфекции, культивирования, амплификации, скрининга, продуцирования и очистки.

В одном варианте осуществления разных объектов настоящего изобретения может быть использована линия клеток гибридомы, экспрессирующая требуемые моноклональные антитела, получаемые хорошо известными стандартными методами. В контексте настоящего изобретения клетка гибридомы способна продуцировать антитело, специфически связывающееся с α2-интегрином, в частности, с α2β1-интегрином. Клетка гибридомы может быть получена путем слияния нормально активированной, антителопродуцирующей В-клетки с миеломной клеткой. Клетка гибридомы, в частности, может быть получена следующим образом: В-клетки удаляют из селезенки животного, стимулированного соответствующим антигеном. Полученные В-клетки затем сливают с миеломными опухолевыми клетками, способными бесконечно расти в культуре. Слияние выполняют, делая клеточные мембраны более проницаемыми. Гибридные клетки (именуемые гибридомами), являющиеся раковыми клетками, быстро и бесконечно размножаются и продуцируют большое количество требуемых антител. Необходимые клетки могут быть отобраны и затем клонированы путем ограничивающего разведения. На данной стадии обычно используют дополнительные среды, содержащие интерлейкин-6 (такие как бриклон). Отбор производят, культивируя только что слитые первичные клетки гибридомы в элективных средах, в частности, в средах, содержащих 1-кратную концентрацию НАТ в течение примерно 10-14 дней. После использования НАТ часто желательно использовать НТ-содержащие среды. Клонирование происходит после идентификации положительных первичных клеток гибридомы.

Пептид или пептидный комплекс по настоящему изобретению может быть продуцирован путем экспрессии нуклеиновой кислоты по настоящему изобретению в приемлемой клетке-хозяине. Таким образом, еще одним объектом настоящего изобретения является способ продуцирования пептида или пептидного комплекса по настоящему изобретению, который включает культивирование клетки-хозяина, содержащей одну или несколько нуклеиновых кислот по настоящему изобретению, в условиях, обеспечивающих экспрессию антитела и необязательно выделение пептида или пептидного комплекса из указанной клетки-хозяина.

Клетки-хозяева могут быть трансфицированы стандартными методами, такими как электропорация с использованием по меньшей мере одного экспрессирующего вектора, содержащего нуклеиновую кислоту по настоящему изобретению, под контролем последовательности, регулирующей транскрипцию. Трансфицированную или трансформированную клетку-хозяина затем культивируют в условиях, обеспечивающих экспрессию белка. Экспрессированный белок выделяют, отделяют и необязательно очищают от клетки (или от культуральной среды в случае внеклеточной экспрессии) соответствующими способами, известными специалисту в данной области. Например, белки выделяют в растворимой форме после лизиса клеток или экстрагируют известными методами, например, в хлориде гуанидина. Полипептид по настоящему изобретению при желании получают в виде слитого белка. Такие слитые белки являются вышеописанными белками. Альтернативно может быть желательно, получить слитые белки с целью усиления экспрессии белка в выбранной клетке-хозяине или для улучшения очистки. Молекулы, включающие полипептиды по настоящему изобретению, могут быть далее очищены целым рядом стандартных методов, которые включают, не ограничиваясь ими, жидкостную хроматографию, в частности, обычную или с обращенной фазой, ВЭЖХ, жидкостную хроматографию быстрого разрешения (FPLC) и тому подобные; аффинную хроматографию (с использованием неорганических лигандов или моноклональных антител); вытеснительную хроматографию; хроматографию на иммобилизованном хелате металла; гель-хроматографию и тому подобные. Специалист в данной области может выбрать наиболее подходящие методы выделения и очистки, не выходя за пределы объема настоящего изобретения. В результате такой очистки получают антиген, по существу не содержащий белковых и небелковых веществ микроорганизма.

Приемлемыми клетками-хозяевами являются, например, эукариотические клетки или линии клеток, выделенные из многоклеточных организмов (таких как указанные выше, например, клетки СНО или клетки ВНК), эукариотические одноклеточные организмы, такие как дрожжи (например, Pombe или S. cerevisiae) или прокариотические клетки, такие как E. coli. В данной области известен целый ряд приемлемых клеток-хозяев.

Один вариант осуществления разных объектов настоящего изобретения относится к рекомбинантной клетке, гетерологично продуцирующей пептид или пептидный комплекс. Гетерологичная экспрессия пептида или белка (в настоящем описании изобретения пептида или пептидного комплекса) означает, что рекомбинантная клетка получена из клетки, не экспрессирующей в естественных условиях указанный пептид, белок или пептидный комплекс, которая была модифицирована (например, трансфицирована или трансформирована) для экспрессии пептида, белка или пептидного комплекса, например, путем введения нуклеиновой кислоты (такой как искусственная конструкция нуклеиновой кислоты (вектор), содержащая вставку, кодирующую пептид или пептидный комплекс), обеспечивающей экспрессию данной клеткой указанного пептида или пептидного комплекса, такого как антитело или его фрагмент. Рекомбинантная клетка может быть получена из любой вышеописанной клетки, линии клеток или клеток-хозяев, включающих эукариотические и прокариотические клетки.

Таким образом, шестым объектом настоящего изобретения является клетка, гетерологично экспрессирующая одну из нуклеиновых кислот по настоящему изобретению.

Седьмым объектом настоящего изобретения является способ продуцирования пептида или пептидного комплекса по настоящему изобретению, который включает культивирование клетки по настоящему изобретению в условиях, обеспечивающих экспрессию пептида или пептидного комплекса и необязательно выделение пептида или пептидного комплекса из клетки-хозяина.

Восьмым объектом настоящего изобретения является композиция, включающая по меньшей мере один пептид, пептидный комплекс или конъюгат, содержащий пептид или пептидный комплекс по настоящему изобретению, и/или по меньшей мере одну нуклеиновую кислоту по настоящему изобретению, которая предназначена для использования в качестве лекарственного средства.

(Фармацевтическая) композиция пол настоящему изобретению далее может включать фармацевтически приемлемые носители и/или наполнители. Фармацевтически приемлемые носители и/или наполнители, используемые в настоящем изобретении, являются стандартными и могут включать буферы, стабилизаторы, разбавители, консерванты и солюбилизаторы. В публикации Remington's Pharmaceutical Sciences, by E.W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975) описаны композиции и препараты, пригодные для фармацевтической доставки полипептидов/нуклеиновых кислот по настоящему изобретению. Содержание активного ингредиента (полипептида или нуклеиновой кислоты) в фармацевтической композиции не ограничено, если такой компонент является полезным для лечения или профилактики, но его количество предпочтительно составляет 0,0000001-10 мас.% от массы общей композиции.

Как правило, характер носителя или наполнителя зависит от конкретного способа введения. Например, препараты для парентерального введения в качестве наполнителя обычно содержат инъецируемые жидкости, включающие фармацевтически и физиологически приемлемые жидкости, такие как вода, физиологический раствор, сбалансированные солевые растворы, водный раствор декстрозы, глицерин или тому подобные. Стандартные нетоксичные твердые носители, предназначенные для твердых композиций (таких как, например, порошок, пилюли, таблетки или капсулы), могут включать, например, фармацевтические сорта маннита, лактозы, крахмала или стеарата магния. Помимо биологически нейтральных носителей, фармацевтические композиции могут содержать незначительные количества нетоксичных вспомогательных веществ, таких как смачивающие вещества или эмульгирующие агенты, консерванты, буферы, регулирующие значение рН, и тому подобные, например, ацетат натрия или монолаурат сорбита.

Носитель обычно содержит соответствующее количество фармацевтически приемлемой соли, делающей препарат изотоническим. Примеры носителей включают, не ограничиваясь ими, физиологический раствор, раствор Рингера и раствор декстрозы. Приемлемые наполнители, носители или стабилизаторы предпочтительно не являются токсичными в используемых дозах и концентрациях, включая буферы, такие как цитрат, фосфат и другие органические кислоты; солеобразующие противоионы, например, натрий и калий; низкомолекулярные (>10 аминокислотных остатков) полипептиды; белки, например, сывороточный альбумин или желатин; гидрофильные полимеры, например, поливинилпирролидон; аминокислоты, такие как гистидин, глутамин, лизин, аспарагин, аргинин или глицин; углеводы, включающие глюкозу, маннозу или декстрины; моносахариды; дисахариды; другие сахара, такие как сахароза, маннит, трегалоза или сорбит; хелатообразователи, например, EDTA; неионогенные поверхностно-активные вещества, например, твин, плюроник и полиэтиленликоль; антиоксиданты, включающие метионин, аскорбиновую кислоту и токоферол; и/или консерванты, например, хлорид октадецилдиметилбензиламмония; хлорид гексаметония; хлорид бензалкония; хлорид бензетония; феноловый, бутиловый или бензиловый спирт; алкилпарабены, например, метилпарабен или пропилпарабен; катехин; резорцин; циклогексанол; 3-пентанол и м-крезол.

Фармацевтическая композиция включает по меньшей мере один пептид, пептидный комплекс или нуклеиновую кислоту по настоящему изобретению; однако указанная композиция может также включать коктейль (то есть простую смесь), содержащий один или несколько разных пептидов, пептидных комплексов и/или нуклеиновых кислот по настоящему изобретению. Пептиды или пептидные комплексы по настоящему изобретению могут быть также использованы в форме фармацевтически приемлемой соли. Приемлемые соли и основания, способные образовывать соли с пептидами по настоящему изобретению, хорошо известны специалистам в данной области и включают неорганические и органические кислоты и основания.

Фармацевтическая композиция предпочтительно может быть использована для лечения или профилактики заболевания или нарушения, ассоциированного с α2-интегрином. В контексте настоящего изобретения заболевание или нарушение, ассоциированное с α2-интегрином, является любым нежелательным состоянием организма, которое обусловлено или вызвано одной или несколькими функциями или активностями α2-интегрина. В качестве примеров можно привести сигнальные пути или процессы, включающие опосредованные α2-интегрином аберрантные клеточные реакции, такие как опосредованную коллагеном повышенную или аберрантную пролиферацию клеток или секрецию цитокинов, в результате чего происходит развитие кровеносных сосудов, возникают воспалительные состояния или нарушается заживление ран. Конкретные примеры включают (не ограничиваясь ими): тромбоз, сосудистое заболевание, рак, включающий новообразование кровеносных сосудов и метастазирование, рак поджелудочной железы, рак ободочной кишки, например, метастазирующее распространение рака ободочной кишки в другие органы (например, в легкое и печень) и меланому, воспаление, воспалительное заболевание, аутоиммунное заболевание и заболевание, характеризующееся нарушенным или повышенным развитием кровеносных сосудов, воспалительное заболевание кишечника, болезнь Крона, неспецифический язвенный колит, реакции на трансплантат, ретробульбарный неврит, травму спинного мозга, ревматоидный артрит, системную красную волчанку (SLE), рассеянный склероз, синдром Рейнауда, синдром Шегрена, склеродермию, сердечно-сосудистое заболевание, псориаз, атеросклероз и инфекции, вызывающие воспалительную реакцию.

В одном варианте осуществления настоящего изобретения фармацевтическая композиция может быть использована для лечения или профилактики сосудистого заболевания и/или тромбоза, в частности, при лечении определенных клинических показаний, например, острого коронарного синдрома, окклюзии коронарной артерии, ишемического инсульта, стеноза сонной артерии или окклюзии периферических артерий.

В контексте настоящего изобретения лечению или профилактике может быть подвергнуто любое животное (отличное от человека или человек, в частности, млекопитающие, такие как человек, сельскохозяйственные животные или домашние животные), нуждающееся в таком лечении (то есть с целью ослабления или устранения болезненного состояния или нарушения или с целью предотвращения или замедления возникновения болезненного состояния или нарушения у субъектов, у которых еще не обнаружены признаки болезненного состояния или нарушения).

α2β1-Интегрин является интересной мишенью при лечении или профилактике тромбоза. Результаты исследований, выполненных in vivo с использованием мышей, у которых был удален ген α2β1, свидетельствуют о пониженном образовании тромбов и более продолжительном времени до окклюзии сосудов в модели тромбоза артерий, а также о более продолжительном времени кровотечения из хвоста. В клинических исследованиях недостаточности и полиморфизма α2-интегрина у субъектов были обнаружены умеренные или тяжелые нарушения кровотечения и неправильная реакция тромбоцитов на коллаген. Полиморфизм вызывает повышенную экспрессию α2β1, сопровождающуюся независимым фактором риска возникновения не смертельного инфаркта миокарда у субъектов старше 62 лет, повышенным риском инсульта у субъектов старше 50 лет и повышенным риском развития диабетической ретинопатии у субъектов, страдающих диабетом типа II. Кроме того, тромбоциты и α2-интегрин участвуют в развитии кровеносных сосудов, прогрессировании/метастазировании опухолей. Таким образом, рак является еще одной интересной терапевтической областью. Установлено, что ингибирование α2-интегрина препятствует инвазии опухоли стромы in vitro и адгезии коллагена типа I, опосредованной интегрином-ЕСМ/α2-интегрином, в частности, стимулирующей образование злокачественного фенотипа рака поджелудочной железы in vitro. In vivo моноклональные антитела против α2-интегрина препятствуют увеличению метастазов в печени, вызванному операцией в крысиной модели, ингибируют дифференцировку клеток колоректального рака у человека и подавляют рост и васкуляризацию ксенотрансплантатов плоскоклеточного рака человека.

Установлено, что в случае колоректального рака удаление первичной колоректальной карциномы может парадоксально увеличить риск развития метастазов, так как накопленные данные позволяют предположить, что хирургическая травма может стимулировать рост опухоли. Манипуляции первичной опухолью во время хирургической операции вызывают отделение опухолевых клеток, что выражается в сложных изменениях клеток. Кроме того, в результате операционной травмы обнажается субэндотелиальный слой ЕСМ, что облегчает сцепление опухолевых клеток, стимулируемое широко экспрессированными интегринами. В животной модели блокирование α2-интегрина на опухолевых клетках полностью устраняло вызванную операцией адгезию и полностью подавляло усиленный рост метастазов в печени после операции в брюшной полости.

Современная терапия в случае рака поджелудочной железы часто является недостаточной, так как продлевает жизнь только на 4 месяца. Адгезия коллагена типа I, опосредованная интегрином-ЕСМ и α2β1-интегрином, в частности, стимулирует злокачественный фенотип рака поджелудочной железы in vitro. Необходимо провести исследования на животных моделях с использованием ингибиторов α2β1-интегрина для оценки терапевтической эффективности таких ингибиторов при лечении рака поджелудочной железы.

На основании полученных данных можно предположить, что функциональное блокирование α2- и/или α2β1-интегрина может дать благоприятный терапевтический эффект, в частности, при лечении колоректального рака и рака поджелудочной железы.

Девятым объектом настоящего изобретения является способ диагностики заболевания, ассоциированного с измененной экспрессией α2-интегрина, который включает:

а) контактирование полученного у субъекта образца, включающего α2-интегрин, с пептидом или пептидным комплексом по настоящему изобретению;

b) обнаружение связывания α2-интегрина с пептидом или пептидным комплексом, и

с) сравнение связывания, обнаруженного на стадии b), с эталонным образцом,

при этом измененное связывание α2-интегрина в образце по сравнению со связыванием в эталонном образце, указывает на наличие заболевания. Измененное связывание может быть идентифицировано, например, по измененному сигналу (то есть по усиленному или ослабленному сигналу), обнаруженному на стадии b), по сравнению с эталонным образцом.

Пептид (комплекс) по настоящему изобретению может быть также использован при выполнении диагностических анализов. Как было подробно описано выше, измененная экспрессия α2-интегрина и/или его мутации могут быть ассоциированы с определенными заболеваниями. Поэтому пептид (комплекс) может быть использован для определения связывания с α2-интегрином. Изменение связывания (в количественном или качественном отношении) по сравнению с контрольным или эталонным образцом может указывать на наличие заболевания.

Таким образом, еще одним объектом настоящего изобретения является способ диагностики заболевания, ассоциированного с измененным α2-интегрином, который включает:

а) контактирование полученного у субъекта образца с пептидом или пептидным комплексом по настоящему изобретению;

b) обнаружение связывания α2-интегрина с пептидом или пептидным комплексом, и

с) сравнение связывания, обнаруженного на стадии b), со связыванием α2-интегрина с пептидом или пептидным комплексом в одном или нескольких эталонных образцах,

при этом измененное связывание в полученном образце по сравнению со связыванием, обнаруженным в одном или нескольких эталонных образцах, указывает на наличие заболевания.

Полученный у субъекта исследуемый образец может быть введен в соприкосновение с пептидом (комплексом) по настоящему изобретению, который специфически связывается с α2-интегрином. Пептид (комплекс) может быть необязательно фиксирован на твердом носителе до контактирования антитела с исследуемым образцом для облегчения промывки и последующего выделения комплекса. Примеры твердых носителей включают стекло или пластик, например, в виде титрационного микропланшета, предметного стекла, покровного стекла, палочки, гранулы или микрогранулы.

Образец инкубируют с антителами, затем смесь промывают и обнаруживают образовавшиеся комплексы пептида (пептидного комплекса) с α2-интегрином. Указанные комплексы могут быть обнаружены путем инкубации промытой смеси с детектирующим реагентом. Указанный детектирующий реагент может быть детектируемой меткой. Специалистам в данной области известны разные метки и методы обнаружения. В качестве детектируемой метки может быть использована любая детектируемая метка, известная в данной области. Например, детектируемой меткой может быть радиоактивная метка (такая как, например, 3Н, 125I, 35S, 14C, 32P и 33Р), ферментативная метка (такая как, например, пероксидаза из хрена, щелочная фосфатаза, глюкоза-6-фосфат-дегидрогеназа и тому подобные), хемилюминесцентная метка (такая как, например, сложные эфиры акридиния, сложные тиоэфиры акридиния, сульфонамиды акридиния, сложные эфиры фенантридиния, люминал, изолюминол и тому подобные), флуоресцентная метка (такая как, например, флуоресцеин (например, 5-флуоресцеин, 6-карбоксифлуоресцеин, 3'6-карбоксифлуоресцеин, 5(6)-карбоксифлуоресцеин, 6-гексахлорфлуоресцеин, 6-тетрахлорфлуоресцеин, изотиоцианат флуоресцеина и тому подобные), родамин, фикобилипротеины, R-фикоэритрин, квантовые точки (например, селенид кадмия, кэппированный сульфидом цинка), термометрическая метка, (вышеуказанный) маркер или метка иммунополимеразной цепной реакции.

При выполнении анализов после исследования каждой комбинации реагентов могут потребоваться стадии инкубации и/или промывки. Стадии инкубации могут продолжаться от около 5 секунд до нескольких часов, предпочтительно от около 5 минут до около 24 часов. Однако время инкубации зависит от выполняемого анализа, используемого биомаркера (антигена), объема раствора, концентраций и подобных факторов. Анализы обычно выполняют при комнатной температуре, хотя такие анализы могут быть выполнены в диапазоне температур от 10°С до 40°С.

Для удобства выполнения анализа пептид (комплекс) может находиться в наборе, включающем упакованную комбинацию реагентов в заранее определенных количествах при наличии инструкций по выполнению диагностического анализа. При мечении пептида (комплекса) ферментом в комплект набора входят субстраты и кофакторы, требуемые данным ферментом (например, предшественник субстрата, предоставляющий детектируемый хромофор или флуорофор). В комплект набора могут входить другие дополнительные вещества, такие как стабилизаторы, буферы (например, блокирующий буфер или лизирующий буфер) и тому подобные. Относительные количества разных реагентов в наборе могут изменяться в широких пределах, например, с достижением концентраций реагентов в растворе, оптимизирующих чувствительность анализа. Реагенты могут быть предоставлены в виде сухих порошков, обычно лиофилизованных, включая наполнители, которые после растворения позволяют получить раствор реагента, имеющий соответствующую концентрацию.

Эталонный образец может быть образцом, полученным у здорового субъекта или определенным в группе здоровых субъектов. Альтернативно может быть использовано известное эталонное значение. Специалисту в данной области должны быть известны статистические методы оценки двух величин, отличающихся друг от друга на значимом уровне, такие как t-критерий Стьюдента или проверка на соответствие по критерию хи-квадрат. Кроме того, квалифицированному специалисту должны быть известны методы отбора приемлемого контрольного образца.

Термины “образец, полученный у субъекта” и “исследуемый образец” означают все биологические жидкости, экскреции и ткани, выделенные у любого данного субъекта, в частности, у человека. В контексте настоящего изобретения такие образцы включают, не ограничиваясь ими, кровь, сыворотку крови, плазму крови, выделения из соска, мочу, сперму, семенную жидкость, семенную плазму, жидкость предстательной железы, экскреции, слезы, слюну, пот, биопсийный материал, асцитную жидкость, цереброспинальную жидкость, молоко, лимфу, образцы бронхиального и другого лаважа или образцы экстрактов из ткани. Пробы крови обычно являются предпочтительными исследуемыми образцами, предназначенными для использования в контексте настоящего изобретения.

Десятым объектом настоящего изобретения является изделие, включающее:

а) упаковочный материал (например, одну или несколько емкостей для пептида или пептидного комплекса и этикетку или вкладыш в упаковку);

b) пептид или пептидный комплекс по настоящему изобретению или его фармацевтически приемлемую соль;

с) этикетку (например, содержащую письменную информацию, штрих-код и/или информацию любого другого типа) или вкладыш (то есть носитель данных любого типа, такой как чип, листовка, буклет и т.д.), находящийся внутри упаковочного материала, с информацией о том, что указанный пептид или пептидный комплекс позволяет эффективно лечить заболевание или нарушение, в частности, заболевание или нарушение, связанное с α2-интегрином.

Одиннадцатым объектом настоящего изобретения является диагностический набор, предназначенный для диагностики нарушения или заболевания, связанного с α2-интегрином, который включает пептид или пептидный комплекс по настоящему изобретению, приемлемую упаковку и, возможно, соответствующие инструкции по использованию указанного пептида или пептидного комплекса для обнаружения α2-интегрина.

Диагностический набор в соответствии с девятым объектом настоящего изобретения является изделием, включающим по меньшей мере компоненты, указанные в девятом объекте, и необязательно один или несколько других компонентов (например, буферы и другие реагенты, необходимые для обнаружения альфа2-интегрина в образце, или другие средства обнаружения альфа2-интегрина или других маркеров данного заболевания, отрицательные/положительные стандарты, одно или несколько вторичных антител (меченых соответствующим образом) для обнаружения, визуализации и/или количественного определения комплекса α2-интегрина с (пептидом/пептидным комплексом), находящиеся в одной или нескольких приемлемых емкостях), которые предпочтительно пространственно объединены в наборе и предназначены для использования в процессе диагностики нарушения или заболевания, связанного с α2-интегрином.

В соответствии с одним вариантом осуществления девятого объекта настоящего изобретения набор далее включает носитель данных с инструкциями по выполнению способа в соответствии с седьмым или одиннадцатым объектом настоящего изобретения и любого из его вариантов.

Двенадцатым объектом настоящего изобретения является способ лечения или диагностики нарушения или заболевания, связанного с α2-интегрином, который включает использование одного или нескольких пептидов или пептидных комплексов по настоящему изобретению и/или одной или нескольких нуклеиновых кислот.

Таким образом, данный объект настоящего изобретения относится к способу диагностики заболевания, ассоциированного с измененным α2-интегрином, который включает:

а) контактирование полученного у субъекта образца с пептидом или пептидным комплексом по настоящему изобретению;

b) обнаружение и/или количественное определение связывания α2-интегрина с пептидом или пептидным комплексом, и

с) сравнение связывания, обнаруженного на стадии b), со связыванием α2-интегрина с пептидом или пептидным комплексом в одном или нескольких эталонных образцах,

при этом измененное связывание в полученном образце по сравнению со связыванием, обнаруженным в одном или нескольких эталонных образцах, указывает на наличие заболевания. Связывание можно обнаружить или количественно определить на основании сродства связывания (например, значения KD, скорости диссоциации (Koff), скорости ассоциации (Kon)) при помощи известных методов или путем измерения (интенсивности) сигнала комплекса пептида/пептидного комплекса с α2-интегрином, вызываемого, например, меченым антителом против пептида/пептидного комплекса по сравнению с сигналом эталонного образца.

Термин “эталон”, особенно в выражениях “эталонный субъект”, “эталонный образец” или “эталонное значение”, в контексте настоящего изобретения означает сравнительный образец или стандарт, который является характерным или репрезентативным для определенного состояния (здоровья), заболевания и т.д. Таким образом, эталонное значение является стандартным значением для определенного параметра (например, уровня экспрессии определенного индикатора/биомаркера), типичного для определенного состояния (например, состояния болезни или здоровья), эталонный субъект является субъектом, выбранным для сравнения и характеризующимся определенным состоянием здоровья или болезни, эталонный образец может быть образцом, полученным у эталонного субъекта, или искусственным образцом с характерным уровнем определенного индикатора или биомаркера, типичным для состояния болезни или здоровья.

Термин “эталонный образец” в использованном здесь значении означает образец, подвергаемый такому же анализу, что и исследуемый образец, при этом данные, полученные для эталонного образца, сравнивают с результатами анализа исследуемого образца. Таким образом, эталонный образец является стандартом, позволяющим оценить информацию, полученную при анализе исследуемого образца.

Эталонный образец может быть выделен из здоровой или нормальной ткани, органа или у субъекта и является стандартом здорового состояния ткани, органа или субъекта. Различия между состоянием нормального эталонного образца и состоянием исследуемого образца могут свидетельствовать о вероятности возникновения заболевания, наличия или дальнейшего прогрессирования такого заболевания или нарушения.

Эталонный образец может быть выделен из аномальной или больной ткани, органа или у субъекта, являясь, таким образом, стандартом больного состояния ткани, органа или субъекта. Различия между состоянием аномального эталонного образца и состоянием исследуемого образца может свидетельствовать о пониженном риске возникновения заболевания, отсутствии или улучшении такого заболевания или нарушения.

Эталонный образец также может быть выделен из той же ткани, органа или у субъекта, что и исследуемый образец, но в более ранний период времени. Различия между состоянием ранее полученного эталонного образца и состоянием исследуемого образца могут свидетельствовать о развитии заболевания, то есть об улучшении или ухудшении заболевания с течением времени. Эталонный образец может быть получен в более ранний или более поздний период времени в случае прохождения определенного периода времени между получением эталонного образца и исследуемого образца. Такой период времени может составлять несколько лет (например, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 лет), месяцев (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 месяцев), недель (например, 1, 2, 3, 4, 5, 6, 7, 8 недель), дней (например, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 дней), часов (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 часов), минут (например, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60 минут) или секунд (например, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60 секунд).

Эталонный образец, типичный для определенного состояния или стадии заболевания, может быть получен у контрольного субъекта, который, как известно, страдает диагностируемым нарушением или заболеванием, то есть нарушением или заболеванием, связанным с альфа2-интегрином, в частности, нарушением или заболеванием, указанным в настоящем описании изобретения. Контрольный субъект может быть млекопитающим, таким как человек, грызун (например, крыса, хомячок или мышь) или обезьяна, или может быть животным, отличным от млекопитающего, например, птицей.

Исследуемый образец и эталонный образец предпочтительно получают у субъектов одного вида (например, у человека), более предпочтительно одного пола (например, у женщины или мужчины) и/или одного возраста (например, у новорожденного, маленького ребенка, подростка, взрослого или пожилого человека).

Эталон или эталонный образец, используемый в разных объектах и вариантах осуществления настоящего изобретения, предпочтительно получают у здорового субъекта, больного субъекта или у того же субъекта, у которого получают исследуемый образец. Если эталон (например, эталонное значение) или эталонный образец получают у того же субъекта, что и исследуемый образец, то эталон (например, эталонное значение) или эталонный образец предпочтительно получают в более ранний или более поздний период времени по сравнению с исследуемым образцом. Период времени между получением эталона (например, эталонного значения) или эталонного образца и получением исследуемого образца или значения может составлять несколько лет (например, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 лет), месяцев (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 месяцев), недель (например, 1, 2, 3, 4, 5, 6, 7, 8 недель), дней (например, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 дней), часов (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 часов), минут (например, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60 минут) или секунд (например, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60 секунд). Альтернативно или дополнительно, в эталонном образце уровень альфа2-интегрина является типичным для здорового субъекта, типичным для наличия или отсутствия нарушения или заболевания, связанного с альфа2-интегрином, или типичным для повышенного или пониженного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином.

В вариантах осуществления изобретения, в которых эталон или эталонный образец получен у здорового субъекта, у субъекта с пониженным риском возникновения нарушения или заболевания, связанного с альфа2-интегрином, или с уровнем альфа2-интегрина, характерным для отсутствия нарушения или заболевания, связанного с альфа2-интегрином, повышенный уровень альфа2-интегрина в исследуемом образце по сравнению с указанным эталонным значением или эталонным образцом является показателем (а) наличия нарушения или заболевания, связанного с альфа2-интегрином, (b) повышенного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, и/или (с) прогрессирования нарушения или заболевания, связанного с альфа2-интегрином, у данного субъекта. В вариантах осуществления изобретения, в которых эталон получен у больного субъекта или у субъекта с повышенным риском возникновения нарушения или заболевания, связанного с альфа2-интегрном, и с уровнем альфа2-интегрина, характерным для наличия нарушения или заболевания, связанного с альфа2-интегрином, такой же уровень альфа2-интегрина является показателем (а) наличия нарушения или заболевания, связанного с альфа2-интегрином, (b) повышенного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, и/или (с) прогрессирования нарушения или заболевания, связанного с альфа2-интегрином, у данного субъекта.

В вариантах осуществления изобретения, в которых эталонное значение или эталонный образец получен у того же субъекта, что и исследуемый образец, но в более ранний период времени, повышенный уровень альфа2-интегрина у исследуемого субъекта/в исследуемом образце является показателем (а) наличия нарушения или заболевания, связанного с альфа2-интегрином, (b) повышенного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, и/или (с) прогрессирования нарушения или заболевания, связанного с альфа2-интегрином, у данного субъекта. В вариантах осуществления изобретения, в которых эталонное значение или эталонный образец получен у того же субъекта, что и исследуемый образец, но в более ранний период времени, пониженный уровень альфа2-интегрина в исследуемом образце является показателем (а) изменения нарушения или заболевания, связанного с альфа2-интегрином, улучшения или отсутствия нарушения или заболевания, связанного с альфа2-интегрином, (b) пониженного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, и/или (c) более медленного прогрессирования нарушения или заболевания, связанного с альфа2-интегрином.

В вариантах осуществления изобретения, в которых эталонное значение или эталонный образец получен у того же субъекта, что и исследуемый образец, но в более ранний период времени, одинаковый уровень альфа2-интегрина в исследуемом образце является показателем (а) такого же риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, (b) остановки прогрессирования нарушения или заболевания, связанного с альфа2-интегрином, и/или (с) персистенции нарушения или заболевания, связанного с альфа2-интегрином, у данного субъекта.

В вариантах осуществления изобретения, в которых эталонное значение или эталонный образец получен у здорового субъекта или у субъекта с пониженным риском возникновения нарушения или заболевания, связанного с альфа2-интегрином, или уровень альфа2-интегрина в эталонном образце является характерным для здорового субъекта, для отсутствия заболевания или пониженного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, повышенный уровень альфа2-интегрина является показателем (а) наличия нарушения или заболевания, связанного с альфа2-интегрином, (b) повышенного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, и/или (с) прогрессирования нарушения или заболевания, связанного с альфа2-интегрином, у данного субъекта.

В вариантах осуществления изобретения, в которых эталонное значение или эталонный образец получен у больного субъекта или у субъекта с повышенным риском возникновения нарушения или заболевания, связанного с альфа2-интегрином, или уровень альфа2-интегрина в эталонном образце является характерным для больного субъекта, для наличия заболевания или повышенного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, такой же уровень альфа2-интегрина является показателем (а) наличия нарушения или заболевания, связанного с альфа2-интегрином, (b) повышенного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, и/или (с) прогрессирования нарушения или заболевания, связанного с альфа2-интегрином, у данного субъекта.

В вариантах осуществления изобретения, в которых эталонное значение или эталонный образец получен у того же субъекта, что и исследуемый образец, но в более ранний период времени, повышенный уровень альфа2-интегрина в исследуемом образце является показателем (а) наличия нарушения или заболевания, связанного с альфа2-интегрином, (b) повышенного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, и/или (с) прогрессирования нарушения или заболевания, связанного с альфа2-интегрином, у данного субъекта.

В вариантах осуществления изобретения, в которых эталонное значение или эталонный образец получен у того же субъекта, что и исследуемый образец, но в более ранний период времени, пониженный уровень альфа2-интегрина в исследуемом образце является показателем (а) изменения нарушения или заболевания, связанного с альфа2-интегрином, улучшения или отсутствия нарушения или заболевания, связанного с альфа2-интегрином, (b) пониженного риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, и/или (c) более медленного прогрессирования нарушения или заболевания, связанного с альфа2-интегрином. В вариантах осуществления изобретения, в которых эталонный образец получен у того же субъекта, что и исследуемый образец, но в более ранний период времени, одинаковый уровень альфа2-интегрина в исследуемом образце является показателем (а) такого же риска возникновения нарушения или заболевания, связанного с альфа2-интегрином, (b) остановки прогрессирования нарушения или заболевания, связанного с альфа2-интегрином, и/или (с) персистенции нарушения или заболевания, связанного с альфа2-интегрином, у данного субъекта.

В соответствии с предпочтительными вариантами осуществления разных объектов настоящего изобретения пептид или пептидный комплекс включает или состоит из выделенного моноклонального антитела или его антигенсвязывающего фрагмента. Ниже указаны некоторые предпочтительные варианты осуществления изобретения, относящиеся к выделенному моноклональному антителу или его антигенсвязывающему фрагменту:

1. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент, которые специфически связываются с I-доменом α2-интегрина человека, при этом указанное антитело или фрагмент включает домен вариабельной области тяжелой цепи (VH) и домен вариабельной области легкой цепи (VL) и обладает перекрестной реактивностью с α2-интегрином примата кроме человека и не обладает перекрестной реактивностью с α2-интегрином вида, отличного от примата.

2. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент, которые специфически связываются с I-доменом α2-интегрина человека, при этом указанное антитело или фрагмент включает домен вариабельной области тяжелой цепи (VH) и домен вариабельной области легкой цепи (VL) и конкурирует с эталонным антителом за связывание с эпитопом эталонного антитела, включающего легкую цепь, кодированную плазмидой, депонированной в DSMZ под номером доступа DSM 23944, и тяжелую цепь, кодированную (i) плазмидой, депонированной в DSMZ под номером доступа DSM 23946, или (ii) плазмидой, депонированной в DSMZ под номером доступа DSM 23945.

3. Антитело или его антигенсвязывающий фрагмент по варианту осуществления изобретения 1 или 2, которые специфически связываются с I-доменом α2-интегрина человека со сродством связывания в нМ диапазоне.

4. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, которые ингибируют взаимодействие α2-интегрина человека с коллагеном in vitro, подавляя, таким образом, активацию тромбоцитов вследствие адгезии указанных тромбоцитов с указанным коллагеном.

5. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором указанный домен вариабельной области тяжелой цепи включает HCDR3 тяжелой цепи SEQ ID NO:5.

6. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором указанный домен вариабельной области тяжелой цепи включает CDR-области тяжелой цепи SEQ ID NO:3 (HCDR1), SEQ ID NO:4 (HCDR2) и SEQ ID NO:5 (HCDR3) или их функционально активные варианты.

7. Антитело или его антигенсвязывающий фрагмент по варианту осуществления изобретения 6, в котором функционально активный вариант HCDR2 включает мутацию Asp→Glu в положении аминокислоты 6.

8. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором указанный домен вариабельной области легкой цепи включает LCDR3 легкой цепи SEQ ID NO:8.

9. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором указанный домен вариабельной области легкой цепи включает CDR-области легкой цепи SEQ ID NO:6 (LCDR1), SEQ ID NO:7 (LCDR2) и SEQ ID NO:8 (LCDR3) или их функционально активные варианты.

10. Антитело или его антигенсвязывающий фрагмент по варианту осуществления изобретения 9, в котором функционально активный вариант LCDR1 включает мутацию Asn→Gln в положении аминокислоты 11.

11. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором последовательность указанного домена вариабельной области тяжелой цепи (VH) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VH SEQ ID NO:2.

12. Антитело или его антигенсвязывающий фрагмент по варианту осуществления изобретения 11, в котором указанный домен вариабельной области тяжелой цепи (VH) включает последовательность SEQ ID NO:2 или ее функционально активный вариант.

13. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором последовательность указанного домена вариабельной области легкой цепи (VL) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VL SEQ ID NO:1.

14. Антитело или его антигенсвязывающий фрагмент по варианту осуществления изобретения 13, в котором указанный домен вариабельной области легкой цепи (VL) включает последовательность SEQ ID NO:1 или ее функционально активный вариант.

15. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором указанный домен вариабельной области тяжелой цепи (VH) включает одну или несколько замен аминокислот в положениях, выбираемых из группы, состоящей из Н5, Н7, Н11, Н12, Н17, Н20, Н38, Н40, Н43, Н55, Н61, Н65, Н66, Н67, Н76, Н81, Н82, Н87, Н91, Н93, Н112, Н113 и Н116.

16. Антитело или его антигенсвязывающий фрагмент по варианту осуществления изобретения 15, в котором одну или несколько замен аминокислот выбирают из группы, состоящей из 5His→Val, 7Pro→Ser, 11Leu→Val, 12Val→Lys, 17Pro→Ser, 20Leu→Val, 38Lys→Arg, 40Arg→Ala, 43Arg→Gln, 55Asp→Glu, 61Asn→Ala, 65Lys→Gln, 66Asp→Gly, 67Lys→Arg, 76Ser→Thr, 81Ile→Met, 82Gln→Glu, 87Thr→Arg, 91Ser→Thr, 93Val→Lys, 112Thr→Leu, 113Leu→Val и 116Ser→Val.

17. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором указанный домен вариабельной области легкой цепи (VL) включает одну или несколько замен аминокислот в положениях, выбираемых из группы, состоящей из L9, L12, L15, L22, L34, L46, L47, L80, L83, L85, L87 и L89.

18. Антитело или его антигенсвязывающий фрагмент по варианту осуществления изобретения 17, в котором одну или несколько замен аминокислот выбирают из группы, состоящей из 9Ala→Ser, 12Ala→Ser, 15Leu→Val, 15Leu→Pro, 22Ser→Thr, 34Asn→Gln, 46Gln→Lys, 47Ala→Pro, 80Asp→Asn, 83Glu→Gln, 85Asp→Glu, 87Ala→Thr и 89Thr→Asn.

19. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором последовательность указанного домена вариабельной области тяжелой цепи (VH) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VH, выбираемой из группы, состоящей из SEQ ID NO:38 (НС1), SEQ ID NO:39 (НС2), SEQ ID NO:40 (НС3), SEQ ID NO:41 (НС4), SEQ ID NO:42 (НС5), SEQ ID NO:43 (НС6) и SEQ ID NO:44 (НС7).

20. Антитело или его антигенсвязывающий фрагмент по варианту осуществления изобретения 19, в котором указанный домен вариабельной области тяжелой цепи (VH) включает последовательность VH, выбираемую из группы, состоящей из SEQ ID NO:38 (НС1), SEQ ID NO:39 (НС2), SEQ ID NO:40 (НС3), SEQ ID NO:41 (НС4), SEQ ID NO:42 (НС5), SEQ ID NO:43 (НС6) и SEQ ID NO:44 (НС7).

21. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором последовательность указанного домена вариабельной области легкой цепи (VL) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VL, выбираемой из группы, состоящей из SEQ ID NO:33 (LC1), SEQ ID NO:34 (LC2), SEQ ID NO:35 (LC3), SEQ ID NO:36 (LC4) и SEQ ID NO:37 (LC5).

22. Антитело или его антигенсвязывающий фрагмент по варианту осуществления изобретения 21, в котором указанный домен вариабельной области легкой цепи (VL) включает последовательность VL, выбираемую из группы, состоящей из SEQ ID NO:33 (LC1), SEQ ID NO:34 (LC2), SEQ ID NO:35 (LC3), SEQ ID NO:36 (LC4) и SEQ ID NO:37 (LC5).

23. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, которые являются химерным антителом или гуманизированным антителом.

24. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, в котором антигенсвязывающую часть выбирают из группы, состоящей из Fab, Fab', F(ab')2, Fv, Fv с дисульфидной связью, scFv и (scFv)2.

25. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, которые выбирают из группы, состоящей из мультиспецифического антитела, двуспецифического антитела, изотипически сходного антитела, антитела с двумя вариабельными доменами и биспецифического антитела.

26. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, которые включают константный домен тяжелой цепи иммуноглобулина, выбираемый из группы, состоящей из константного домена IgM человека, константного домена IgG1 человека, константного домена IgG2 человека, константного домена IgG3 человека, константного домена IgG4 человека, константного домена IgE человека и константного домена IgA человека.

27. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения, которые включают константный домен IgG4 человека.

28. Выделенная нуклеиновая кислота, кодирующая аминокислотную последовательность антитела или его антигенсвязывающий фрагмент по любому из предшествующих вариантов осуществления изобретения.

29. Рекомбинантный экспрессирующий вектор, включающий нуклеиновую кислоту по варианту осуществления изобретения 28.

30. Клетка-хозяин, включающая рекомбинантный экспрессирующий вектор по варианту осуществления изобретения 29.

31. Способ получения антитела или его антигенсвязывающего фрагмента по любому из вариантов осуществления изобретения 1-26, который включает культивирование клетки-хозяина по варианту осуществления изобретения 30 в условиях, обеспечивающих продуцирование антитела клеткой-хозяином.

32. Фармацевтическая композиция, включающая антитело или его антигенсвязывающий фрагмент по любому из вариантов осуществления изобретения 1-27 и один или несколько фармацевтически приемлемых носителей.

33. Способ лечения, профилактики или диагностики нарушения или заболевания, связанного с α2-интегрином, который включает введение нуждающемуся субъекту фармацевтической композиции по варианту осуществления изобретения 32.

34. Способ по варианту осуществления изобретения 33, в котором заболевание или нарушение, связанное с α2-интегрином, выбирают из группы, состоящей из тромбоза, сосудистого заболевания, рака, включающего развитие кровеносных сосудов и метастазирование, воспаления, воспалительного заболевания, аутоиммунного заболевания и заболевания, характеризующегося аномальным или повышенным развитием кровеносных сосудов, воспалительного заболевания кишечника, болезни Крона, неспецифического язвенного колита, реакций на трансплантат, ретробульбарного неврита, травмы спинного мозга, ревматоидного артрита, системной красной волчанки (SLE), рассеянного склероза, синдрома Рейнауда, экспериментального аутоиммунного энцефаломиелита, синдрома Шегрена, склеродермии, сердечно-сосудистого заболевания, псориаза и инфекций, вызывающих воспалительную реакцию.

35. Способ по варианту осуществления изобретения 33, в котором заболевание или нарушение, связанное с α2-интегрином, выбирают из группы, состоящей из острого коронарного синдрома, окклюзии коронарной артерии, ишемического инсульта, стеноза сонной артерии или окклюзии периферических артерий.

36. Способ диагностики заболевания, ассоциированного с измененным α2-интегрином, который включает:

а) контактирование образца, содержащего α2-интегрин, с антителом или антигенсвязывающим фрагментом по любому из вариантов осуществления изобретения 1-27;

b) обнаружение связывания α2-интегрина с антителом или антигенсвязывающим фрагментом; и

с) сравнение связывания, обнаруженного на стадии b), с эталонным образцом,

при этом измененное связывание α2-интегрина в образце по сравнению с эталонным образцом указывает на наличие заболевания.

37. Изделие, включающее:

а) упаковочный материал,

b) антитело или антигенсвязывающий фрагмент по любому из вариантов осуществления изобретения 1-27,

с) этикетку или вкладыш, находящийся внутри упаковочного материала, с информацией о том, что указанное антитело или антигенсвязывающий фрагмент позволяет эффективно лечить или диагностировать заболевание или нарушение, связанное с α2-интегрином.

Настоящее изобретение не ограничено конкретными методами, процедурами и реагентами, рассмотренными в настоящем описании изобретения, так как они могут меняться. Кроме того, терминология, использованная в настоящем описании изобретения, служит только для описания конкретных вариантов осуществления изобретения и не ограничивает объем изобретения. В значении, использованном в описании изобретения и прилагаемой формуле изобретения, формы единственного числа включают формы множественного числа за исключением тех случаев, когда из контекста изобретения ясно следует обратное. Аналогичным образом, слова “включают”, “содержат” и “охватывают” следует понимать как “включающие в себя”, а не “исключающие из себя”.

За исключением особо оговоренных случаев, все технические и научные термины и любые акронимы, использованные в настоящем описании изобретения, имеют значения, известные специалистам в области настоящего изобретения. Несмотря на то, что при осуществлении настоящего изобретения могут быть использованы любые методы и вещества, подобные или эквивалентные описанным в настоящем изобретении, предпочтительными методами и веществами являются методы и вещества, представленные в настоящем описании изобретения.

Настоящее изобретение далее проиллюстрировано приведенными ниже примерами, при этом следует отметить, что указанные примеры включены в настоящее описание изобретения только в целях иллюстрации и не ограничивают объем изобретения за исключением особо оговоренных случаев.

Краткое описание чертежей

На фигуре 1 А и В показано связывание моноклонального антитела против α2-интегрина, очищенного от супернатанта гибридомы, при выполнении анализа методом MesoScale с использованием клеток HUVEC.

На фигуре 2 показано воздействие моноклонального антитела против α2-интегрина, очищенного от супернатанта гибридомы, на развитие кровеносных сосудов в клетках HUVEC. Моноклональное антитело против α2-интегрина было способно ингибировать FGF2-индуцированное развитие кровеносных сосудов в зависимости от дозы.

На фигуре 3 показано ингибирование адгезии тромбоцитов с коллагеном в текучем состоянии Fab-фрагментом моноклонального антитела против α2-интегрина. Кровь человека, обработанную антикоагулянтом, инкубировали в течение 10 минут с красителем DiOC6(3) и производили серийное разведение Fab-фрагмента против α2-интегрина при 37°С. Затем кровь пропускали через покрытые коллагеном капилляры со скоростью сдвига 3000 с-1. Степень покрытия поверхности вычисляли на основании 10 изображений, являющихся репрезентативными примерами покрытой площади. Полученные значения представляют собой процентное значение ингибирования указанного покрытия поверхности под воздействием Fab-фрагмента против α2-интегрина в зависимости от дозы.

На фигуре 4 показаны результаты исследования перекрестной реактивности между видами при выполнении анализов методом FACS с использованием моноклонального антитела против α2-интегрина, выделенного из супернатанта гибридомы, и проб крови, полученных у макака (фиг. 4а и b) и человека (фиг. 4с и d). На фиг. 4а и 4с представлены отрицательные контрольные исследования, в которых было использовано только вторичное антитело без первичного антитела.

Фигура 5. На фигуре 5а) показана аминокислотная последовательность (SEQ ID NO:1) и кодирующая последовательность (SEQ ID NO:12) вариабельной области легкой цепи мышиного моноклонального антитела против α2-интегрина, продуцированного гибридомой. На фигуре 5b) показана аминокислотная последовательность (SEQ ID NO:2) и кодирующая последовательность (SEQ ID NO:13) вариабельной области тяжелой цепи мышиного моноклонального антитела против α2-интегрина. CDR-области в аминокислотных последовательностях выделены жирным шрифтом и подчеркнуты.

На фигуре 6 показаны аминокислотные последовательности разных CDR-областей мышиного моноклонального антитела против α2-интегрина, на фиг. 6а показаны CDR-области тяжелой цепи и на фиг. 6b показаны CDR-области легкой цепи, где HCDR1 представлена SEQ ID NO:3, HCDR2 представлена SEQ ID NO:4, HCDR3 представлена SEQ ID NO:5, LCDR1 представлена SEQ ID NO:6, LCDR2 представлена SEQ ID NO:7, LCDR3 представлена SEQ ID NO:8.

На фигуре 7 показаны последовательности химерных конструкций, созданных путем связывания вышеуказанной вариабельной области легкой цепи мыши (SEQ ID NO:1) или вариабельных областей тяжелой цепи (SEQ ID NO:2) с (частями) константной области человека, как подробно описано в примерах. На фиг. 7а показаны аминокислотная последовательность (SEQ ID NO:9) и кодирующая последовательность (SEQ ID NO:14) легкой цепи химерной конструкции, на фиг. 7b показаны аминокислотная последовательность (SEQ ID NO:10) и кодирующая последовательность (SEQ ID NO:15) тяжелой цепи химерной конструкции, на фиг. 7с показаны аминокислотная последовательность (SEQ ID NO:11) и кодирующая последовательность (SEQ ID NO:16) тяжелой цепи химерной конструкции Fab-фрагмента. CDR-области в аминокислотных последовательностях подчеркнуты, последовательность, представляющая вариабельные домены α2, напечатана жирным шрифтом и His-метка выделена курсивом.

На фигуре 8 показаны аминокислотные последовательности разных константных областей человека, использованные для создания химерных конструкций: SEQ ID NO:17 является аминокислотной последовательностью белка IGKC человека, константная область легкой цепи которой, депонированная под номером доступа Q502W4 в Swiss-Prot, была использована для создания легкой цепи химерной конструкции в соответствии с SEQ ID NO:9, SEQ ID NO:18 является аминокислотной последовательностью мутированного белка IGHG4 человека, константная область тяжелой цепи которой, депонированная под номером доступа Р01861.1 в Swiss-Prot, была использована для создания тяжелой цепи химерной конструкции в соответствии с SEQ ID NO:10 (мутированные аминокислоты напечатаны жирным шрифтом); SEQ ID NO:19 является аминокислотной последовательностью белка IGHG1 человека, константная область тяжелой цепи которой, депонированная под номером доступа Q569F4 в Swiss-Prot, была использована для создания тяжелой цепи химерной конструкции Fab-фрагмента в соответствии с SEQ ID NO:11.

На фигуре 9 показаны аминокислотная последовательность и кодирующая последовательность α2- и β1-интегрина человека, при этом SEQ ID NO:20 является аминокислотной последовательностью белка-предшественника α2-интегрина под номером доступа NP_002194.2. I-Домен, который был использован в экспериментах и рекомбинантно экспрессирован в E. coli, подчеркнут и выделен жирным шрифтом. SEQ ID NO:21 является кодирующей последовательностью α2-интегрина под номером доступа NM_002203.3 в NCBI; SEQ ID NO:22 является аминокислотной последовательностью белка-предшественника изоформы 1А β2-интегрина под номером доступа NP_002202.2 в NCBI; и SEQ ID NO:23 является кодирующей последовательностью изоформы 1А β1-интегрина под номером доступа NM_002211.3 в NCBI.

На фигуре 10 показаны аминокислотная последовательность и кодирующая последовательность исходного мышиного антитела против α2-интегрина, полученного из гибридомы мыши, которые были подтверждены при помощи масс-спектрометрии: SEQ ID NO:45 (фигура 10а) является нуклеотидной последовательностью кДНК, кодирующей LC моноклонального антитела против α2-интегрина; SEQ ID NO:46 (фигура 10b) является нуклеотидной последовательностью кДНК, кодирующей НС моноклонального антитела против α2-интегрина; SEQ ID NO:47 (фигура 10с) является аминокислотной последовательностью LC моноклонального антитела против α2-интегрина, секретированного из гибридомы; SEQ ID NO:48 (фигура 10d) является аминокислотной последовательностью LC моноклонального антитела против α2-интегрина, секретированного из гибридомы; SEQ ID NO:53 (фигура 10е) является аминокислотной последовательностью LC моноклонального антитела-компаратора ТМС2206; SEQ ID NO:54 (фигура 10f) является аминокислотной последовательностью НС моноклонального антитела-компаратора ТМС2206.

На фигуре 11 показаны константы диссоциации разных антител против альфа2-интегрина, определенные методом Biacore. Полученные константы диссоциации во многих случаях оказываются лучше или по меньшей мере соответствуют константе диссоциации моноклонального антитела ТМС2206.

На фигуре 12 показано связывание моноклонального антитела-компаратора ТМС2206 с I-доменом α2-интегрина, который был предварительно связан негуманизированным Fab-фрагментом, при выполнении измерения методом Biacore (время указано в секундах (сек) (ось Х), и различие реакций указано в реакционных единицах (RU) (ось Y)). Как показано на фигуре 12, антитело ТМС2206 связывается с I-доменом интегрина, предварительно связанным негуманизированным Fab-фрагментом.

На фигуре 13 показано связывание негуманизированного Fab-фрагмента с I-доменом α2-интегрина, который был предварительно связан моноклональным антителом-компаратором ТМС2206 (время указано в секундах (сек) (ось Х), и различие реакций указано в реакционных единицах (RU) (ось Y)). Как показано на фигуре 13, негуманизированный Fab-фрагмент связывается с I-доменом α2-интегрина, предварительно связанным моноклональным антителом-компаратором ТМС2206.

На фигуре 14 показано ингибирование адгезии тромбоцитов с коллагеном в статических условиях при использовании промытых тромбоцитов. Серия 660 соответствует LC1/HC1, серия 661 соответствует LC2/HC2, серия 662 соответствует LC3/HC3, серия 663 соответствует LC3/HC4, серия 664 соответствует LC4/HC5, серия 665 соответствует LC4/HC6, серия 666 соответствует LC5/HC7, и серия 667 относится к антителу-компаратору. Результаты также представлены в таблице 12. Серии под номерами 660, 662 и 663 демонстрируют по меньшей мере равное или лучшее ингибирование адгезии тромбоцитов с коллагеном по сравнению с моноклональным антителом ТМС2206.

Примеры

Пример 1. Создание и отбор функционального моноклонального антитела против α2-интегрина и Fab-фрагмента

А - Выделение последовательностей из клеток клона моноклонального антитела против α2-интегрина

Продуцирование и выделение моноклонального антитела против α2-интегрина из гибридомы

Одну криопробирку, содержащую 2х106 клеток из банка клеток с моноклональным антителом против α2-интегрина, быстро размораживали при 37°С. Клетки переносили в колбу Т-25 см2, содержащую 5 мл свежей среды, состоящей из модифицированной по способу Дульбекко среды Игла (Gibco 31053-028), включающей 10% FBS, 1-кратный ITS (Gibco 41-400-045), 1-кратный пируват натрия (Gibco 11 360-039), 150 мкг/мл щавелевоуксусной кислоты, 2 мМ глутамина (Gibco 25030-024) и 100 ед/мл пенициллина/стрептомицина (Gibco 15070-063), и помещали при 37°С в термостат с увлажненной атмосферой, содержащей 5% СО2 в воздухе, на платформу шейкера, вращающуюся со скоростью 110 оборотов/мин.

Изотип моноклонального антитела, выделенного из гибридомы, определяли при помощи стандартного коммерчески доступного набора для изотипирования компании Serotec (набор для изотипирования мышиного моноклонального антитела; идентифицирующий номер ММТ1), полученные результаты показали наличие моноклонального антитела mCk изотипа mIgG2a.

Клетки субкультивировали каждые 2-3 дня для амплификации. Для продуцирования антитела клетки инокулировали в количестве 1,8×105 клеток/мл в среде Дульбекко, модифицированной по способу Исков (Sigma I3390), содержащей 10% FBS, 1-кратный ITS, 1-кратный пируват натрия, 150 мкг/мл щавелевоуксусной кислоты, 2 мМ глутамина и 100 ед/мл пенициллина/стрептомицина, в шести колбах Т500 (200 мл) в течение 10 дней.

Моноклональное антитело против α2-интегрина очищали, удаляя из супернатанта при помощи аффинной хроматографии на протеине G (протеин G Hitrap, GE Healthcare) и элюируя 0,1 М уксусной кислоты. Белок очищали при помощи вытеснительной хроматографии (SEC), используя Superdex 200 (GE Healthcare), подвергали ультрафильтрации и затем использовали в указанных экспериментах.

Определение последовательности тяжелой и легкой цепей моноклонального антитела против α2-интегрина

кДНК, кодирующая вариабельные домены моноклонального антитела, была получена следующим образом: мРНК экстрагировали из клеток гибридомы при помощи набора Oligotex компании Qiagen. Соответствующую кДНК амплифицировали при помощи ПЦР с обратной транскриптазой (RT-ПЦР) методом RACE, используя набор Gene Racer (Invitrogen), транскриптазу SuperScript III при 55°С (Invitrogen) и праймеры, представленные в таблице 1 (RACEMOG2a или CKFOR). Фрагменты кДНК амплифицировали при помощи ПЦР, используя полимеразу Phusion при 55°С (Finnzymes), и праймеры, также представленные в таблице 1.

Таблица 1
Праймеры, использованные при выполнении RT-ПЦР и ПЦР
Праймеры Последовательность в направлении от 5'- к 3'-концу
5'-концевой праймер GeneRacer CGACTGGAGCACGAGGACACTGA
(SEQ ID NO:24)
RACEMOG2a: 3'-концевой внутренний праймер к шарнирной области мыши AGGACAGGGCTTGATTGTGGG
(SEQ ID NO:25)
CKFOR: 3'-концевой внутренний праймер к Ck-области мыши CTCATTCCTGTTGAAGCTCTTGAC
(SEQ ID NO:26)

Амплифицированные фрагменты, кодирующие вариабельные области тяжелой (VH) и легкой (VL) цепей, клонировали в плазмиды pCR4-Topo компании Invitrogen, которые были амплифицированы в E. coli. Клонированную кДНК затем секвенировали в обеих цепях.

Белковые последовательности транслировали из кодирующих последовательностей плазмиды и вычисляли массы тяжелой (НС) и легкой (LC) цепей (таблица 2). Полученные значения полностью соответствовали данным масс-спектрометрии, полученным для моноклонального антитела, очищенного от культуры соответствующей гибридомы, см. таблицу 2. Последовательность нуклеиновой кислоты и аминокислотная последовательность НС и LC приведены в списке последовательностей: SEQ ID NO:46 и 48 соответствуют НС моноклонального антитела против α2-интегрина, выделенного из супернатанта гибридомы, и SEQ ID NO:45 и 47 соответствуют LC моноклонального антитела против α2-интегрина, выделенного из супернатанта гибридомы.

Таблица 2
Масс-спектрометрический анализ моноклонального антитела против α2-интегрина, выделенного из гибридомы
Цепь Масса (Да), определенная методом ЖХ/МС Значение массы (Да) in silico
Моноклональное антитело против α2-интегрина LC
HC
23899
59728 (G0F))
23896
50725 (G0F)

В - Определение последовательностей CDR моноклональных антител против α2-интегрина

Последовательности CDR-областей вычленяли из белковой последовательности, используя номенклатуру Кабата.

В тяжелой цепи (НС) CDR1 соответствует SEQ ID NO:3, CDR2 соответствует SEQ ID NO:4, CDR3 соответствует SEQ ID NO:5.

В легкой цепи (LC) CDR1 соответствует SEQ ID NO:6, CDR2 соответствует SEQ ID NO:7, CDR3 соответствует SEQ ID NO:8.

С - Создание плазмид, экспрессирующих химерное моноклональное антитело против α2-интегрина

Вариабельная область тяжелой и легкой цепи моноклонального антитела против α2-интегрина была создана при помощи ПЦР с использованием набора AccuPrimePfx SuperMix (Invitrogen; № по каталогу 12344-040) и кДНК тяжелой и легкой цепи моноклонального антитела против α2-интегрина (создание кДНК описано выше). Используя 25 мкл реакционной смеси для ПЦР выполняли 5 циклов с прямыми и обратными праймерами α2mAB-VH (тяжелая цепь) и прямыми и обратными праймерами α2mAB-VL (легкая цепь) (95°С, 15 сек; 62°С, 30 сек; 68°С, 1 мин). Для введения лидерной последовательности в качестве матрицы для второй ПЦР использовали по 0,5 мкл каждого образца из первой ПЦР с прямыми праймерами 1-54 для лидерной последовательности и обратными праймерами α2mAB-VL, выполняя ПЦР в тех же условиях, что и первую ПЦР. И наконец, 0,5 мкл продукта второй ПЦР использовали в качестве матрицы для третьей ПЦР, которую выполняли на протяжении 25 циклов, используя прямые праймеры 1-23 для лидерной последовательности и обратные праймеры для α2mAb-VL (или -VH), в тех же условиях, что и первую реакцию ПЦР. Продукты третьей ПЦР очищали при помощи набора для очистки продуктов ПЦР (Qiagen, № по каталогу 28104) в соответствии с инструкцией, прилагаемой к набору. Продукты ПЦР клонировали в pCR2.1-TOPO, используя набор для клонирования ТОРО ТА компании Invitrogen (№ по каталогу 450001) в соответствии с руководством поставщика, и секвенировали с помощью прямых и обратных праймеров М13, входящих в набор для клонирования.

Последовательности вариабельной области легкой и тяжелой цепи мышиного антитела против α2-интегрина показаны на фигуре 5, где SEQ ID NO:1 является аминокислотной последовательностью и SEQ ID NO:12 является кодирующей последовательностью вариабельного домена легкой цепи, SEQ ID NO:2 является аминокислотной последовательностью и SEQ ID NO:13 является кодирующей последовательностью вариабельного домена тяжелой цепи.

Вариабельный домен легкой цепи (в соответствии с SEQ ID NO:1) сливали с константной областью легкой цепи (IGKC, Swiss-Prot: Q502W4) путем расщепления VL ферментами NheI/BsiWI и IGKC ферментами BsiWI/HindIII, в результате чего была создана легкая цепь VL-IGKC химерного антитела против α2-интегрина, соответствующая SEQ ID NO:9 и 14. Указанный гибрид был лигирован с сайтами NheI/HindIII эписомного экспрессирующего вектора pXL (Durocher et al. (2002), Nucl. Acids Res. 30(2)), E9, с образованием плазмиды, экспрессирующей легкую цепь химерного антитела против α2-интегрина, для клонирования в клетках млекопитающих “pFF0033_pXLc-AscII-IGKC”, которая депонирована в DSMZ под номером доступа DSM 23944.

Вариабельный домен тяжелой цепи (в соответствии с SEQ ID NO:2) сливали с мутированным вариантом константной области тяжелой цепи человека (IGHG4, Swiss-Prot P01861, S108P, L115E), в результате чего была создана константная область тяжелой цепи VH-IGHG4 химерного антитела против α2-интегрина, соответствующая SEQ ID NO:10/15, а в случае создания Fab-фрагмента вариабельный домен тяжелой цепи сливали с СН1 доменом, меченным 6xHis меткой, из константной области IGHG1 человека (Swiss-Prot: Q569F4), что позволило получить константную область тяжелой цепи VH-IGHG1 Fab-фрагмента химерного антитела против α2-интегрина, соответствующую SEQ ID NO:11/16. VH расщепляли ферментами NheI/ApaLI и сливали соответственно с IGHG4, расщепленной ApaI/HindIII, или с СН1 доменом, меченным His меткой. Полученный гибрид лигировали с сайтами NheI/HindIII эписомного экспрессирующего вектора pXL с образованием плазмиды, экспрессирующей тяжелую цепь IgG4 химерного антитела против α2-интегрина “pFF0036_pXLc-AscII-IGHG4”, для клонирования в клетках млекопитающих, которая депонирована в DSMZ под номером доступа DSM 23946, или плазмиды, экспрессирующей тяжелую цепь Fab-фрагмента химерного антитела против α-интегрина “pFF0035_pXLc-AscII-CH1-Hi”, для клонирования в клетках млекопитающих, которая депонирована в DSMZ под номером доступа DSM 23945.

Разные плазмиды были депонированы в Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Braunschweig, под следующими номерами доступа: DSM 23945 (плазмида для экспрессии тяжелой цепи Fab-фрагмента химерного антитела против α2-интегрина в эукариотических клетках), DSM 23946 (плазмида для экспрессии тяжелой цепи IgG4 химерного антитела против α2-интегрина) и DSM 23944 (плазмида для экспрессии легкой цепи IGKC химерного антитела против α2-интегрина).

В вышеуказанных последовательностях были использованы следующие праймеры.

SEQ ID NO:
Прямой праймер α2mAB-VL:
CTGGTGGCCACCGCCACCGGCGTGCACAGCAACATTGTGCTGACCCAATCTC
27
Обратный праймер α2mAB-VL:
ACCGTACGTTTTATTTCCAGCTTGGTCCCC
28
Прямой праймер α2mAb mAB-VH:
CTGGTGGCCACCGCCACCGGCGTGCACAGCCAGGTCCAACTGCATCAGCCTG
29
Обратный праймер α2mAB mAB-VH:
TAGGGCCCTTGGTGCTGGCTGAGGAGACTGTGAGAGTGG
30
Праймеры для лидерной последовательности 1-54:
GCTAGCACCATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCCACCGCCACC
31
Праймеры для лидерной последовательности 1-23:
CAAGCTAGCACCATGGGCTGGTCCTG
32

Пример 2. Свойства моноклонального антитела против α2-интегрина и Fab-фрагмента

А - Получение рекомбинантного моноклонального антитела против α2-интегрина и Fab-фрагментов

Экспрессия молекул химерного антитела IgG4 против α2-интегрина и Fab-фрагмента против α2-интегрина

Экспрессирующие плазмиды, кодирующие тяжелую и легкую цепи антитела, культивировали в E. coli DH5a. Плазмиды, использованные для трансфекции, были получены из E. coli при помощи набора EndoFree Plasmid Mega компании Qiagen.

Клетки НЕК 293-FS, выращиваемые в среде Freestyle (Invitrogen), трансфицировали указанными LC и НС плазмидами, используя трансфицирующий реагент фуген (Roche). Через 7 дней клетки удаляли центрифугированием и супернатант пропускали через 0,22-мкм фильтр для удаления частиц.

Очистка молекул химерного антитела IgG4 против α2-интегрина и Fab-фрагмента против α2-интегрина

Белок IgG4 очищали при помощи аффинной хроматографии на протеине А (колонки НР с протеином А HiTrap, GE Life Sciences). Моноклональные антитела элюировали из колонки 100 мМ ацетатного буфера с 100 мМ NaCl, рН 3,5, обессоливали на обессоливающих колонках HiPrep 26/10, вводили в PBS в концентрации 1 мг/мл и фильтровали через 0,22-мкм фильтр.

Белки Fab-фрагментов очищали методом IMAC на колонках НР HiTrap IMAC (GE Life Science). После элюирования из колонки в линейном градиенте (буфер для элюирования: 20 мМ фосфата натрия, 0,5 М NaCl, 50-500 мМ имидазола, рН 7,4) содержащие белок фракции собирали и обессоливали на обессоливающих колонках HiPrep 26/10, вводили в PBS в концентрации 1 мг/мл и фильтровали через 0,22-мкм фильтр.

Концентрацию белка определяли, измеряя оптическую плотность при 280 нм. Каждую серию белка анализировали, используя набор Protein 200 Plus LabChip, в биоанализаторе Agilent 2100 в восстановительных и невосстановительных условиях для определения чистоты и молекулярной массы каждой субъединицы мономера.

В - Связывающие свойства моноклонального антитела против α2-интегрина и Fab-фрагмента

Кинетику очищенного антитела и соответствующего Fab-фрагмента детально исследовали методом резонанса поверхностных плазмонов в устройстве Biacore 3000 (GE Healthcare). Выполняли анализ прямого связывания, используя антитело против интегрина или Fab-фрагмент в качестве лиганда и I-домен αβ1-интегрина в качестве анализируемого вещества. 600 реакционных единиц (RU) антитела или Fab-фрагмента иммобилизовали на чипе СМ5 аналитической чистоты путем связывания реакционно-способным амином с достижением значения Rmax, равного 80 и 140 RU для I-домена, связанного соответственно с антителом и Fab-фрагментом. Кинетику связывания измеряли в диапазоне концентраций от 0,4 до 28 нМ I-домена в буфере HBS-P, содержащем 4 мМ MgCl2 (10 мМ HEPES, рН 7,4, 150 мМ NaCl, 0,005% поверхностно-активного вещества Р20) при скорости потока, равной 30 мкл/мин. Поверхности чипа регенерировали 10 мМ глицина, рН 2,2. Кинетические параметры анализировали и вычисляли с помощью пакета программ BIAevaluation (версия 4.1), используя проточную кювету без иммобилизированного антитела против интегрина или Fab-фрагмента в качестве эталона. Модель связывания 1:1 с переносом массы была использована для глобального согласования данных для кривых, соответствующих концентрациям анализируемого вещества для 0,4-28 нМ антитела или Fab-фрагмента.

Таблица 3
Кинетика связывания моноклонального антитела против α2-интегрина и Fab-фрагмента против I-домена интегрина
Лиганд ka (1/Мс) Е+05 kd (1/с) Е-04 KD (М) Е-10
Антитело 8,6 11,7 13,5
Fab-фрагмент 9,9 8,3 8,4

Блокирующее моноклональное антитело и Fab-фрагмент характеризовались сродством к домену α2β1-интегрина человека в наномолярном диапазоне (таблица 3).

Для дальнейшего исследования связывающих свойств моноклонального антитела против α2-интегрина был выполнен анализ с использованием клеток HUVEC (Promocell C12200, партия 6062203). Клетки наносили на планшеты с высокой степенью связывания (Meso Scale Discovery (MSD), L15XB-3) в PBS (10000 клеток/лунку) и инкубировали в течение 2 часов при комнатной температуре. Затем содержимое планшетов сливали, планшеты дважды промывали PBS и блокировали блокирующим раствором (MSD, R93BA-4) в течение 90 минут. После вышеуказанного повторного слива и промывки планшетов добавляли моноклональное антитело против α2-интегрина в виде серийных разведений и инкубировали с клетками в течение 1 часа при комнатной температуре. После выполнения еще одной вышеуказанной стадии промывки добавляли буфер Т READ без поверхностно-активного вещества (Meso scale Discovery, R92TD-2). Электрохемилюминесценцию считывали в соответствующем устройстве (Meso scale Discovery, визуализирующее устройство Sector). Для определения KD исследованных моноклональных антител был произведен анализ графика Скэтчарда (см. фиг. 1).

С - Свойства перекрестной реактивности моноклонального антитела против α2-интегрина

Моноклональное антитело против α2-интегрина оценивали в отношении его способности специфически взаимодействовать с тромбоцитами макака и человека, выполняя эксперименты методом FACS с использованием образцов крови или тромбоцитов человека. Моноклональное антитело инкубировали с образцами крови человека, крови макака или тромбоцитов человека и с вторичными моноклональными антителами козы против IgG мыши, связанными с фикоэритрином (РЕ) (Beckman Coulter № 731856). Образцы обрабатывали лизирующим раствором (BD № 349202), тромбоциты центрифугировали, ресуспендировали и анализировали методом FACS.

Моноклональное антитело против α2-интегрина характеризовалось такой же реактивностью в отношении образцов крови макака (Macaca fascicularis) (97,3% положительного результата, фиг. 4b), что и в отношении образца цельной крови человека (>98% положительных результатов, фиг. 4d), при этом не было обнаружено реактивности в отношении α2β1-интегрина мыши, крысы, собаки, морской свинки, поросенка или кролика при исследовании цельной крови, полученной у указанных видов (данные не показаны). Таким образом, результаты анализов FACS свидетельствуют о наличии перекрестной реактивности данного антитела с α2β1-интегрином примата на тромбоцитах крови, полученной у макака, при отсутствии перекрестной реактивности с α2β1-интегрином мыши, крысы, собаки, морской свинки, поросенка или кролика при исследовании цельной крови, полученной у указанных видов.

Пример 3. Гуманизация и создание Fv-домена IgG против α2-интегрина и Fab-фрагмента

Гуманизация

Трехмерные модели гомологии последовательностей VL и VH моноклонального антитела против α2-интегрина были созданы при помощи программы моделирования антител в МОЕ 2008. Было идентифицировано несколько матриц PDB для создания каркасных областей LC и НС и петель CDR. Все матрицы были более, чем на 83% идентичны последовательностям VL и VH моноклонального антитела против α2-интегрина за исключением лучшей матрицы петли Н3 (56% идентичность). В полученных моделях LC и НС энергия была минимизирована стандартным методом, применяемым в МОЕ. Затем при температуре 500° по шкале Кельвина в течение 1,1 наносекунды в универсальном растворителе Борна вычисляли динамику молекул (MD) трехмерной минимизированной модели гомологии VL/VH мыши, ограничивая длину остова белка. В первой серии исследований MD на последней наносекунде было экстрагировано 10 разных конформацией через каждые 100 псек. Затем при температуре 300° по шкале Кельвина в течение 2,3 наносекунды в универсальном растворителе Борна вычисляли MD в 10 указанных разных конформациях без ограничения длины остова белка. В каждом из 10 исследований MD вычисление производили, используя 2000 последних моментальных снимков траектории MD, по одному через каждую пикосекунду, для каждой аминокислоты моноклонального антитела против α2-интегрина, при этом среднеквадратичные отклонения (rmsd) сравнивали с эталонным средним положением. Сравнивая среднее значение среднеквадратичного отклонения для 10 отдельных исследований MD данной аминокислоты с общим средним значением среднеквадратичного отклонения всех аминокислот мышиного моноклонального антитела против α2-интегрина, можно определить, является ли данная аминокислота достаточно гибкой, как было установлено во время определения MD, для взаимодействия с Т-клеточными рецепторами и активации иммунного ответа. В моноклональном антителе против α2-интегрина достаточно гибкими были признаны 64 аминокислоты, из которых 34 аминокислоты не были локализованы в CDR-областях или непосредственно рядом с ними (5Å). Аминокислоты, локализованные в зоне “Верньера”, также не принимались во внимание (J. Mol. Biol. 1992, 224, 487-499).

Движение 34 наиболее гибких аминокислот моноклонального антитела против α2-интегрина (исключая область CDR+5Å) в течение 20 нсек (10×2 нсек) затем сравнивали с движением соответствующих гибких аминокислот 49 моделей гомологии зародышевых линий клеток человека, для каждой из которых была произведена имитация MD в течение 10×2 нсек. 49 моделей зародышевых линий клеток человека были созданы путем систематического объединения 7 наиболее распространенных легких цепей зародышевой линии клеток человека (vk1, vk2, vk3, vk4, vлямбда1, vлямбда2, vлямбда3) и 7 наиболее распространенных тяжелых цепей зародышевой линии клеток человека (vh1a, vh1b, vh2, vh3, vh4, vh5, vh6). Человеческое антитело гаметического типа vk1-vh1b характеризовалось 62% 4D сходством его гибких аминокислот с гибкими аминокислотами моноклонального антитела против α2-интегрина; поэтому антитело гаметического типа vk1-vh1b было использовано для гуманизации моноклонального антитела против α2-интегрина, при этом основное внимание было сфокусировано на гибких аминокислотах. Для парной сборки аминокислот моноклонального антитела против α2-интегрина и аминокислот vk1-vh1b был произведен сравнительный анализ 2 последовательностей на основе оптимального трехмерного наложения α-атомов углерода 2 соответствующих моделей гомологии.

Стабилизация

Аминокислоты легких и тяжелых цепей с низкой частотой встречаемости по сравнению с соответствующими каноническими последовательностями, за исключением CDR-областей, первоначально было предложено мутировать в наиболее часто встречающихся аминокислотах (ΔΔGth>0,5 ккал/моль [E. Monsellier, H. Bedouelle, Improving the stability of an antibody variable fragment by a combination of knowledge-based approaches: validation and mechanisms. J. Mol. Biol. 2006, 362, 580-593]). Первый список консенсусных мутаций для LC и НС был ограничен аминокислотами, обнаруженными в ближайшей зародышевой линии клеток человека (то есть vk1-vh1b), а именно 4 потенциальными мутациями в LC и 3 мутациями в НС. Ни одна из указанных мутаций не находится в CDR-областях, в непосредственной близости от них (+5 ангстрем) или в зоне “Верньера” (J. Mol. Biol. 1992, 224, 487-499). При рассмотрении указанных консенсусных мутаций для потенциальной стабилизации антитела против альфа2-интегрина во внимание были приняты также другие критерии оценки. Указанные критерии оценки включают благоприятное изменение гидрофобности на поверхности или прогнозируемую стабилизацию мутанта на основе молекулярной механики.

Гуманизация путем трансплантации

Гуманизацию начинают с идентификации зародышевых линий клеток человека, наиболее близко соответствующих легким и тяжелым цепям моноклонального антитела против α2-интегрина. Данную операцию выполняют при помощи программы BLAST, которая ведет поиск во всех систематически пронумерованных зародышевых линиях клеток человека (все возможные комбинации V и J доменов для каппа- и лямбда-цепей; V, D и J домены для тяжелых цепей). Поиск с помощью программы BLAST был выполнен при помощи прикладной программы собственной интрасети.

Были идентифицированы следующие ближайшие зародышевые линии клеток человека, идентичные легким и тяжелым цепям антитела против α2-интегрина на 77% и 68%:

IGLKV79_IGLKJ2 соответствует SEQ ID NO:49. IGHV11_IGHD33_IGHJ8 соответствует SEQ ID NO:50.

Гуманизирующие мутации получены в результате попарного сравнения 2 совмещаемых последовательностей за исключением остатков CDR (нумерация Кабата) и зоны Верньера.

Мутация нежелательных фрагментов последовательностей

Были рассмотрены следующие фрагменты последовательностей: Asp-Pro (кислотолабильная связь), Asn-X-Ser/Thr (гликозилирование, Х = любая аминокислота, кроме Pro), Asp-Gly/Ser/Thr (образование сукцинимида/iso-asp в гибких областях), Asn-Gly/His/Ser/Ala/Cys (сайты, подверженные деамидированию), Met (окисление в доступной области). Полученные гуманизированные последовательности исследовали в отношении сходства последовательностей с использованием базы данных IEDB (http://www.immuneepitope.org/home.do; версия: июнь 2009 г.) для гарантии того, что ни одна из последовательностей не содержит любого известного В- или Т-клеточного эпитопа.

1. Исходные последовательности вариабельных доменов антитела против α2β1-интегрина

а. Легкая цепь (CDR-области + 5Å выделены, 1 потенциально проблемный фрагмент NS в CDR-области подчеркнут)

b. Тяжелая цепь(CDR-области + 5Å выделены, 1 проблемный сайт в CDR-области [сайт образования сукцинимида и Iso-Asp DS] подчеркнут)

Созданные последовательности

Было создано пять вариантов легкой цепи (варианты легкой цепи LC1, LC2, LC3, LC4, LC5) и семь вариантов тяжелой цепи (варианты тяжелой цепи НС1, НС2, НС3, НС4, НС5, Н6, Н7). Вариант LC1 содержит 4 мутации, полученные в результате прямого сравнения наиболее гибких аминокислот, не входящих в CDR-область, легкой цепи моноклонального антитела против α2-интегрина и легкой цепи зародышевой линии клеток человека VK1. Вариант LC2 включает одну дополнительную мутацию, предназначенную для удаления сайта потенциального деамидирования в CDR-области (N34Q). Вариант LC3 включает гуманизирующие и стабилизирующие мутации, предположительно необходимые для оптимальной стабилизации легкой цепи моноклонального антитела против α2-интегрина. Вариант LC4 включает одну дополнительную мутацию, предназначенную для удаления сайта потенциального деамидирования (N34Q). Вариант LC5 содержит 6 мутаций, полученных методом трансплантации.

Вариант НС1 содержит 3 мутации, полученные в результате прямого сравнения наиболее гибких аминокислот, не входящих в CDR-область, тяжелой цепи моноклонального антитела против α2-интегрина и тяжелой цепи зародышевой линии клеток человека VH1b. Вариант НС2 включает еще одну дополнительную мутацию, предназначенную для удаления потенциально проблемного сайта образования сукцинимида и Iso-Asp в CDR-области (D55E). Вариант НС3 включает гуманизирующие и стабилизирующие мутации, предположительно необходимые для оптимальной стабилизации тяжелой цепи моноклонального антитела против α2-интегрина. Вариант НС4 включает дополнительную мутацию, относящуюся к проблеме потенциальной агрегации. Вариант НС5 включает мутации варианта НС3 и дополнительную мутацию, предназначенную для удаления потенциально проблемного сайта образования сукцинимида и Iso-Asp в CDR-области (D55E). Вариант НС6 включает дополнительную мутацию, относящуюся к проблеме потенциальной агрегации. Вариант НС7 содержит 20 мутаций, полученных методом трансплантации.

Было получено в общей сложности семь комбинаций:

- LC1/HC1 (мутации, относящиеся только к гуманизации)

- LC2/HC2 (мутации, относящиеся к гуманизации и потенциально проблемному сайту LC/HC [NS и DS])

- LC3/HC3 (мутации, относящиеся к гуманизации и стабилизации)

- LC3/HC4 (мутации, относящиеся к гуманизации, стабилизации и препятствующие агрегации)

- LC4/HC5 (мутации, относящиеся к гуманизации, стабилизации, потенциально проблемному сайту LC [NS] и потенциально проблемному сайту НС [DS])

- LC4/HC6 (мутации, относящиеся к гуманизации, стабилизации, препятствующие агрегации, а также относящиеся к потенциально проблемному сайту LC [NS] и потенциально проблемному сайту НС [DS])

- LC5/HC7 (мутации, относящиеся к гуманизации путем трансплантации)

Таблица 4
Краткий обзор 7 комбинаций LCxHC
(LC1) Гуманизация LC2 Гуманизация и сайт NS в CDR LC3 Гуманизация и стабилизация LC4 Гуманизация, сайт NS в CDR и стабилизация LC5 (транс-плантация)
(НС1)
Гуманизация
х
(НС2)
Гуманизация и DS
в CDR
х
(НС3)
Гуманизация и стабилизация
х
(НС4)
Гуманизация, стабилизация и “противодействие агрегации”
х
(НС5)
Гуманизация, DS в CDR и стабилизация
х
(НС6)
Гуманизация, стабилизация, “противодействие агрегации” и DS в CDR
х
(НС7) (трансплантация) х
Таблица 5
Краткий обзор мутаций, введенных в созданную легкую цепь Fab-фрагмента против α2β1-интегрина
Легкая цепь (последовательная нумерация) (LC1) Гуманизация (LC2) Гуманизация и NS в CDR (LC3) Гуманизация и стабилизация (LC4) Гуманизация, NS в CDR и стабилизация (LC5) Транс-плантация
ALA9 SER SER SER SER
ALA12 SER SER
LEU15 VAL VAL VAL VAL PRO
SER22 THR
ASN34 GLN GLN
GLN46 LYS LYS
ALA47 PRO
ASP80 ASN
GLU83 GLN GLN GLN GLN
ASP85 GLU GLU
ALA87 THR
THR89 ASN
Таблица 6
Мутации 7 вариантов НС антитела против α2-интегрина
Тяжелая цепь (после-довательная нумерация) (НС1) Гумани-зация (НС2) Гумани-зация и DS в CDR (НС3) Гумани-зация и стабили-зация (НС4) Гуманизация, стабилизация и “противо-действие агрегации” (НС5) Гуманизация, DS в CDR и стабили-зация (НС6) Гуманизация, стабилизация, “противо-действие агрегации” и DS в CDR (НС7) Транс-плантация
HIS5 VAL
PRO7 SER
LEU11 VAL
VAL12 LYS
PRO17 SER SER SER SER SER
LEU20 VAL
LYS38 ARG
ARG40 ALA
ARG43 GLN GLN GLN
ASP55 GLU GLU GLU
ASN61 ALA
LYS65 GLN
ASP66 GLY
LYS67 ARG ARG ARG
SER76 THR
ILE81 MET
GLN82 GLU
THR87 ARG
SER91 THR
VAL93 LYS LYS
THR112 LEU
LEU113 VAL
SER116 VAL VAL VAL VAL VAL VAL
3 мутации 4 мутации 2 мутации 3 мутации 3 мутации 4 мутации 20 мутаций

Гуманизированные последовательности вариабельной области были созданы путем генного синтеза и клонированы в соответствующие векторы, экспрессирующие тяжелые и легкие цепи, в соответствии с описанием, приведенным в примере 1С.

Созданные последовательности легких цепей

Были клонированы пять вариантов легких цепей (LC1, LC2, LC3, LC4, LC5). Мутации, введенные в процессе создания варибельных областей цепей, выделены или подчеркнуты.

LC1 (гуманизирующие мутации напечатаны жирным шрифтом и подчеркнуты):

LC2 (гуманизирующие мутации выделены, мутации для NS CDR напечатаны жирным шрифтом и подчеркнуты):

LC3 (гуманизирующие и стабилизирующие мутации выделены):

LC4 (гуманизирующие и стабилизирующие мутации выделены, мутация для NS CDR напечатана жирным шрифтом и подчеркнута):

LC5 (трансплантированные мутации выделены):

Ниже представлен сравнительный анализ LC антитела против α2β1-интгрина и Vk1-Vh1b зародышевой линии клеток человека:

Созданные последовательности тяжелых цепей

Были клонированы семь вариантов тяжелых цепей (НС1, НС2, НС3, НС4, НС5, НС6, НС7). Мутации, введенные в процессе создания вариабельных областей цепей, выделены.

НС1 (гуманизирующие мутации выделены):

НС2 (гуманизирующие мутации выделены, потенциально проблемные фрагменты [сайт DS CDR]):

НС3 (гуманизирующие и стабилизирующие мутации выделены):

НС4 (гуманизирующие и стабилизирующие мутации выделены, мутация, препятствующая агрегации):

НС5 (гуманизирующие и стабилизирующие мутации выделены, потенциально проблемные фрагменты [сайт DS CDR]):

НС6 (гуманизирующие и стабилизирующие мутации выделены, потенциально проблемные фрагменты [сайт DS CDR], мутация, препятствующая агрегации):

НС7 (трансплантированные мутации выделены):

Ниже представлен сравнительный анализ НС моноклонального антитела против α2β1-интегрина и НС Vk1-Vh1b зародышевой линии клеток человека:

Вариабельные области тяжелых и легких цепей каждого варианта моноклонального антитела против α2-интегрина (5 разных легких цепей: VL1-VL5, и 7 разных тяжелых цепей: VH1-VH7) были созданы путем генного синтеза, включая 5' UTR-последовательность (5'-GTGCACAGC-3') с использованием AlaLI и 3' UTR-последовательность (5'-GCTTCCACCAAGGGCCC-3') c использованием ApaI (тяжелая цепь) или BsiWI (легкая цепь). Вариабельные домены тяжелых цепей были лигированы в сайты ApaLI/ApaI модифицированного экспрессирующего вектора pXL, содержащего мутированный вариант константной области тяжелой цепи человека (IGHG4, Swiss-Prot P01861, S108P, L115E), с образованием моноклонального антитела против α2-интегрина, включающего константную область тяжелой цепи VH-IGHG4.

Вариабельные домены легких цепей были лигированы в сайты AlaLI/BsiWI модифицированного экспрессирующего вектора pXL, содержащего константную область легкой цепи человека (IGKC, Swiss-Prot: Q502W4), с образованием моноклонального антитела против α2-интегрина, включающего константную область легкой цепи VL-IGKC. Весь процесс генного синтеза, клонирования и продуцирования ДНК был выполнен коммерческим поставщиком (Geneart AG).

Для сравнения было использовано гуманизированное антитело против альфа2-интегрина hIgG4, известное в данной области (ТМС2206) (“компаратор”). Аминокислотные последовательности легких и тяжелых цепей компаратора представлены в настоящем описании изобретения в виде SEQ ID NO:53 и 54 на фигуре 10е.

Таблица 7
Список гуманизированных вариантов моноклонального антитела против α2-интегрина
Комбинация LC/HC Гуманизированный вариант
LC1/HC1 Мутации, относящиеся только к гуманизации
LC2/HC2 Мутации, относящиеся только к гуманизации и потенциально проблемным сайтам LC/HC (NS; DS)
LC3/HC3 Мутации, относящиеся к гуманизации и стабилизации
LC3/HC4 Мутации, относящиеся к гуманизации, стабилизации и препятствующие агрегации
LC4/HC5 Мутации, относящиеся к гуманизации, стабилизации и потенциально проблемным сайтам LC/HC (NS; DS)
LC4/HC6 Мутации, относящиеся к гуманизации и стабилизации, препятствующие агрегации и относящиеся к потенциально проблемным сайтам LC/HC (NS; DS)
LC5/HC7 Мутации, относящиеся к гуманизации путем трансплантации
TMC2206 Компаратор, соответствующий SEQ ID NO:53

Последовательности моноклональных антител исследовали при помощи масс-спектрометрии. Для выполнения измерений массы интактных антител образец иммобилизовали в течение 20 минут, обессоливали 20 мкл/мин на монолитной улавливающей колонке с 2% ацетонитрила и 0,1% ТФУ (об./об.) и элюировали в градиенте от 15% элюента А (Н2О/0,05% ТФУ) до 50% элюента В (ацетонитрил/0,05% ТФУ).

Образец разделяли в нанопотоке (300 нл/мин) на монолитной колонке (PS-DVB; внутренний диаметр 100 мкм×5 см) при температуре 37°С. Образец вводили при помощи электрораспыляющих игл с наружным диаметром 365 мкм, внутренним диаметром 75 мкм и диаметром наконечника 15 мкм при наличии газовой оболочки. Полученные спектры суммировали в течение соответствующего периода времени и подвергали обратной свертке, используя программу реконструкции белка, поставленную вместе с программой BioAnalyst компанией Applied Biosystems/MDS Sciex.

Белковые последовательности транслировали из плазмиды, кодирующей последовательности, и вычисляли массы НС и LC (таблица 8).

Таблица 8
Масс-спектрометрический анализ очищенных гуманизированных моноклональных антител против α2-интегрина
Комбинация LC/HC Легкая цепь Тяжелая цепь
Предпола-гаемая масса (Да) Измерен-ная масса (Да) Миллион-ные доли Предпола-гаемая масса (Да) (G0F) Измерен-ная масса (Да) Миллион-ные доли
LC1/HC1 23727,38 23724,56 119 50314,47 50311,80 53
LC2/HC2 23741,41 23738,26 130 50328,5 50327,52 19
LC3/HC3 23757,36 23753,89 146 50304,47 50301,96 50
LC3/HC4 23757,36 23754,17 134 50333,52 50331,29 44
LC4/HC5 23771,39 23769,87 64 50318,5 50317,68 16
LC4/HC6 23771,39 23768,13 137 50347,54 50350,26 54
LC5/HC7 23792,41 23789,01 142 50187,3 50184,84 49
TMC2206 23378,01 23374,51 150 50237,54 50233,48 81

Представлнные величины находятся в хорошем соответствии с вычисленными массами и подтверждают правильность клонированных конструкций.

Пример 4. Исследование моноклонального антитела против α2-интегрина при помощи биохимических и клеточных анализов in vitro

Для выполнения твердофазного анализа интегрин (I-домен α2-интегрина: аминокислоты 140-339 GST I-домена α2-интегрина в TBS/5 мМ Mn2+, 50 мкл/лунку) иммобилизовали на 96-луночном планшете (Corning Costar, 3690) при комнатной температуре в течение ночи. Добавляли 25 мкл/лунку блокирующего раствора (5% BSA (неочищенный) (А7906), 1×TBS), который затем сливали. Добавляли 200 мкл/лунку блокирующего раствора и оставляли на 3 часа при комнатной температуре. После стадии промывки (3 раза с использованием 200 мкл/лунку связывающего буфера: 1×TBS, 0,1% BSA (А7638) и 2 мМ Mn2+; TBS: 150 мМ NaCl, 25 мМ трис-буфера (Fluka 93371) рН 7,4) образцы инкубировали в стационарных условиях при комнатной температуре в течение 3 часов с добавлением 50 мкл:

а) только биотинилированного коллагена - контрольный образец (10 мкл связывающего буфера и 40 мкл биотинилированного коллагена);

b) 10 мкл/лунку соединения, 40 мкл/лунку биотинилированного коллагена;

с) контрольный анализ: 50 мкл/лунку связывающего буфера.

После стадии промывки (3 раза с использованием 200 мкл/лунку связывающего буфера) образцы инкубировали в 50 мкл/лунку экстравидин-пероксидазы (конъюгат пероксидазы, Sigma E2886; 1:500 в связывающем буфере) в течение 30 минут при комнатной температуре и снова 4 раза промывали 200 мкл/лунку связывающего буфера. Добавляли 50 мкл/лунку пероксидазного субстрата (раствор ABTS; 2,2'-азино-бис-3-этилбензтиазолин-6-сульфоновая кислота), Sigma A-1888; 275 мкл (11 мг ABTS, растворенного в 0,5 мл деионизированной Н2О, и 5,5 мл 0,1 М ацетата натрия (Sigma S-3272)/0,05 М NaH2PO4 (Riedel de Haen 04270) рН 5,0 и 55 мкл Н2О2 Sigma H-1009 (10 мкл (=30%) и 1045 мкл деионизированной Н2О) в течение 10-30 минут при комнатной температуре в стационарных условиях (до окрашивания в зеленый цвет), затем добавляли 50 мкл/лунку 2% SDS и измеряли оптическую плотность при 405 нм (SpectraMax 190). Процентное значение ингибирования вычисляли по формуле 100-((среднее значение соединений×100)/(среднее значение положительного контрольного образца коллагена) после вычитания значения контрольного анализа.

Таблица 9
Ингибирование взаимодействия с коллагеном моноклональным антителом против α2-интегрина
Анализ Взаимо-действие α2β1-коллагена Взаимо-действие α2-I-домена-коллагена Взаимо-действие α2β1-коллагена (4% HSA) Адгезия тромбоцитов человека с коллагеном в статических условиях (промытые тромбоциты) Адгезия тромбоцитов человека с коллагеном в статических условиях (PRP) Адгезия тромбоцитов человека с коллагеном в условиях сдвига (цельная кровь) 3000 с-1
IC50 IgG4 (мкг/мл) 0,05 0,2 Данных нет 0,017 0,3 Данных нет
IC50 IgG4 (нМ) 0,3 1,5 Данных нет 0,1 6,7 Данных нет
IC50 Fab (мкг/мл) 0,2 Данных нет 0,4 0,04 0,3 0,06
IC50 Fab (нМ) 4,2 Данных нет 8,2 0,8 6,7 1,3

В кратком изложении, можно отметить, что моноклональное антитело против α2-интегрина не влияло на взаимодействие α1β1/коллагена (твердофазный анализ), взаимодействие α5β1/фибронектина (твердофазный анализ), активацию aIIbb3 (GPIIbIIIa) (анализ FACS), экспрессию Р-селектина на тромбоцитах человека (анализ FACS), агрегацию тромбоцитов человека в цельной крови или после стимуляции ADP, TRAP, коллагеном, высвобождения LDH, TNFα или IL1β из PBL человека (отдельно или в комбинации с LPS).

Образование трубочек в клетках HUVEC

Для оценки активности моноклонального антитела против α2-интегрина в развитии кровеносных сосудов выполняли анализ in vitro с использованием клеток HUVEC. Матригель (BD Biosciences, № 354230) смешивали с коллагеном типа I (BD Biosciences № 35429) (матригель 1/3,25, PBS 5×1/5, коллаген I 1 мг/мл, вода) и инкубировали в течение 1 часа при 37°С с 5% СО2. Сцепленные клетки HUVEC осторожно отделяли от культуральных колб, используя раствор акутазы, центрифугировали и ресуспендировали в культуральной среде (EBM, FCS 2%, набор шариков EGF) в количестве 105 клеток/мл. В лунки с матрицей добавляли 100 мкл взвеси клеток в присутствии или в отсутствие серийно разведенного моноклонального антитела против α2-интегрина и FGF2 (Peptrotech, 10 нг/мл) и инкубировали в течение 18 часов при 37°С с 5% СО2. Для обнаружения образования трубочек добавляли раствор крезила фиолетового и инкубировали в течение 30 минут при 37°С. Образование трубочек определяли, измеряя сумму длин трубочек в одной лунке. Вычисления выполняли в сравнении с отрицательным контрольным образцом (без FGF2) и положительными контрольными образцами (с FGF2, но без моноклонального антитела против α2-интегрина) при помощи программного обеспечения Image Proand (MediaCybernetics, измеряя 6 копий для каждого анализируемого условия. Полученные результаты показаны на фиг. 2. Моноклональное антитело против альфа2-интегрина было способно ингибировать FGF2-индуцированное развитие кровеносных сосудов в зависимости от дозы.

Пример 5. Ингибирование адгезии тромбоцитов с коллагеном моноклональным антителом против α2-интегрина и Fab-фрагментом в текучем состоянии и в статических условиях

Для исследования белок-белковых взаимодействий 96-луночные планшеты (Corning Costar 3690) сенсибилизировали рекомбинантно экспрессированным α2β1-интегрином или I-доменом α2β1-интегрина в буфере TBS в течение ночи при 4°С. После вымывания избыточного белка планшеты блокировали раствором BSA (5%, Sigma A7906) и еще раз промывали. На планшеты добавляли серийно разведенное моноклональное антитело против α2-интегрина и биотинилированный коллаген (из хвоста крысы, Sigma C8897). Указанную операцию выполняли в присутствии или в отсутствие 4% HSA. Планшеты инкубировали в течение 2 часов при комнатной температуре и снова промывали. Добавляли раствор экстравидин-пероксидазы (Sigma E2886) и планшеты инкубировали в течение 20 минут в темноте. Измерение производили в спектофотометре для прочтения планшетов Elisa (SpectraMax190 Molecular Devices) при 405 нм. Процентное значение ингибирования и значения IC50 вычисляли на основании известных стандартов.

Для исследования связывания тромбоцитов с коллагеном планшеты (Isoplate, Perkin Elmer, F1450 571) сенсибилизировали коллагеном (Sigma C8897) в TBS в течение 1 часа при комнатной температуре. Лунки дважды промывали TBS до добавления серийно разведенного моноклонального антитела против α2-интегрина. Добавляли только что приготовленную плазму с высоким содержанием тромбоцитов человека или только что выделенные тромбоциты человека, обработанные антикоагулянтом гирудином, PGE1 и ReoPro, метили кальцеином АМ (С-3099, Molecular Probes) и инкубировали в течение 90 минут при комнатной температуре с защитой от света. Планшеты промывали и измеряли в спектрофотометре для прочтения планшетов М5 (Molecular Devices) при длине волны возбуждения 492 нм и длине волны излучения 535 нм. Процентное значение ингибирования и значения IC50 вычисляли на основании известных стандартов.

При выполнении экспериментов в условиях сдвига моноклональное антитело против α2-интегрина анализировали в отношении способности ингибировать адгезию тромбоцитов с коллагеном в текучем состоянии. Стеклянные капилляры покрывали коллагеном и выдерживали в течение ночи при 4°С. Стеклянные капилляры промывали, блокировали BSA и устанавливали в проточное устройство. Антикоагулированную кровь человека, непосредственно перед исследованием полученную у добровольцев, метили DiOC6(3) и инкубировали в течение 10 минут с серийно разведенным моноклональным антителом против α2-интегрина при 37°С. Образцы пропускали через капилляры со скоростью сдвига 3000 с-1, имитирующей артериальный ток крови. После промывки капилляров было сделано 10 снимков поверхности капилляров, контактирующей с текущей кровью. При помощи программного обеспечения обработки изображений было определено покрытие поверхности и вычислено процентное значение ингибирования и значения IC50 на основании известных стандартов.

Для анализа адгезии тромбоцитов производили обогащение тромбоцитов следующим образом: гирудин (20 мкг/мл; Refludan (Pharmion)) и кровь центрифугировали с ускорением 150 g в течение 20 минут, в результате чего была получена антикоагулированная кровь человека. Плазму с высоким содержанием тромбоцитов (PRP) собирали, снова центрифугировали и собирали, как было описано выше. Плазма с низким содержанием тромбоцитов (РРР) была получена из остальной крови путем центрифугирования с ускорением 1940 g в течение 10 минут (2 раза). Плазму с низким содержанием тромбоцитов добавляли к разведенным клеткам (2 мМ Mg) и концентрацию клеток доводили до 2×105 клеток/мкл. Клетки оставляли на 0,5 часа и разводили до 5×104 клеток/мкл. Затем клетки вводили в соприкосновение с 3 мкг/мл ReoPro (2,5 мкг/мл; Centocor B.V., Leiden, N.L.) (10 минут, комнатная температура) и добавляли 6 мМ MnCl2×4H2O (5 мМ) (инкубировали в течение 10 минут).

Планшеты были получены следующим образом: планшеты (Perkin Elmer, IsoPlate, 1450-571) инкубировали с 100 мкл/лунку коллагена типа I (10 мкг/мл коллагена типа I из хвоста крысы, Sigma C8897, исходный раствор 200 мкг/мл в 0,01 М уксусной кислоты) при комнатной температуре в течение 1 часа. Планшеты 3 раза промывали 200 мкл/лунку TBS (50 мМ трис-буфера с HCl, рН 7,4, 120 мМ NaCl, 2,7 мМ KCl, 0,05 мМ CaCl2, 2 мМ MgCl2×6 Н2О, 0,1% BSA). Затем добавляли 10 мкл/лунку соединения и тромбоциты, обработанные ReoPro и Mn (5×104 клеток/мкл, 50 мкл/лунку). Клетки инкубировали в течение 1,5 часа (в темноте) и 3 раза промывали 200 мкл/лунку TBS. Добавляли 2,5 мкМ кальцеина АМ (50 мкл/лунку, С-3099, Molecular Probes, молекулярная масса 994,87, 30 минут, при комнатной температуре) и выполняли стадию промывки. Данные считывали в устройстве SpectraMax M5: флуоресценция при длине волны возбуждения 492 нм и длине волны излучения 535 нм с автоматическим отсечением при 530 нм при отсутствии клеток. Процентное значение ингибирования вычисляли по формуле 100-((среднее значение соединений×100)/среднее значение контрольного образца) после вычитания результата контрольного анализа.

Как показано на фигуре 3, моноклональное антитело против α2-интегрина ингибирует адгезию тромбоцитов в условиях напряжения сдвига при наномолярном значении IC50.

Пример 6. Поведение агрегации при использовании моноклональных антител против α2-интегрина, определенное при помощи вытеснительной хроматографии

Все гуманизированные варианты и компаратор исследовали в отношении процентного значения агрегации. Вытеснительную хроматографию выполняли в устройстве АКТА 10 (GE Healthcare), используя колонку TSKgel G3000SWXL (внутренний диаметр 7,8 мм×длина 30,0 см, TosohBioscience), при наличии контролирующей колонки TSKgel SWXL (TosohBioscience). В колонку вводили 30 мкл образца с концентрацией 0,4-1 мг/мл и выполняли хроматографию со скоростью потока 1 мл/мин, используя 100 мМ Na2SO4, 100 мМ Na2HPO4, 0,05% NaN3, рН 6,7, в качестве разделяющего буфера, при длине волны обнаружения 280 нм. Колонку калибровали, используя маркеры молекулярной массы для гель-фильтрации (Sigma Aldrich). Данные оценивали при помощи программного обеспечения Unicorn, версия 5.11 (GE Healthcare).

Таблица 10
Процентное значение агрегации при использовании моноклональных антител против α2-интегрина, определенное при помощи вытеснительной хроматографии
Комбинация LC/HC Агрегация [%] Высота пика [мА]
LC1/HC1 <0,5 74,4
LC2/HC2 <0,5 47,8
LC3/HC3 <0,5 93,7
LC3/HC4 2,3 67,2
LC4/HC5 1,8 67,9
LC4/HC6 <0,5 29,1
LC5/HC7 <0,5 46,5
TMC2206 11,8 20,7

Как показано в таблице 10, все исследованные варианты моноклонального антитела против альфа2-интегрина характеризуются низким процентным значением агрегатов. Для всех исследованных антител против альфа2-интегрина были получены более низкие процентные значения агрегации по сравнению с поведением агрегации, характерным для компаратора.

Пример 7. Данные кинетики связывания моноклональных антител против α2-интегрина, определенные методом Biacore

Детальное исследование кинетики очищенных гуманизированных антител было выполнено методом резонанса поверхностных плазмонов в устройстве Biacore 3000 (GE Healthcare). Анализ с захватом антитела выполняли, используя антитело против интегрина, захваченное специфическим антителом против Fc человека (MAB 1302, Millipore), и I-домен α2-интегрина в качестве анализируемого вещества. Специфическое антитело против Fc человека, иммобилизованное на чипе СМ5 аналитической степени чистоты, обычно улавливало 120 RU антитела против интегрина, в результате чего для I-домена, связанного с антителом, было получено значение Rmax, равное 30 RU. Кинетику связывания измеряли в диапазоне концентраций I-домена от 0,8 до 25 нМ в буфере HBS-P, содержащем 4 мМ MgCl2 (10 мМ HEPES, рН 7,4, 150 мМ NaCl, 0,005% поверхностно-активного вещества Р20), при скорости потока 30 мкл/мин. Поверхности чипа регенерировали 10 мМ глицина, рН 2,5. Кинетические параметры анализировали и вычисляли при помощи пакета программ BIAevaluation (версия 4.1), используя проточную кювету с иммобилизованным специфическим антителом против Fc человека в качестве эталона. Модель связывания 1:1 с переносом массы использовали для глобального подбора данных для кривых, соответствующих концентрациям анализируемого вещества, равным 0,8-25 нМ антитела.

Таблица 11
Три варианта имеют одинаковое значение KD при исследовании в устройстве Biacore в виде негуманизированного моноклонального антитела:
- комбинация LC1/HC1 (мутации, относящиеся только к гуманизации)
- комбинация LC3/HC3 (мутации, относящиеся к гуманизации и стабилизации)
- комбинация LC3/HC4 (мутации, относящиеся к гуманизации, стабилизации и препятствующие агрегации).

Значение мутации варианта, полученной в результате трансплантации, близко к аналогичному показателю негуманизированного моноклонального антитела.

Пример 8. Определение эпитопа антитела против альфа2-интегрина

Для сравнения эпитопа негуманизированного моноклонального антитела против альфа2-интегрина с моноклональным антителом-компаратором было выполнено исследование эпитопа методом резонанса поверхностных плазмонов в устройстве Biacore 3000 (GE Healthcare). Fab-фрагмент, соответствующий негуманизированному моноклональному антителу против альфа2-интегрина, иммобилизовали на чипе СМ5 путем связывания реакционно-способным амином в количестве 500 реакционных единиц (RU). I-домен интегрина был захвачен Fab-фрагментом со скоростью 10 мкл/мин, и после короткого периода диссоциации вводили антитело ТМС2206, которое связывалось с I-доменом α2-интегрина со скоростью 30 мкл/мин. Чип регенерировали 10 мМ глицинового буфера, рН 2,0. Во втором эксперименте моноклональное антитело-компаратор ТМС2206 было захвачено на поверхности специфического антитела против Fc человека (МАВ 1302, Millipore). Затем происходило связывание I-домена интегрина негуманизированным Fab-фрагментом. Результаты представлены на фигурах 13 и 14. Полученные результаты ясно показывают, что антитело-компаратор ТМС2206 связывается с I-доменом интегрина, предварительно связанным негуманизированным Fab-фрагментом.

Таким образом, негуманизированный Fab-фрагмент связывается с I-доменом интегрина, с которым было предварительно связано моноклональное антитело-компаратор ТМС2206. Одновременное связывание негуманизированного Fab-фрагмента и моноклонального антитела-компаратора с I-доменом α2-интегрина свидетельствует о том, что эпитопы Fab-фрагмента и моноклонального антитела-компаратора не являются идентичными. Из вышеизложенного следует, что антитело против альфа2-интегрина по настоящему изобретению и антитело-компаратор связываются с разными эпитопами альфа2-интегрина.

Пример 9. Анализы связывания тромбоцитов в статических условиях при использовании планшетов, сенсибилизированных коллагеном, и промытых тромбоцитов или плазмы с высоким содержанием тромбоцитов

Так как α2β1-интегрин экспрессирован на тромбоцитах крови и играет важную роль в адгезии тромбоцитов с коллагеном, была использована аналитическая система, применяемая для исследования связывания тромбоцитов in vitro с использованием указанных клеток. Для исследования связывания тромбоцитов планшеты (Isoplate, Perkin Elmer, F1450 571) сенсибилизировали коллагеном (Sigma C8897) в TBS в течение 1 часа при комнатной температуре. Лунки дважды промывали TBS и вводили серийно разведенное моноклональное антитело против α2-интегрина. Добавляли только что приготовленную плазму с высоким содержанием тромбоцитов человека или только что выделенные тромбоциты человека, обработанные антикоагулянтом гирудином, PGE1 и ReoPro, метили кальцеином АМ (С-3099, Molecular Probes) и инкубировали в течение 90 минут при комнатной температуре с защитой от света. Планшеты промывали и измеряли в спектрофотометре для прочтения планшетов М5 (Molecular Devices) при длине волны возбуждения 492 нм и длине волны излучения 535 нм. Процентное значение ингибирования и значения IC50 вычисляли на основании кривых титрования, полученных с использованием низкомолекулярных ингибиторов альфа2-интегрина или негуманизированного моноклонального антитела против альфа2-интегрина. Результаты представлены в таблице 12.

Таблица 12
Ингибирование связывания промытых тромбоцитов с коллагеном
Комбинация LC/HC IC50 (мкг/мл)
LC1/HC1 0,021
LC2/HC2 0,092
LC3/HC3 0,012
LC3/HC4 0,016
LC4/HC5 0,057
LC4/HC6 0,068
LC5/HC7 0,031
TMC2206 (компаратор) 0,023

Как видно из результатов, приведенных в таблице 12, ингибирование связывания промытых тромбоцитов разными вариантами антитела против альфа2-интегрина в статических условиях сравнимо с ингибированием антителом-компаратором, при этом некоторые варианты (LC3/HC3 или LC3/HC4) характеризовались даже значительно более сильным или немного (LC1/HC1) более сильным ингибированием.

Таблица 13
Ингибирование связывания тромбоцитов с коллагеном в плазме с высоким содержанием тромбоцитов
Комбинация LC/HC MW IC50 (мкг/мл)
LC1/HC1 0,277
LC2/HC2 3,963
LC3/HC3 0,132
LC3/HC4 0,193
LC4/HC5 3,251
LC4/HC6 4,113
LC5/HC7 0,224
TMC2206 0,110

Как видно из результатов, приведенных в таблице 13, ингибирование связывания тромбоцитов в плазме с высоким содержанием тромбоцитов разными вариантами антитела против альфа2-интегрина в статических условиях, а именно вариантами LC1/HC1, LC3/HC3, LC3/HC4 и LC5/HC7 сравнимо с ингибированием антителом-компаратором.

На основании результатов анализов связывания тромбоцитов в статических условиях можно сделать вывод о том, что гуманизированные формы антитела против α2-интегрина блокируют адгезию только что выделенных тромбоцитов человека в присутствии или в отсутствие плазмы крови в зависимости от концентрации. Четыре варианты характеризуются такой же ингибирующей активностью при выполнении биоанализа, что и негуманизированное моноклональное антитело:

- комбинация LC1/HC1 (мутации, относящиеся только к гуманизации);

- комбинация LC3/HC3 (мутации, относящиеся к гуманизации и стабилизации);

- комбинация LC3/HC4 (мутации, относящиеся к гуманизации, стабилизации и препятствующие агрегации);

- комбинация LC5/HC7 (мутации, относящиеся к гуманизации путем трансплантации).

Три варианта, относящиеся к проблемным сайтам (NS; DS) LC2/HC2, LC4/HC5 и LC4/HC6, которые характеризовались более низким ингибированием тромбоцитов в вышеописанных экспериментах по связыванию тромбоцитов, были идентичны вариантам, обладающим более слабой активностью связывания с I-доменом α2-интегрина по сравнению с негуманизированным антителом против альфа2-интегрина в вышеуказанных экспериментах, выполненных методом Biacore в примере 7 (см. таблицу 11). Таким образом, результаты анализов связывания тромбоцитов хорошо согласуются с данными сродства, полученными при исследовании методом Biacore.

Пример 10. Теплостойкость разных вариантов антитела против альфа2-интегрина

Результаты исследования теплостойкости суммированы в таблице 14. Антитела по настоящему изобретению характеризуются сравнимой, одинаковой или лучшей теплостойкостью по сравнению с компаратором. Измерения теплостойкости производили в термоблоке для ПЦР (My-IQ) в температурном режиме от 10 до 90°С со скоростью изменения температуры 1°С/мин при выполнении двух экспериментов. К двум микрограммам антитела, разведенного в буфере PBS, добавляли оранжевый краситель 40XSYPRO (Invitrogen).

Таблица 14
Теплостойкость разных вариантов
Комбинация LC/HC Температура плавления, °С (1) Температура плавления, °С (2)
LC1/HC1 64 -
LC2/HC2 64 -
LC3/HC3 64 68
LC3/HC4 66 -
LC4/HC5 62 67
LC4/HC6 66 -
LC5/HC7 65 72
ТМС2206 (компаратор) 65 71

1. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент, где указанное антитело или фрагмент специфически связывается с I-доменом α2-интегрина человека, при этом указанное антитело включает домен вариабельной области тяжелой цепи (VH) и домен вариабельной области легкой цепи (VL), где указанное антитело или фрагмент включает следующие компоненты a-f:
(a) LCDR1, где LCDR1 является последовательностью RASESVESYGNSFIY (SEQ ID NO: 6) или имеет вариантную последовательность с по меньшей мере 70% идентичностью с ней;
(b) LCDR2, где LCDR2 является последовательностью LASNLAS (SEQ ID NO: 7) или имеет вариантную последовательность с по меньшей мере 70% идентичностью с ней;
(c) LCDR3, где LCDR3 является последовательностью QQNNEDPYT (SEQ ID NO: 8) или имеет вариантную последовательность с по меньшей мере 70% идентичностью с ней;
(d) HCDR1, где HCDR1 является последовательностью GYTFTSYWMN (SEQ ID NO: 3) или имеет вариантную последовательность с по меньшей мере 70% идентичностью с ней;
(e) HCDR2, где HCDR2 является последовательностью RIDPSDSETHYNQKFK (SEQ ID NO: 4) или имеет вариантную последовательность с по меньшей мере 70% идентичностью с ней; и
(f) HCDR3, где HCDR3 является последовательностью VGRGYFDY (SEQ ID NO: 5) или имеет вариантную последовательность с по меньшей мере 70% идентичностью с ней;
при этом компоненты a)-f) расположены с возможностью связывания антитела или фрагмента с α2-интегрином.

2. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по п. 1, где указанное антитело или его фрагмент обладает перекрестной реактивностью с α2-интегрином примата кроме человека и не обладает перекрестной реактивностью с α2-интегрином вида, отличного от примата.

3. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по п. 1, где выделенное моноклональное антитело или его антигенсвязывающий фрагмент конкурирует с эталонным антителом за связывание с эпитопом эталонного антитела, при этом эталонное антитело включает легкую цепь, являющуюся вариабельным доменом и константной областью согласно последовательности SEQ ID NO: 9, и тяжелую цепь, являющуюся вариабельным доменом и константной областью согласно последовательности SEQ ID NO: 10 или являющуюся вариабельным доменом и константной областью согласно последовательности SEQ ID NO: 11.

4. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, где:
(i) компоненты а)-с) находятся в вариабельном домене легкой цепи (VL); и/или
(ii) компоненты d)-f) находятся в вариабельном домене тяжелой цепи (VH); и/или
(iii) антитело или фрагмент является химерным антителом, гуманизированным антителом, Fab, Fab′, F(ab′)2, Fv, Fv с дисульфидной связью, scFv, (scFv)2, однодоменным антителом, диателом, мультиспецифическим антителом, двуспецифическим антителом, изотипически сходным антителом, антителом с двумя вариабельными доменами и биспецифическим антителом; и/или
(iv) антитело или фрагмент включает константный домен тяжелой цепи иммуноглобулина, выбираемый из группы, состоящей из константного домена IgM человека, константного домена IgG1 человека, константного домена IgG2 человека, константного домена IgG3 человека, константного домена IgG4 человека, константного домена IgE человека и константного домена IgA человека; и/или
(v) вариантная последовательность имеет по меньшей мере на 80%, предпочтительно по меньшей мере на 90%, идентичность с аминокислотной последовательностью любой из SEQ ID NO: 3-8, особенно в тех случаях, когда вариантная последовательность получена из аминокислотных последовательностей любой из SEQ ID NO: 3-8 в результате выполнения одной или нескольких консервативных замен аминокислот; и/или
(vi) антитело или фрагмент включает аминокислотную последовательность:
- SEQ ID NO: 1 или вариантную последовательность, имеющую по меньшей мере 90% идентичность с ней, и/или
- SEQ ID NO: 2 или вариантную последовательность, имеющую по меньшей мере 90% идентичность с ней, и/или
- SEQ ID NO: 9 или ее вариант, и/или
- SEQ ID NO: 10 или вариантную последовательность, имеющую по меньшей мере 90% идентичность с ней, и/или
- SEQ ID NO: 11 или вариантную последовательность, имеющую по меньшей мере 90% идентичность с ней, или
(vii) антитело или фрагмент состоит из аминокислотной последовательности
- SEQ ID NO: 1 или вариантную последовательность, имеющую по меньшей мере 90% идентичность с ней, и
- SEQ ID NO: 2 или вариантную последовательность, имеющую по меньшей мере 90% идентичность с ней, и
- необязательно из 50 дополнительных аминокислотных остатков, предпочтительно из 1-40, более предпочтительно из 1-30, еще предпочтительнее из 1-25, еще предпочтительнее из 1-10, наиболее предпочтительно из 1, 2, 3, 4 или 5 дополнительных аминокислотных остатков; или
(viii) антитело или фрагмент состоит из аминокислотной последовательности
- SEQ ID NO: 9 или варианта, и
- SEQ ID NO: 10 или вариантной последовательности, имеющей по меньшей мере 90% идентичность с ней, и
- необязательно из 50 дополнительных аминокислотных остатков, предпочтительно из 1-40, более предпочтительно из 1-30, еще предпочтительнее из 1-25, еще предпочтительнее из 1-10, наиболее предпочтительно из 1, 2, 3, 4 или 5 дополнительных аминокислотных остатков; или
(ix) антитело или фрагмент состоит из аминокислотной последовательности
- SEQ ID NO: 9 или вариантной последовательности, имеющей по меньшей мере 90% идентичность с ней, и
- SEQ ID NO: 11 или вариантной последовательности, имеющую по меньшей мере 90% идентичность с ней, и
- необязательно из 50 дополнительных аминокислотных остатков, предпочтительно из 1-4 0, более предпочтительно из 1-30, еще предпочтительнее из 1-25, еще предпочтительнее из 1-10, наиболее предпочтительно из 1, 2, 3, 4 или 5 дополнительных аминокислотных остатков.

5. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором:
- вариантная последовательность LCDR1 включает мутацию в положении аминокислоты 11, в частности, 11Asn→Gln; и/или
- вариантная последовательность HCDR2 включает мутацию в положении аминокислоты 6, в частности, 6Asp→Glu; и/или
- вариантная последовательность SEQ ID NO: 1 включает одну или несколько мутаций в положениях аминокислот 9, 12, 15, 22, 34, 46, 47, 80, 83, 85, 87 и/или 89, в частности, выбираемых из группы, состоящей из 9Ala→Ser, 12Ala→Ser, 15Leu→Val, 15Leu→Pro, 22Ser→Thr, 34Asn→Gln, 46Gln→Lys, 47Ala→Pro, 80Asp→Asn, 83Glu→Gln, 85Asp→Glu, 87Ala→Thr и 89Thr→Asn; и/или
- вариантная последовательность SEQ ID NO: 2 включает одну или несколько мутаций в положениях аминокислот 5, 7, 11, 12, 17, 20, 38, 40, 43, 55, 61, 65, 66, 67, 76, 81, 82, 87, 91, 93, 112, 113 и/или 116, в частности, выбираемых из группы, состоящей из 5His→Val, 7Pro→Ser, 11Leu→Val, 12Val→Lys, 17Pro→Ser, 20Leu→Val, 38Lys→Arg, 40Arg→Ala, 43Arg→Gln, 55Asp→Glu, 61Asn→Ala, 65Lys→Gln, 66Asp→Gly, 67Lys→Arg, 76Ser→Thr, 81Ile→Met, 82Gln→Glu, 87Thr→Arg, 91Ser→Thr, 93Val→Lys, 112Thr→Leu, 113Leu→Val и 116Ser→Val.

6. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором указанное антитело или его фрагмент специфически связывается с I-доменом α2-интегрина человека со сродством связывания в нМ диапазоне.

7. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, которое ингибирует взаимодействие α2-интегрина человека с коллагеном in vitro, подавляя активацию тромбоцитов вследствие адгезии указанных тромбоцитов с указанным коллагеном.

8. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором указанный домен вариабельной области тяжелой цепи включает HCDR3 тяжелой цепи SEQ ID NO: 5.

9. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором указанный домен вариабельной области тяжелой цепи включает CDR-области тяжелой цепи SEQ ID NO: 3 (HCDR1), SEQ ID NO: 4 (HCDR2) и SEQ ID NO: 5 (HCDR3) или вариантные последовательности, имеющие по меньшей мере 70% идентичность с ней.

10. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по п. 9, в котором вариантная последовательность HCDR2 включает мутацию Asp→Glu в положении аминокислоты 6.

11. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором указанный домен вариабельной области легкой цепи включает LCDR3 легкой цепи SEQ ID NO: 8.

12. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором указанный домен вариабельной области легкой цепи включает CDR-области легкой цепи SEQ ID NO: 6 (LCDR1), SEQ ID NO: 7 (LCDR2) и SEQ ID NO: 8 (LCDR3) или вариантные последовательности, имеющие по меньшей мере 70% идентичность с ней.

13. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по п. 12, в котором вариантная последовательность LCDR1 включает мутацию Asn→Gln в положении аминокислоты 11.

14. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором последовательность указанного домена вариабельной области тяжелой цепи (VH) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VH SEQ ID NO: 2.

15. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по п. 14, в котором указанный домен вариабельной области тяжелой цепи (VH) включает последовательность SEQ ID NO: 2.

16. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором последовательность указанного домена вариабельной области легкой цепи (VL) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VL SEQ ID NO: 1.

17. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по п. 16, в котором указанный домен вариабельной области легкой цепи (VL) включает последовательность SEQ ID NO: 1.

18. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором указанный домен вариабельной области тяжелой цепи (VH) включает одну или несколько замен аминокислот в положениях, выбираемых из группы, состоящей из Н5, Н7, Н11, Н12, Н17, Н20, Н38, Н40, Н43, Н55, Н61, Н65, Н66, Н67, Н76, Н81, Н82, Н87, Н91, Н93, Н112, Н113 и Н116.

19. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по п. 18, в котором одну или несколько замен аминокислот выбирают из группы, состоящей из 5His→Val, 7Pro→Ser, 11Leu→Val, 12Val→Lys, 17Pro→Ser, 20Leu→Val, 38Lys→Arg, 40Arg→Ala, 43Arg→Gln, 55Asp→Glu, 61Asn→Ala, 65Lys→Gln, 66Asp→Gly, 67Lys→Arg, 76Ser→Thr, 81Ile→Met, 82Gln→Glu, 87Thr→Arg, 91Ser→Thr, 93Val→Lys, 112Thr→Leu, 113Leu→Val и 116Ser→Val.

20. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором указанный домен вариабельной области легкой цепи (VL) включает одну или несколько замен аминокислот в положениях, выбираемых из группы, состоящей из L9, L12, L15, L22, L34, L46, L47, L80, L83, L85, L87 и L89.

21. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по п. 20, в котором одну или несколько замен аминокислот выбирают из группы, состоящей из 9Ala→Ser, 12Ala→Ser, 15Leu→Val, 15Leu→Pro, 22Ser→Thr, 34Asn-Gln, 46Gln→Lys, 47Ala→Pro, 80Asp→Asn, 83Glu→Gln, 85Asp→Glu, 87Ala→Thr и 89Thr→Asn.

22. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором последовательность указанного домена вариабельной области тяжелой цепи (VH) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VH, выбираемой из группы, состоящей из SEQ ID NO: 38 (НС1), SEQ ID NO: 39 (НС2), SEQ ID NO: 40 (HC3), SEQ ID NO: 41 (HC4), SEQ ID NO: 42 (HC5), SEQ ID NO: 43 (HC6) и SEQ ID NO: 44 (HC7).

23. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по п. 22, в котором указанный домен вариабельной области тяжелой цепи (VH) включает последовательность VH, выбираемую из группы, состоящей из SEQ ID NO: 38 (НС1), SEQ ID NO: 39 (НС2), SEQ ID NO: 40 (HC3), SEQ ID NO: 41 (HC4), SEQ ID NO: 42 (HC5), SEQ ID NO: 43 (HC6) и SEQ ID NO: 44 (HC7).

24. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором последовательность указанного домена вариабельной области легкой цепи (VL) по меньшей мере на 90%, 95%, 97% или 99% идентична последовательности VL, выбираемой из группы, состоящей из SEQ ID NO: 33 (LC1), SEQ ID NO: 34 (LC2), SEQ ID NO: 35 (LC3), SEQ ID NO: 36 (LC4) и SEQ ID NO: 37 (LC5).

25. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по п. 24, в котором указанный домен вариабельной области легкой цепи (VL) включает последовательность VL, выбираемую из группы, состоящей из SEQ ID NO: 33 (LC1), SEQ ID NO: 34 (LC2), SEQ ID NO: 35 (LC3), SEQ ID NO: 36 (LC4) и SEQ ID NO: 37 (LC5).

26. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором указанное антитело или его связывающая часть является химерным антителом или гуманизированным антителом.

27. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, в котором антигенсвязывающую часть выбирают из группы, состоящей из Fab, Fab′, F(ab′)2, Fv, Fv с дисульфидной связью, scFv и (scFv)2.

28. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, которое выбирают из группы, состоящей из мультиспецифического антитела, двуспецифического антитела, изотипически сходного антитела, антитела с двумя вариабельными доменами и биспецифического антитела.

29. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, которое включает константный домен тяжелой цепи иммуноглобулина, выбираемый из группы, состоящей из константного домена IgM человека, константного домена IgG1 человека, константного домена IgG2 человека, константного домена IgG3 человека, константного домена IgG4 человека, константного домена IgE человека и константного домена IgA человека.

30. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, которое включает константный домен IgG4 человека.

31. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-3, которое включает или состоит из выделенного моноклонального антитела или его антигенсвязывающего фрагмента.

32. Нуклеиновая кислота, кодирующая выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-31.

33. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-31, предназначенное для применения при лечении, профилактике или диагностике нарушения или заболевания, связанного с α2-интегрином.

34. Нуклеиновая кислота по п. 32, локализованная в векторе.

35. Клетка, гетерологично экспрессирующая нуклеиновую кислоту по п. 32 или 34, содержащая нуклеиновую кислоту по п. 32 или 34.

36. Способ продуцирования выделенного моноклонального антитела или его антигенсвязывающего фрагмента по любому из пп. 1-31, который включает культивирование клетки по п. 35 в условиях, обеспечивающих экспрессию выделенного моноклонального антитела или его антигенсвязывающего фрагмента, и необязательно выделение выделенного моноклонального антитела или его антигенсвязывающего фрагмента из клетки-хозяина.

37. Фармацевтическая композиция, включающая по меньшей мере одно выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-31 в терапервтически эффективном количестве, которая предназначена для применения в качестве лекарственного средства для лечения или профилактики нарушения или заболевания, связанного с α2-интегрином.

38. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по пп. 1-31, предназначенное для лечения или профилактики заболевания или нарушения, связанного с α2-интегрином, предпочтительно выбираемого из группы, состоящей из тромбоза, сосудистого заболевания, рака, включающего развитие кровеносных сосудов и метастазирование, воспаления, воспалительного заболевания, аутоиммунного заболевания и заболевания, характеризующегося аномальным или повышенным развитием кровеносных сосудов, воспалительного заболевания кишечника, болезни Крона, неспецифического язвенного колита, реакций на трансплантат, ретробульбарного неврита, травмы спинного мозга, ревматоидного артрита, системной красной волчанки (SLE), рассеянного склероза, синдрома Рейнауда, экспериментального аутоиммунного энцефаломиелита, синдрома Шегрена, склеродермии, сердечно-сосудистого заболевания, псориаза и инфекций, вызывающих воспалительную реакцию.

39. Фармацевтическая композиция по п. 37, предназначенная для лечения или профилактики заболевания или нарушения, связанного с α2-интегрином, предпочтительно выбираемого из группы, состоящей из тромбоза, сосудистого заболевания, рака, включающего развитие кровеносных сосудов и метастазирование, воспаления, воспалительного заболевания, аутоиммунного заболевания и заболевания, характеризующегося аномальным или повышенным развитием кровеносных сосудов, воспалительного заболевания кишечника, болезни Крона, неспецифического язвенного колита, реакций на трансплантат, ретробульбарного неврита, травмы спинного мозга, ревматоидного артрита, системной красной волчанки (SLE), рассеянного склероза, синдрома Рейнауда, экспериментального аутоиммунного энцефаломиелита, синдрома Шегрена, склеродермии, сердечно-сосудистого заболевания, псориаза и инфекций, вызывающих воспалительную реакцию.

40. Выделенное моноклональное антитело или его антигенсвязывающий фрагмент по пп. 1-31, предназначенное для лечения или профилактики сосудистого заболевания и/или тромбоза, в частности для лечения острого коронарного синдрома, окклюзии коронарной артерии, ишемического инсульта, стеноза сонной артерии или окклюзии периферических артерий.

41. Фармацевтическая композиция по п. 37, предназначенная для лечения или профилактики сосудистого заболевания и/или тромбоза, в частности для лечения острого коронарного синдрома, окклюзии коронарной артерии, ишемического инсульта, стеноза сонной артерии или окклюзии периферических артерий.

42. Способ диагностики заболевания, ассоциированного с измененным α2-интегрином, который включает:
a) контактирование образца, включающего α2-интегрин, с выделенным моноклональным антителом или его антигенсвязывающим фрагментом по любому из пп. 1-31;
b) обнаружение связывания α2-интегрина с выделенным моноклональным антителом или его антигенсвязывающим фрагментом по любому из пп. 1-31, и
c) сравнение связывания, обнаруженного на стадии b), с эталонным образцом,
при этом измененное связывание α2-интегрина в образце относительно связывания в эталонном образце указывает на наличие заболевания.

43. Набор для лечения заболевания или нарушения, в частности заболевания или нарушения, связанного с α2-интегрином, включающий:
a) упаковочный материал,
b) выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-31 или 33 или его фармацевтически приемлемую соль, или фармацевтическую композицию по любому из пп. 37, 39 и 41,
c) этикетку или вкладыш, находящийся внутри упаковочного материала, с информацией о том, что указанное антитело или его фрагмент позволяет эффективно лечить заболевание или нарушение, в частности заболевание или нарушение, связанное с α2-интегрином.

44. Диагностический набор, предназначенный для диагностики нарушения или заболевания, связанного с α2-интегрином, который включает выделенное моноклональное антитело или его антигенсвязывающий фрагмент по любому из пп. 1-31, приемлемую упаковку и, возможно, соответствующие инструкции по использованию указанного антитела или его фрагмента для обнаружения α2-интегрина.

45. Способ лечения нарушения или заболевания, связанного с α2-интегрином, который включает использование одного или нескольких выделенных моноклональных антител или их антигенсвязывающий фрагментов по любому из пп. 1-31 и/или нуклеиновую кислоту по п. 32 или 34 или одну из фармацевтических композиций по любому из пп. 37, 39 и 41.

46. Способ диагностики нарушения или заболевания, связанного с α2-интегрином, который включает использование одного или нескольких выделенных моноклональных антител или их антигенсвязывающий фрагментов по любому из пп. 1-31 и/или нуклеиновую кислоту по п. 32 или 34 или одну из фармацевтических композиций по любому из пп. 37, 39 и 41.

47. Способ диагностики заболевания, ассоциированного с измененным α2-интегрином, который включает:
a) контактирование образца, полученного у субъекта, с выделенным моноклональным антителом или его антигенсвязывающим фрагментом по любому из пп. 1-31;
b) обнаружение связывания α2-интегрина с выделенным моноклональным антителом или его антигенсвязывающим фрагментом; и
c) сравнение связывания, обнаруженного на стадии b), со связыванием α2-интегрина с выделенным моноклональным антителом или его антигенсвязывающим фрагментом в одном или нескольких эталонных образцах;
при этом измененное связывание в полученном образце, относительно связывания, обнаруженного в одном или нескольких эталонных образцах, указывает на наличие заболевания.



 

Похожие патенты:

Изобретение относится к биохимии. Описано рекомбинантное антитело, его фрагмент, нейтрализующие VEGF человека, содержащие вариабельную область тяжелой цепи (VH), где VH содержит CDRH1, CDRH2 и CDRH3 последовательности SEQ ID NO: 8, SEQ ID NO: 20 и SEQ ID NO: 32 соответственно, и вариабельную область легкой цепи (VL), где VL содержит CDRL1, CDRL2 и CDRL3 последовательности SEQ ID NO: 43, SEQ ID NO: 55 и SEQ ID NO: 66 соответственно и где вариабельная область тяжелой цепи содержит аминокислотную последовательность SEQ ID NO: 164 и вариабельная область легкой цепи содержит аминокислотную последовательность SEQ ID NO: 87.

Изобретение относится к биотехнологии. Предложено выделенное антитело, которое специфически связывается по меньшей мере с одним из собачьего интерлейкина-31 (IL-31) или кошачьего IL-31.

Настоящее изобретение относится к области иммунологии. Предложено выделенное биспецифическое антитело, которое связывается с двумя различными областями белка 6 рецептора липопротеинов низкой плотности (LRP6).

Изобретение относится к биохимии. Описано применение антител или их фрагментов, которые специфично связывают hDH4 и блокируют взаимодействие между Dll4 и Notch-рецептором для предупреждения, лечения или ослабления сахарного диабета 1-го типа у субъекта.

Изобретение относится к области биохимии. Представлено гуманизированное антитело или его фрагмент, способные связываться с интерлейкином-10 (IL-10).

Данное изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5 человека, охарактеризованное последовательностями гипервариабельных участков (HVR), и его антигенсвязывающий фрагмент.

Изобретение относится к области иммунологии и медицины. Предложено применение антитела или его антиген-связывающего фрагмента, которые специфически связываются с дельта-подобным лигандом 4 (Dll4) человека, в предупреждении рецидивирования рассеянного склероза или снижении развития данного заболевания при его рецидивировании у субъекта.

Группа изобретений относится к области фармакологии и медицины и касается стабильной фармацевтической композиции, содержащей антитело против TNF-альфа и адипиновую кислоту или адипат, а также применения указанной композиции для лечения, по меньшей мере, одного патологического состояния, выбранного из группы, включающей аутоиммунные заболевания, инфекционные болезни, неопластические заболевания, болезни нервной системы.

Группа изобретений относится к медицине и касается способа определения резистентности субъекта к лечению рака с использованием 2,2-диметил-N-((S)-6-оксо-6,7-дигидро-5Н-дибензо[b,d]-азепин-7-ил)-N′-(2,2,3,3,3-пентафторпропил)малонамида, включающего измерение уровня биомаркера, присутствующего в биологическом образце, полученном у упомянутого субъекта, где биомаркер представляет собой IL6 и/или IL8, и где повышенный уровень IL6 и/или IL8 свидетельствует о наличии резистентности к указанному лечению.
Изобретение относится к медицине и касается способа получения продукта, содержащего иммуноглобулины G, A, M, при котором в качестве исходного сырья используют осадки фракции Кона, которые гомогенизируют с получением суспензии, которую обрабатывают хлороформом, перемешивают, выдерживают, центрифугируют, формируют осадок с последующим удалением балластных фракций дополнительным центрифугированием, выделяют целевой продукт с последующим розливом, замораживанием и высушиванием.

Изобретение относится к области фармацевтики и биотехнологии, а именно касается новой стабильной композиции антитела, специфически связывающегося с HER2 рецепторами, как в лиофилизированной форме, которая может быть восстановлена растворителем, так и в виде концентрированного раствора, а также способа получения композиции. Изобретение может быть использовано для создания готовой лекарственной формы препарата, а также для приготовления раствора для инфузий, применяемых для лечения НЕR2-положительных опухолей. 2 н. и 7 з.п. ф-лы, 1 ил, 3 табл., 21 пр.

Предложена группа изобретений, касающихся лечения злокачественных опухолей. Заявлены: применение 2-амид-1-({4-метил-5-[2-(2,2,2-трифтор-1,1-диметил-этил)пиридин-4-ил]тиазол-2-ил}амид) (S)-пирролидин-1,2-дикарбоновой кислоты или её соли для производства фармацевтических композиций для лечения злокачественной опухоли, комбинация данного соединения с EGFR-модуляторами в целях указанного использования, способ лечения указанного заболевания с помощью этого соединения, и фармацевтические композиции для лечения указанного заболевания. Технический результат: показана регрессия опухоли под действием заявленного соединения, показан синергизм противоопухолевого действия указанного соединения в комбинации с EGFR-модулятором. 4 н. и 6 з.п. ф-лы, 7 ил., 3 табл., 6 пр.

Группа изобретений раскрывает комбинации антитела к CD20 типа II, которое представляет собой созданное с помощью гликоинженерии гуманизированное антитело B-Ly1, где гуманизированное антитело B-Ly1 имеет вариабельную область тяжелой цепи (VH) SEQ ID No. 7 и вариабельную область легкой цепи (VL) SEQ ID No. 20, и химиотерапевтических средств, выбранных из группы, включающей циклофосфамид, винкристин и доксорубицин, предназначенные для лечения B-клеточной неходжкинской лимфомы, а также применение вышеуказанного антитела для приготовления лекарственного средства. Группа изобретений эффективна в лечении B-клеточной неходжкинской лимфомы. 2 н. и 3 з.п. ф-лы, 4 ил., 3 табл., 4 пр.

Изобретение относится к области биохимии. Заявлено антитело, связывающееся с рецептором клеточной поверхности DR5. Антитело проявляет цитотоксическую активность против клеток, экспрессирующих содержащий домен гибели рецептор, посредством апоптоза. Также изобретение относится к полинуклеотиду, вектору, клеткам-хозяевам для получения указанного антитела, а также к фармацевтическим композициям и способам лечения и профилактики злокачественного новообразования, аутоиммунного заболевания или воспалительного заболевания. Изобретение позволяет усилить цитотоксическую активность антитела против DR5 и индуцировать апоптоз в клетках, а также позволяет достичь эффективного терапевтического действия при лечении пациента антителом по изобретению. 11 н. и 33 з. п. ф-лы, 58 ил., 14 пр.

Настоящая группа изобретений относится к медицине, а именно к дерматологии, и касается лечения псориаза. Для этого вводят антитело к IL-17 в эффективных дозах в соответствии с разработанной схемой введения. Это обеспечивает эффективное лечение псориаза, в том числе его рецидивов, без обострения заболевания. 5 н. и 13 з.п. ф-лы, 11 ил., 11 табл., 6 пр.

Изобретение относится к биохимии. Представлено химерное, CDR-привитое, гуманизированное или рекомбинантное человеческое антитело или его фрагмент, который специфически связывается с человеческим EFNA4. Также представлен конъюгат указанного антитела с цитотоксическим агентом. Представлена фармацевтическая композиция и способ лечения EFNA4-ассоциированного расстройства. Изобретение расширяет арсенал средств борьбы с EFNA4-ассоциированными расстройствами. 10 н. и 41 з.п. ф-лы, 20 ил., 5 табл., 20 пр.
Наверх