Устойчивые к глифосату растения и способы, связанные с ними



Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними
Устойчивые к глифосату растения и способы, связанные с ними

 


Владельцы патента RU 2627169:

ДАУ АГРОСАЙЕНСИЗ ЭлЭлСи (US)

Изобретение относится к области биохимии, в частности к выделенной молекуле нуклеиновой кислоты для обеспечения в растении устойчивости к глифосату, а также к экспрессирующему вектору, клетке-хозяину, растения, части растения, семени растения, культуре ткани растения, ее содержащего. Также раскрыты способ получения трансгенного растения, части растения, органа растения, семени растения или клетки растения, которая устойчива к глифосату, и способ обеспечения устойчивости к глифосату в растении и использование вышеуказанной молекулы нуклеиновой кислоты. Изобретение также относится к способу борьбы с сорняками на возделываемой посевной площади, содержащей устойчивые к гербицидам растения или устойчивые к гербицидам семена растения, предусматривающему внесение на возделываемую посевную площадь достаточного количества глифосата для борьбы с сорняками на возделываемой посевной площади без существенного влияния на указанные семя или растение. Изобретение позволяет эффективно получать устойчивое к глифосату трансгенное растение. 13 н. и 14 з.п. ф-лы, 17 ил., 9 табл., 18 пр.

 

ПРИТЯЗАНИЕ НА ПРИОРИТЕТ

По настоящей заявке испрашивается приоритет по временной патентной заявке США с серийным № 61/593555, поданной 1 февраля 2012 года, и также по временной патентной заявке США с серийным № 61/625222, поданной 17 апреля 2012 года.

ПОЛОЖЕНИЕ В СООТВЕТСТВИИ С 37 C.F.R. § 1.821(c) или (e) - СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ, ПРЕДОСТАВЛЕННЫЙ В КАЧЕСТВЕ ТЕКСТОВОГО ФАЙЛА ASCII

В соответствии с 37 C.F.R. § 1.821(c) или (e), файл, содержащий текстовую версию ASCII списка последовательностей, предоставлен совместно с настоящей заявкой, содержание которого включено в настоящее описание в качестве ссылки.

ОБЛАСТЬ ТЕХНИКИ

Настоящее изобретение относится к новым и особым растениям, которые содержат DGT-14, а также к способам, связанным с ними. Некоторые варианты осуществления относятся к новым полипептидам, вовлеченным в метаболизм N-(фосфонометил)глицина, нуклеиновым кислотам, кодирующим такие полипептиды, и к способам их идентификации. Конкретные варианты осуществления относятся к растениям, частям растений и клеткам растений, которые содержат указанные выше полипептиды и/или нуклеиновые кислоты.

УРОВЕНЬ ТЕХНИКИ

Виды сорных растений давно являются проблемой на возделываемых полях. Хотя борьба с сорняками является трудоемкой работой, она упростилась благодаря доступности эффективных уничтожающих сорняки химических гербицидов. Повсеместное применение гербицидов, совместно с усовершенствованными сортами сельскохозяйственных растений и удобрениями для них, внесло значительный вклад в "зеленую революцию" в сельском хозяйстве. В частности, пригодными являются гербициды, которые обладают широким спектром гербицидной активности. К сожалению, гербициды широкого спектра, как правило, обладают вредоносным эффектом на сельскохозяйственные культуры, подвергнутые воздействию гербицида. Одним из способов преодоления этой проблемы является получение растений, устойчивых к определенным гербицидам широкого спектра.

Одним примером гербицида широкого спектра является N-фосфонометилглицин, также известный как глифосат. Глифосат широко используется фермерами по всему миру для борьбы с сорняками перед посевом культуры, например, при нулевой обработке почвы. Кроме того, глифосат является эффективным средством для борьбы с сорняками и самосевными растениями между циклами производства или чередованием культур. Глифосат не переносится в почву после внесения, и он повсеместно считается одним из наиболее безопасных для окружающей среды и широкоэффективных химических гербицидов, доступных для применения в сельском хозяйстве.

Глифосат уничтожает растения путем ингибирования каскада шикимовой кислоты. Этот каскад приводит к биосинтезу ароматических соединений, включая аминокислоты, витамины и гормоны растений. Глифосат блокирует конденсацию фосфоенолпировиноградной кислоты (PEP) и 3-фосфошикимовой кислоты в 5-енолпирувил-3-фосфошикимовую кислоту путем связывания и ингибирования активности фермента 5-енолпирувилшикимат-3-фосфатсинтазы, обычно обозначаемой как "EPSP-синтаза" и "EPSPS."

К сожалению, неизвестны сельскохозяйственные культуры, которые естественным образом устойчивы к глифосату, и, таким образом, применимость этого гербицида для борьбы с сорняками в сельскохозяйственных культурах была ограничена. Одним из способов получения устойчивых к глифосату сельскохозяйственных культур является введение гена, кодирующего гетерологичную устойчивую к глифосату форму гена EPSPS, в культурное растение с использованием способов генной инженерии. С использованием химического мутагенеза были получены устойчивые к глифосату формы EPSPS в бактериях, и гетерологичные гены были введены в растения с получением устойчивых к глифосату растений (смотрите, например, Comai et al. Science 221:370-71 (1983)). Гетерологичные гены EPSPS обычно сверхэкспрессируют в сельскохозяйственных культурах с получением желаемого уровня устойчивости.

Указанные выше примеры из уровня техники и ограничения, связанные с ними, являются иллюстративными, но не исключающими. Другие ограничения уровня техники станут понятными специалистам в данной области при прочтении описания.

ОПИСАНИЕ

В вариантах осуществления изобретение относится к растению, части растения, органу растения, семени растения и/или клетке растения, содержащим нуклеиновую кислоту, кодирующую полипептид, обладающий по меньшей мере 90% идентичностью с SEQ ID NO:1.

В следующих вариантах осуществления изобретение относится к способам получения растения, части растения, органа растения, семени растения и/или клетки растения, устойчивых к глифосату, включающим: трансформацию растения, части растения, органа растения, семени растения и/или клетки растения нуклеиновой кислотой, кодирующей полипептид, обладающий по меньшей мере 90% идентичностью с SEQ ID NO:1; и экспрессию нуклеиновой кислоты так, чтобы получить полипептид, обладающий по меньшей мере 90% идентичностью с SEQ ID NO:1.

Варианты осуществления включают векторы, содержащие нуклеиновую кислоту, кодирующую полипептид, обладающий по меньшей мере 90% идентичностью с SEQ ID NO:1.

Конкретные примеры включают векторы, содержащие нуклеиновую кислоту, кодирующую полипептид, обладающий по меньшей мере 95% идентичностью с SEQ ID NO:1.

Другие варианты осуществления включают векторы, содержащие последовательность нуклеиновой кислоты, обладающую по меньшей мере 90% идентичностью с SEQ ID NO:2 или SEQ ID NO:3. Например, вектор может содержать последовательность нуклеиновой кислоты, обладающую по меньшей мере 90% идентичностью с SEQ ID NO:2 или SEQ ID NO:3.

Варианты осуществления включают устойчивые к глифосату растения и клетки растений, экспрессирующие полипептид, обладающий по меньшей мере 90% идентичностью с SEQ ID NO:1.

Дополнительные варианты осуществления включают способы борьбы с сорняками на поле или возделываемой посевной площади с устойчивыми к глифосату растениями, где такой способ может включать: посев растения или семени растения, содержащих нуклеиновую кислоту, кодирующую полипептид, обладающий по меньшей мере 90% идентичностью с SEQ ID NO:1, на поле или возделываемую посевную площадь; и внесение на поле или возделываемую посевную площадь достаточного количества глифосата для борьбы с сорняками на поле без существенного повреждения растения.

В некоторых вариантах осуществления изобретение относится к способным к регенерации клеткам для применения в тканевой культуре растений, устойчивых к глифосату. Такая тканевая культура может быть способна регенерировать растения, обладающие физиологическими и морфологическими характеристиками указанных выше устойчивых к глифосату растений, а также регенерировать растения, имеющие по существу тот же генотип, что и у указанных выше растений. Способные к регенерации клетки в таких тканевых культурах могут представлять собой, например, зародышей, протопласты, клетки меристемы, каллюс, пыльцу, листья, пыльники, корни, корневые кончики, цветки, семена, стручки и стебли. Конкретные варианты осуществления относятся к растениям, способным регенерировать из культур тканей в соответствии с вариантами осуществления изобретения.

В некоторых вариантах осуществления изобретение относится к клеткам, которые не регенерируют с образованием растений, например, для применения для получения линий клеток растений, устойчивых к глифосату. В других вариантах осуществления изобретение относится к растениям, частично содержащим такие клетки.

В определенных вариантах осуществления настоящее изобретение относится к внесению множества гербицидов в сельскохозяйственные культуры, посеянные на возделываемой посевной площади. Поверхностное внесение глифосата в дополнение к нескольким гербицидам обладает преимуществом, состоящим в различных гербицидных свойствах, так что обеспечивается борьба с сорняками с усовершенствованной комбинацией универсальности и экономичности. Например, отдельные гербициды имеют различный срок действия на возделываемой посевной площади; т.е. некоторые гербициды остаются и являются эффективными в течение относительно длительного периода времени после их внесения на площадь, в то время как другие гербициды могут быстро разлагаться на другие и/или неактивные соединения. Усовершенствованная система использования гербицидов в соответствии с конкретными вариантами осуществления позволяет использовать глифосат и несколько гербицидов так, чтобы растениеводы могли адаптировать выбор конкретных гербицидов для применения в конкретной ситуации.

В других вариантах осуществления настоящее изобретение относится к способам и композициям для получения и применения растения, которое является устойчивым более чем к одному гербициду или классу или подклассу гербицидов, как описано ниже. В конкретных вариантах осуществления предусматривается растение, которое является устойчивым как к глифосату, так и по меньшей мере к одному другому гербициду (или классу или подклассу гербицидов) или химическому реагенту (или классу или подклассу другого химического реагента) (например, фунгициды, инсектициды, регуляторы роста растений и т.п.). Такие растения могут быть применимы, например, в способах, включающих обработку сельскохозяйственных культур несколькими гербицидами. Таким образом, изобретение относится к устойчивым к гербицидам растениям, которые выдерживают обработку гербицидом или комбинацией гербицидов (включая комбинацию гербицидов, каждый из которых действует посредством отличающегося механизма действия) или комбинацией по меньшей мере одного гербицида и по меньшей мере одного другого химического реагента, включая фунгициды, инсектициды, регуляторы роста растений и т.д. Таким образом, в настоящем описании описаны усовершенствованные способы выращивания сельскохозяйственных культур, в которых осуществляется селективная борьба с сорняками.

В одном варианте осуществления устойчивые к гербицидам растения содержат молекулу нуклеиновой кислоты, которая кодирует гетерологичный полипептид, который сообщает устойчивость к глифосату, и молекулу нуклеиновой кислоты, кодирующую полипептид, который сообщает устойчивость к 2,4-дихлорфеноксиуксусной кислоте (2,4-D). В соответствии с представленными выше абзацами предусматриваются растения, которые содержат по меньшей мере третью молекулу нуклеиновой кислоты, кодирующую полипептид, сообщающий растению признак, выбранный из группы, состоящей из признака устойчивости к гербицидам; признака устойчивости к насекомым; агрономического признака; признака устойчивости к заболеванию; признака модифицированной жирной кислоты; или признака сниженного содержания фитатов.

В другом варианте осуществления устойчивые к гербицидам растения содержат гетерологичную молекулу нуклеиновой кислоты, которая кодирует полипептид, который сообщает устойчивость к глифосату, и молекулу нуклеиновой кислоты, кодирующую полипептид, который сообщает устойчивость к глюфосинату. Некоторые примеры включают устойчивое к гербицидам растение, содержащее по меньшей мере третью молекулу нуклеиновой кислоты, которая кодирует полипептид, сообщающий растению признак устойчивости к гербицидам; признак устойчивости к насекомым; агрономический признак; признак устойчивости к заболеванию; признак модифицированной жирной кислоты или признак сниженного содержания фитатов.

В другом варианте осуществления устойчивое к гербицидам растение содержит молекулу нуклеиновой кислоты, которая кодирует полипептид, который сообщает устойчивость к глифосату, и молекулу нуклеиновой кислоты, кодирующую полипептид, который сообщает устойчивость к гербициду, который ингибирует ацетолактатсинтазу (ALS) (Lee et al. (1988) EMBO J. 7:1241), также известный как фермент синтаза ацетогидроксикислот (AHAS) фермент (Miki et al. (1990) Theor. Appl. Genet. 80:449). Таким образом, кроме того, предусматриваются растения, содержащие по меньшей мере третью молекулу нуклеиновой кислоты, которая кодирует полипептид, сообщающий растению признак устойчивости к гербицидам; признак устойчивости к насекомым; агрономический признак; признак устойчивости к заболеванию; признак модифицированной жирной кислоты или признак сниженного содержания фитатов.

В другом варианте осуществления любые молекулы нуклеиновой кислоты можно комбинировать или "пакетировать" с любой молекулой нуклеиновой кислоты для обеспечения дополнительной устойчивости к глифосату или другому гербициду, и/или для обеспечения устойчивости к отдельным насекомым или заболеваниям, и/или усиленного питания, и/или улучшенных агрономических характеристик, и/или белков или других продуктов, пригодных в кормах, продуктах питания, в промышленных, фармацевтических и/или в других применениях. Варианты осуществления включают пакетирование двух или более представляющих интерес последовательностей нуклеиновых кислот в геноме растения. Такое "пакетирование" можно осуществлять посредством общепринятого разведения растений с использованием двух или более трансгенных объектов, трансформации растения конструкцией, которая содержит представляющие интерес последовательности, повторной трансформации трансгенного растения или добавления новых признаков посредством направленного встраивания способом гомологичной рекомбинации. Примером такого пакетирования является любая из следующих комбинаций: молекула нуклеиновой кислоты dgt-14, молекула нуклеиновой кислоты Cry34Ab1, молекула нуклеиновой кислоты Cry35Ab1, молекула нуклеиновой кислоты Cry1F, молекула нуклеиновой кислоты Cry1Ac, молекула нуклеиновой кислоты aad-12, молекула нуклеиновой кислоты aad-1, молекула нуклеиновой кислоты pat и молекула нуклеиновой кислоты DSM-2.

В дополнение к иллюстративным аспектам и вариантам осуществления, описанным выше, дополнительные аспекты и варианты осуществления станут очевидными при помощи изучения представленного ниже описания.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фиг. 1 представлено частичное выравнивание последовательностей DGT-14 (SEQ ID NO:46), DGT-11 (SEQ ID NO:47), DGT-12 (SEQ ID NO:49), DGT-18 (SEQ ID NO:50), DGT-29 (SEQ ID NO:53) и DGT-30 (SEQ ID NO:52) с другими ферментами EPSP-синтазами, такими как: grg-23 (SEQ ID NO:54; взятая из патента США № 7834249), CP4 (SEQ ID NO:48; GENBANK ACC № AEM75108.1) из Agrobacterium tumefaciens, DGT-3 (SEQ ID NO:57; GENBANK ACC № P17688) из Brassica napus, DGT-1 (SEQ ID NO:56) из Glycine max, DGT-7 (SEQ ID NO:55; GENBANK ACC № EU977181) из Triticum aestivum и aroA (SEQ ID NO:51; Padgette et al., (1991); Eschenburg et al.,(2002); Priestman et al., (2005); Haghani et al., (2008) из Escherichia coli. Все шесть ферментов DGT (DGT-14, DGT-11, DGT-12, DGT-18, DGT-30 и DGT-29) обладают консервативным аланином в положении аминокислоты 96 фермента EPSP-синтазы aroA. Положение этой аминокислоты указано звездочкой, и аминокислотный остаток подчеркнут.

На фиг. 2 представлено выравнивание полноразмерных ферментов DGT-1 (SEQ ID NO:59) из Glycine max, DGT-3 (SEQ ID NO:58; GENBANK ACC № P17688) из Brassica napus, и DGT-7 (SEQ ID NO:60; GENBANK ACC № EU977181) из Triticum aestivum. Положение аминокислотного остатка, в котором была внесена мутация с глицина на аланин, указано первой звездочкой. Положение аминокислотного остатка, в котором была внесена мутация с тероина на изолейцин, указано второй звездочкой. Положение третьего аминокислотного остатка, в котором была внесена мутация с пролина на серин, указано третьей звездочкой.

На фиг. 3 представлена карта плазмиды pDAB100427.

На фиг. 4 представлена карта плазмиды pDAB102946.

На фиг. 5 представлена карта плазмиды pDAB100431.

На фиг. 6 представлена карта плазмиды pDAB100432.

На фиг. 7 представлена карта плазмиды pDAB100435.

На фиг. 8 представлена карта плазмиды pDAB100446.

На фиг. 9 представлена карта плазмиды pDAB100436.

На фиг. 10 представлены величины IC50, полученные после внесения различных мутаций в DGT-1 (A) и DGT-7 (B) с использованием 1 мМ PEP. Для кривых IC50, как A, так и B, закрашенные треугольники соответствуют дикому типу, закрашенные круги соответствуют мутантам GA, незакрашенные квадраты соответствуют мутантам GAPS, и закрашенные квадраты соответствуют мутантам TIPS.

На фиг. 11 представлена карта плазмиды pDAB107526.

На фиг. 12 представлена карта плазмиды pDAB102787.

На фиг. 13 представлена карта плазмиды pDAB105525.

На фиг. 14 представлена карта плазмиды pDAB105526.

На фиг. 15 представлена карта плазмиды pDAB105527.

На фиг. 16 представлена карта плазмиды pDAB105528.

На фиг. 17 представлена карта плазмиды pDAB105529.

СПОСОБ(Ы) ОСУЩЕСТВЛЕНИЯ ИЗОБРЕТЕНИЯ

Кодон-оптимизированные молекулы нуклеиновой кислоты dgt-14, описанные в настоящем описании, пригодны в широком множестве применений, где в растении может быть использована устойчивость к гербициду глифосату.

При указании на растения, которые являются резистентными или устойчивыми к глифосату, подразумевают, что применение достаточного количества глифосата к растению не оказывает значительного влияния или не уничтожает растение. Растение может быть естественным образом устойчивым к конкретному гербициду или оно может быть устойчивым к гербициду в результате действий человека, например, таких как селекция или внесение трансгена в геном растения. "Устойчивое к глифосату растение" представляет собой растение, содержащее полипептид или молекулу нуклеиновой кислоты, которые сообщают устойчивость к гербициду растению или другому организму, экспрессирующему их (т.е. делают растение или другой организм устойчивыми к гербициду). Растения, которые являются резистентными или устойчивыми к глифосату, могут демонстрировать некоторый минимальный эффект вследствие применения глифосата к растению. Например, может происходить изменение нормального роста и развития растения, где растение может проявлять признаки или симптомы, которые ассоциированы со стрессом или заболеванием. Такой минимальный эффект вследствие применения глифосата к растениям, которые являются резистентными или толерантными к глифосату, отличается от неблагоприятного эффекта, который является результатом применения глифосата к растениям, которые чувствительны к глифосату. Применение глифосата к чувствительным растениям может значительно влиять на растение или вызывать его гибель. Применение глифосата к растениям, содержащим молекулу нуклеиновой кислоты, которая сообщает устойчивость, приводит к значительно меньшему влиянию, чем применение к растениям, не содержащим молекулу нуклеиновой кислоты, которая сообщает устойчивость к глифосату.

Таким образом, растение является устойчивым к гербициду или другому химическому реагенту, если оно демонстрирует повреждение по сравнению с соответствующим контрольным растением, которое является меньшим, чем повреждение, которое проявляет контрольное растение, по меньшей мере на 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900% или 1000% или более. Таким образом, растение, которое является устойчивым к гербициду или другому химическому реагенту, демонстрирует увеличенную устойчивость по сравнению с соответствующим контрольным растением. Повреждение в результате гербицида или другой химической обработки оценивают путем оценки любого параметра роста или благополучия растения, который сочтет подходящим специалист в данной области. Повреждение можно оценивать путем визуального исследования и/или посредством статистического анализа пригодных параметров индивидуальных растений или группы растений. Таким образом, повреждение можно оценивать путем оценки, например, параметров, таких как рост растения, масса растения, цвет листьев, длина листьев, цветение, способность к размножению, выметывание пестичных столбиков, выход, продукция семян и т.д. Повреждение также можно оценивать путем оценки времени, прошедшего до конкретной стадии развития (например, выметывание пестичных столбиков, цветение и сбрасывание пыльцы), или времени, пошедшего до тех пор, пока растение не восстановится после обработки конкретным химическим реагентом и/или гербицидом.

При проведении такой оценки, конкретным степеням повреждения можно приписывать конкретные величины так, чтобы можно было проводить статистический анализ или количественные сравнения. Использование диапазонов величин для описания конкретных степеней повреждения известно в данной области, и можно использовать любой походящий диапазон или шкалу. Например, можно присваивать показатели повреждения гербицидом (также называемые показателями устойчивости). Как указано выше, на устойчивость к гербициду также указывают другие оценки на этой школе, где соответствующее контрольное растение проявляет более низкий показатель по шкале, или где группа соответствующих контрольных растений проявляет статистически более низкий показатель в ответ на обработку гербицидом, чем группа индивидуальных растений.

Повреждение, вызываемое гербицидом или другим химическим реагентом, можно оценивать в различные моменты времени после обработки растения гербицидом. Часто повреждение оценивают приблизительно в момент времени, когда контрольное растение проявляет максимальное повреждение. Иногда повреждение оценивают после периода времени, на протяжении которого контрольное растение, которое не было обработано гербицидом или другим химическим реагентом, выросло и/или развилось на поддающемся измерению уровне по сравнению с размером или стадией, при которых проводили обработку. Повреждение можно оценивать в любой из множества подходящих периодов времени, например, через 12 часов или через 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 и/или 14 суток; или через три недели, четыре недели, или более, после того, как растение обработали гербицидом. Является пригодным любой момент времени оценки при условии, что он позволяет обнаружение различий в ответ на обработку исследуемого и контрольного растений.

Гербицид не вызывает "значительного повреждения" растения, либо когда он не имеет эффекта на растение, либо когда он имеет некоторый эффект на растение, после которого растение впоследствии восстанавливается, либо когда он имеет эффект на растение, который является вредоносным, но который уравновешивается, например, воздействием конкретного гербицида на сорняки. Таким образом, например, сельскохозяйственная культура может "не повреждаться значительно" гербицидом или другой обработкой, если она проявляет менее чем 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% или 1% снижение по меньшей мере одного подходящего параметра, который указывает на здоровье и/или продуктивность растения, по сравнению с соответствующим контрольным растением (например, необработанная сельскохозяйственная культура). Подходящие параметры, которые указывают на здоровье и/или продуктивность растения, включают, например, высоту растения, вес растения, длину листа, время, прошедшее до конкретной стадии развития, цветение, выход, продукцию семян и т.д. Оценку параметра можно проводить путем визуального исследования и/или посредством статистического анализа любого подходящего параметра. Сравнение можно проводить путем визуального исследования и/или с помощью статистического анализа. Таким образом, сельскохозяйственная культура не "повреждается значительно" гербицидом или другой обработкой, если она проявляет снижение по меньшей мере одного параметра, однако это снижение имеет временный характер и растение полностью восстанавливается в пределах 1 недели, 2 недель, 3 недель, 4 недель или 6 недель.

Напротив, растение значительно поражается или повреждается гербицидом или другой обработкой, если оно проявляет более чем 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 150% или 170% снижение по меньшей мере одного подходящего параметра, который указывает на здоровье и/или продуктивность растения, по сравнению с соответствующим контрольным растением (например, необработанный сорняк того же вида). Таким образом, растение значительно повреждается, если оно проявляет снижение по меньшей мере одного параметра и растение не восстанавливается полностью в пределах 1 недели, 2 недель, 3 недель, 4 недель или 6 недель.

Повреждение в результате обработки гербицидом или другой химической обработки растения специалист в данной области оценивает путем визуального исследования или другим подходящим способом, и оценивает с помощью статистического анализа подходящих параметров. Оцениваемое растение называют "исследуемым растением". Как правило, соответствующее контрольное растение представляет собой растение, которое экспрессирует тот же полипептид(ы) устойчивости к гербицидам, что и растение, оцениваемое на устойчивость к гербициду (т.е. "исследуемое растение"), но которое не было обработано гербицидом.

Если не определено иначе, все технические и научные термины, используемые в настоящем описании, обладают тем же значением, которое обычно подразумевает специалист в области, к которой относится настоящее изобретение. В случае противоречия, настоящая заявка, включая определения, будет решающей. Если иное не требуется контекст, термины в единственном числе включают термины во множественном числе, и термины во множественном числе включают термины в единственном числе. Все публикации, патенты и другие ссылки, упомянутые в настоящем описании, включены в качестве ссылок в полном объеме для всех целей, как если бы было конкретно и индивидуально указано, что каждая индивидуальная публикация или патентная заявка включена в качестве ссылки, если не указано, что только конкретные разделы патентов или патентных публикаций включены в качестве ссылки.

Чтобы далее пояснить настоящее изобретения, предоставлены следующие термины, сокращения и определения.

Как используют в рамках изобретения, термины "содержит", "содержащий", "включает", "включающий", "имеет", "имеющий", "вмещает" и "вмещающий" и их любые другие варианты являются неисключающими или открытыми. Например, композиция, смесь, процесс, способ, изделие или устройство, которые содержат перечень элементов, не обязательно ограничиваются только этими элементами, а могут включать другие элементы, не приведенные явно или не являющиеся присущими такой композиции, смеси, процессу, способу, изделию или устройству. Кроме того, если явно не указано иное, "или" относится к включающему "или", но не исключающему "или". Например, условие A или B удовлетворяется любому из следующих: A является истинным (или присутствует) и B является ложным (или отсутствует); A является ложным (или отсутствует) и B является истинным (или присутствует); и как A, так и B, являются истинными (или присутствуют).

Также форма единственного числа элемента или компонента варианта осуществления изобретения является неограничивающей в отношении количества экземпляров, т.е. случаев элемента или компонента. Таким образом, формулу единственного числа следует истолковывать как включающую один или по меньшей мере один, и форма слова в единственном числе для элемента или компонента также включает множественное число, если цифра не указывает явно на единственное число.

Термины "изобретение" или "настоящее изобретение", как используют в рамках изобретения, является неограничивающим термином, и не подразумевается, что он относится к какому-либо одному варианту осуществления конкретного изобретения, а охватывает все возможные варианты осуществления, как описано в заявке.

"Гербицид" представляет собой химическое вещество, которое вызывает временное или постоянное повреждение растения. Неограничивающие примеры гербицидов, которые можно использовать в различных способах и композициях по изобретению, приведены и более подробно рассмотрены в настоящем описании. Гербицид может включаться в растение, или он может действовать на растение без включения в растение или его клетки. "Активный ингредиент" представляет собой химическое вещество в гербицидном составе, которое в основном ответственно за его фитотоксичность и которое обозначают как активный ингредиент на товарной этикетке. Информация товарных этикеток доступна от U.S. Environmental Protection Agency, и она обновляется в сети Интернет на oaspub.epa.gov/pestlabl/ppls.own; информация товарных этикеток также доступна в сети Интернет на www.cdms.net. Термин "эквивалент кислоты" выражает уровень или количество относительно гербицидно активной исходной кислоты.

Термин "растение", как используют в рамках изобретения, включает, но не ограничивается ими, любого потомка, клетку, ткань или часть растения.

Термины "полинуклеотид", "нуклеиновая кислота" и "молекула нуклеиновой кислоты" охватывают одну нуклеиновую кислоту, а также несколько нуклеиновых кислот, фрагмент, вариант или производное нуклеиновой кислоты или конструкцию, например, матричную РНК (мРНК) или плазмидную ДНК (пДНК). Полинуклеотид или нуклеиновая кислота могут содержать нуклеотидную последовательность полноразмерной последовательности кДНК или ее фрагмента, включая нетранслируемые 5ʹ- или 3ʹ-последовательности и кодирующие последовательности. Полинуклеотид или нуклеиновая кислота могут состоять из любого полирибонуклеотида или полидезоксирибонуклеотида, которые могут представлять собой немодифицированные РНК или ДНК или модифицированные РНК или ДНК. Например, полинуклеотид или нуклеиновая кислота могут состоять из одноцепочечной и двухцепочечной ДНК, ДНК, которая представляет собой смесь одноцепочечной и двухцепочечной областей, одноцепочечной и двухцепочечной РНК, и РНК, которая представляет собой смесь одноцепочечной и двухцепочечной областей, гибридные молекулы, содержащие ДНК и РНК, которые могут быть одноцепочечными или, более типично, двухцепочечными, или могут представлять собой смесь одноцепочечных и двухцепочечных областей. Эти термины также охватывают химически, ферментативно или метаболически модифицированные формы полинуклеотида или нуклеиновой кислоты.

"Выделенными" могут быть обозначены полинуклеотид или последовательность нуклеиновой кислоты, которые были извлечены из их нативной среды. Например, содержащиеся в векторе гетерологичный полинуклеотид или нуклеиновая кислота, кодирующие полипептид или фрагмент полипептида, обладающие активностью устойчивости к глифосату, считают выделенными для целей настоящего изобретения. Следующие примеры выделенного полинуклеотида или нуклеиновой кислоты включают рекомбинантный полинуклеотид, поддерживаемый в гетерологичных клетках-хозяевах, или очищенный (частично или по существу) полинуклеотид или нуклеиновую кислоту в растворе. Выделенный полинуклеотид или нуклеиновая кислота в соответствии с вариантами осуществления настоящего изобретения, кроме того, включают такие молекулы, полученные синтетически. Выделенный полинуклеотид или нуклеиновая кислота в форме полимера ДНК могут содержать один или несколько сегментов кДНК, геномной ДНК или синтетической ДНК.

Термин "ген" относится к последовательности нуклеиновой кислоты, которая кодирует молекулы функционального продукта, либо РНК, либо белка, необязательно включающей регуляторные последовательности, предшествующие (5ʹ-некодирующие последовательности) и следующие после (3ʹ-некодирующие последовательности) кодирующей последовательности.

Как используют в рамках изобретения, термин "кодирующая область" относится к последовательности ДНК, которая кодирует конкретную аминокислотную последовательность. "Подходящие регуляторные последовательности" относятся к нуклеотидным последовательностям, расположенным выше (5ʹ-некодирующие последовательности), внутри или ниже (3ʹ-некодирующие последовательности) кодирующей последовательности, и которые влияют на транскрипцию, процессинг РНК или стабильность, или трансляцию ассоциированной кодирующей последовательности. Регуляторные последовательности могут включать промоторы, лидерные последовательности трансляции, интроны, последовательности распознавания полиаденилирования, участки процессинга РНК, участки связывания эффектора и структуру стебель-петля.

Как используют в рамках изобретения, термин "полипептид" охватывает "полипептид" в единственном числе, а также "полипептиды" во множественном числе, и их фрагменты, и относится к молекуле, состоящей из мономеров (аминокислот), линейно связанных амидными связями (также известными как пептидные связи). Термин "полипептид" относится к любой цепи или цепям из двух или более аминокислот, и он не относится к конкретной длине продукта. Таким образом, пептиды, дипептиды, трипептиды, олигопептиды, "белок", "цепь аминокислот" или любой другой используемый термин относятся к цепи или цепям из двух или более аминокислот, включены в определение "полипептид", и термин "полипептид" можно использовать вместо или взаимозаменяемо с любым из этих терминов. Полипептид может происходить из природного биологического источника, или он может быть получен с помощью рекомбинантной технологии, однако он не обязательно транслируется с определенной последовательности нуклеиновой кислоты. Он может быть получен любым образом, включая химический синтез.

Под "выделенным" полипептидом или фрагментом, вариантом или их производным подразумевают полипептид, который не находится в его природной среде. Не требуется конкретный уровень очистки. Таким образом, указание на "выделенный" означает вовлечение "действий человека", как описано в настоящем описании. Например, выделенный полипептид может быть удален из его нативной или природной среды. Рекомбинантные полипептиды и белки, экспрессируемые в клетках-хозяевах, считают выделенными для целей настоящего изобретения, также как и нативные или рекомбинантные полипептиды, которые были отделены, фракционированы или частично или по существу очищены любым подходящим способом.

Как используют в рамках изобретения, "нативный" относится к форме полинуклеотида, гена или полипептида, встречающейся в природе с ее собственными регуляторными последовательностями, при их наличии.

Как используют в рамках изобретения, "эндогенный" относится к нативной форме полинуклеотида, гена или полипептида в его природном положении в организме или в геноме организма. "Эндогенный полинуклеотид" включает нативный полинуклеотид в его природном положении в геноме организма. "Эндогенный ген" включает нативный ген в его природном положении в геноме организма. "Эндогенный полипептид" включает нативный полипептид в его природном положении в организме.

Как используют в рамках изобретения, "гетерологичный" относится к полинуклеотиду, гену или полипептиду, в норме не встречающимся в организме хозяина, но который введен в организм хозяина. "Гетерологичный полинуклеотид" включает нативную кодирующую область или ее часть, которую повторно вводят в организм-источник в форме, которая отличается от соответствующего нативного полинуклеотида. "Гетерологичный ген" включает нативную кодирующую область или ее часть, которые повторно вводят в организм-источник в форме, которая отличается от соответствующего нативного гена. Например, гетерологичный ген может включать нативную кодирующую область, которая является частью химерного гена, включающей ненативные регуляторные области, которые повторно вводят нативному хозяину. "Гетерологичный полипептид" включает нативный полипептид, который повторно вводят в организм-источник в форме, которая отличается от соответствующего нативного полипептида. Рассматриваемые гены и белки можно подвергать слиянию с другими генами и белками с получением химерных или слитых белков. Гены и белки, пригодные в соответствии с вариантами осуществления настоящего изобретения, включают не только конкретно проиллюстрированные полноразмерные последовательности, но также их части, сегменты и/или фрагменты (включая непрерывные фрагменты и внутренние и/или концевые делеции по сравнению с полноразмерными молекулами) этих последовательностей, варианты, мутанты, химерные последовательности и слитые конструкции.

Как используют в рамках изобретения, термин "модификация" может относиться к изменению полинуклеотида, описанного в настоящем описании, которое приводит к сниженной, по существу устраненной или устраненной активности полипептида, кодируемого полинуклеотидом, а также к изменению полипептида, описанного в настоящем описании, которое приводит к сниженной, по существу устраненной или устраненной активности полипептида. Альтернативно термин "модификация" может относиться к изменению полинуклеотида, описанного в настоящем описании, которое приводит к увеличенной или усиленной активности полипептида, кодируемого полинуклеотидом, а также к изменению полипептида, описанного в настоящем описании, которое приводит к увеличенной или усиленной активности полипептида. Такие изменения можно вносить способами, хорошо известными в данной области, включая, но не ограничиваясь ими, делецию, мутацию (например, спонтанный мутагенез, случайный мутагенез, мутагенез, вызванный генами-мутаторами, или мутагенез с помощью транспозонов), замену, инсерцию, подавление, изменение положения в клетке, изменение состояния полинуклеотида или полипептида (например, метилирование, фосфорилирование или убиквитинилирование), удаление кофактора, введение антисмысловой РНК/ДНК, введение интерферирующей РНК/ДНК, химическую модификацию, ковалентную модификацию, облучение УФ-излучением и рентгеновским излучением, гомологичную рекомбинацию, митотическую рекомбинацию, способы замены промотора и/или их комбинации. Указание на то, какие нуклеотиды или аминокислотные остатки можно модифицировать, может быть найдено путем сравнения последовательности конкретного полинуклеотида или полипептида с последовательностью гомологичных полинуклеотидов или полипептидов, например, дрожжевых или бактериальных, и максимизации количества модификаций, внесенных в области высокой гомологии (консервативные области) или консенсусные последовательности.

Термин "производное", как используют в рамках изобретения, относится к модификации последовательности, указанной в настоящем описании. Примером таких модификаций является замена, инсерция и/или делеция одного или нескольких оснований, относящихся к последовательности нуклеиновой кислоты кодирующей последовательности, описанной в настоящем описании, которая сохраняет, немного изменяет или повышает функцию кодирующей последовательности, описанной в настоящем описании, в сельскохозяйственных культурах. Такие производные может без труда определить специалист в данной области, например, с использованием способов компьютерного моделирования для прогнозирования и оптимизации структуры последовательности. Таким образом, термин "производное" также включает последовательности нуклеиновой кислоты, имеющие значительную идентичность последовательности с кодирующими последовательностями, описанными в настоящем описании, так что они способны иметь описанную функциональность для применения при получении DGT-14 согласно вариантам осуществления настоящего изобретения.

Как используют в рамках изобретения, термин "вариант" относится к полипептиду, отличающемуся от конкретно указанного полипептида согласно варианту осуществления изобретения аминокислотными инсерциями, делециями, мутациями и заменами, полученному с использованием, например, способов рекомбинантных ДНК, таких как мутагенез. Указания для определения того, какие аминокислотные остатки могут быть заменены, добавлены или удалены без устранения представляющей интерес активности, могут быть найдены путем сравнения последовательности конкретного полипептида с последовательностью гомологичных полипептидов и минимизации количества изменений аминокислотной последовательности, внесенных в области высокой гомологии (консервативные области) или путем замены аминокислот консенсусными последовательностями. Белки согласно вариантам осуществления настоящего изобретения могут иметь замещенные аминокислоты при условии, что они сохраняют желаемую функциональную активность. "Варианты" генов имеют нуклеотидные последовательности, которые кодируют те же белки или эквивалентные белки, имеющие активность, эквивалентную или сходную с проиллюстрированным белком.

Термины "варианты белков" и "эквивалентные белки" относятся к белкам, имеющим одинаковую или по существу одинаковую биологическую/функциональную активность против субстратов-мишеней, и к последовательностям, эквивалентным проиллюстрированным белкам. Как используют в рамках изобретения, указание на "эквивалентную" последовательность относится к последовательностям, имеющим аминокислотные замены, делеции, вставки или инсерции, которые улучшают или неблагоприятно влияют на активность в значительной степени. Фрагменты, сохраняющие активность, также включены в это определение. Фрагменты и другие эквиваленты, которые сохраняют ту же или сходную функцию или активность, что и у соответствующего фрагмента проиллюстрированного белка, находятся в объеме вариантов осуществления настоящего изобретения.

Для получения вариантов белков можно использовать варианты генов; для получения вариантов белков можно использовать рекомбинантных хозяев. С использованием этих способов "шаффлинга генов" можно конструировать эквивалентные гены и белки, которые содержат любые 5, 10 или 20 последовательно расположенных остатков (аминокислота или нуклеотид) любой последовательности, проиллюстрированной в настоящем описании. Как известно специалисту в данной области, способы шаффлинга генов, например, можно корректировать для получения эквивалентов, например, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292 или 293 последовательно расположенных остатков (аминокислотные или нуклеотидные), соответствующих сегменту (того же размера) в любых проиллюстрированных или предложенных последовательностях (или комплементарных (полностью комплементарных) им последовательностях). Также в качестве зондов и/или праймеров можно использовать сегменты сходного размера, особенно сегменты для консервативных областей.

Стратегии "шаффлинга" можно разрабатывать и планировать после получения и исследования атомных 3-D (трехмерных) координат и кристаллической структуры представляющего интерес белка. Таким образом, "сфокусированный шаффлинг" может быть направлен на определенные сегменты белка, которые являются идеальными для модификации, такие как экспонированные на поверхности сегменты, и предпочтительно не внутренние сегменты, которые вовлечены в сворачивание белка и необходимы для целостности 3-D структуры. В патенте США № 5605793, например, описаны способы обеспечения дополнительного молекулярного разнообразия с использованием повторной сборки ДНК после случайной или сфокусированной фрагментации. Это может называться "шаффлингом" генов, который, как правило, вовлекает смешение фрагментов (желаемого размера) двух или более различных молекул ДНК с последующими повторяющимися раундами ренатурации. Это может повышать активность белка, кодируемого исходным геном. Результатом является химерный белок, имеющий увеличенную активность, измененную субстратную специфичность, увеличенную устойчивость к ферментам, измененную стереоспецифичность или другие характеристики.

Аминокислотные "замены" могут быть результатом замены одной аминокислоты другой аминокислотой, имеющей сходные структурные и/или химические свойства, т.е. консервативной аминокислотной замены, или они могут быть результатом замены одной аминокислоты другой аминокислотой, имеющей отличающиеся структурные и/или химические свойства, т.е. неконсервативной аминокислотной замены. Аминокислоты могут быть отнесены к следующим классам: неполярные; незаряженные полярные; основные и кислые. "Консервативные" аминокислотные замены можно вносить, исходя из сходства полярности, заряда, растворимости, гидрофобности, гидрофильности или амфипатической природы вовлеченных остатков. Например, неполярные (гидрофобные) аминокислоты включают глицин, аланин, лейцин, изолейцин, валин, пролин, фенилаланин, триптофан и метионин; полярные нейтральные аминокислоты включают серин, треонин, цистеин, тирозин, аспарагин и глутамин; положительно заряженные (основные) аминокислоты включают аргинин, лизин и гистидин; и отрицательно заряженные (кислые) аминокислоты включают аспарагиновую кислоту и глутаминовую кислоту.

Альтернативно "неконсервативные" аминокислотные замены можно вносить путем выбора отличий в полярности, заряде, растворимости, гидрофобности, гидрофильности или амфипатической природе любой из этих аминокислот. "Вставки" или "делеции" могут находиться в пределах диапазона изменений, структурно или функционально допустимых для рекомбинантных белков. Допустимое варьирование может быть экспериментально определено путем систематического внесения инсерций, делеций или замен аминокислоты в молекулу полипептида с использованием способов рекомбинантных ДНК и анализа полученных рекомбинантных вариантов в отношении активности.

Конкретные изменения "активного центра" фермента можно вносить для влияния на присущую функциональность в отношении активности или стереоспецифичности. Смотрите Muller et. al., "Structural basis for the enantiospecificities of R- и S-specific phenoxypropionate/alpha-ketoglutarate dioxygenases", Protein Sci. (2006). Например, известную кристаллическую структуру tauD использовали в качестве модельной диоксигеназы для определения остатков активного центра, когда она была связана с ее собственным субстратом таурином. Смотрите Elkins et al. (2002) "X-ray crystal structure of Escherichia coli taurin/alpha-ketoglutarate dioxygenase complexed to ferrous iron and substrates", Biochemistry 41(16):5185-5192. Что касается оптимизации последовательности и конструктивной осуществимости активных центров фермента, смотрите Chakrabarti et al., PNAS (Aug. 23, 2005), 102(34):12035-12040.

Различные свойства и трехмерные признаки белка также можно изменять без неблагоприятного влияния на активность/функциональность белка. Консервативные аминокислотные замены могут быть допустимыми/можно вносить так, чтобы не оказывать неблагоприятного эффекта на активность и/или трехмерную конфигурацию молекулы. Аминокислоты могут быть отнесены к следующим классам: неполярные, незаряженные полярные, основные и кислые. Консервативные замены, при которых аминокислоту одного класса заменяют другой аминокислотой того же типа, входят в объем вариантов осуществления настоящего изобретения при условии, что замена не оказывает неблагоприятного влияния на биологическую активность соединения. Также можно конструировать варианты белков, которые отличаются на уровне последовательности, но которые сохраняют ту же или сходную общую основную трехмерную структуру, распределение поверхностного заряда и т.п. Смотрите, например, патент США № 7058515; Larson et al., Protein Sci. 2002 11: 2804-2813, "Thoroughly sampling sequence space: Large-scale protein design of structural ensembles"; Crameri et al, Nature Biotechnology 15, 436-438 (1997), "Molecular evolution of an arsenate detoxification pathway by DNA shuffling"; Stemmer, W.P.C.1994. DNA shuffling by random fragmentation and reassembly: in vitro recombination for molecular evolution. Proc. Natl. Acad. Sci. USA 91: 10747-10751; Stemmer, W.P.C.1994. Rapid evolution of a protein in vitro by DNA shuffling. Nature 370: 389-391; Stemmer, W.P.C.1995. Searching sequence space. Bio/Technology 13: 549-553; Crameri, A., Cwirla, S. and Stemmer, W.P.C.1996. Construction and evolution of antibody-phage libraries by DNA shuffling. Nature Medicine 2: 100-103; и Crameri, A., Whitehorn, E.A., Tate, E. and Stemmer, W.P.C. 1996. Improved green fluorescent protein by molecular evolution using DNA shuffling. Nature Biotechnology 14: 315-319.

Компьютерное моделирование 5ʹ- или 3ʹ-UTR, наиболее подходящих для DGT-14 (синтетические шпильки) также можно осуществлять в объеме вариантов осуществления настоящего изобретения. Компьютерное моделирование в общем, а также шаффлинг генов и направленная эволюция, рассмотрены в настоящем описании. Более конкретно, в отношении компьютерного моделирования и UTR, способы компьютерного моделирования для применения в прогнозировании/оценке производных 5ʹ- и 3ʹ-UTR в соответствии с настоящем изобретением включают, но не ограничиваются ими: программу MFoId version 3.1, доступную от Genetics Corporation Group, Madison, WI (смотрите Zucker et al., "Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide", RNA Biochemistry and Biotechnology, 11-43, J. Barciszewski & B.F.C. Clark, eds., NATO ASI Series, Kluwer Academic Publishers, Dordrecht, NL, (1999); Zucker et al., "Expanded Sequence Dependence of Thermodynamic Parameters Improves Prediction of RNA Secondary Structure", J. Mol. Biol. 288, 911-940 (1999); Zucker et al., "RNA Secondary Structure Prediction", Current Protocols in Nucleic Acid Chemistry, S. Beaucage, D.E. Bergstrom, G.D. Glick, и R.A. Jones eds., John Wiley & Sons, New York, 11,2,1-11,2,10, (2000)); COVE (анализ структуры РНК с использованием ковариационных моделей (стохастические контекстно-независимые грамматические способы)) v.2.4.2 (Eddy & Durbin, Nucl. Acids Res. 1994, 22: 2079-2088), которая свободно распространяется в виде исходного текста и которую можно загрузить путем доступа к web-сайту genetics.wustl.edu/eddy/software/; и FOLDALIGN, также свободно распространяемую и доступную для загрузки с web-сайта bioinf.au.dk.FOLDALIGN/ (смотрите "Finding the most significant common sequence and structure motifs in a set of RNA sequences", J. Grodkin, L. J. Heyer and G. D. Stormo. Nucleic Acids Research, Vol. 25, no. 18 pp. 3724-3732, 1997, "Finding Common Sequence and Structure Motifs in a set of RNA Sequences", J. Gorodkin, L. J. Heyer, and G. D. Stormo. ISMB 5; 120-123, 1997).

Фрагменты полноразмерных генов можно получать с использованием коммерчески доступных экзонуклеаз или эндонуклеаз по стандартным методикам. Например, ферменты, такие как Bbs I, или сайт-направленный мутагенез можно использовать, чтобы систематически отщеплять нуклеотиды с концов генов. Также неполные гены, которые кодируют активные фрагменты, можно получать с использованием различных ферментов рестрикции. Протеазы можно использовать, чтобы прямо получить активные фрагменты этих белков.

В объем вариантов осуществления изобретения, описанного в настоящем описании, входит то, что белки могут быть укороченными и, тем не менее, могут сохранять функциональную активность. Под "укороченным белком" подразумевают, что часть белка может отщепляться, в то время как оставшийся укороченный белок сохраняет и проявляет желаемую активность после расщепления. Расщепление можно осуществлять с помощью различных протеаз. Более того, эффективно расщепленные белки можно получать с использованием способов молекулярной биологии, где основания ДНК, кодирующие указанный белок, удаляются либо путем расщепления эндонуклеазами рестрикции, либо другими способами, доступными квалифицированному специалисту. После укорочения указанные белки можно экспрессировать в гетерологичных системах, таких как E. coli, бакуловирусы, вирусные системы на основе растений, дрожжи и т.д., а затем подвергать биоанализам устойчивости к гербицидам, как описано в настоящем описании, для определения активности. Специалистам в данной области хорошо известно, что можно успешно получать укороченные белки так, чтобы они сохраняли функциональную активность при наличии менее чем полной полноразмерной последовательности. Например, B.t.-белки можно использовать в укороченной (коровый белок) форме (смотрите, например, Hofte et al. (1989), и Adang et al. (1985)). Как используют в рамках изобретения, термин "белок" может включать функционально активные укорочения.

В некоторых случаях, особенно для экспрессии в растениях, может быть преимущественным использование укороченных генов, которые экспрессируют укороченные белки. Предпочтительные укороченные гены, как правило, кодируют 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 или 99% полноразмерного белка.

Термин "промотор" относится к последовательности ДНК, способной контролировать экспрессию кодирующей последовательности или функциональной РНК. Обычно, кодирующая последовательность расположена с 3′-стороны от промоторной последовательности. Промоторы могут происходить полностью из их нативного гена, или они могут содержать различные элементы, происходящие из различных промоторов, встречающихся в природе, или даже могут содержать синтетические сегменты ДНК. Специалистам в данной области понятно, что различные промоторы могут контролировать экспрессию гена в различных тканях или типах клеток, или на различных стадиях развития, или в ответ на различные условия окружающей среды или физиологические условия. Промоторы, которые обеспечивают экспрессию гена в большинстве типов клеток в большинство моментов времени, обычно называют "конститутивными промоторами". Кроме того, понятно, что поскольку в большинстве случаев точные границы регуляторных последовательностей не полностью определены, фрагменты ДНК различной длины могут иметь идентичную промоторную активность.

Термин "функционально связанный" относится к ассоциации последовательностей нуклеиновой кислоты на одном фрагменте нуклеиновой кислоты так, чтобы функция одной из них находилась под влиянием другой. Например, промотор функционально связан с кодирующей последовательностью, когда он способен осуществлять экспрессию этой кодирующей последовательности (например, кодирующая последовательность находится под транскрипционным контролем промотора). Кодирующие последовательности могут быть функционально связаны с регуляторными последовательностями в смысловой или антисмысловой ориентации.

Термин "экспрессия", как используют в рамках изобретения, относится к транскрипции и стабильному накоплению смысловой (мРНК) или антисмысловой РНК, происходящей из фрагмента нуклеиновой кислоты согласно вариантам осуществления изобретения. Экспрессия также может относиться к трансляции мРНК в полипептид.

Термин "сверхэкспрессия", как используют в рамках изобретения, относится к экспрессии, которая превышает эндогенную экспрессию указанного или родственного гена. Гетерологичный ген "сверхэкспрессируется", если его экспрессия превышает экспрессию аналогичного эндогенного гена.

Как используют в рамках изобретения, термин "трансформация" относится к переносу и встраиванию нуклеиновой кислоты или фрагмента в организм хозяина, который приводит к генетически стабильному наследованию. Организмы-хозяева, содержащие трансформированные фрагменты нуклеиновой кислоты, называют "трансгенными" или "рекомбинантными", или "трансформированными" организмами. Известные способы трансформации включают трансформацию, опосредуемую Agrobacterium tumefaciens или Agrobacterium rhizogenes, трансформацию с фосфатом кальция, трансформацию с полибреном; слияние протопластов, электропорацию, ультразвуковые способы (например, сонопорация), трансформацию с помощью липосом, микроинъекцию, трансформацию "голой" ДНК, трансформацию плазмидными векторами, трансформацию вирусными векторами, биолистическую трансформацию (бомбардировка микрочастицами), опосредуемую карбидом кремния WHISKERS трансформацию, направленный поток аэрозоля или трансформацию с помощью PEG.

Термины "плазмида" и "вектор", как используют в рамках изобретения, относятся к внехромосомному элементу, часто содержащему гены, которые не являются частью центрального метаболизма клетки и обычно имеют форму замкнутых двухцепочечных молекул ДНК. Такие элементы могут представлять собой автономно реплицирующиеся последовательности, встраивающиеся в геном последовательности, линейные или замкнутые фаговые или нуклеотидные последовательности одноцепочечной или двухцепочечной ДНК или РНК, происходящие из любого источника, в которых ряд нуклеотидных последовательностей связан или рекомбинирован в уникальную конструкцию, которая способна вводить промоторный элемент и последовательность ДНК для выбранного продукта гена вместе с соответствующей 3ʹ-нетранслируемой последовательностью в клетку.

Как используют в рамках изобретения, термин "вырожденность кодонов" относится к природе генетического кода, позволяющей варьирование нуклеотидной последовательности без влияния на аминокислотную последовательность кодируемого полипептида. Квалифицированному специалисту хорошо известно "предпочтение кодонов", которое проявляет конкретная клетка-хозяин, в отношении использования нуклеотидных кодонов для обеспечения данной аминокислоты. Таким образом, при синтезе гена для увеличенной экспрессии в клетке-хозяине, желательно конструировать ген так, чтобы его частота использования кодонов была приближенной к частоте предпочтительного использования кодонов в клетке-хозяине.

Термин "кодон-оптимизированный", относящийся к генам или кодирующим областям молекул нуклеиновой кислоты для трансформации различных хозяев, относится к изменению кодонов в гене или кодирующих областях молекул нуклеиновой кислоты так, чтобы они отражали типичное использование кодонов организмом хозяина без изменения полипептида, кодируемого ДНК. Такая оптимизация включает замену по меньшей мере одного, или более чем одного, или значительного количества кодонов одним или несколькими кодонами, которые более часто используются в генах этого организма.

Варьирование нуклеотидной последовательности, которая содержат кодоны, кодирующие аминокислоты любой полипептидной цепи, позволяет варьирование последовательности, кодирующей ген. Поскольку каждый кодон состоит из трех нуклеотидов, и нуклеотиды, составляющие ДНК, ограничены четырьмя конкретными основаниями, существует 64 возможных комбинации нуклеотидов, 61 из которых кодируют аминокислоты (остальные три кодона кодируют сигналы, завершающие трансляцию). "Генетический код", который демонстрирует, какие кодоны кодируют какие аминокислоты, общеизвестен в данной области. В результате многие аминокислоты обозначаются более чем одним кодоном. Например, аминокислоты аланин и пролин кодируются четырьмя триплетами, серин и аргинин - шестью, в то время как триптофан и метионин кодируются только одним триплетом. Эта вырожденность позволяет составу оснований ДНК варьировать в широком диапазоне без изменения аминокислотной последовательности белков, кодируемых ДНК.

Многие организмы проявляют предпочтение к использованию конкретных кодонов для кодирования вставки конкретной аминокислоты в растущую пептидную цепь. Отличия в преимущественном использовании кодонов или предпочтении кодонов между организмами обеспечиваются вырожденностью генетического кода и документально подтверждены для многих организмов. Предпочтение кодонов часто коррелирует с эффективностью трансляции матричной РНК (мРНК), которая, как полагают, в свою очередь зависит, среди прочих, от свойств транслируемых кодонов и доступности конкретных молекул транспортной РНК (тРНК). Распространенность отдельных тРНК в клетке, как правило, отражает кодоны, наиболее часто используемые для синтеза пептидов. Таким образом, гены можно адаптировать или конструировать для оптимальной экспрессии гена в данном организме на основе оптимизации кодонов.

Учитывая большое количество последовательностей генов, доступных для широкого множества видов животных, растений и микроорганизмов, является возможным вычисление относительных частот использования кодонов. Таблицы использования кодонов являются общедоступными, например, в базе данных "Codon Usage Database", доступной на kazusa.или.jp/codon/, и эти таблицы можно адаптировать рядом способов. Смотрите Nakamura et al. Nucl. Acids Res. 28:292 (2000). C использованием этой или сходных таблиц специалист в данной области может использовать частоты в данной полипептидной последовательности, для конструирования и продуцирования синтетического фрагмента нуклеиновой кислоты кодон-оптимизированной кодирующей области, которая кодирует полипептид, но в которой используются кодоны, оптимальные для данного вида. В некоторых вариантах осуществления настоящее изобретение относится к кодон-оптимизированным формам dgt-14 и/или другим вспомогательным белка по изобретению, как описано в настоящем описании далее.

Для достижения высокой экспрессии гетерологичных генов в растениях, может быть предпочтительным конструирование и повторная модификация способами инженерии указанных генов так, чтобы они более эффективно экспрессировались в клетках растений, и, в частности, оно может быть предпочтительным, когда желательно, чтобы бактериальный ген экспрессировался в клетках как двудольных, так и однодольных растений. Ген дикого типа, кодирующий DGT-14, был выделен и нативная нуклеотидная последовательность, кодирующая предсказанную аминокислотную последовательность, может быть найдена в GenBank под номером доступа № ZP_01452683, который включен в настоящее описание в качестве ссылки в полном объеме. Кодируемая белковая последовательность, содержащая модификацию, где глицин был модифицирован на аланин в аминокислотном остатке 111 последовательности GenBank под номером доступа ZP_01452683, представлена в качестве SEQ ID NO:1.

Варианты осуществления изобретения относятся к модификации dgt-14, где синтетическая последовательность гена dgt-14 была сконструирована для экспрессии в растениях. Конструирование оптимизированного гена dgt-14 для экспрессии того же белка DGT-14 как в однодольных, так и в двудольных растениях, представлено с помощью повторной модификации способами инженерии кодирующей области белка этого гена для оптимальной экспрессии. В настоящем описании описаны оптимизированные нуклеотидные последовательности, кодирующие полипептид DGT-14. Две таких оптимизированных для растений нуклеотидных последовательности dgt-14 представлены в SEQ ID NO:2 и SEQ ID NO:3. Модифицированную нуклеотидную последовательность dgt-14, оптимизированную для двудольных растений, обозначают как SEQ ID NO:2, или модифицированную нуклеотидную последовательность dgt-14, оптимизированную для однодольных растений, обозначают как SEQ ID NO:3, и она обеспечивает устойчивость к глифосату в растениях.

Молекулу нуклеиновой кислоты dgt-14 SEQ ID NO:2 оптимизировали для повышения экспрессии в двудольных растениях. Молекула нуклеиновой кислоты dgt-14 SEQ ID NO:3 была оптимизирована для повышения экспрессии в однодольных растениях. Использование кодонов выбирали на основе предпочтительного использования кодонов в том отношении, что его повторно модифицировали способами инженерии так, чтобы белок кодировался кодонами, являющимися предпочтительными в отношении использования либо в однодольных, либо в двудольных растениях, и вредоносные последовательности и излишние участки рестрикции были удалены для повышения эффективности транскрипции/трансляции полипептида DGT-14 и для облегчения стадий манипулирования ДНК. При этом экспрессия DGT-14 в растениях будет повышаться, и DGT-14 будет обеспечивать устойчивость к внесению глифосата.

Аналогично, молекула нуклеиновой кислоты dgt-14 (v6) SEQ ID NO:4 была оптимизирована для увеличения экспрессии в Escherichia coli. Использование кодонов было выбрано на основе предпочтительного использования кодонов E.coli в том отношении, что dgt-14 был повторно модифицирован способами инженерии так, чтобы белок кодировался предпочтительными кодонами с точки зрения использования в E.coli. Во время повторной модификации способами инженерии вредоносные последовательности и излишние участки рестрикции удаляли для повышения эффективности транскрипции/трансляции кодирующей последовательности DGT-14 и для облегчения стадий манипулирования ДНК. При этом экспрессия DGT-14 в E. coli приводит к надежной экспрессии белка для ферментативной охарактеризации DGT-14.

Термин "процентная идентичность" (или "% идентичность"), как известно в данной области, представляет собой взаимосвязь между двумя или более полипептидными последовательностями или двумя или более полинуклеотидными последовательностями, при определении путем сравнения последовательностей. В данной области "идентичность" также означает степень родства последовательностей между полипептидными или полинуклеотидными последовательностями, которую можно определять путем сопоставления цепей таких последовательностей. "Идентичность" и "сходство" можно без труда вычислять известными способами, включая, но не ограничиваясь ими, способы, описанные в: 1.) Computational Molecular Biology (Lesk, A. M., Ed.) Oxford University: NY (1988); 2.) Biocomputing: Informatics and Genome Projects (Smith, D. W., Ed.) Academic: NY (1993); 3.) Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., Eds.) Humania: NJ (1994); 4.) Sequence Analysis in Molecular Biology (von Heinje, G., Ed.) Academic (1987); и 5.) Sequence Analysis Primer (Gribskov, M. and Devereux, J., Eds.) Stockton: NY (1991).

Способы определения идентичности последовательностей нуклеиновой кислоты и аминокислотных последовательностей известны в данной области. Как правило, такие способы включают определение нуклеотидной последовательности мРНК для гена и/или определение аминокислотной последовательности, кодируемой им, и сравнение этих последовательностей со второй нуклеотидной или аминокислотной последовательностью. Также таким путем можно определять и сравнивать геномные последовательности. Как правило, идентичность относится к точному соответствию нуклеотида к нуклеотиду или аминокислоты к аминокислоте двух полинуклеотидов или полипептидных последовательностей, соответственно. Две или более последовательности (полинуклеотидные или аминокислотные) можно сравнивать путем определения их процентной идентичности. Процентная идентичность двух последовательностей, как последовательностей нуклеиновых кислот, так и аминокислотных последовательностей, представляет собой количество точных совпадений между двумя выравниваемыми последовательностями, деленое на длину более короткой последовательности и умноженное на 100. Смотрите Russell, R., and Barton, G., "Structural Features can be Unconserved in Proteins with Similar Folds", J. Mol. Biol. 244, 332-350 (1994), at p. 337, которая включена в настоящее описание в качестве ссылки в полном объеме.

Кроме того, способы определения идентичности и сходства закодированы в общедоступных компьютерных программах. Выравнивание последовательностей и вычисление идентичности можно проводить, например, с использованием программы AlignX пакета программ Vector NTI® (Invitrogen, Carlsbad, CA) или программы MegAlign™ биоинформатического вычислительного пакета программ LASERGENE (DNASTAR Inc., Madison, WI). Множественное выравнивание последовательностей проводят с использованием "способа выравнивания Clustal", соответствующего способу выравнивания, обозначаемому как Clustal V (описан в Higgins and Sharp, CABIOS 5:151-3 (1989); Higgins et al. Comput. Appl. Biosci. 8:189-91 (1992)) и присутствует в программе MegAlign™ биоинформатического вычислительного пакета программ LASERGENE (DNASTAR Inc.). Для множественных выравниваний величины по умолчанию соответствуют ШТРАФУ ЗА ДЕЛЕЦИЮ=10 и ШТРАФУ ЗА ПРОДОЛЖЕНИЕ ДЕЛЕЦИИ=10. Параметры по умолчанию для попарного выравнивания и вычисления процентной идентичности белковых последовательностей с использованием способа Clustal представляют собой KTUPLE=1, ШТРАФ ЗА ДЕЛЕЦИЮ=3, ОКНО=5 и СОХРАНЕНИЕ ДИАГНОНАЛЕЙ=5. Для нуклеиновых кислот эти параметры представляют собой KTUPLE=2, ШТРАФ ЗА ДЕЛЕЦИЮ=5, ОКНО=4 и СОХРАНЕНИЕ ДИАГОНАЛЕЙ=4. После выравнивания последовательностей с использованием программы Clustal V, "процентную идентичность" можно получить путем изучения таблицы "расстояний между последовательностями" в той же программе. Кроме того, доступен "способ выравнивания Clustal W", и он соответствует способу выравнивания, обозначаемому как Clustal W (описан в Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D.G. et al., Comput. Appl. Biosci. 8:189-191(1992)) и присутствует в программе MegAlign™ v6.1 биоинформатического вычислительного пакета программ LASERGENE (DNASTAR Inc.). Параметры по умолчанию для множественного выравнивания представляют собой (ШТРАФ ЗА ДЕЛЕЦИЮ=10, ШТРАФ ЗА ПРОДОЛЖЕНИЕ ДЕЛЕЦИИ=0,2, приостановка расходящихся последовательностей (%)=30, вес транзиции ДНК=0,5, весовая матрица белков=Gonnet Series, весовая матрица ДНК =IUB). После выравнивания последовательностей с использованием программы Clustal W, "процентную идентичность" можно получить путем изучения таблицы "расстояний между последовательностями" в той же программе.

Специалисту в данной области хорошо понятно, что многие уровни идентичности последовательностей пригодны для идентификации полипептидов из других видов, где полипептиды обладают той же или сходной функцией или активностью. Подходящие примеры процентной идентичности включают, но не ограничиваются ими: 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% или 95%, или любой целый процент от 55% до 100% может быть пригоден для описания вариантов осуществления настоящего изобретения, такой как 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99%. Подходящие фрагменты нуклеиновых кислот не только имеют описанную выше гомологию, но, как правило, кодируют полипептид, имеющий по меньшей мере 50 аминокислот, предпочтительно по меньшей мере 100 аминокислот, более предпочтительно по меньшей мере 150 аминокислот, еще более предпочтительно по меньшей мере 200 аминокислот, и наиболее предпочтительно по меньшей мере 250 аминокислот.

Термин "программное обеспечение для анализа последовательностей" относится к любому компьютерному алгоритму или компьютерной программе, которые пригодны для анализа нуклеотидных или аминокислотных последовательностей. "Программное обеспечение для анализа последовательностей" может быть коммерчески доступным или независимо разработанным. Типичное программное обеспечение для анализа последовательностей включает, но не ограничивается ими: 1.) пакет программ GCG (Wisconsin Package Version 9,0, Genetics Computer Group (GCG), Madison, WI); 2.) BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol., 215:403-410 (1990)); 3.) DNASTAR (DNASTAR, Inc. Madison, WI); 4.) Sequencher (Gene Codes Corporation, Ann Arbor, MI); и 5.) программа FASTA, включающая алгоритм Смита-Ватермана (W. R. Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Plenum: New York, NY). В контексте настоящей заявки будет понятно, что, когда для анализа используют программное обеспечение для анализа последовательностей, результаты анализа будут основаны на "значениях по умолчанию" указанной программы, если нет иных указаний. Как используют в рамках изобретения "значения по умолчанию" означают любой набор величин или параметров, которые изначально загружаются программным обеспечением, когда его впервые запускают.

При указании на способы гибридизации, всю известную нуклеотидную последовательность или ее часть можно использовать в качестве зонда, который селективно гибридизуется с другими соответствующими нуклеотидными последовательностями, присутствующими в популяции клонированных геномных фрагментов ДНК или фрагментов кДНК (т.е. библиотеки геномной ДНК или кДНК) из выбранного организма. Зонды для гибридизации могут представлять собой фрагменты геномной ДНК, фрагменты плазмидной ДНК, фрагменты кДНК, фрагменты РНК, амплифицированные способом ПЦР фрагменты ДНК, олигонуклеотиды или другие полинуклеотиды, и они могут быть меченными поддающейся обнаружению группой, такой как 32P или любой другой поддающийся обнаружению маркер. Таким образом, например, зонды для гибридизации можно получать путем мечения синтетических олигонуклеотидов на основе последовательностей ДНК вариантов осуществления изобретения. Способы получения зондов для гибридизации и для конструирования библиотек кДНК и геномных библиотек являются общеизвестными в данной области и описаны (Sambrook et al., 1989).

Зонды и праймеры на основе нуклеиновой кислоты согласно вариантам осуществления настоящего изобретения гибридизуются в жестких условиях с заданной последовательностью ДНК. Для идентификации присутствия ДНК из трансгенного объекта в образце можно использовать любой общепринятый способ гибридизации нуклеиновых кислот или способ амплификации. Молекулы нуклеиновой кислоты или их фрагменты способны специфически гибридизоваться с другими молекулами нуклеиновой кислоты в определенных обстоятельствах. Как используют в рамках изобретения, две молекулы нуклеиновой кислоты называют способными специфически гибридизоваться друг с другом, если две молекулы способны образовывать антипараллельную двухцепочечную структуру нуклеиновой кислоты. Молекулу нуклеиновой кислоты называют "комплементарной" другой молекуле нуклеиновой кислоты, если эти две молекулы нуклеиновой кислоты проявляют полную комплементарность. Как используют в рамках изобретения, молекулы называют проявляющими "полную комплементарность", когда каждый нуклеотид одной из молекул комплементарен нуклеотиду другой. Молекулы, которые проявляют полную комплементарность, как правило, гибридизуются друг у другом с достаточной стабильностью, чтобы обеспечивался их отжиг друг с другом в общепринятых условиях "высокой жесткости". Общепринятые условия высокой жесткости описаны Sambrook et al., 1989.

Две молекулы называют проявляющими "минимальную комплементарность", если они могут гибридизоваться друг с другом с достаточной стабильностью, чтобы позволить им оставаться в состоянии отжига по меньшей мере в общепринятых условиях "низкой жесткости". Общепринятые условия низкой жесткости также описаны Sambrook et al., 1989. Чтобы молекула нуклеиновой кислоты служила в качестве праймера или зонда, она должна проявлять только минимальную комплементарность последовательности, чтобы быть способной образовывать стабильную двухцепочечную структуру в конкретном используемом растворителе и в конкретных используемых концентрациях соли.

Факторы, которые влияют на жесткость гибридизации, хорошо известны специалистам в данной области и включают, но не ограничиваются ими, температуру, pH, ионную силу и концентрацию органических растворителей, например, таких как формамид и диметилсульфоксид. Как известно специалистам в данной области, жесткость гибридизации увеличивается при более высоких температурах, более низкой ионной силе или более низких концентрациях растворителя.

Термин "жесткие условия" или "условия жесткости" функционально определяют в отношении гибридизации зонда нуклеиновой кислоты с заданной нуклеиновой кислотой (т.е. с конкретной представляющей интерес последовательностью нуклеиновой кислоты) по конкретной методике гибридизации, описанной в Sambrook et al., 1989, 9.52-9.55. Также смотрите Sambrook et al., 1989, 9.47-9.52 и 9.56-9.58.

Как правило, жесткие условия представляют собой условия, в которых концентрация соли представляет собой менее чем приблизительно 1,5 M ионов Na+, как правило, приблизительно от 0,01 до 1,0 M ионов натрия Na+ (или других солей) при pH 7,0-8,3 и температура по меньшей мере приблизительно равна 30°C для коротких зондов (например, 10-50 нуклеотидов) и по меньшей мере приблизительно 60°C для длинных зондов (например, больше 50 нуклеотидов). Жесткие условия также можно обеспечивать добавлением дестабилизаторов, таких как формамид. Иллюстративные условия низкой жесткости включают гибридизацию с буферным раствором из 30-35% формамида, 1,0 M NaCl, 0,1% SDS (додецилсульфат натрия) при 37°C, и промывание в 1×-2× SSC (20× SSC=3,0 M NaCl/0,3 M трицитрат натрия) при 50-55°C. Иллюстративные условия умеренной жесткости включают гибридизацию в 40-45% формамиде, 1,0 M NaCl, 0,1% SDS при 37°C, и промывание в 0,5×-1× SSC при 55-60°C. Иллюстративные условия высокой жесткости включают гибридизацию в 50% формамиде, 1,0 M NaCl, 0,1% SDS при 37°C, и промывание в 0,1× SSC при 60-65°C.

Специфичность, как правило, является функцией промываний после гибридизации, причем критическими факторами являются ионная сила и температура конечного раствора для промывания. Для гибридов ДНК-ДНК Tm можно аппроксимировать из уравнения Tm=81,5°C+16,6(logM)+0,41(%GC)-0,61(%форм.)-500/L, где M представляет собой молярность одновалентных катионов, %GC представляет собой процент гуанозиновых и цитозиновых нуклеотидов в ДНК, %форм. представляет собой процент формамида в растворе для гибридизации, и L представляет собой длину гибрида в парах оснований (Meinkoth и Wahl, 1984). Tm представляет собой температуру (при определенной ионной силе и pH), при которой 50% комплементарной последовательности-мишени гибридизуется с абсолютно соответствующим зондом. Tm снижается приблизительно на 1°C для каждого 1% несовпадающих оснований; таким образом Tm, гибридизацию и/или условия промывания можно корректировать для гибридизации последовательностей с желаемой идентичностью. Например, если требуется гибридизация последовательностей с 90% идентичностью, Tm можно снизить на 10°C. Как правило, жесткие условия выбирают так, чтобы они были приблизительно на 5°C ниже температуры плавления (Tm) конкретной последовательности и комплементарной ей последовательности при определенной ионной силе и pH. Однако в условиях высокой жесткости может использоваться гибридизация и/или промывание при температуре на 1, 2, 3 или 4°C ниже температуры плавления (Tm); в условиях умеренной жесткости может использоваться гибридизация и/или промывание при температуре на 6, 7, 8, 9 или 10°C ниже температуры плавления (Tm); в условиях низкой жесткости может использоваться гибридизация и/или промывание при температуре на 11-20°C ниже температуры плавления (Tm). При использовании этого уравнения, композиций для гибридизации и промывания, и желаемой Tm, специалисту в данной области будет понятно, что варьирование жесткости растворов для гибридизации и/или промывания по существу описано. Если желаемая степень несоответствия оснований приводит к Tm менее 45°C (водный раствор) или 32°C (раствор формамида), предпочтительно увеличить концентрацию SSC так, чтобы можно было использовать более высокую температуру. Исчерпывающее руководство по гибридизации нуклеиновых кислот находится в (1997) Ausubel et al., Short Protocols in Molecular Biology, стр.2-40, Third Edit. (1997) и Sambrook et al. (1989).

Стандартные способы рекомбинантных ДНК и молекулярного клонирования хорошо известны в данной области и описаны, например, в Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989); и Silhavy et al., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1984); и Ausubel et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987).

Генетическое манипулирование с рекомбинантным хозяином, описанным в настоящем описании, можно проводить с использованием стандартных генетических способов и скрининг можно проводить в любой клетке-хозяине, которая пригодна для трансгенного манипулирования. В некоторых вариантах осуществления рекомбинантной клеткой-хозяином, описанной в настоящем описании, может быть любой организм-хозяин или микроорганизм-хозяин, пригодный для генетической модификации и рекомбинантный экспрессии генов. В некоторых вариантах осуществления рекомбинантный хозяин может представлять собой, но не ограничиваться ими, любое высшее растение, включая как двудольные, так и однодольные растения, и потребляемые растения, включая сельскохозяйственные культуры и растения, используемые для получения масел. Таким образом, любой вид растения или любую клетку растения можно выбирать, как дополнительно описано ниже.

В некоторых вариантах осуществления растения, которые генетически модифицированы в соответствии с настоящим изобретением (например, клетки-хозяева растений) включают, но не ограничивается ими, любые высшие растения, включая как двудольные, так и однодольные растения, и, в частности, потребляемые растения, включая сельскохозяйственные культуры. Такие растения могут включать, но не ограничиваться ими, например: люцерну, сою, хлопок, рапс (также описываемый как канола), лен, кукурузу, рис, брахиурию, пшеницу, сафлор, сорго, сахарную свеклу, подсолнечник, табак и травы рулонного газона. Таким образом, могут быть выбраны любой вид растения или клетка растения. В вариантах осуществления клетки растения, используемые в настоящем описании, и растения, выращенные и происходящие из них, включают, но не ограничиваются ими, клетки, получаемые из рапса (Brassica napus); горчицы индийской (Brassica juncea); горчицы эфиопской (Brassica carinata); репы (Brassica rapa); капусты (Brassica oleracea); сои (Glycine max); льняного семени/льна (Linum usitatissimum); маиса (также описываемого как кукуруза) (Zea mays); сафлора (Carthamus tinctorius); подсолнечника (Helianthus annuus); табака (Nicotiana tabacum); Arabidopsis thaliana, бразильского ореха (Betholettia excelsa); клещевины обыкновенной (Ricinus communis); кокоса (Cocus nucifera); кориандра (Coriandrum sativum); хлопка (Gossypium spp.); арахиса (Arachis hypogaea); хохобы (Simmondsia chinensis); масличной пальмы (Elaeis guineeis); оливы (Olea eurpaea); риса (Oryza sativa); пшеницы (Triticum spp. включая Triticum durum и Triticum aestivum) и ряски (Lemnaceae sp.). В некоторых вариантах осуществления, генетический фон в пределах вида растений может варьировать.

"Части растений", как используют в рамках изобретения, включают любые части растения, включая, но не ограничиваясь ими, семена (включая зрелые семена и незрелые семена), черенок растения, клетку растения, культуру клеток растения, орган растения, пыльцу, зародышей, цветки, плоды, побеги, листья, корни, стебли, эксплантаты и т.д. Клетка растения представляет собой структурную и физиологическую единицу растения, содержащую протопласт и клеточную стенку. Клетка растения может быть в форме выделенной единичной клетки или совокупности клеток, такой как рыхлый каллюс, или культивируемой клетки, или она может быть частью более высокоорганизованного элемента, например, ткани растения, органа растения или растения. Таким образом, клетка растения может представлять собой протопласт, продуцирующую гаметы клетку или клетку или совокупность клеток, которые могут регенерировать в целое растение. По существу, семя, которое содержит множество клеток растений и способно регенерировать в целое растение, считается клеткой растения для целей настоящего описания. Ткань растения или орган растения могут представлять собой семя, протопласт, каллюс или любые другие группы клеток растений, которые организованы в структурную или функциональную единицу. Особенно пригодные части растения включают пожинаемые части и части, пригодные для размножения растений-потомков. Пожинаемая часть может представлять собой любую пригодную часть растения, например, цветки, пыльцу, проростки, клубни, листья, стебли, плоды, семена, корни и т.п. Часть растения, пригодная для размножения, включает, например, семена, плоды, черенки, проростки, клубни, корневища и т.п. Культура ткани предпочтительно способна регенерировать растения, имеющие физиологические и морфологические характеристики предшествующего инбредного растения и регенерировать растения, имеющие по существу тот же генотип, что и предшествующее инбредное растение. Напротив, некоторые клетки растения неспособны регенерировать с образованием растений. Предпочтительно, способные к регенерации клетки в таких культурах ткани представляют собой зародышей, протопласты, клетки меристемы, каллюс, пыльцу, листья, пыльники, корни, корневые кончики, метелку, цветки, зерна, колосья, початки, пленку зерна или цветоножки. Кроме того, варианты осуществления настоящего изобретения относятся к растениям, регенерированным из культур ткани согласно вариантам осуществления изобретения.

Что касается получения генетически модифицированных растений, способы генной инженерии растений хорошо известны в данной области. Например, были разработаны многочисленные способы трансформации растений, включая протоколы биологической и физической трансформации для двудольных растений, а также для однодольных растений (например, Goto-Fumiyuki et al., Nature Biotech 17:282-286 (1999); Miki et al., Methods in Plant Molecular Biology and Biotechnology, Glick, B. R. and Thompson, J. E. Eds., CRC Press, Inc., Boca Raton, pp. 67-88 (1993)). Кроме того, доступны векторы и способы культивирования клеток растений или трансформации и регенерации тканей растений in vitro, например, в Gruber et al., Methods in Plant Molecular Biology и Biotechnology, Glick, B. R. and Thompson, J. E. Eds., CRC Press, Inc., Boca Raton, pp. 89-119 (1993).

Большое количество способов доступно для встраивания ДНК в клетку растения-хозяина. Эти способы включают трансформацию разоруженной T-ДНК с использованием Agrobacterium tumefaciens или Agrobacterium rhizogenes в качестве агента для трансформации, трансфекцию с фосфатом кальция, трансформацию с полибреном, слияние протопластов, электропорацию, ультразвуковые способы (например, сонопорация), трансформацию липосом, микроинъекцию, трансформацию "голой" ДНК, трансформацию плазмидных векторов, трансформацию вирусных векторов, биолистические способы трансформации (бомбардировка микрочастицами), опосредуемую диоксидом углерода WHISKERS™ трансформацию, направленный поток аэрозоля и опосредуемую PEG трансформацию, а также другие возможные способы.

Например, конструкцию ДНК можно вводить прямо в геномную ДНК клетки растения с использованием способов, таких как электропорация и микроинъекция протопластов клеток растений, или конструкции ДНК можно вводить прямо в ткань растения с использованием биолистических способов, таких как бомбардировка частицами ДНК (смотрите, например, Klein et al. (1987) Nature 327:70-73). Дополнительные способы трансформации клеток растений включают микроинъекцию посредством опосредуемого диоксидом кремния WHISKERS захвата ДНК (Kaeppler et al. (1990) Plant Cell Reporter 9:415-418). Альтернативно конструкцию ДНК можно вводить в клетку растения путем трансформации без использования частиц (смотрите, например, патентную заявку США № 12/245685, которая включена в настоящее описание в качестве ссылки в полном объеме).

Другим известным способом трансформации растений является опосредуемая микроснарядами трансформация, где ДНК переносится на поверхности микроснарядов. В этом способе экспрессирующий вектор вводят в ткани растения с помощью биолистического устройства, которое ускоряет микроснаряды до скоростей, достаточных для проникновения через клеточные стенки и мембраны растений. Sanford et al., Part. Sci. Technol. 5:27 (1987), Sanford, J. C., Trends Biotech. 6:299 (1988), Sanford, J. C., Physiol. Plant 79:206 (1990), Klein et al., Biotechnology 10:268 (1992).

Альтернативно способы переноса и трансформации генов включают, но не ограничиваются ими, трансформацию протопластов путем осаждения с хлоридом кальция, опосредуемого полиэтиленгликолем (PEG) или электропорацией захвата "голой" ДНК (смотрите Paszkowski et al. (1984) EMBO J 3:2717-2722, Potrykus et al. (1985) Molec. Gen. Genet. 199:169-177; Fromm et al. (1985) Proc. Nat. Acad. Sci. USA 82:5824-5828; и Shimamoto (1989) Nature 338:274-276) и электропорацию тканей растений (D’Halluin et al. (1992) Plant Cell 4:1495-1505).

Широко используемый способ введения экспрессирующего вектора в растения основан на природной системе трансформации Agrobacterium. Horsch et al., Science 227:1229 (1985). A. tumefaciens и A. rhizogenes являются патогенными для растений почвенными бактериями, известными тем, что они пригодны для генетической трансформации клеток растений. Плазмиды Ti и Ri из A. tumefaciens и A. rhizogenes, соответственно, содержат гены, ответственные за генетическую трансформацию растения. Kado C.I., Crit. Rev. Plant. Sci. 10:1 (1991). Описание векторных систем Agrobacterium и способов опосредуемого Agrobacterium переноса генов, также доступны, например, в Gruber et al., выше, Miki et al., выше, Moloney et al., Plant Cell Reports 8:238 (1989), и в патентах США № 4940838 и 5464763.

Если для трансформации используют Agrobacterium, ДНК, подлежащая встраиванию, должна быть клонирована в специальные плазмиды; а именно, либо в промежуточный вектор, либо в бинарный вектор. Промежуточные векторы не могут реплицироваться в Agrobacterium самостоятельно. Промежуточный вектор можно переносить в Agrobacterium tumefaciens с помощью плазмиды-помощника (конъюгация). Супербинарная система Japan Tobacco является примером такой системы (рассмотрено в Komari et al. (2006) Methods in Molecular Biology (K. Wang, ed.) No. 343; Agrobacterium Protocols, 2nd Edition, Vol. 1, Humana Press Inc., Totowa, NJ, pp.15-41; и Komori et al. (2007) Plant Physiol. 145:1155-1160). Бинарные векторы могут реплицироваться как в E. coli, так и в Agrobacterium. Они содержат ген селективного маркера и линкер или полилинкер, которые заключены между правой и левой пограничными областями T-ДНК. Их можно трансформировать прямо в Agrobacterium (Holsters, 1978). Agrobacterium, используемые в качестве клеток-хозяев, содержат плазмиду, содержащую область vir. Плазмида Ti или Ri также содержит область vir, необходимую для переноса T-ДНК. Область vir необходима для переноса T-ДНК в клетку растения. Могут содержаться дополнительные T-ДНК.

Функции вирулентности Agrobacterium tumefaciens-хозяина определяют встраивание T-цепи, содержащей конструкцию и соседний маркер, в ДНК клетки растения, когда клетка инфицируется бактериями с использованием бинарного T-ДНК-вектора (Bevan (1984) Nuc. Acid Res. 12:8711-8721) или процедуры сокультивирования (Horsch et al. (1985) Science 227:1229-1231). Как правило, систему трансформации Agrobacterium используют для модификации способами инженерии двудольных растений. (Bevan et al. (1982) Ann. Rev. Genet. 16:357-384; Rogers et al. (1986) Methods Enzymol. 118:627-641). Систему трансформации Agrobacterium также можно использовать для трансформации, а также для переноса, ДНК в однодольные растения и клетки растений. Смотрите патент США № 5591616; Hernalsteen et al. (1984) EMBO J. 3:3039-3041; Hooykass-Van Slogteren et al. (1984) Nature 311:763-764; Grimsley et al. (1987) Nature 325:1677-1679; Boulton et al. (1989) Plant Mol. Biol. 12:31-40; и Gould et al. (1991) Plant Physiol. 95:426-434. После введения генетической конструкции в клетку растения, клетки растения можно выращивать и после появления дифференцирующейся ткани, такой как побеги и кори, можно получать зрелые растения. В некоторых вариантах осуществления можно получать множество растений. Методологии регенерации растений известны средним специалистам в данной области, и могут быть найдены, например, в: Plant Cell and Tissue Culture, 1994, Vasil and Thorpe Eds. Kluwer Academic Publishers и в: Plant Cell Culture Protocols (Methods in Molecular Biology 111, 1999 Hall Eds Humana Press). Генетически модифицированное растение, описанное в настоящем описании, можно культивировать в ферментационной среде или выращивать в подходящей среде, такой как почва. В некоторых вариантах осуществления подходящей средой для роста высших растений может быть любая среда для роста растений, включая, но не ограничиваясь ими, почву, песок, любую среду в форме частиц, которая поддерживает рост корней (например, вермикулит, перлит, и т.д.) или гидропонную культуру, а также подходящее освещение, воду и питательные вещества, которые оптимизируют рост высшего растения.

Трансформированные клетки растений, которые получены любым из описанных выше способов трансформации, можно культивировать для регенерации целого растения, которое обладает трансформированным генотипом, и, таким образом, желаемым фенотипом. Такие способы регенерации основаны на манипулировании с определенными фитогормонами в среде для роста тканевой культуры, как правило, они основаны на биоцидном и/или гербицидном маркере, который вводят вместе с желаемыми нуклеотидными последовательностями. Регенерация растений из культивируемых протопластов описана в Evans, et al., "Protoplasts Isolation and Culture", Handbook of Plant Cell Culture, pp. 124-176, Macmillian Publishing Company, New York, 1983; и Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Регенерацию также можно осуществлять из каллюса, эксплантатов, органов, пыльцы, зародышей или частей растения. Такие способы регенерации описаны, главным образом, в Klee et al. (1987) Ann. Rev. of Plant Phys. 38:467-486.

В других вариантах осуществления клетки растений, которые являются трансформированными, не способны к регенерации с образованием растения. Такие клетки можно использовать, например, для разработки линии клеток растения, имеющей соответствующий фенотип, например, устойчивость к гербициду.

Нуклеиновые кислоты, введенные в клетку растения, можно использовать для сообщения желаемых признаков по существу любому растению. Широкое множество растений и систем клеток растения можно модифицировать способами инженерии для желаемых физиологических и агрономических характеристик, описанных в настоящем описании, с использованием конструкций нуклеиновой кислоты по настоящему изобретению и различных способов трансформации, упомянутых выше. В предпочтительных вариантах осуществления целевые растения и клетки растений для модификации способами инженерии включают, но не ограничиваются ими, однодольные и двудольные растения, такие как сельскохозяйственные культуры, включая зерновые культуры (например, пшеница, кукуруза, рис, просо, ячмень), плодовые культуры (например, томат, яблоко, груша, клубника, апельсин), кормовые культуры (например, люцерна), корневые овощные культуры (например, морковь, картофель, сахарная свекла, ямс), листовые овощные культуры (например, салат-латук, шпинат); цветковые растения (например, петуния, роза, хризантема), хвойные и сосновые деревья (например, сосна, пихта, ель); растения, используемые для фиторекультивации (например, растения, накапливающие тяжелые металлы); масличные культуры (например, подсолнечник, рапс) и растения, используемые для экспериментальных целей (например, Arabidopsis). Таким образом, описанные способы и композиции являются применимыми для широкого диапазона растений, включая, но не ограничиваясь ими, виды из родов Asparagus, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucurbita, Daucus, Erigeron, Glycine, Gossypium, Hordeum, Lactuca, Lolium, Lycopersicon, Malus, Manihot, Nicotiana, Orychophragmus, Oryza, Persea, Phaseolus, Pisum, Pyrus, Prunus, Raphanus, Secale, Solanum, Sorghum, Triticum, Vitis, Vigna и Zea mays.

Трансформированную клетку растения, каллюс, ткань или растение можно идентифицировать и выделять путем выбора или скрининга модифицированного способами инженерии растительного материала в отношении признаков, кодируемых маркерными генами, присутствующими на трансформирующей ДНК. Например, селекцию можно проводить путем выращивания модифицированного способами инженерии растительного материала на средах, содержащих ингибиторное количество антибиотика или гербицида, к которым трансформированная генная конструкция сообщает устойчивость. Кроме того, трансформированные растения и клетки растений также можно идентифицировать путем скрининга видов активности или любых выявляемых визуально маркерных генов (например, гены β-глюкуронидазы, люциферазы или gfp), которые могут присутствовать в рекомбинантных конструкциях нуклеиновых кислот. Такие методологии селекции и скрининга хорошо известны специалистам в данной области.

Термин "введенный" в контексте включения нуклеиновой кислоты в клетку, включает трансформацию в клетку, а также скрещивание растения, имеющего последовательность, с другим растением, так чтобы второе растение содержало гетерологичную последовательность, как и в общепринятых способах разведения растений. Такие способы разведения хорошо известны специалисту в данной области. Для обсуждения способов разведения растений смотрите Poehlman (1995) Breeding Field Crops, AVI Publication Co., Westport Conn, 4th Edit. Для введения гена в растения можно использовать способы обратного скрещивания. Этот способ используют на протяжении десятилетий для введения признаков в растение. Пример описания этого и других методологий разведения растений, которые хорошо известны, может быть найден в источниках литературы, таких как Poehlman, выше, и Plant Breeding Methodology, edit. Neal Jensen, John Wiley & Sons, Inc. (1988). В типичном протоколе обратного скрещивания исходный представляющий интерес сорт (рекуррентное родительское растение) скрещивают со вторым сортом (нерекуррентное родительское растение), который содержит один представляющий интерес ген, подлежащий переносу. Затем полученное потомство от этого скрещивания вновь скрещивают с рекуррентным родительским растением и процесс повторяют до тех пор, пока не получат растение, где по существу все из желаемых морфологических и физиологических характеристик рекуррентного родительского растения восстановлены в преобразованном растении, в дополнение к одному перенесенному гену из нерекуррентного родительского растения.

Определенные варианты осуществления относятся к способам проведения скрещиваний с использованием растения согласно варианту осуществления настоящего изобретения в качестве по меньшей мере одного родительского растения. Например, конкретные варианты осуществления относятся к гибридному растению F1, имеющему в качестве одного или обоих родительских растений любое из растений, проиллюстрированных в настоящем описании. Другие варианты осуществления относятся к семенам, продуцированным такими гибридами F1. Другие варианты осуществления относятся к способу получения гибридных семян F1 путем скрещивания проиллюстрированного растения с отличающимся растением (например инбредным родительским растением) и сбора полученных гибридных семян. Другие варианты осуществления относятся к проиллюстрированному растению, которое представляет собой либо женское родительское растение, либо мужское родительское растение. Характеристики полученных растений могут быть улучшены путем тщательного изучения родительских растений.

Трансгенное растение, содержащее полинуклеотид dgt-14 согласно варианту осуществления настоящего изобретения, можно выводить путем первоначального полового скрещивания первого родительского растения, представляющего собой растение, выращенное из семени любой из линий, указанных в настоящем описании, и второго растения, тем самым получая множество растений первого потомства; затем селекции растения первого потомства, которое является устойчивым к глифосату; самоопыления растения первого потомства, тем самым, получая множество растений второго потомства; а затем селекции из растений второго потомства растения, которое является устойчивым к глифосату. Эти стадии могут далее включать обратное скрещивание растения первого потомства или растения второго потомства с растением второго потомства или растением третьего потомства. Затем можно производить посев сельскохозяйственной культуры, содержащей семена согласно конкретным вариантам осуществления, или ее потомков.

Также должно быть понятно, что два различных трансгенных растения также можно скрещивать с получением потомства, которое содержит два независимо сегрегирующих дополнительных экзогенных гена. Самоопыление соответствующего потомка может обеспечить растения, которые являются гомозиготными по обоим дополнительным экзогенным генам. Также предусматривается обратное скрещивание с родительским растением и ауткроссинг с нетрансгенным растением, как в случае вегетативного размножения. Другие способы разведения, широко используемые для различных признаков и культуры, известны в данной области. Разведение путем обратного скрещивания используют для переноса генов просто наследуемого признака с высокой наследуемостью в желаемый гомозиготный культивар или инбредную линию, которые являются рекуррентным родительским растением. Источник переносимого признака называют донорным растением. Ожидается, что полученное растение будет иметь признаки рекуррентного растения (например, культивара) и желаемый признак, перенесенной из донорного растения. После первоначального скрещивания особи, обладающие фенотипом донорного растения, отбирают и многократно скрещивают (подвергают обратному скрещиванию) с рекуррентным родительским растением. Ожидается, что полученное родительское растение будет обладать признаками рекуррентного родительского растения (например, культивара) и желаемым признаком, перенесенным из донорного растения.

Нуклеиновую кислоту, кодирующую нуклеотидную последовательность dgt-14, как описано в настоящем описании, можно клонировать в вектор для трансформации в прокариотические или эукариотические клетки для репликации и/или экспрессии. Векторы могут представлять собой прокариотические векторы; например, плазмиды, или челночные векторы, векторы насекомых или эукариотические векторы. Нуклеиновую кислоту, кодирующую полинуклеотид dgt-14, также можно клонировать в экспрессирующий вектор, например, для введения в клетку растения. Иногда может быть предпочтительным наличие векторов, которые являются функциональными в E. coli (например, продукция белка для индукции антител, анализ последовательности ДНК, конструирование вставок, получение некоторых количеств нуклеиновых кислот).

Для экспрессии белка DGT-14 нуклеотидные последовательности, кодирующие последовательность dgt-14, обычно субклонируют в экспрессирующий вектор, который содержит промотор для контроля транскрипции. Подходящие бактериальные и эукариотические промоторы хорошо известны в данной области и описаны, например, в Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed. 1989; 3rd ed., 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); и Current Protocols in Molecular Biology (Ausubel et al., выше). Бактериальные экспрессирующие системы для экспрессии последовательности dgt-14 в рамках настоящего изобретения доступны, например, в E. coli, Bacillus sp. и Salmonella (Palva et al., Gene 22:229-235 (1983)). Наборы для таких экспрессирующих систем являются коммерчески доступными. Эукариотические экспрессирующие системы для клеток млекопитающих, дрожжей и клеток насекомых хорошо известны специалистам в данной области и также являются коммерчески доступными.

Конкретный экспрессирующий вектор, используемый для переноса генетической информации в клетку, выбирают с учетом предполагаемого применения белка DGT-14, например, экспрессии в растениях, животных, бактериях, грибах, простейших и т.д. Стандартные экспрессирующие векторы для бактерий и животных известны в данной области и подробно описаны, например, в публикации патента США 20050064474 A1 и международных публикациях патентов WO 05/084190, WO 05/014791 и WO 03/080809. Для получения бактериальных клеточных линий, которые экспрессируют большие количества белка, который затем можно очищать с использованием стандартных способов, можно использовать стандартные способы трансфекции.

Промотор, используемый для контроля экспрессии нуклеиновой кислоты, кодирующей dgt-14, зависит от конкретного применения. Например, сильный конститутивный промотор, пригодный для клетки-хозяина, как правило, используют для экспрессии и очистки белков DGT-14. Неограничивающие примеры предпочтительных промоторов растений включают промоторные последовательности, происходящие из убиквитина-10 A. thaliana (ubi-10) (Callis, et al., 1990, J. Biol. Chem., 265:12486-12493); маннопинсинтазы A. tumefaciens (Δmas) (Petolino et al., патент США № 6730824); и/или вируса мозаики прожилок маниоки (CsVMV) (Verdaguer et al., 1996, Plant Molecular Biology 31:1129-1139).

В способах, описанных в настоящем описании, можно использовать ряд промоторов, которые контролируют экспрессию гена в растении. Такие промоторы можно выбирать из конститутивных, химически регулируемых, индуцибельных, тканеспецифических и предпочтительных для семян промоторов.

Конститутивные промоторы включают, например, коровый промотор 35S вируса мозаики цветной капусты (Odell et al. (1985) Nature 313:810-812); промотор актина риса (McElroy et al. (1990) Plant Cell 2:163-171); промотор убиквитина кукурузы (патент США № 5510474; Christensen et al. (1989) Plant Mol. Biol. 12:619-632 и Christensen et al. (1992) Plant Mol. Biol. 18:675-689); промотор pEMU (Last et al. (1991) Theor. Appl. Genet. 81:581-588); промотор ALS (патент США № 5659026); промотор гистонов кукурузы (Chabouté et al. Plant Molecular Biology, 8:179-191 (1987)) и т.п.

Диапазон доступных совместимых с растениями промоторов включает тканеспецифические и индуцибельные промоторы. Индуцибельный регуляторный элемент представляет собой элемент, который способен прямо или непрямо активировать транскрипцию одной или нескольких последовательностей ДНК или генов в ответ на индуцирующий агент. В отсутствие индуцирующего агента последовательности ДНК или гены не транскрибируются. Как правило, белковый фактор, который специфично связывается с индуцибельным регуляторным элементом для активации транскрипции, присутствует в неактивной форме, которая затем прямо или непрямо преобразуется в активную форму индуцирующим агентом. Индуцирующий агент может представлять собой химический агент, такой как белок, метаболит, регулятор роста, гербицид или фенольное соединение или физиологический стрессовый фактор, обусловливаемый прямо нагреванием, холодом, солью или токсическими элементами, или непрямо путем действия патогена или болезнетворного агента, такого как вирус. Клетка растения, содержащая индуцибельный регуляторный элемент, может быть подвергнута воздействию индуцирующего агента путем применения извне индуцирующего агента к клетке или растению, такого как распыление, полив, нагревание или сходные способы.

В вариантах осуществления в рамках настоящего изобретения можно использовать любой индуцибельный промотор. Смотрите Ward et al. Plant Mol. Biol. 22: 361-366 (1993). Иллюстративные индуцибельные промоторы включают промоторы рецептора экдизона (патент США № 6504082); промоторы из системы ACE1, которые отвечают на медь (Mett et al. PNAS 90: 4567-4571 (1993)); ген In2-1 и In2-2 из кукурузы, который отвечает на антидоты бензолсульфонамидных гербицидов (патент США № 5364780; Hershey et al., Mol. Gen. Genetics 227: 229-237 (1991) и Gatz et al., Mol. Gen. Genetics 243: 32-38 (1994)); репрессор Tet из Tn10 (Gatz et al., Mol. Gen. Genet. 227: 229-237 (1991) или промоторы из гена стероидного гормона, транскрипционная активность которого индуцируется глюкокортикостероидным гормоном, Schena et al., Proc. Natl. Acad. Sci. U.S.A. 88: 10421 (1991) и McNellis et al., (1998) Plant J. 14(2): 247-257; промотор GST кукурузы, который активируется гидрофобными электрофильными соединениями, которые используют в качестве предвсходовых гербицидов (смотрите патент США № 5965387 и публикацию международной патентной заявки № WO 93/001294); и промотор PR-1a табака, который активируется салициловой кислотой (смотрите Ono S, Kusama M, Ogura R, Hiratsuka K., "Evaluation of the Use of the Tobacco PR-1a Promoter to Monitor Defense Gene Expression by the Luciferase Bioluminescence Reporter System", Biosci Biotechnol Biochem. 2011 Sep 23; 75(9): 1796-800). Другие представляющие интерес химически регулируемые промоторы включают индуцируемые тетрациклином и репрессируемые тетрациклином промоторы (смотрите, например, Gatz et al., (1991) Mol. Gen. Genet. 227: 229-237, и патенты США № 5814618 и 5789156).

Другие представляющие интерес регулируемые промоторы включают отвечающий на холод регуляторный элемент или регуляторный элемент теплового шока, транскрипция которого может осуществляться в ответ на воздействие холода или тепла, соответственно (Takahashi et al., Plant Physiol. 99:383-390, 1992); промотор гена алкогольдегидрогеназы (Gerlach et al., PNAS USA 79:2981-2985 (1982); Walker et al., PNAS 84(19):6624-6628 (1987)), индуцируемый анаэробными условиями; индуцируемый светом промотор, происходящий из гена rbcS гороха или гена psaDb гороха (Yamamoto et al. (1997) Plant J. 12(2):255-265); индуцируемый светом регуляторный элемент (Feinbaum et al., Mol. Gen. Genet. 226:449, 1991; Lam and Chua, Science 248:471, 1990; Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590; Orozco et al. (1993) Plant Mol. Bio. 23(6):1129-1138); индуцируемый гормонами растений регуляторный элемент (Yamaguchi-Shinozaki et al., Plant Mol. Biol. 15:905, 1990; Kares et al., Plant Mol. Biol. 15:225, 1990) и т.п. Индуцибельный регуляторный элемент также может представлять собой промотор гена In2-1 или In2-2 кукурузы, который отвечает на антидоты бензолсульфонамидных гербицидов (Hershey et al., Mol. Gen. Gene. 227:229-237, 1991; Gatz et al., Mol. Gen. Genet. 243:32-38, 1994), и репрессор Tet транспозона Tn10 (Gatz et al., Mol. Gen. Genet. 227:229-237, 1991). Индуцируемые стрессом промоторы включают индуцируемые стрессовым воздействием соли/воды промоторы, такие как P5CS (Zang et al. (1997) Plant Sciences 129:81-89); индуцируемые холодом промоторы, такие как cor15a (Hajela et al. (1990) Plant Physiol. 93:1246-1252), cor15b (Wilhelm et al. (1993) Plant. Mol. Biol. 23:1073-1077), wsc120 (Ouellet et al. (1998) FEBS Lett. 423-324-328), ci7 (Kirch et al. (1997) Plant Mol. Biol. 33:897-909) и ci21A (Schneider et al. (1997) Plant Physiol. 113:335-45); индуцируемые засухой промоторы, такие как Trg-31 (Chaudhary et al (1996) Plant Mol. Biol. 30:1247-57) и rd29 (Kasuga et al. (1999) Nature Biotechnology 18:287-291); осмотически индуцируемые промоторы, такие как Rab17 (Vilardell et al. (1991) Plant Mol. Biol. 17:985-93) и осмотин (Raghothama et al. (1993) Plant Mol. Biol. 23:1117-28); индуцируемые нагреванием промоторы, такие как белки теплового шока (Barros et al. (1992) Plant Mol. 19:665-75; Marrs et al. (1993) Dev. Genet. 14:27-41), smHSP (Waters et al. (1996) J. Experimental Botany 47:325-338); и индуцируемый тепловым шоком элемент из промотора убиквитина петрушки (WO 03/102198). Другие индуцируемые стрессовым воздействием промоторы включают rip2 (патент США № 5332808 и публикация США № 2003/0217393) и rd29a (Yamaguchi-Shinozaki et al. (1993) Mol. Gen. Genetics 236:331-340). Определенные промоторы индуцируются нанесением раны, включая промотор pMAS Agrobacterium (Guevara-Garcia et al. (1993) Plant J. 4(3):495-505) и промотор ORF13 Agrobacterium (Hansen et al., (1997) Mol. Gen. Genet. 254(3):337-343).

Предпочтительные для ткани промоторы можно использовать для обеспечения усиленной транскрипции и/или экспрессии в конкретной ткани растения. При указании на предпочтительную экспрессию подразумевается экспрессия на более высоком уровне в конкретной ткани растения, чем в другой ткани растения. Примеры этих типов промоторов включают промоторы с предпочтительной для семян экспрессией, такой как экспрессия, обеспечиваемая промотором фазеолина (Bustos et al.1989. The Plant Cell Vol. 1, 839-853), и геном глобулина-1 кукурузы, Belanger, et al. 1991 Genetics 129:863-972. Для двудольных растений предпочтительные для семян промоторы включают, но не ограничиваются ими, промоторы β-фазеолина бобов, напина, β-конглицинина, лектина сои, круциферина и т.п. Для однодольных растений предпочтительные для семян промоторы включают, но не ограничиваются ими, промоторы 15-кДа зеина кукурузы, 22-кДа зеина, 27-кДа зеина, γ-зеина, waxy, shrunken 1, shrunken 2, глобулина 1, и т.д. Предпочтительные для семян промоторы также включают промоторы, которые контролируют экспрессию генов предпочтительно в конкретных тканях в семенах, например, такие как предпочтительный для эндосперма промотор γ-зеина, криптический промотор из табака (Fobert et al. 1994. T-DNA tagging of a seed coat-specific cryptic promoter in tobacco. Plant J. 4: 567-577), промотор P-гена из кукурузы (Chopra et al. 1996. Alleles of the maize P gene with distinct tissue specificities encode Myb-homologous proteins with C-terminal replacements. Plant Cell 7:1149-1158, Erratum in Plant Cell 1997, 1:109), промотор глобулина-1 из кукурузы (Belenger и Kriz.1991. Molecular basis for Allelic Polymorphysm of the maize Globulin-1 gene. Genetics 129: 863-972), и промоторы, которые обеспечивают экспрессию в семенной оболочке или пленке кукурузных зерен, например, специфичный к перикарпию промотор глутаминсинтетазы (Muhitch et al., 2002. Isolation of a Promoter Sequence From the Glutamine Synthetase1-2 Gene Capable of Conferring Tissue-Specific Gene Expression in Transgenic Maize. Plant Science 163:865-872).

В дополнение к промотору, экспрессирующий вектор обычно содержит элемент транскрипции или экспрессирующую кассету, которая содержит все дополнительные элементы, требуемые для экспрессии нуклеиновой кислоты в клетках-хозяевах, либо прокариотических, либо эукариотических. Таким образом, типичная экспрессирующая кассета содержит промотор, функционально связанный, например, с последовательностью нуклеиновой кислоты, кодирующей белок, и сигнальные последовательности, требуемые, например, для эффективного полиаденилирования транскрипта, терминации транскрипции, участков связывания рибосом или терминации трансляции. Дополнительные элементы кассеты могут включать, например, энхансеры и гетерологичные сигналы сплайсинга.

Также могут быть включены другие компоненты вектора, также в зависимости от предполагаемого применения гена. Примеры включают селективные маркеры, направляющие или регуляторные последовательности, последовательности транзитных пептидов, такие как оптимизированная последовательность транзитного пептида (смотрите патент США № 5510471), стабилизирующие последовательности, такие как RB7 MAR (смотрите Thompson and Myatt, (1997) Plant Mol. Biol., 34: 687-692 и WO9727207) или лидерные последовательности, интроны и т.д. Общее описание и примеры экспрессирующих векторов растений и репортерных генов могут быть найдены в Gruber, et al., "Vectors for Plant Transformation", Methods in Plant Molecular Biology and Biotechnology, Glick et al eds; CRC Press pp. 89-119 (1993). Выбор подходящего экспрессирующего вектора зависит от хозяина и способа введения экспрессирующего вектора в хозяина. Экспрессирующая кассета может включать на 3′-конце представляющей интерес гетерологичной нуклеотидной последовательности область терминации транскрипции и трансляции, являющуюся функциональной в растениях. Область терминации может быть нативной для представляющей интерес последовательности ДНК или она может происходить из другого источника. Походящие области терминации доступны из Ti-плазмиды A. tumefaciens, такие как области терминации октопинсинтазы и нопалинсинтазы (nos) (Depicker et al., Mol. and Appl. Genet. 1:561-573 (1982) и Shaw et al. (1984) Nucleic Acids Research vol. 12, No. 20 pp7831-7846(nos)); также смотрите Guerineau et al. Mol. Gen. Genet. 262:141-144 (1991); Proudfoot, Cell 64:671-674 (1991); Sanfacon et al. Genes Dev. 5:141-149 (1991); Mogen et al. Plant Cell 2:1261-1272 (1990); Munroe et al. Gene 91:151-158 (1990); Ballas et al. Nucleic Acids Res. 17:7891-7903 (1989); Joshi et al. Nucleic Acid Res. 15:9627-9639 (1987).

Кроме того, экспрессирующая кассета может содержать 5′-лидерные последовательности. Такие лидерные последовательности могут действовать, усиливая трансляцию. Лидерные последовательности трансляции известны в данной области и включают, в качестве примера, лидерные последовательности пикорнавирусов, лидерную последовательность EMCV (5ʹ-некодирующая область вируса энцефаломиокардита), Elroy-Stein et al. Proc. Nat. Acad. Sci. USA 86:6126-6130 (1989); лидерные последовательности потивирусов, например, лидерная последовательность TEV (вирус гравировки табака) Carrington and Freed, Journal of Virology, 64:1590-1597 (1990), лидерную последовательность MDMV (вирус карликовой мозаики кукурузы), Allison et al., Virology 154:9-20 (1986); связывающий тяжелую цепь иммуноглобулина человека белок (BiP), Macejak et al. Nature 353:90-94 (1991); нетранслируемую лидерную последовательность из мРНК белка оболочки вируса мозаики люцерны (AMV РНК 4), Jobling et al. Nature 325:622-625 (1987); лидерную последовательность вируса табачной мозаики (TMV), Gallie et al. (1989) Molecular Biology of RNA, pages 237-256; и лидерную последовательность вируса хлоротической крапчатости кукурузы (MCMV) Lommel et al. Virology 81:382-385 (1991). Также смотрите Della-Cioppa et al. Plant Physiology 84:965-968 (1987).

Конструкция также может содержать последовательности, которые усиливают трансляцию и/или стабильность мРНК, такие как интроны. Примером такого интрона является первый интрон гена II варианта гистона H3.III Arabidopsis thaliana. Chaubet et al. Journal of Molecular Biology, 225:569-574 (1992).

В случаях, когда являются желательными направление продукта экспрессии гетерологичной нуклеотидной последовательности в конкретную органеллу, в частности, пластиду, амилопласт или в эндоплазматическую сеть, или секреция на поверхности клетки или внеклеточно, экспрессирующая кассета, кроме того, может содержать кодирующую последовательность транзитного пептида. Такие транзитные пептиды хорошо известны в данной области и включают, но не ограничиваются ими, транзитный пептид для белка-переносчика ацильных групп, малой субъединицы RUBISCO, EPSP-синтазы растений и Helianthus annuus (смотрите Lebrun et al. патент США 5510417), транзитный пептид хлоропластов Zea mays Brittle-1 (Nelson et al. Plant Physiol. 117(4):1235-1252 (1998); Sullivan et al. Plant Cell 3(12):1337-48; Sullivan et al., Planta (1995) 196(3):477-84; Sullivan et al., J. Biol. Chem. (1992) 267(26):18999-9004) и т.п. Кроме того, в данной области известны химерные транзитные пептиды хлоропластов, такие как оптимизированный транзитный пептид (смотрите, патент США № 5510471). Дополнительные транзитные пептиды хлоропластов были описаны ранее в патентах США № 5717084; 5728925. Специалисту в данной области будет хорошо понятно, что доступно множество возможностей для экспрессии продукта в конкретной органелле. Например, последовательность альфа-амилазы ячменя часто используют для экспрессии в эндоплазматической сети. Rogers, J. Biol. Chem. 260:3731-3738 (1985).

Специалисту в данной области будет понятно, что использование технологий рекомбинантных ДНК может улучшить контроль экспрессии трансфицированных молекул нуклеиновой кислоты путем манипулирования, например, количеством копий молекул нуклеиновой кислоты в клетке-хозяине, эффективностью, с которой эти молекулы нуклеиновых кислот транскрибируются, эффективностью, с которой полученные транскрипты транслируются, и эффективностью посттрансляционных модификаций. Кроме того, промоторную последовательность можно модифицировать способами генной инженерии для повышения уровня экспрессии по сравнению с нативным промотором. Рекомбинантные способы, пригодные для контроля экспрессии молекул нуклеиновой кислоты, включают, но не ограничиваются ими, стабильное встраивание молекул нуклеиновой кислоты в одну или несколько хромосом клетки-хозяина, добавление стабилизирующих вектор последовательностей в плазмиды, замены или модификации сигналов контроля транскрипции (например, промоторы, операторы, энхансеры), замены или модификации сигналов контроля трансляции (например, участки связывания рибосом, последовательности Шайна-Дальгарно или последовательности Козака), модификацию молекул нуклеиновой кислоты так, чтобы они соответствовали использованию кодонов клеткой-хозяином, и делецию последовательностей, которые дестабилизируют транскрипты.

В векторы для трансформации могут быть включены репортерные или маркерные гены для селекции трансформированных клеток или тканей или частей растений или растений. Примеры селективных маркеров включают селективные маркеры, которые сообщают устойчивость к антиметаболитам, таким как гербициды или антибиотики, например, дигидрофолатредуктаза, которая сообщает устойчивость к метотрексату (Reiss, Plant Physiol. (Life Sci. Adv.) 13:143-149, 1994; также смотрите Herrera Estrella et al., Nature 303:209-213, 1983; Meijer et al., Plant Mol. Biol. 16:807-820, 1991); неомицинфосфотрансфераза, которая сообщает устойчивость к аминогликозидам неомицину, канамицину и паромицину (Herrera-Estrella, EMBO J. 2:987-995, 1983 и Fraley et al. Proc. Natl. Acad. Sci USA 80:4803 (1983)); гигромицинфосфотрансфераза, которая сообщает устойчивость к гигромицину (Marsh, Gene 32:481-485, 1984; также смотрите Waldron et al., Plant Mol. Biol. 5:103-108, 1985; Zhijian et al., Plant Science 108:219-227, 1995); trpB, которая позволяет клеткам утилизировать индол вместо триптофана; hisD, которая позволяет клеткам утилизировать гистинол вместо гистидина (Hartman, Proc. Natl. Acad. Sci., USA 85:8047, 1988); манноза-6-фосфатизомераза, которая позволяет клеткам утилизировать маннозу (WO 94/20627); орнитиндекарбоксилаза, которая сообщает устойчивость к ингибитору орнитиндекарбоксилазы 2-(дифторметил)-DL-орнитину (DFMO; McConlogue, 1987, Current Communications in Molecular Biology, Cold Spring Harbor Laboratory ed.); и дезаминаза из Aspergillus terreus, которая сообщает устойчивость к бластицидину S (Tamura, Biosci. Biotechnol. Biochem. 59:2336-2338, 1995).

Дополнительные селективные маркеры включают, например, мутантную ацетолактатсинтазу, которая сообщает устойчивость к имидазолинону или сульфонилмочевине (Lee et al., EMBO J. 7:1241-1248, 1988), мутантную psbA, которая сообщает устойчивость к атразину (Smeda et al., Plant Physiol. 103:911-917, 1993) или мутантную протопорфириногеноксидазу (смотрите патент США № 5767373), или другие маркеры, сообщающие устойчивость к гербициду, такому как глюфосинат. Примеры подходящих генов селективных маркеров включают, но не ограничиваются ими, гены, кодирующие устойчивость к хлорамфениколу (Herrera Estrella et al., EMBO J. 2:987-992, 1983); стрептомицину (Jones et al., Mol. Gen. Genet. 210:86-91, 1987); спектиномицину (Bretagne-Sagnard et al., Transgenic Res. 5:131-137, 1996); блеомицину (Hille et al., Plant Mol. Biol. 7:171-176, 1990); сульфонамиду (Guerineau et al., Plant Mol. Biol. 15:127-136, 1990); бромксинилу (Stalker et al., Science 242:419-423, 1988); глифосату (Shaw et al., Science 233:478-481, 1986); фосфинотрицину (DeBlock et al., EMBO J. 6:2513-2518, 1987) и т.п.

Одной из возможностей для использования селективного гена является ДНК, кодирующая устойчивость к глюфосинату, и в одном варианте осуществления ей может быть ген фосфинотрицинацетилтрансферазы (pat), оптимизированный для кукурузы ген pat, или ген bar под контролем промотора вируса мозаики прожилок маниоки. Эти гены сообщают устойчивость к биалафосу. (Смотрите Wohlleben et al., (1988) Gene 70: 25-37); Gordon-Kamm et al., Plant Cell 2:603; 1990; Uchimiya et al., BioTechnology 11:835, 1993; White et al., Nucl. Acids Res. 18:1062, 1990; Spencer et al., Theor. Appl. Genet. 79:625-631, 1990; и Anzai et al., Mol. Gen. Gen. 219:492, 1989). Версией гена pat является оптимизированный для кукурузы ген pat, описанный в патенте США № 6096947.

Кроме того, можно использовать маркеры, которые облегчают идентификацию клетки растения, содержащей полинуклеотид, кодирующий маркер. Являются пригодными поддающиеся оценке или скринингу маркеры, где присутствие последовательности обеспечивает поддающийся измерению продукт, и продукт может продуцироваться без разрушения клетки растения. Примеры включают β-глюкуронидазу или ген uidA (GUS), который кодирует фермент, для которого известны различные хромогенные субстраты (например, патенты США 5268463 и 5599670); хлорамфениколацетилтрансферазу (Jefferson et al. The EMBO Journal vol. 6 No. 13 pp. 3901-3907) и щелочную фосфатазу. В предпочтительном варианте осуществления используемым маркером является бета-каротин или провитамин A (Ye et al., Science 287:303-305-(2000)). Ген используют для усиления питания риса, однако в данном случае его вместо этого используют в качестве поддающегося скринингу маркера, и присутствие этого гена, связанного с представляющим интерес геном, обнаруживают по обеспечиваемому золотистому цвету. В отличие от случая, когда ген используют для усиления питания растения, меньшее количество белка является достаточным для целей маркировки. Другие поддающиеся скринингу маркеры включают, как правило, гены антоцианина/флавоноида (смотрите обсуждение в Taylor and Briggs, The Plant Cell (1990)2:115-127), включая, например, ген R-локуса, который кодирует продукт, который регулирует продукцию антоцианиновых пигментов (красный цвет) в тканях растения (Dellaporta et al., Chromosome Structure and Function, Kluwer Academic Publishers, Appels and Gustafson eds., pp. 263-282 (1988)); гены, которые контролируют биосинтез флавоноидных пигментов, такие как ген C1 кукурузы (Kao et al., Plant Cell (1996) 8: 1171-1179; Scheffler et al. Mol. Gen. Genet. (1994) 242:40-48) и ген C2 кукурузы (Wienand et al., Mol. Gen. Genet. (1986) 203:202-207); ген B (Chandler et al., Plant Cell (1989) 1:1175-1183), ген p1 (Grotewold et al, Proc. Natl. Acad. Sci USA (1991) 88:4587-4591; Grotewold et al., Cell (1994) 76:543-553; Sidorenko et al., Plant Mol. Biol. (1999)39:11-19); гены локуса bronze (Ralston et al., Genetics (1988) 119:185-197; Nash et al., Plant Cell (1990) 2(11): 1039-1049), среди прочих.

Следующие примеры подходящих маркеров включают ген голубого флуоресцентного белка (CYP) (Bolte et al. (2004) J. Cell Science 117: 943-54 и Kato et al. (2002) Plant Physiol. 129: 913-42), ген желтого флуоресцентного белка (PHIYFP™ от Evrogen; смотрите Bolte et al. (2004) J. Cell Science 117: 943-54); ген lux, который кодирует люциферазу, присутствие которой можно обнаруживать с использованием, например, рентгеновской пленки, сцинтилляционного измерения, флуоресцентной спектрофотометрии, низкоуровневых видеокамер, камер с устройством подсчета фотонов или многолуночной люминометрии (Teeri et al. (1989) EMBO J. 8:343); ген зеленого флуоресцентного белка (GFP) (Sheen et al., Plant J. (1995) 8(5):777-84); и DsRed2, где клетки растений, трансформированные маркерным геном, имеют красный цвет, и, таким образом, их селекцию можно проводить визуально (Dietrich et al. (2002) Biotechniques 2(2):286-293). Дополнительные примеры включают ген β-лактамазы (Sutcliffe, Proc. Natl. Acad. Sci. U.S.A. (1978) 75:3737), который кодирует фермент, для которого известны различные хромогенные субстраты (например, PADAC, хромогенный цефалоспорин); ген xylE (Zukowsky et al., Proc. Natl. Acad. Sci. U.S.A. (1983) 80:1101), который кодирует катехолдиоксигеназу, которая может конвертировать хромогенные катехолы; ген α-амилазы (Ikuta et al., Biotech. (1990) 8:241); и ген тирозиназы (Katz et al., J. Gen. Microbiol. (1983) 129:2703), который кодирует фермент, способный окислять тирозин до DOPA и допахинона, который в свою очередь конденсируется с образованием легко обнаруживаемого соединения меланина. Очевидно, что множество таких маркеров доступно и известно специалисту в данной области.

В определенных вариантах нуклеотидную последовательность необязательно можно комбинировать с другой представляющей интерес нуклеотидной последовательностью. Термин "представляющая интерес нуклеотидная последовательность" относится к молекуле нуклеиновой кислоты (которая также может быть обозначена как полинуклеотид), которая может представлять собой транскрибированную молекулу РНК, а также молекулу ДНК, которая кодирует желаемый полипептид или белок, но также может относиться к молекулам нуклеиновой кислоты, которые не составляют целый ген, и которые не обязательно кодируют полипептид или белок (например, промотор). Например, в определенных вариантах осуществления молекулу нуклеиновой кислоты можно комбинировать или "пакетировать" с другой нуклеиновой кислотой, которая обеспечивает дополнительную резистентность или устойчивость к глифосату или другому гербициду, и/или обеспечивает резистентность к отдельным насекомым или заболеваниям и/или усиление питания, и/или улучшенные агрономические характеристики, и/или обеспечивает белки или другие продукты, пригодные в кормах, продуктах питания, промышленных, фармацевтических или других применениях. "Пакетирование" двух или более представляющих интерес последовательностей нуклеиновой кислоты в геноме растения можно осуществлять, например, общепринятыми способами разведения растений с использованием двух или более трансгенных объектов, трансформации растения конструкцией, которая содержит нуклеиновые кислоты, повторной трансформации трансгенного растения или добавления новых признаков посредством направленного встраивания способом гомологичной рекомбинации.

Такие представляющие интерес нуклеотидные последовательности включают, но не ограничиваются ими, примеры, предоставленные ниже:

1. Гены или кодирующие последовательности (например i-РНК), которые сообщают устойчивость к паразитам или заболеваниям

(A) Гены устойчивости к заболеваниям растений. Защита растений часто активируется специфическим взаимодействием между продуктом гена устойчивости к заболеванию (R) в растении и продуктом соответствующего гена авирулентности (Avr) в патогене. Сорт растения можно трансформировать клонированным геном устойчивости для конструирования растений, которые являются устойчивыми к конкретным патогенным штаммам. Примеры таких генов включают ген Cf-9 томата для устойчивости к Cladosporium fulvum (Jones et al., 1994 Science 266:789), ген Pto томата, который кодирует протеинкиназу, для устойчивости к Pseudomonas syringae pv. tomato (Martin et al., 1993 Science 262:1432), и ген RSSP2 Arabidopsis для устойчивости к Pseudomonas syringae (Mindrinos et al., 1994 Cell 78:1089).

(B) Белок Bacillus thuringiensis, его производное или синтетический полипептид, смоделированный на его основе, такой как нуклеотидная последовательность гена Bt δ-эндотоксина (Geiser et al., 1986 Gene 48:109), и гена вегетативного инсектицидного белка (VIP) (смотрите, например, Estruch et al. (1996) Proc. Natl. Acad. Sci. 93:5389-94). Более того, молекулы ДНК, кодирующие гены δ-эндотоксина, можно приобретать от American Type Culture Collection (Rockville, Md.) под номерами доступа ATCC 40098, 67136, 31995 и 31998.

(C) Лектин, такой как нуклеотидные последовательности нескольких генов манноза-связывающих лектинов Clivia miniata (Van Damme et al., 1994 Plant Molec. Biol. 24:825).

(D) Связывающий витамин белок, такой как авидин и гомологи авидина, которые пригодны в качестве ларвацидов против вредных насекомых. Смотрите патент США № 5659026.

(E) Ингибитор фермента, например, ингибитор протеазы или ингибитор амилазы. Примеры таких генов включают ингибитор цистеиновой протеазы риса (Abe et al., 1987 J. Biol. Chem. 262:16793), ингибитор I протеазы табака (Huub et al., 1993 Plant Molec. Biol. 21:985) и ингибитор α-амилазы (Sumitani et al., 1993 Biosci. Biotech. Biochem. 57:1243).

(F) Специфичный к насекомым гормон или феромон, такой как экдистероидный и ювенильный гормон, их варианты, миметик на их основе или их антагонист или агонист, такой как бакуловирусная экспрессия клонированного ювенильного гормона эстеразы, инактиватора ювенильного гормона (Hammock et al., 1990 Nature 344:458).

(G) Специфичный к насекомым пептид или нейропептид, который при экспрессии нарушает физиологию пораженного паразита (J. Biol. Chem. 269:9). Примеры таких генов включают рецептор диуретического гормона насекомых (Regan, 1994), аллостатин, идентифицированный в Diploptera punctata (Pratt, 1989) и специфические для насекомых паралитические нейротоксины (патент США № 5266361).

(H) Специфический для насекомых яд, продуцируемый змеями, пчелами и т.д., такой как инсектотоксический пептид скорпиона (Pang, 1992 Gene 116:165).

(I) Фермент, ответственный за гипераккумуляцию монотерпенов, сесквитерпенов, стероидов, гидроксамовой кислоты, фенилпропаноидного производного или другой небелковой молекулы с инсектицидной активностью.

(J) Фермент, вовлеченный в модификацию, в том числе посттрансляционную модификацию, биологически активной молекулы; например, гликолитический фермент, протеолитический фермент, липолитический фермент, нуклеаза, циклаза, трансаминаза, эстераза, гидролаза, фосфатаза, киназа, фосфорилаза, полимераза, эластаза, хитиназа и глюканаза, как природный, так и синтетический. Примеры таких генов включают ген callas (опубликованная заявка PCT WO93/02197), кодирующие хитиназу последовательности (которые могут быть получены, например, из ATCC под номерами доступа 3999637 и 67152), хитиназу анкилостома табака (Kramer et al., 1993 Insect Molec. Biol. 23:691), и ген полиубиквитина ubi4-2 петрушки (Kawalleck et al., 1993 Plant Molec. Biol. 21:673).

(K) Молекула, которая стимулирует передачу сигнала. Примеры таких молекул включают нуклеотидные последовательности для клонов кДНК кальмодулина фасоли золотистой (Botella et al., 1994 Plant Molec. Biol. 24:757) и нуклеотидную последовательность клона кДНК кальмодулина кукурузы (Griess et al., 1994 Plant Physiol. 104:1467).

(L) Пептид с гидрофобным моментом. Смотрите патенты США № 5659026 и 5607914; в последнем из которых описаны синтетические противомикробные пептиды, которые сообщают устойчивость к заболеванию.

(M) Мембранная пермеаза, образующий канал белок или блокатор каналов, такой как аналог литического пептида цекропина-β (Jaynes et al., 1993 Plant Sci. 89:43), который сообщает трансгенным растениям табака устойчивость к Pseudomonas solanacearum.

(N) Вирусный инвазивный белок или комплексный токсин, происходящий из него. Например, накопление белков вирусной оболочки в трансформированных клетках растений сообщает устойчивость к вирусной инфекции и/или развитию заболевания, обусловленного вирусом, из которого происходит ген белка оболочки, а также родственными вирусами. Опосредуемая белком оболочки устойчивость была сообщена трансформированным растениям против вируса мозаики люцерны, вируса мозаики огурца, вируса полосатости табака, вируса X картофеля, вируса Y картофеля, вируса гравировки табака, вируса погремковости табака и вируса табачной мозаики. Смотрите, например, Beachy et al. (1990) Ann. Rev. Phytopathol. 28:451.

(O) Специфическое к насекомым антитело или иммунотоксин, происходящий из него. Таким образом, антитело, нацеленное на критическую метаболическую функцию в кишечнике насекомого, может инактивировать затрагиваемый фермент, вызывая гибель насекомого. Например, в Taylor et al. (1994) Abstract #497, Seventh Int’l. Symposium on Molecular Plant-Microbe Interactions, показана ферментативная инактивация трансгенного табака посредством продукции одноцепочечных фрагментов антител.

(P) Вирус-специфическое антитело. Смотрите, например, Tavladoraki et al. (1993) Nature 266:469, где показано, что трансгенные растения, экспрессирующие рекомбинантные гены антител, защищены от вирусной атаки.

(Q) Останавливающий развитие белок, продуцируемый в природе патогеном или паразитом. Таким образом, эндо-α-1,4-D-полигалактуроназы грибов способствуют колонизации грибов и высвобождению питательных веществ растений с помощью солюбилизирующей клеточную стенку растения гомо-α-1,4-D-галактуроназы (Lamb et al., 1992) Bio/Technology 10:1436. Клонирование и охарактеризация гена, который кодирует ингибирующий эндополигалактуроназу белок бобов, описано в Toubart et al. (1992 Plant J. 2:367).

(R) Останавливающий развитие белок, продуцируемый в природе растением, такой как инактивирующий рибосомы ген ячменя, который обеспечивает увеличенную устойчивость к грибковым заболеваниям (Longemann et al., 1992). Bio/Technology 10:3305.

(S) РНК-интерференция, в которой молекулу РНК используют для ингибирования экспрессии гена-мишени. В одном примере молекула РНК является частично или полностью двухцепочечной молекулой, которая запускает подавляющий ответ, что приводит к расщеплению дцРНК на малые интерферирующие РНК, которые затем встраиваются в направленный комплекс, который разрушает гомологичную мРНК. Смотрите, например, Fire et al., патент США 6506559; Graham et al. 6573099.

2. Гены, которые сообщают устойчивость к гербицидам

(A) Гены, кодирующие резистентность или устойчивость к гербициду, который ингибирует точку роста или меристему, такому как имидазалиноновый, сульфонанилидный гербицид или гербицид на основе сульфонилмочевины. Иллюстративные гены в этой категории кодируют мутантный фермент ALS (Lee et al., 1988 EMBO J. 7:1241), который также известен как фермент AHAS (Miki et al., 1990 Theor. Appl. Genet. 80:449).

(B) Один или несколько дополнительных генов, кодирующих резистентность или устойчивость к глифосату, обеспечиваемую мутантными генами синтазы EPSP и aroA или метаболической инактивацией с помощью генов, таких как GAT (глифосатацетилтрансфераза) или GOX (глифосатоксидаза), и других фосфоносоединений, таких как глюфосинат (гены pat и bar; DSM-2), и арилоксифеноксипропионовые кислоты и циклогександионы (гены, кодирующие ингибитор ACC-азы). Смотрите, например, патент США № 4940835, в котором описана нуклеотидная последовательность формы EPSP, которая может сообщать устойчивость к глифосату. Молекулу ДНК, кодирующую мутантный ген aroA, можно получать из ATCC под номером доступа 39256, и нуклеотидная последовательность мутантного гена описана в патенте США № 4769061. В патентной заявке Европы № 0 333 033 и патенте США № 4975374 описаны нуклеотидные последовательности генов глутаминсинтетазы, которые сообщают устойчивость к гербицидам, таким как L-фосфинотрицин. Нуклеотидная последовательность гена фосфинотрицинацетилтрансферазы предоставлена в заявке Европы № 0242246. В De Greef et al. (1989) Bio/Technology 7:61 описано получение трансгенных растений, которые экспрессируют химерные гены bar, кодирующие активность фосфинотрицинацетилтрансферазы. Иллюстративные гены, сообщающие устойчивость к арилоксифеноксипропионовым кислотам и циклогександионам, таким как сетоксидим и галоксифор, представляют собой гены Accl-S1, Accl-S2 и Accl-S3, описанные Marshall et al. (1992) Theor. Appl. Genet. 83:435.

(C) Гены, кодирующие резистентность или устойчивость к гербициду, который ингибирует фотосинтез, такому как триазин (гены psbA и gs+) и бензонитрил (ген нитрилазы). В Przibilla et al. (1991) Plant Cell 3:169 описано использование плазмид, кодирующих мутантные гены psbA, для трансформации Chlamydomonas. Нуклеотидные последовательности для генов нитрилазы описаны в патенте США № 4810648, и молекулы ДНК, содержащие эти гены, доступны под номерами доступа ATCC 53435, 67441 и 67442. Клонирование и экспрессия ДНК, кодирующей глутатион-S-трансферазу, описаны Hayes et al. (1992) Biochem. J. 285:173.

(D) Гены, кодирующие резистентность или устойчивость к гербицидам, которые связываются с гидроксифенилпируватдиоксигеназами (HPPD) - ферментами, которые катализируют реакцию, в которой пара-гидроксифенилпируват (HPP) преобразуется в гомогенисат. Они включают гербициды, такие как изоксазолы (EP418175, EP470856, EP487352, EP527036, EP560482, EP682659, патент США № 5424276), в частности изоксафлутол, который представляет собой селективный гербицид для кукурузы, дикетонитрилы (EP496630, EP496631), в частности, 2-циано-3-циклопропил-1-(2-SO2CH3-4-CF3фенил)пропан-1,3-дион и 2-циано-3-циклопропил-1-(2-SO2CH3-4-2,3Cl2фенил)пропан-1,3-дион, трикетоны (EP625505, EP625508, патент США № 5506195), в частности сулькотрион и пиразолинаты. Ген, который продуцирует избыток HPPD в растениях, может обеспечить устойчивость или резистентность к таким гербицидом, включая, например, гены, описанные в патентах США № 6268549 и 6245968 и публикации патентной заявки США № 20030066102.

(E) Гены, кодирующие резистентность или устойчивость к феноксиауксиновым гербицидам, таким как 2,4-дихлорфеноксиуксусная кислота (2,4-D) и которые также могут сообщать резистентность или устойчивость к арилоксифеноксипропионатным (AOPP) гербицидам. Примеры таких генов включают ген фермента α-кетоглутарат-зависимой диоксигеназы (aad-1), описанный в патенте США № 7838733.

(F) Гены, кодирующие резистентность или устойчивость к феноксиауксиновым гербицидам, таким как 2,4-дихлорфеноксиуксусная кислота (2,4-D), и которые также могут сообщать резистентность или устойчивость к пиридилоксиауксиновым гербицидам, таким как флуроксипир или триклопир. Примеры таких генов включают ген фермента α-кетоглутарат-зависимой диоксигеназы (aad-12), описанный в WO 2007/053482 A2.

(G) Гены, кодирующие резистентность или устойчивость к дикамбе (смотрите, например, публикацию патента США № 20030135879).

(H) Гены, обеспечивающие резистентность или устойчивость к гербицидам, которые ингибируют протопорфириногеноксидазу (PPO) (смотрите патент США № 5767373).

(I) Гены, обеспечивающие резистентность или устойчивость к триазиновым гербицидам (таким как атразин) и гербицидам на основе производных мочевины (таким как диурон), которые связываются с коровыми белками реакционных центров фотосистемы II (PS II) (смотрите Brussian et al., (1989) EMBO J. 1989, 8(4): 1237-1245.

3. Гены, которые сообщают или вносят вклад в дополнительный ценный признак

(A) Модифицированный метаболизм жирных кислот, например, путем трансформации кукурузы или Brassica антисмысловым геном или стеароил-ACP-десатуразой для увеличения содержания стеариновой кислоты в растении (Knultzon et al., 1992) Proc. Nat. Acad. Sci. USA 89:2624.

(B) Сниженное содержание фитатов

(1) Введение кодирующего фитазу гена, такого как ген фитазы Aspergillus niger (Van Hartingsveldt et al., 1993 Gene 127:87), усиливает разрушение фитатов, добавляя больше свободного фосфата трансформированному растению.

(2) Можно вводить ген, который уменьшает содержание фитатов. В кукурузе это можно осуществлять, например, путем клонирования, а затем повторного введения ДНК, ассоциированной с одним аллелем, который ответственен за мутанты кукурузы, характеризующиеся низкими уровнями фитиновой кислоты (Raboy et al., 1990 Maydica 35:383).

(C) Модифицированный состав углеводов, обеспечиваемый, например, путем трансформации растений геном, кодирующим фермент, который изменяет характер ветвления крахмала. Примеры таких ферментов включают, ген фруктозилтрансферазы Streptococcus mucus (Shiroza et al., 1988) J. Bacteriol. 170:810, ген левансукразы Bacillus subtilis (Steinmetz et al., 1985 Mol. Gen. Genet. 200:220), ген α-амилазы Bacillus licheniformis (Pen et al., 1992 Bio/Technology 10:292), гены инвертазы томата (Elliot et al., 1993), ген амилазы ячменя (Sogaard et al., 1993 J. Biol. Chem. 268:22480), и фермент II, разветвляющий крахмал эндосперма кукурузы (Fisher et al., 1993 Plant Physiol. 102:10450).

Представляющая интерес последовательность также может представлять собой нуклеотидную последовательность, введенную в заданную область генома растения путем гомологичной рекомбинации. Способы стабильного встраивания полинуклеотидной последовательности в конкретную область хромосомы клетки-растения способом гомологичной рекомбинации описаны в данной области. Например, сайт-специфическое встраивание, описанное в публикации патентной заявки США № 2009/0111188 A1 вовлекает применение рекомбиназ или интеграз для опосредования введения донорной полинуклеотидной последовательности в хромосомную мишень. Кроме того, в международной патентной заявке № WO 2008/021207 описана опосредуемая цинковыми пальцами гомологичная рекомбинация для стабильного встраивания одной или нескольких донорных полинуклеотидных последовательностей в конкретные области генома. Для стабильного встраивания полинуклеотидной последовательности в конкретный участок хромосомы можно использовать рекомбиназы, такие как FLP/FRT, как описано в патенте США № 6720475, или CRE/LOX, как описано в патенте США № 5658772. Наконец, для нацеливания донорных полинуклеотидов в конкретную область хромосомы было описано применение мегануклеаз, Puchta et al., PNAS USA 93 (1996) pp. 5055-5060).

Другие различные способы для сайт-специфического встраивания в клетки растений, являются общеизвестными и применимыми (Kumar et al., Trends in Plant Sci. 6(4) (2001) pp. 155-159). Более того, для применения в растениях можно использовать системы сайт-специфической рекомбинации, которые были идентифицированы у некоторых прокариотических и низших эукариотических организмов. Примеры таких систем включают, но не ограничиваются ими; систему рекомбиназы R/RS из плазмиды pSR1 дрожжей Zygosaccharomyces rouxii (Araki et al. (1985) J. Mol. Biol. 182: 191-203), и систему Gin/gix фага Mu (Maeser and Kahlmann (1991) Mol. Gen. Genet. 230: 170-176).

Различные анализы можно использовать применительно к молекуле нуклеиновой кислоты определенных вариантов осуществления настоящего изобретения. Описанные далее способы являются пригодными в различных ситуациях, и в одном варианте осуществления они пригодны для обнаружения молекулы нуклеиновой кислоты и/или полипептида, кодируемого в клетке растения. Например, присутствие молекулы можно определять различными путями, в том числе с использованием праймера или зонда для последовательности, анализа ELISA для обнаружения кодируемого белка, вестерн-блоттинга для обнаружения белка или нозерн- или саузерн-блоттинга для обнаружения РНК или ДНК. Можно использовать ферментативные анализы для обнаружения фермента DGT-14. Кроме того, антитело, которое может обнаруживать присутствие белка DGT-14, можно получать с использованием известных в данной области методик. Также для обнаружения присутствия или экспрессии рекомбинантной конструкции в конкретных органах или тканях растения можно использовать дополнительные способы, такие как гибридизация in situ, окрашивание ферментов и иммунное окрашивание. Трансген можно селективно экспрессировать в некоторых тканях растения и на некоторых стадиях развития, или трансген можно экспрессировать во всех тканях растения, по существу в продолжение всего жизненного цикла. Однако также применим любой комбинаторный способ экспрессии.

Саузерн-анализ представляет собой широко используемый способ обнаружения, где ДНК расщепляют с помощью ферментов рестрикции и фракционируют на агарозном геле для разделения ДНК по молекулярной массе, а затем переносят на нейлоновые мембраны. Затем ее гибридизуют с фрагментом-зондом, который является радиоактивно меченным посредством 32P (или другими метками для зондов) и промывают в растворе SDS.

Аналогично, в нозерн-анализе используется сходный протокол, где РНК расщепляют эндонуклеазами рестрикции и фракционируют на агарозном геле для разделения РНК по молекулярной массе, а затем переносят на нейлоновые мембраны. Затем ее гибридизуют с фрагментом-зондом, который является радиоактивно меченным посредством 32P (или других меток для зондов) и промывают в растворе SDS. Анализ РНК (например мРНК), выделенной из представляющих интерес тканей, может указывать на относительные уровни экспрессии. Как правило, если мРНК присутствует или количество мРНК увеличилось, можно предположить, что соответствующий трансген экспрессируется. Нозерн-анализ или другие протоколы для анализа мРНК можно использовать для определения уровней экспрессии введенного трансгена или нативного гена.

В вестерн-анализе вместо выделения ДНК/РНК представляющий интерес белок экстрагируют и наносят на акриламидный гель. Затем белок переносят способом блоттинга на мембрану и контактируют с веществом для мечения. Смотрите например, Hood et al., "Commercial Production of Avidin from Transgenic Maize; Characterization of Transformants, Production, Processing, Extraction and Purification" Molecular Breeding 3:291-306 (1997); Towbin et al, (1979) "Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications" Proc. Natl. Acad. Sci. USA 76(9): 4350-4354; Renart et al. "Transfer of proteins from gels to diazobenzyloxymethyl-paper and detection with antisera: a method for studying antibody specificity and antigen structure" Proc. Natl. Acad. Sci. USA 76(7): 3116-3120.

Молекулы нуклеиновой кислоты согласно вариантам осуществления изобретения или их сегменты можно использовать в качестве праймеров для амплификации способом ПЦР. При проведении амплификации способом ПЦР может быть допустима определенная степень несоответствия между праймером и матрицей. Таким образом, мутации, делеции и инсерции (особенно вставки нуклеотидов на 5ʹ-конец) проиллюстрированных праймеров входят в объем рассматриваемого изобретения. Мутации, инсерции и делеции можно вносить в данный праймер способами, известными специалисту в данной области.

Другим примером способа обнаружения является способ пиросеквенирования, как описано Winge (Innov. Pharma. Tech. 00:18-24, 2000). В этом способе конструируют олигонуклеотид, который перекрывается с соседней геномной ДНК и точкой присоединения ДНК-вставки. Олигонуклеотид гибридизуют с одноцепочечным продуктом ПЦР из представляющей интерес области (один праймер во встроенной последовательности и один во фланкирующей геномной последовательности) и инкубируют в присутствии ДНК-полимеразы, ATP, сульфурилазы, люциферазы, апиразы, аденозин-5′-фосфосульфата и люциферина. DNTP добавляют по отдельности, и встраивание приводит к световому сигналу, который измеряют. Световой сигнал указывает на присутствие вставки трансгена/фланкирующей последовательности вследствие успешной амплификации, гибридизации и удлинения на одно или несколько оснований. (Этот способ используют для первоначального секвенирования, но не для обнаружения конкретного гена, когда он известен).

Для применения для обнаружения последовательности описаны молекулярные маяки. В кратком изложении, конструируют олигонуклеотидный зонд FRET, который перекрывает область соединения фланкирующей геномной ДНК и ДНК-вставки. Уникальная структура зонда FRET приводит к тому, что он содержит вторичную структуру, которая удерживает флуоресцентную часть и осуществляющую гашение часть близко друг к другу. Зонд FRET и праймеры для ПЦР (один праймер в последовательности ДНК-вставки и один во фланкирующей геномной последовательности) подвергают циклическим реакциям в присутствии термостабильной полимеразы и dNTP. После успешной амплификации способом ПЦР, гибридизация зонда(ов) FRET с последовательностью-мишенью приводит к удалению вторичной структуры зонда и пространственному разделению флуоресцентной части и осуществляющей гашение части. Флуоресцентный сигнал указывает на присутствие последовательности фланкирующей геномной ДНК/вставки трансгена вследствие успешной амплификации и гибридизации.

Анализ с гидролизом зонда, также известный как TAQMAN® (Life Technologies, Foster City, Calif.), представляет собой способ обнаружения и количественного определения присутствия последовательности ДНК. В кратком изложении, олигонуклеотидные зонды FRET конструируют так, чтобы один олигонуклеотид находился в трансгене, а другой находился во фланкирующей последовательности для специфичного обнаружения трансгенного объекта. Зонд FRET и праймеры для ПЦР (один праймер в последовательности ДНК-вставки и один во фланкирующей геномной последовательности) подвергают циклической реакции в присутствии термостабильной полимеразы и dNTP. Гибридизация зонда FRET приводит к расщеплению и освобождению флуоресцентной части от осуществляющей гашение части на зонде FRET. Флуоресцентный сигнал указывает на присутствие фланкирующей последовательности/последовательности трансгенной вставки вследствие успешной амплификации и гибридизации.

ELISA, или твердофазный иммуноферментный анализ, известен с 1971 года. Как правило, антигенами, солюбилизированными в буфере, покрывают пластмассовую поверхность. Когда добавляют сыворотку, антитела могут связываться с антигеном на твердой фазе. Присутствие или отсутствие этих антител может быть продемонстрировано, когда они конъюгированы с ферментом. Добавление соответствующего субстрата выявит некоторое количество связанного конъюгата, которое можно количественно определить. Обычный анализ ELISA представляет собой анализ, в котором используются биотинилированные поликлональные антитела (против белка) и конъюгат с щелочной фосфатазой. Например, ELISA, используемый для количественного определения уровней лакказы, может представлять собой сэндвич-анализ антитела, в котором используются поликлональные антитела кролика, полученные коммерчески. Антитело конъюгируют с щелочными фосфатазами для обнаружения. В другом примере в анализе ELISA для обнаружения трипсина или трипсиногена используются биотинилированные поликлональные антитела против трипсина или против трипсиногена и конъюгат стрептавидин-щелочная фосфатаза.

Глифосат, композиция, содержащая N-(фосфонометил)глицин, представляет собой широко используемый компонент в гербицидах. Глифосат, как правило, составляют в качестве соли в водном жидком концентрате, твердом концентрате, эмульсии или микроэмульсии. Подходящие солевые формы глифосата, которые можно использовать в соответствии с любым из составов, включают, например, соли щелочных металлов, например, соли натрия и калия, соли аммония, соли диаммония, такие как диметиламмоний, соли алкиламина, например, соли диметиламина и изопропиламина, соли алканоламина, например, соли этаноламина, соли алкилсульфония, например, соли триметилсульфония, соли сульфоксония и их смеси или комбинации. Примеры коммерчески составов глифосата включают, но не ограничиваются ими: GLYPHOMAX™, GLYPHOMAZ™ XRT, GLYPHOMAX™ PLUS, DURANGO™, ROUNDUP™ ULTRA, ROUNDUP™ ULTRAMAK, ROUNDUP™ CT, ROUNDUP™ EXTRA, ROUNDUP™ BIOACTIVE, ROUNDUP™ BIOFORCE, RODEO™, POLARIS™, SPARK™, ACCORD™ SP, ACCORD™ XRT и ACCORD™ CONCENTRATE, все из которых содержат глифосат в качестве его соли изопропиламмония (IPA); ROUNDUP™ DRY и RIVAL™, которые содержат глифосат в качестве его соли аммония; ROUNDUP™ GEOFORCE, состав натрий глифосата; TOUCHDOWN™, состав соли глифосата-тримезия, TOUCHDOWN™ IQ, состав соли глифосата-диаммония, TOUCHDOWN™ TOTAL IQ, состав глифосата калия, и ROUNDUP™ WEATHERMAX, состав глифосата калия. Составы глифосата могут включать антидоты, поверхностно-активные вещества и/или адъюванты. Предоставление растения или клетки растения, которые являются устойчивыми к составам гербицида глифосата, может быть пригодным в различных применениях, где клетки растений, обладающие такой устойчивостью, могут выдерживать воздействие достаточных количеств глифосата, который используют для борьбы с сорняками на возделываемой посевной площади. Модификация нативной нуклеотидной последовательности бактериального dgt-14 может обеспечить увеличенную устойчивость к гербициду глифосату при экспрессии в растении.

Глифосат можно наносить на растения поверхностно, начиная с их прорастания, на протяжении различных стадий развития растения. Устойчивые к глифосату сорта растений, используемые в комбинации с гербицидными составами глифосата, стали стандартной программой для борьбы с сорняками при производстве сельскохозяйственных культур в США и по всему миру. Основным преимуществом для растениеводов в использовании признака устойчивости к глифосату (например, dgt-14) является то, что он обеспечивает простое и удобное внесение глифосата, послевсходового гербицида широкого спектра, для борьбы с нежелательными растениями и травами (т.е. "сорняками") с превосходной безопасностью для культуры и меньшей зависимостью от внесения предпосадочных гербицидов. Другая польза включает лучшую приспособляемость к системам нулевой обработки почвы и ограниченной подготовки почвы. Устойчивые к глифосату культуры обеспечивают расширенные возможности для борьбы с сорняками, и они обеспечивают значительное упрощение, снижение стоимости и большую универсальность практики борьбы с сорняками. Растениеводы сообщали о том, что они проводили меньшее количество выездов на поля для внесения гербицидов, а также делали меньше выездов для обработки, что сохраняет топливо и уменьшает эрозию почвы. Таким образом, устойчивые к глифосату культуры снижают экологические риски гербицидов, и в то же время увеличивают эффективность необходимой химической борьбы с сорняками.

Таким образом, в различных вариантах осуществления, предусматриваются способы селективной борьбы с сорняками на возделываемой посевной площади, содержащей устойчивое к глифосату растение. Способы включают внесение достаточного количества гербицида глифосата на листву сельскохозяйственной культуры и сорняки для борьбы с сорняками.

Относительное количество глифосата, присутствующего в предусматриваемой гербицидной композиции (например, концентрат в форме твердых частиц, жидкий концентрат, готовая к применению композиция и композиция баковой смеси) может варьировать в зависимости от многих факторов, включая, например, вид сорняков, с которым осуществляют борьбу, и способ внесения. Однако, в общем, концентрация глифосата, и необязательно поверхностно-активного вещества и/или некоторого другого адъюванта или добавки (как описано в настоящем описании), используемых в гербицидной композиции, является достаточной для борьбы с сорняками на возделываемой посевной площади.

Кроме того, концентрация глифосата, и необязательно поверхностно-активного вещества и/или некоторого другого адъюванта или добавки (как описано в настоящем описании), используемых в гербицидной композиции, является достаточной для обеспечения борьбы с сорняками на возделываемой посевной площади.

Таким образом, композицию жидкого концентрата составляют так, чтобы она включала глифосат в концентрации по меньшей мере приблизительно 50 грамм, по меньшей мере приблизительно 75 грамм, или по меньшей мере приблизительно 100, 125, 150, 175, 200, 225, 250, 275, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690 или 700 грамм (эквивалент кислоты или э.к.) на литр или больше. Диапазон концентраций глифосата может составлять, например, от приблизительно 50 до приблизительно 680 грамм (э.к.) на литр (г/л), от приблизительно 100 до приблизительно 600 г/л, от приблизительно 250 до приблизительно 600 г/л, и от приблизительно 360 до приблизительно 540 г/л. При выражении в качестве весового процента на основе общей массы концентрата глифосата, жидкий концентрат содержит, например, по меньшей мере приблизительно 10 масс. % глифосата (эквивалент кислоты или э.к.), по меньшей мере приблизительно 15 масс. %, и по меньшей мере приблизительно 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67 или 68 масс. %, или более. Диапазон концентраций глифосата может составлять, например, от приблизительно 10 масс. % до приблизительно 70 масс. % э.к., от приблизительно 20 масс. % до приблизительно 68 масс. %, или от приблизительно 25 масс. % до приблизительно 45 масс. %. Если глифосат вносят в качестве готовой к применению композиции, концентрация глифосата составляет, как правило, от приблизительно 1 масс. % до приблизительно 3 масс. % э.к., и от приблизительно 1 масс. % до приблизительно 2 масс. %.

При выражении в качестве процента по массе в расчете на общую массу концентрата глифосата, композиции твердого концентрата составляют так, чтобы они включали глифосат в концентрации по меньшей мере приблизительно 5 масс. % глифосата (эквивалент кислоты или э.к.), по меньшей мере приблизительно 20 масс. % э.к., или по меньшей мере приблизительно 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 или 95 масс. % э.к., или более. Концентрация глифосата находится в диапазоне, например, от приблизительно 5 масс. % до приблизительно 97 масс. % э.к., от приблизительно 30 масс. % до приблизительно 85 масс. % э.к., или от приблизительно 50 масс. % до приблизительно 75 масс. % э.к.

Композиции спрея можно составлять для внесения, например, по меньшей мере приблизительно 1 галлона (3,8 л) композиции спрея на акр, по меньшей мере приблизительно 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 галлонов (75,7 л) на акр и более. Распыляемый объем композиции спрея может находиться в диапазоне, например, от приблизительно 1 галлона (3,8 л) до приблизительно 100 галлонов (378,5 л) на акр, от приблизительно 2 галлонов (7,6 л) до приблизительно 40 галлонов (151,4 л) на акр, и от приблизительно 2 галлонов (7,6 л) до приблизительно 5 галлонов (18,9 л) на акр для авиационного внесения, и от приблизительно 5 галлонов (18,9 л) до приблизительно 20 галлонов (75,7 л) на акр для внесения в почву.

Альтернативно гербицидные композиции глифосата можно предоставлять конечному пользователю уже составленными, либо в желаемом разведении для внесения (т.е. "готовые для применения" композиции), либо требующие разбавления, диспергирования или растворения в воде конечным пользователем (т.е. композиции "концентрата"). Такие предварительно составленные концентраты могут представлять собой жидкости или твердые вещества в форме частиц.

Можно использовать состав жидкого концентрата, имеющий водную фазу, где глифосат присутствует в основном в форме соли, и неводную фазу, необязательно содержащую второй гербицидно активный ингредиент, который является относительно нерастворимым в воде. Такие составы могут включать, например, эмульсии (включая макроэмульсии и микроэмульсии, типы "вода-в-масле", "масло-в-воде" и "вода-в-масле-в-воде"), суспензии и суспоэмульсии. Неводная фаза в определенных случаях может содержать микроинкапсулированный компонент, например, микроинкапсулированный гербицид. В составах, имеющих неводную фазу, концентрация глифосата, э.к., в композиции в целом, тем не менее, может находиться в конкретных иллюстративных диапазонах, указанных в настоящем описании для составов водного концентрата.

Следует отметить, что композиции гербицидного спрея вносят в виде водных растворов или дисперсий, независимо от того, изготовлены ли они в готовом для применения виде или получены ли они путем дальнейшего разбавления жидкого концентрата глифосата или добавления воды к концентрату глифосата в форме твердых частиц. Однако не подразумевается, что термин "водный", как используют в рамках изобретения, исключает присутствие некоторого небольшого количества неводного растворителя при условии, что основным присутствующим растворителем является вода.

Один вариант осуществления изобретения относится к способу уничтожения или борьбы с сорняками или нежелательной растительности на возделываемой посевной площади, содержащей сельскохозяйственную культуру (например, трансгенные устойчивые к глифосату растения. В одном варианте осуществления способ включает внесение глифосата в качестве баковой смеси и внесение гербицидно достаточного количества баковой смеси на листву растений, генетически трансформированных, чтобы они были устойчивыми к глифосату, и одновременно на листья сорняков, растущих вблизи таких растений. Этот способ применения приводит к борьбе с сорняками и нежелательной растительностью при сохранении устойчивых к гербициду растений по существу неповрежденными.

В одном варианте осуществления изобретения водную композицию глифосата можно вносить на ткани листьев растений для уничтожения или контроля роста широкого множества нежелательных растений, включая однолетние и многолетние травы и широколистные виды сорняков, путем внесения на ткани листьев растений водных композиций глифосата. Такие растения могут включать, но не ограничиваться ими, например: люцерну, сою, хлопок, рапс, лен, кукурузу, рис, брахиурию, пшеницу, сафлор, сорго, сахарную свеклу, подсолнечник, табак и травы рулонного газона. Таким образом, могут быть выбраны любой вид растения или клетка растения. В вариантах осуществления клетки растения, используемые в настоящем описании, и растения, выращенные и происходящие из них, включают, но не ограничиваются ими, клетки, получаемые из рапса (Brassica napus); горчицы индийской (Brassica juncea); горчицы эфиопской (Brassica carinata); репы (Brassica rapa); капусты (Brassica oleracea); сои (Glycine max); льняного семени/льна (Linum usitatissimum); маиса (также описываемого как кукуруза) (Zea mays); сафлора (Carthamus tinctorius); подсолнечника (Helianthus annuus); табака (Nicotiana tabacum); Arabidopsis thaliana, бразильского ореха (Betholettia excelsa); клещевины обыкновенной (Ricinus communis); кокоса (Cocus nucifera); кориандра (Coriandrum sativum); хлопка (Gossypium spp.); арахиса (Arachis hypogaea); хохобы (Simmondsia chinensis); масличной пальмы (Elaeis guineeis); оливы (Olea eurpaea); риса (Oryza sativa); пшеницы (Triticum spp. включая Triticum durum и Triticum aestivum) и ряски (Lemnaceae sp.). В некоторых вариантах осуществления генетический фон в пределах вида растений может варьировать.

Гербицидную композицию вносят в растения во вносимых дозах, достаточных для обеспечения желаемых биологических результатов: контроль роста сорняков без значительного повреждения устойчивых к глифосату сельскохозяйственных культур. Эти вносимые дозы обычно выражают как количество глифосата на единицу обрабатываемой площади, например, в граммах на гектар (г/га). То, что представляет собой "значительный эффект", варьирует в зависимости от стандартов и практики лиц, которые исследуют, разрабатывают, выпускают на рынок и применяют композиции, и выбор уровней применения композиции, которые обладают значительной эффективностью, находится в пределах квалификации специалистов в данной области. Главным образом, количество композиции, вносимой на единицу площади для обеспечения 85% борьбы с сорными видами, определяемое по снижению роста или смертности, часто используют для определения коммерческой дозы.

Выбор ряда вносимых доз гербицида глифосата, достаточных для борьбы с сорняками на возделываемой посевной площади, находится в пределах квалификации ученого-агронома. Аналогично, специалистам в данной области будет понятно, что индивидуальные условия посева, погодные условия и условия роста, а также конкретные активные ингредиенты и их весовое соотношение в композиции будут влиять на степень гербицидной эффективности, достигаемой при осуществлении на практике способов, описанных в настоящем описании.

Композиции гербицидного спрея можно наносить на листья растений, подлежащих обработке, посредством любого из подходящих способов, которые хорошо известны специалистам в данной области, включая способы авиационного внесения и внесения в почву (например, штанговый опрыскиватель, ручной опрыскиватель и веревочный фитиль).

Если желательно, пользователь может смешивать один или несколько адъювантов с композицией глифосата и водой для разведения при получении композиции для применения. Такие адъюванты могут включать дополнительное поверхностно-активное вещество и/или неорганическую соль, такую как сульфат аммония, с целью дальнейшего усиления гербицидной эффективности.

Дальнейшие усовершенствования также включают применение соответствующих антидотов для дополнительной защиты растений и/или добавления перекрестной устойчивости к большему количеству гербицидов. Антидоты, как правило, действуют, усиливая иммунную систему растения путем активации/экспрессии cP450. Антидоты представляют собой химические вещества, которые уменьшают фитотоксичность гербицидов для сельскохозяйственных культур благодаря физиологическому или молекулярному механизму, без снижения их эффективности борьбы с сорняками.

Антидоты гербицидов включают беноксакор, клоквинтоцет, циометринил, дихлормид, дициклонон, диэтолат, фенхлоразол, фенклорим, флуразол, флуксофеним, фурилазол, изоксадифен, мефенпир, мефенат, нафталиновый ангидрид и оксабетринил. Активаторы растений (новый класс соединений, которые защищают растения путем активации их механизмов защиты), также можно использовать в вариантах осуществления в рамках настоящего изобретения. Они включают ацибензолар и пробеназол.

Для защиты травяных культур с крупными семенами, таких как кукуруза, сорго обыкновенное и рис влажного посева можно использовать коммерческие антидоты против вносимых до всходов или вносимых после всходов гербицидов семейств тиокарбаматов и хлорацетнилидов. Также были разработаны антидоты для защиты зимних злаковых культур, таких как пшеница, от послевсходового внесения гербицидов на основе арилоксифеноксипропионата и сульфонилмочевины. Применение антидотов для защиты кукурузы и риса от гербицидов на основе сульфонилмочевины, имидазолинона, циклогександиона, изоксазола и трикетона также является общепринятым. Индуцируемое антидотом усиление детоксикации в обработанных антидотом растениях широко признано в качестве основного механизма действия антидота. Антидоты индуцируют кофакторы, такие как глутатион, и детоксифицирующие гербициды ферменты, такие как глутатион-S-трансферазы, монооксигеназы цитохрома P450 и глюкозилтрансферазы. Hatzios KK, Burgos N (2004) "Methabolism-based herbicide resistance: regulation by safeners", Weed Science: Vol. 52, No. 3 pp. 454-467. Все публикации и опубликованные патентные документы, цитированные в настоящем описании, включены в настоящее описание в качестве ссылок в той же степени, как если бы каждая индивидуальная публикация или патентная заявка была конкретно и индивидуально указана, как включенная в качестве ссылок.

Варианты осуществления настоящего изобретения далее определены в представленных ниже примерах. Следует понимать, что эти примеры приведены только в качестве иллюстрации. Из представленного выше обсуждения и этих примеров квалифицированный специалист может установить неотъемлемые характеристики настоящего изобретения и, без отклонения от его сущности и объема, может внести различные изменения и модификации в варианты осуществления изобретения, чтобы адаптировать их к различным способам применения и условиям. Таким образом, различные модификации вариантов осуществления изобретения, в дополнение к вариантам осуществления, представленным и описанным в настоящем описании, будут очевидными специалистам в данной области из представленного выше описания. Подразумевается, что такие модификации также входят в объем прилагаемой формулы изобретения. Нижеследующее предоставлено в качестве иллюстрации и не предназначено для ограничения объема изобретения.

ПРИМЕРЫ

Пример 1: мутантные EPSP-синтазы

Одна мутация аминокислоты (G96A) в ферменте 5-енолпирувилшикимат-3-фосфатсинтазе (EPSP-синтаза) Escherichia coli может приводить к нечувствительности к глифосату (Padgette et al., (1991); Eschenburg et al., (2002); Priestman et al., (2005); Haghani et al., (2008)). Хотя эта мутация сообщает устойчивость к глифосату, также известно, что она неблагоприятно влияет на связывание EPSP-синтазы с ее природным субстратом фосфоенолпируватом (PEP). Изменение в результате этого эффективности связывания субстрата может привести к тому, что мутантный фермент будет непригодным для обеспечения устойчивости растений к глифосату.

Базу данных Genbank NCBI подвергали скринингу in silico в отношении белковых и полинуклеотидных последовательностей EPSP-синтазы, которые естественным образом содержат аланин в положении в ферменте EPSP-синтазе, аналогичном положению мутации G96A, которая была внесена в версию фермента из E. coli (Padgette et al., (1991); Eschenburg et al., (2002); Priestman et al., (2005); Haghani et al., (2008)) или в отношении белковых и полинуклеотидных последовательностей EPSP-синтазы, которые могли быть изменены путем внесения аланина вместо глицина в положении, аналогичном G96A.

Одним ферментом, который был идентифицирован, был DGT-14 (GENBANK ACC № ZP_01452683) из Mariprofundus ferrooxydans. Кроме того, изучение данных in silico выявило пять других уникальных ферментов с гомологией с DGT-14, обозначаемых как DGT-11 (GENBANK ACC № YP_989551.1), DGT-12 (GENBANK ACC № ZP_01622155.1), DGT-18 (GENBANK ACC № NP_928909.1), DGT-29 (GENBANK ACC № YP_322772.1) и DGT-30 (GENBANK ACC № ZP_02156189.1). Один из этих ферментов, DGT-11 (SEQ ID NO:5), содержит природный аланин в положении фермента EPSP-синтазы, аналогичном мутации G96A, которая была внесена в версию фермента из E. coli. Поскольку белки EPSP-синтазы из различных организмов имеют различную длину, нумерация мутации для версии фермента EPSP-синтазы из E.coli не обязательно соответствует нумерации мутации для ферментов EPSP-синтаз из других организмов. Эти идентифицированные ферменты EPSP-синтазы, нативные или мутантные на аланин, внесенный вместо аминокислотного остатка глицина, ранее не были охарактеризованы в отношении устойчивости к глифосату или аффинности к субстрату PEP.

Были получены новые ферменты DGT-14, DGT-12, DGT-18, DGT-29 и DGT-30, и была внесена мутация глицина на аланин в ферменты EPSP-синтазы в положении, аналогичном положению G96A, описанному для версии фермента EPSP-синтазы из E. coli. Белковая последовательность DGT-14 была модифицирована путем внесения аланина для замены эндогенного глицина GENBANK ACC № ZP_01452683 в аминокислотном остатке 101, тем самым, получая SEQ ID NO:1. Белковая последовательность DGT-12 была модифицирована путем внесения аланина вместо эндогенного глицина GENBANK ACC № ZP_01622155.1 в аминокислотном остатки 111, тем самым, получая SEQ ID NO:7. Белковая последовательность DGT-18 была модифицирована путем внесения аланина вместо эндогенного глицина GENBANK ACC № NP_928909.1 в аминокислотном остатке 96, тем самым, получая SEQ ID NO:9. Белковая последовательность DGT-29 была модифицирована путем внесения аланина вместо эндогенного глицина GENBANK ACC № YP_322772.1 в аминокислотном остатке 96, тем самым, получая SEQ ID NO:11. Белковая последовательность DGT-30 была модифицирована путем внесения аланина вместо эндогенного глицина GENBANK ACC № ZP_02156189.1 в аминокислотном остатке 96, тем самым, получая SEQ ID NO:13.

Модифицированные ферменты EPSP-синтазы и нативный фермент EPSP-синтазу DGT-11 охарактеризовывали в отношении устойчивости к глифосату и аффинности к субстрату PEP путем сравнения с ферментами EPSP-синтазами класса I. Для сравнения использовали следующие ферменты класса I: DGT-1 из Glycine max, DGT-3 из Brassica napus (GENBANK ACC № P17688) и DGT-7 из Triticum aestivum (GENBANK ACC № EU977181). Ферменты EPSP-синтазы класса I и их мутантные варианты синтезировали и оценивали. Мутация, внесенная в ферменты EPSP-синтазы растений, состояла из мутации глицина на аланин, внесенной в фермент EPSP-синтазу в положении, сходном с положением мутации G96A из версии фермента из E. coli. Кроме того, мутации треонина на изолейцин и пролина на серин вносили в эти ферменты EPSP-синтазы класса I в положениях, аналогичных положениям аминокислоты 97 (T на I) и аминокислоты 101 (P на S) в EPSP-синтазе E. coli, как описано в Funke et al., (2009).

На фиг. 1 представлено неполное выравнивание последовательностей DGT-14, DGT-11, DGT-12, DGT-18, DGT-29 и DGT-30 с другими ферментами EPSP-синтазами. В результате модификации аланина вместо глицина для DGT-14, DGT-12, DGT-18, DGT-29 и DGT-30, эти ферменты DGT обладают консервативным аланином в положении аминокислоты 96 фермента EPSP-синтазы aroA. Положение этой аминокислоты указано звездочкой, и аминокислотный остаток подчеркнут.

На фиг. 2 представлено выравнивание ферментов DGT-1, DGT-3 и DGT-7. Положение аминокислотного остатка, в котором была внесена мутация с глицина на аланин, указано первой звездочкой. Положение аминокислотного остатка, в котором была внесена мутация с треонина на изолейцин, указано второй звездочкой. Положение третьего аминокислотного остатка, в котором была внесена мутация с пролина на серин, указано третьей звездочкой. Эти мутации вносили в различные версии DGT-1, DGT-3 и DGT-7. Различные версии генов, которые содержат мутации, более подробно описаны ниже.

Пример 2: оптимизация последовательности для экспрессии в растениях и бактериях

Анализ кодирующей последовательности DGT-14 из Mariprofundus ferrooxydans выявил присутствие нескольких мотивов последовательности, которые, как полагали, были неблагоприятными для оптимальной экспрессии в растениях, а также композиции неоптимальных кодонов для экспрессии в двудольных и однодольных растениях. Варианты осуществления настоящего изобретения относятся к конструированию оптимизированного для растений гена, кодирующего DGT-14, для получения последовательности ДНК, которая может оптимально экспрессироваться в двудольных или однодольных растениях, и в которой модификации последовательности не препятствуют трансляции или транскрипции.

Вследствие пластичности, обеспечиваемой избыточностью/вырожденностью генетического кода (т.е. некоторые аминокислоты определяются более чем одним кодоном), эволюция геномов в различных организмах или классах организмов привела к различающемуся использованию синонимичных кодонов. Это "предпочтение кодонов" кодонов отражается средним составом оснований в кодирующих белок областях. Например, в организмах, имеющих геномы с относительно низким содержанием G+C, используется больше кодонов, имеющих A или T в третьем положении синонимичных кодонов, в то время как в организмах, имеющих более высокое содержание G+C, используется больше кодонов, имеющих G или C в третьем положении. Кроме того, полагают, что присутствие "второстепенных" кодонов в мРНК может снизить абсолютную скорость трансляции этой мРНК, особенно когда относительная распространенность заряженной тРНК, соответствующей второстепенному кодону, является низкой. Продолжением этого рассуждения является то, что уменьшение скорости трансляции индивидуальными второстепенными кодонами может быть по меньшей мере аддитивным для множества второстепенных кодонов. Таким образом, мРНК, имеющие высокое относительное содержание второстепенных кодонов, может соответственно иметь низкие скорости трансляции. Эта скорость может соответственно отражаться низкими уровнями кодируемого белка.

В модифицированном способами инженерии гене, кодирующем DGT-14, для экспрессии в двудольных или однодольных растениях (таких как хлопок, канола, табак, кукуруза, соя, пшеница и рис), можно определять предпочтение кодонов предполагаемым растением(ями)-хозяином, например, с использованием общедоступных баз данных последовательностей ДНК для поиска информации о распределении кодонов в геномах растений или кодирующих белок областях различных генов растений. Предпочтение кодонов представляет собой статистическое распределение кодонов, которое используется растением для кодирования аминокислот его белков. Предпочтительное использование кодонов для двудольных или однодольных (кукуруза) растений представлено в таблице 1.

ТАБЛИЦА 1
Представления синонимичных кодонов из кодирующих областей генов однодольных (кукуруза, %) и двудольных (двудольные, %) растений представлены в столбцах D, E, I и J. Величины, соответствующие сбалансированным предпочтительным кодонам, представленные для оптимизированной для растения синтетической конструкции гена, показаны в столбцах C и H.
A B C D E F G H I J
Аминокислота Кодон Средневзвешенное значение Кукуруза, % Двудольные, % Аминокислота Кодон Средневзвешенное значение Кукуруза, % Двудольные, %
ALA (A) GCA 25,5 18 25 LEU (L) CTA DNU 8 8
GCC 35,6 34 27 CTC 34,3 26 19
100 GCG DNU 24 6 CTG DNU 29 9
GCT 39,0 24 42 100 CTT 34,3 17 28
ARG (R) AGA 27,4 15 30 TTA DNU 5 10
AGG 31,5 26 25 TTG 31,4 15 26
CGA DNU 9 8 LYS (K) AAA 30,6 22 39
100 CGC 21,7 24 11 100 AAG 69,4 78 61
CGG DNU 15 4 MET (M) ATG 100 100 100
CGT 19,4 11 21 PHE (F) TTC 63,2 71 55
ASN (N) AAC 61,4 68 55 100 TTT 36,8 29 45
100 AAT 38,6 32 45 PRO (P) CCA 41,4 26 42
ASP (D) GAC 52,6 63 42 CCC 25,3 24 17

100 GAT 47,4 37 58 100 CCG DNU 28 9
CYS (C) TGC 61,8 68 56 CCT 33,3 22 32
100 TGT 38,2 32 44 SER (S) AGC 26,0 23 18
END TAA 20 48 AGT DNU 9 14
100 TAG 21 19 100 TCA 22,4 16 19
TGA 59 33 TCC 26,3 23 18
GLN (Q) CAA 48,4 38 59 TCG DNU 14 6
100 CAG 51,6 62 41 TCT 25,4 15 25
GLU (E) GAA 38,8 29 49 THR (T) ACA 28,0 21 27
100 GAG 61,2 71 51 ACC 39,5 37 30
GLY (G) GGA 28,5 19 38 100 ACG DNU 22 8
GGC 29,0 42 16 ACT 32,5 20 35
101 GGG 16,0 20 12 TRP (W) TGG 100 100 100
GGT 26,6 20 33 TYR (Y) TAC 65,0 73 57
HIS (H) CAC 54,1 62 46 100 TAT 35,0 27 43
100 CAT 45,9 38 54 VAL (V) GTA DNU 8 12
ILE (I) ATA 15,9 14 18 GTC 28,7 32 20
100 ATC 47,9 58 37 100 GTG 38,0 39 29
ATT 36,4 28 45 GTT 33,3 21 39
*DNU = Не используется

Предпочтение кодонов можно вычислять в качестве частоты, при которой один кодон используется относительно кодонов для всех аминокислот. Альтернативно предпочтение кодонов можно вычислять в качестве частоты, при которой один кодон используется для кодирования конкретной аминокислоты, относительно всех других кодонов для этой аминокислоты (синонимичных кодонов). При конструировании кодирующих областей для экспрессии в растении, необходимо определять основные кодоны ("первого выбора"), предпочитаемые растением, а также кодоны второго, третьего, четвертого и т.д. выбора предпочтительных кодонов, когда существует множество вариантов для выбора. Затем можно конструировать новую последовательность ДНК, которая кодирует аминокислотную последовательность того же пептида DGT-14, однако новая последовательность ДНК отличается от исходной последовательности ДНК посредством замены кодонов растения (первого предпочтения, второго предпочтения, третьего предпочтения или четвертого предпочтения и т.д.), чтобы задавать аминокислоту в каждом положении в аминокислотной последовательности. Затем новую последовательность анализируют в отношении участков ферментов рестрикции, которые могут быть образованы путем модификаций. Идентифицированные участки можно далее модифицировать путем замены кодонов на предпочтительные кодоны первого, второго, третьего или четвертого выбора. Другие участки в последовательности, которые могут влиять на транскрипцию или трансляцию представляющего интерес гена, представляют собой структуры стебель-петля, области соединения экзон:интрон (5ʹ или 3ʹ), сигналы присоединения поли-A и сигналы терминации РНК-полимеразы; эти участки можно удалять путем замены кодонов растений. Последовательность можно далее анализировать и модифицировать для уменьшения частоты дублетов TA или CG. В дополнение к дублетам, блоки последовательности G или C, которые имеют более шести остатков, которые являются одинаковыми, могут влиять на транскрипцию или трансляцию последовательности. Таким образом, эти блоки можно модифицировать путем замены кодонов первого или второго выбора, например, на следующий предпочтительный для выбора кодон.

Таким образом, для получения гена, как описано в настоящем описании, можно использовать различные способы. Пример одного такого подхода далее проиллюстрирован в заявке PCT WO 97/13402. Таким образом, синтетические гены, которые функционально эквивалентны гену dgt-14 по настоящему изобретению, можно использовать для трансформации хозяев, включая растения. Дополнительное руководство в отношении получения синтетических генов может быть найдено, например, в патенте США № 5380831.

Для конструирования оптимизированного для растения гена, кодирующего dgt-14, конструировали последовательность ДНК для кодирования аминокислотных последовательностей с использованием избыточного генетического кода на основе таблицы предпочтения кодонов, составленной из кодирующих белок последовательностей для конкретных растений-хозяев. В таблице 1, столбцы D и I, представлено распределение (в % использовании всех кодонов этой аминокислоты) синонимичных кодонов для каждой аминокислоты, встречающихся в кодирующих областях однодольных (кукуруза) растений. В столбцах E и J представлены распределения (в % использовании всех кодонов для этой аминокислоты) синонимичных кодонов для каждой аминокислоты, встречающихся в кодирующих областях двудольных растений. Некоторые синонимичные кодоны для некоторых аминокислот встречаются только редко в генах растений (например CGG). Обычно кодон считался редко используемым, если он соответствовал приблизительно 10% или менее случаев кодирования соответствующей аминокислоты в генах любого типа растений (указанный как DNU в столбцах C и H таблицы 1). Для уравновешивания распределения оставшихся выбираемых кодонов для аминокислоты, вычисляли средневзвешенное представление для каждого кодона с использованием формулы:

Средневзвешенный %C1=1/(%C1+%C2+%C3+ и т.д.)×%C1×100

где C1 представляет собой рассматриваемый кодон, и %C2, %C3 и т.д. соответствуют средним значениям для двудольного растения % величин оставшихся кодонов (средние % величины для соответствующих кодонов взяты из столбцов C и H), представленных в таблице 1.

Средневзвешенная % величина для каждого кодона приведена в столбцах C и H таблицы 1.

Была сконструирована новая последовательность ДНК, которая фактически кодирует аминокислотную последовательность белка DGT-14, для оптимальной экспрессии в двудольных растениях с использованием сбалансированного распределения кодонов для часто используемых кодонов, встречающихся в генах двудольных растений. Вторую последовательность ДНК, которая фактически кодирует аминокислотную последовательность белка DGT-14, конструировали для оптимальной экспрессии в однодольных растениях с использованием сбалансированного распределения кодонов для часто используемых кодонов, встречающихся в генах однодольных растений. Две новых последовательности ДНК отличаются от исходной последовательности ДНК, кодирующей dgt-14, заменой кодонов растения (первого предпочтения, второго предпочтения, третьего предпочтения или четвертого предпочтения) для обеспечения соответствующей аминокислоты в каждом положении в аминокислотной последовательности белка. Конструирование оптимизированной для растений последовательности ДНК начинали путем обратной трансляции белковой последовательности DGT-14 (GENBANK ACC № ZP_01452683), которая была модифицирована путем внесения аланина вместо эндогенного глицина в аминокислотном остатке 101. SEQ ID NO:1 подвергали обратной трансляции с использованием таблицы предпочтительных кодонов для двудольных растений, составленной на основе таблицы 1, столбцы E и J. Вторую обратную трансляцию SEQ ID NO:1 осуществляли с использованием таблицы предпочтения кодонов для однодольных растений, составленной на основе таблицы 1, столбцы D и I. Затем первоначальную последовательность модифицировали путем компенсации замен кодонов (при сохранении общего средневзвешенного представления кодонов) для удаления или добавления участков распознавания ферментами рестрикции, удаления высокостабильных внутрицепочечных вторичных структур и удаления других последовательностей, которые могут быть неблагоприятными для манипуляций при клонировании или экспрессии модифицированного способами инженерии гена в растениях. Затем последовательность ДНК повторно анализировали в отношении участков распознавания ферментами рестрикции, которые могли быть сформированы путем модификаций. Идентифицированные участки далее модифицировали путем замены соответствующих кодонов предпочтительными кодонами первого, второго, третьего или четвертого выбора. Другие участки в последовательностях, которые могут влиять на транскрипцию или трансляцию представляющего интерес гена, включают участки соединения экзон:интрон (5ʹ или 3ʹ), сигналы присоединения поли-A, или сигналы терминации для РНК-полимеразы. Модифицированные последовательности далее анализировали и далее модифицировали для уменьшения частоты дублетов TA или CG, и для увеличения частоты дублетов TG или CT. В дополнение к этим дублетам, блоки последовательности, которые имеют более чем приблизительно шесть последовательно расположенных остатков [G+C] или [A+T], могут влиять на транскрипцию или трансляцию последовательности. Таким образом, эти блоки последовательности также модифицировали путем замены кодонов первого или второго выбора и т.д. другими предпочтительными для выбора кодонами. Редко используемые кодоны по существу не включали в конструкцию гена, и их использовали по существу только при необходимости для удовлетворения различных критериев конструирования, а не для композиции кодонов (например, добавление или удаление участков распознавания ферментами рестрикции).

Вновь сконструированная оптимизированная для двудольных растений полинуклеотидная последовательность dgt-14 v2 приведена в SEQ ID NO:2. Вновь сконструированная оптимизированная для однодольных растений полинуклеотидная последовательность dgt-14 v2 приведена в SEQ ID NO:3. Полученные последовательности ДНК обладают более высокой степенью разнообразия кодонов, желаемой композицией оснований, они содержат стратегически расположенные участки распознавания ферментами рестрикции и лишены последовательностей, которые могут препятствовать транскрипции гена или трансляции мРНК-продукта.

После моделирования оптимизированной для растений последовательности ДНК на бумаге или in silico, реальные молекулы ДНК можно синтезировать в лаборатории, чтобы они точно соответствовали по последовательности смоделированной последовательности. Такие синтетические молекулы нуклеиновой кислоты можно клонировать или иным образом подвергать манипулированию точно так, как если бы они происходили из природных или нативных источников. Синтез фрагмента ДНК, включающего SEQ ID NO:2 или SEQ ID NO:3, который содержит дополнительные последовательности, такие как стоп-кодоны 6 рамок (стоп-кодоны, расположенные во всех шести рамках считывания, которые добавлены к 3ʹ-концу кодирующей последовательности), и 5ʹ-участок рестрикции для клонирования, проводился коммерческими поставщиками (DNA2.0, Menlo Park, CA). Затем синтетическую молекулу нуклеиновой кислоты клонировали в экспрессирующие векторы и трансформировали в растения или бактерии, как описано в примерах ниже.

Оптимизация для экспрессии в бактериях

Конструировали новую последовательность ДНК, кодирующую белок DGT-14 SEQ ID NO:1, которая оптимизирована для экспрессии в клетках Escherichia coli. Конструирование оптимизированной для E. coli последовательности ДНК начинали путем обратной трансляции белковой последовательности SEQ ID NO:1 с использованием запатентованного протокола оптимизации кодонов от GeneArt (Regensburg, Германия). Исходную последовательность модифицировали путем компенсации изменений кодонов (при сохранении общего средневзвешенного представления) для удаления или добавления участков распознавания ферментами рестрикции, для удаления высокостабильных внутрицепочечных вторичных структур и для удаления других последовательностей, которые могут быть неблагоприятными для манипуляций при клонировании или экспрессии модифицированного способами инженерии гена. Примером такой неблагоприятной последовательности, которую стремились избегать в кодирующей области, является последовательность связывания 16S рибосомной РНК ("последовательность Шайна-Дальгарно"), такая как AGGAGG, которая может кодировать, например, две последовательно расположенных аминокислоты аргинина, но которая также может служить в качестве внутригенного (и, таким образом, нежелательного) сигнала инициации трансляции. Предпочтительная для E. coli последовательность ДНК dgt-14 v6, которая кодирует белок SEQ ID NO:1, приведена в качестве SEQ ID NO:4.

Для облегчения клонирования и для обеспечения эффективной инициации трансляции 5ʹ-концевую последовательность для распознавания ферментом рестрикции NdeI помещали выше инициирующего трансляцию кодона ATG. Также для облегчения клонирования и для обеспечения надлежащей терминации трансляции на 3ʹ-конце кодирующей области были включены основания, кодирующие два стоп-кодона трансляции TAA и участок распознавания ферментами рестрикции XhoI. Синтез фрагмента ДНК, содержащего SEQ ID NO:4, проводился коммерчески поставщиком GeneArt.

Сходные стратегии оптимизации кодонов для Escherichia coli использовали для конструирования dgt-11 v6, dgt-12 v6, dgt-18 v6, dgt-29 v6 и dgt-30 v6. Кодон-оптимизированные для Escherichia coli версии этих генов представлены в качестве SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12 и SEQ ID NO:14, соответственно.

Пример 3: конструирование векторов для экспрессии в бактериях генов, которые сообщают устойчивость к глифосату

Конструирование экспрессирующего вектора pET для экспрессии dgt-14 в E. coli

Для исследования in vitro оптимизированную для E.coli последовательность гена dgt-14 v6 (SEQ ID NO:3) отправляли в GeneArt для синтеза и клонирования. Синтезированную последовательность гена dgt-14 v6 встраивали путем клонирования в экспрессирующий вектор pET28 с помощью добавленных участков рестрикции Nde I и Xho I. В полученную конструкцию встраивали N-концевую 6X His-метку и мотив для связывания тромбина. Полученная конструкция была обозначена как pDAB100427 (фиг. 3).

Сайт-направленный мутагенез осуществляли для синтетического dgt-14 v6, чтобы подтвердить роль аланина, который был встроен вместо аминокислотного остатка глицина в положении 101. Для проведения мутагенеза использовали набор Quick Change II® от Stratagene (Santa Clara, CA). Для обеспечения переключения аминокислот конструировали следующие праймеры: DGT14 MutF: (SEQ ID NO:15 5′ ggATgCCggTAATgCAggAACCTgTgTTCgTCTgATgg), DGT14 MutR: (SEQ ID NO:16 5′ CCATCAgACgAACACAggTTCCTgCATTACCggCATCC). Реакции ПЦР проводили в соответствии с протоколом QuickChange с использованием pDAB100427 (dgt-14 v6) в качестве ДНК-матрицы. Конструкция, содержащая перевернутую последовательность dgt-14 v1 дикого типа (SEQ ID NO:17), была обозначена как pDAB102945 (фиг. 4) и была подтверждена путем секвенирования ДНК.

Дополнительные конструкции, экспрессирующий вектор pET для экспрессии в E. coli

Для исследования in vitro последовательности генов dgt-11 v6, dgt-12 v6, dgt-18 v6, dgt-29 v6 и dgt-30 v6 отправляли в GeneArt для синтеза и клонирования. Синтезированные гены клонировали в экспрессирующий вектор pET28. Полученные конструкции были обозначены как pDAB100431 (фиг. 5), содержащая dgt-11 v6, pDAB100432 (фиг. 6), содержащая dgt-11 v6, pDAB100435 (фиг. 7), содержащая dgt-18 v6, pDAB100446 (фиг. 8), содержащая dgt-29 v6, и pDAB100436 (фиг. 9), содержащая dgt-30 v6.

Синтезировали дополнительные конструкции, содержащие dgt-1, dgt-3 и dgt-7. Эти конструкции использовали для исследования in vitro последовательностей генов dgt-1 v5, dgt-1 v6, dgt-1 v7, dgt-1 v8, dgt-3 v6, dgt-3 v7, dgt-3 v8, dgt-7 v5, dgt-7 v6, dgt-7 v7 и dgt-7 v8, которые были отправлены в GeneArt для синтеза и клонирования. Синтезированные гены клонировали в экспрессирующий вектор pET28. Полученные конструкции были обозначены как pDAB102028, содержащая dgt-1 v5, pDAB102029, содержащая dgt-1 v6, pDAB102032, содержащая dgt-1 v7, pDAB102034, содержащая dgt-1 v8, pDAB100429, содержащая dgt-3 v6, pDAB100442, содержащая dgt-3 v7, pDAB100430, содержащая dgt-3 v8, pDAB102036, содержащая dgt-7 v5, pDAB102038, содержащая dgt-7 v6, pDAB102040, содержащая dgt-7 v7, и pDAB102042, содержащая dgt-7 v8. Эти конструкции и последовательности белка DGT, которые были экспрессированы, описаны в патенте США, выданном под № 11975658, включенном в настоящее описание в качестве ссылки в полном объеме.

Пример 4: биохимический анализ кинетики ферментов in vitro

Сверхэкспрессия и очистка рекомбинантных ферментов DGT

Рекомбинантные белки DGT сверхэкспрессировали в клетках Rosetta2™ (DE3) (Novagen, Madison, WI) с помощью конструкций, описанных выше. Одну колонию использовали для инокуляции 50-мл заквасочных культур в LB, содержавшем хлорамфеникол (25 мкг/мл) и канамицин (50 мкг/мл), которые культивировали в течение ночи при 37°C. Ночные культуры использовали для инокуляции 1 л LB, содержавшего хлорамфеникол (25 мкг/мл) и канамицин (50 мкг/мл). Культуры выращивали при 37°C до O.D.600=0,6, а затем помещали на баню с ледяной водой на 10 минут. Экспрессию белков-мишеней обеспечивали добавлением IPTG до конечной концентрации 500 мкМ. Индукции позволяли протекать в течение ночи при 20°C, а затем проводили сбор путем центрифугирования при 8000 об./мин. в течение 20 минут. Клеточные осадки хранили при -80°C до тех пор, пока они не понадобятся для очистки. Все стадии очистки проводили при 4°C.

Клеточные осадки из 1-л культур ресуспендировали в 20-30 мл буфера A (50 мМ HEPES pH 7,5, 150 мМ KCl, 2 мМ DTT, 1 мМ EDTA, 20 мМ имидазол и 5% глицерин). Затем добавляли коктейль ингибиторов протеаз COMPLETE™ (1 таблетка/50 мл, Roche, Indianapolis, IN) и лизоцим (1 мг/мл, Sigma-Aldrich, St. Louis, MO) и суспензию перемешивали в течение 20 минут. Лизис клеток проводили с использованием Branson Sonifier 250 (3 импульса × 60 секунд) с последующим удалением клеточного дебриса центрифугированием при 16000 об./мин. в течение 45 минут. Ферменты DGT очищали до однородности посредством одной стадии аффинной хроматографии с использованием иммобилизованных металлов (IMAC) с использованием предварительной колонки HisTrap FF объемом 5 мл. Колонку уравновешивали в буфере A и образец наносили в том же буфере. Затем колонку промывали 10 объемами колонки буфера A, а затем проводили элюирование в 0-100% линейном градиенте буфера B (50 мМ HEPES pH 7,5, 200 мМ KCl, 2 мМ DTT, 1 мМ EDTA, 500 мМ имидазол и 5% глицерин) в 25 объемах колонки. Фракции, содержавшие белок-мишень, исходя из анализа SDS-PAGE, концентрировали до 2,5 мл с использованием устройства для ультрацентрифугирования Millipore с пороговым значением молекулярной массы 10 кДа (MWCO). Очищенные ферменты DGT подвергали замене буфера с использованием колонок PD-10 (GE Healthcare) на 50 мМ HEPES pH 7,5, 150 мМ KCl, 2 мМ DTT и 5% глицерин, а затем концентрировали до приблизительно 1 мл. Образцы, как правило, разбавляли 1:50 и спектр в УФ-видимой области регистрировали в диапазоне 240-700 на спектрофотометре УФ-видимой области Cary50™ Bio. Затем теоретический коэффициент экстинкции использовали для вычисления концентрации белка на основе поглощения при 280 нм (ExPASy, Geneva, Швейцария).

Охарактеризация in vitro кинетики ферментов DGT растений и бактерий

Активность ферментов в случае фермента DGT дикого типа (WT) и мутантных DGT измеряли по продукции неорганического фосфата (Pi) с помощью модифицированной методики, описанной Lanzetta et al., (1979). Lanzetta P., Alvarez L., Reinach P., и Candia O., (1979) Anal Bioch., 100:95-97. Анализы проводили в формате 96-луночного планшета всего в 50 мкл на устройстве для считывания планшетов Spectra-Max 190 (Molecular Devices, Sunnyvale, CA). Типичные образцы для анализа содержали 50 мМ HEPES pH 7,5, 150 мМ KCl, 2 мМ DTT и 1 мМ S3P. Концентрации PEP и глифосата варьировали, как указано. Глифосат приобретали от Sigma в качестве свободной кислоты и его ресуспендировали в ddH2O. Глифосат солюбилизировали добавлением KOH до тех пор, пока значение pH не становилось нейтральным. Анализы начинали добавлением фермента DGT в концентрациях, которые варьировали между 0,01-1 мкМ. Реакции завершали добавлением 235 мкл смеси 3:1 малахитовый зеленый: раствор молибдата аммония. После завершения развития окраски (приблизительно 1 минута), регистрировали изменение поглощения при 660 нм и количество образовавшегося Pi вычисляли из стандартной кривой. Контрольные реакции без фермента использовали для внесения поправки на фоновое поглощение. При использовании этого способа обнаружения высокие концентрации PEP (>2 мМ) и глифосата (>30 мМ) обеспечивают значительный уровень фонового поглощения. Данные приводили в соответствие с уравнением Михаэлеса-Ментен, которое позволяло определение Km и Vmax (уравнение 1), в то время как IC50 определяли из уравнения 2, где y представляет собой относительную активность и s представляет собой коэффициент Хилла. Данные анализировали с использованием программного обеспечения GraFit version 5TM (Erithacus Software Limited, Horley, Великобритания).

Уравнение 1:

Уравнение 2:

Величина IC50 для конкурентного ингибитора изменяется в зависимости от концентрации субстрата, таким образом, величины IC50 в таблице 2 были получены при 1 мМ PEP и при 60 мкм PEP (оценка внутриклеточных концентраций PEP растениях). Следует сравнивать только величины IC50, измеренные при одной и той же концентрации PEP. Кроме того, величины IC50 для высоко устойчивых ферментов нельзя было точно определить способом Lanzetta и, таким образом, их оценивали, исходя из относительной активности.

Кинетика DGT растений

Два фермента с немутантными нативными последовательностями, DGT-1 v5 и DGT-7 v5, исследовали сначала для установления исходных параметров для чувствительности к глифосату. Оба белка имели величины Km в отношении PEP (приблизительно 70 мкм) и они были чувствительными к глифосату с величинами IC50 приблизительно 20 мкм (таблица 2) при 1 мМ PEP. Как было выявлено для DGT-1 v6, DGT-3 v6 и DGT-7 v6, одна точковая мутация с G на A значительно увеличивала устойчивость к глифосату (величины IC50 8-21 мМ), но также увеличивала Km для PEP в приблизительно 8 раз. Двойная мутация (GAPS) для всех происходящих из растений DGT (DGT-1 v7, DGT-3 v7 и DGT-7 v7), также повышала устойчивость к глифосату, однако вновь приводила к значительному увеличению Km в отношении PEP (таблица 2). Мутанты TIPS (DGT-1 v8, DGT-3 v8 и DGT-7 v8) были устойчивыми к умеренным концентрациям глифосата (3-6 мМ), но, в противоположность мутантам GA и GAPS, уровни Km оставались близкими к уровням белков дикого типа 60-200 мкМ. На фиг. 10 представлены сдвиги устойчивости к глифосату для DGT-1 (A) и DGT-7 (B) при внесении указанных мутаций. Концентрацию PEP сохраняли на уровне 1 мМ для экспериментов, в которых были получены данные, представленные на фиг. 10, что, вероятно, привело к повышенной IC50 (>80 мМ) для DGT-7 v8. Дальнейшие действия проводили для определения того, изменяют ли более низкие уровни PEP относительную устойчивость к глифосату. Физиологически значимые уровни PEP находятся в диапазоне 5-60 мкМ. В случае 60 мкМ PEP, величина IC50 была значительно снижена (3,6 мМ), что указывает на то, что на первоначальное определение влиял избыток PEP, как и ожидалось, исходя из кинетики Михаэлеса-Ментен, и как указано в таблице 2.

На фиг. 10 представлены величины IC50, полученные после внесения различных мутаций в DGT-1 (A) и DGT-7 (B) с использованием 1 мМ PEP. Для обеих кривых IC50, A и B, закрашенные треугольники соответствуют дикому типу, закрашенные круги соответствуют мутантам GA, незакрашенные квадраты соответствуют мутантам GAPS и закрашенные квадраты соответствуют мутантам TIPS.

ТАБЛИЦА 2
Параметры стационарной кинетики для ферментов DGT
Величины IC50, превышающие 50, являются оценочными вследствие ограничений использованного способа. *IC50 для глифосата определяли при 100 мкМ PEP
IC50 (мМ глифосат)
Белок Версия последовательности IC50 (мМ) при 1 мМ PEP IC50 (мМ) при 60 мкМ PEP KM PEP (мкМ) kcat/Km (M-1⋅с-1)
Ферменты растений Соя DGT-1 v5 Нативная 0,0 0,0 73,0 7,41E+04
DGT-1 v6 G→A 21,1 17,3 608,2 1,34E+04
DGT-1 v7 G→A, P→S >80,00 >80,00 1291,2 6,67E+03
DGT-1 v8 T→I, P→S 13,3 5,9 151,4 1,23E+04
Канола DGT-3 v6 G→A 15,8 8,7 1073,4 1,39E+04
DGT-3 v7 G→A, P→S 50,5 42,0 2728,3 2,28E+03
DGT-3 v8 T→I, P→S 13,3 4,8 196,8 3,29E+04
Пшеница DGT-7 v5 Нативная 0,0 0,0 75,6 2,15E+05
DGT-7 v6 G→A 8,1 15,1 538,2 1,61E+04
DGT-7 v7 G→A, P→S 19,7 15,4 1103,2 1,46E+04
DGT-7 v8 T→I, P→S >80,0 3,6 60,5 1,36E+04

Бактериальные Ферменты DGT-14 v1 Нативная >20,16 0,44 208,6 5E+04
DGT-14 v6 G→A >80,00 >80,00 352,5 3E+04
DGT-11 v6 Нативная 9,98 -- 1576,6 5E+01
DGT-12 v6 G→A 4,00 -- 128,0 7E+02
DGT-18 v6 G→A 33,25 9,24 375,9 4E+04
DGT-29 v6 G→A >80,00 >80,00* 1502,2 4E+03
DGT-30 v6 G→A 15,5 7,86 414,9 3E+04
*KM, определенная при 100 мкМ PEP

Кинетика бактериальных DGT

Мутантный фермент DGT-14 v6 (мутация G101A) обладал наиболее благоприятными общими параметрами кинетики и устойчивостью к глифосату kcat/Km и увеличенная IC50). Фермент был устойчивым к глифосату в концентрации >80 мМ и проявлял каталитическую эффективность 3×104 M-1⋅с-1. Как и ожидалось, фермент дикого типа DGT-14 v1 проявлял значительно более низкую IC50, составляющую 0,44 мМ (при 60 мкМ PEP), и Km для PEP 208,6 мкМ. Нативный фермент или фермент дикого типа также проявлял высокую каталитическую эффективность (5,3×104 M-1⋅с-1). Данные демонстрируют, что, даже несмотря на то, что DGT-14 v1 является более чувствительным к глифосату по сравнению с DGT-14 v6, он сохраняет некоторый присущий ему уровень устойчивости, который превышает уровень устойчивости у нативных ферментов растений. В результате введения остатка аланина вместо глицина в положении аминокислотного остатка 101, IC50 изменялась с приблизительно 20,16 мМ до >80,00 мМ при 1 мМ PEP, и с 0,44 мМ до >0,80 мМ при 60 мкМ PEP. Физиологические характерные уровни PEP находятся в диапазоне 5-60 мкМ. Аналогично, внесение остатка аланина вместо глицина в положении аминокислоты 101 приводило к увеличению Km в отношении PEP с 208,6 мкМ до 352,5 мкМ. Внесение мутации G101A приводило к увеличенной устойчивости к DGT-14 v6.

Кроме того, пять других бактериальных ферментов также оценивали в отношении их устойчивости к глифосату. Все из них представляли собой варианты с заменой глицина на аланин за исключением DGT-11 v6, который содержит белковую последовательность дикого типа и обладает природным остатком аминокислоты аланина. Параметры кинетики и величины IC50 описаны в таблице 2. Ферменты DGT-11v6, DGT-12 v6, DGT-18 v6, DGT-29 v6 и DGT-30 v6 были устойчивыми к глифосату в концентрациях 9,98 мМ, 4,00 мМ, 33,25 мМ, 80 мМ и 15,55 мМ, соответственно, при 1 мМ PEP. Параметры кинетики и устойчивость к ферментам, которые обладают остатком аминокислоты аланина, являются более высокими, чем у нативных ферментов растений или ферментов растений дикого типа (DGT-1 v5 и DGT-7 v5), которые обладают остатком аминокислоты глицина. DGT-11 v6, DGT-12 v6, DGT-18 v6, DGT-29 v6 и DGT-30 v6 обладали параметрами кинетики, которые указывают на то, что ферменты являются устойчивыми к глифосату.

Пример 5: клонирование векторов для трансформации растений

Конструирование бинарного вектора для растений

Для конструирования исходных векторов, содержащих полинуклеотидную последовательность для транзитного пептида хлоропластов, слитую в рамке считывания с dgt-14, использовали стандартные способы клонирования. Исходные векторы, содержавшие транзитный пептид хлоропластов (TraP), слитый с dgt-14, собирали с использованием технологии In-Fusion™ Advantage Technology (Clontech, Mountain View, CA). Каждый из транзитных пептидов TraP4 v5 (SEQ ID NO:18), TraP5 v1 (SEQ ID NO:19), TraP5 v2 (SEQ ID NO:20), TraP8 v2 (SEQ ID NO:21), TraP9 v2 (SEQ ID NO:22), TraP12 v2 (SEQ ID NO:23) и TraP13 v2 (SEQ ID NO:24) был синтезирован в DNA2.0 (Menlo Park, CA) и его подвергали слиянию с 5ʹ-концевым фрагментом dgt-14, вплоть до и включая уникальный участок распознавания эндонуклеазы рестрикции AccI.

Бинарные плазмиды, которые содержали различные экспрессирующие кассеты для TraP и dgt-14, контролировались промотором убиквитина 10 Arabidopsis thaliana (AtUbi10; Callis, et al., (1990) J. Biol. Chem., 265: 12486-12493), и они были фланкированы 3′-нетранслируемой областью двадцать третей открытой рамки считывания Agrobacterium tumefaciens (AtuORF23 3′ UTR; патент США № 5428147).

Собранные экспрессирующие кассеты для TraP и dgt-14 модифицировали способами инженерии с использованием технологии Gateway® Technology (Invitrogen, Carlsbad, CA) и трансформировали в растения с помощью опосредуемой Agrobacterium трансформации растений. Эндонуклеазы рестрикции получали от New England BioLabs (NEB; Ipswich, MA) и для лигирования ДНК использовали ДНК-лигазу T4 (Invitrogen). Реакции Gateway проводили с использованием смеси ферментов Gateway® LR Clonase® (Invitrogen) для сборки одного исходного вектора в один конечный вектор, который содержал кассету селективного маркера с промотором вируса мозаики прожилок маниоки (CsVMV; Verdaguer et al., (1996) Plant Mol. Biol., 31: 1129-1139) - DSM-2 (патент США App. № 2007/086813) - 3ʹ-нетранслируемую область первой открытой рамки считывания Agrobacterium tumefaciens (AtuORF1 3ʹ UTR; Huang et al., (1990) J. Bacteriol. 172:1814-1822). Получение плазмид проводили с использованием набора NucleoSpin® Plasmid Kit (Macherey-Nagel Inc., Bethlehem, PA) или набора Plasmid Midi Kit™ (Qiagen) в соответствии с инструкциями поставщиков. Фрагменты ДНК выделяли с использованием набора для экстракции из геля QIAquick Gel Extraction Kit™ (Qiagen) после электрофореза на Tris-ацетатном агарозном геле.

Колонии всех собранных плазмид сначала подвергали скринингу рестрикционным расщеплением ДНК, полученной по минипрепаративной методике. Плазмидную ДНК выбранных клонов секвенировали у коммерческого поставщика, осуществляющего секвенирование (Eurofins MWG Operon, Huntsville, AL). Данные о последовательности собирали и анализировали с использованием программного обеспечения Sequencher™ (Gene Codes Corp., Ann Arbor, MI).

Следующие бинарные конструкции экспрессируют различные слитые последовательности генов TraP:dgt-14: pDAB107526 (фиг.11) содержит TraP4 v5:dgt-14 v2 (SEQ ID NO:25); pDAB102787 (фиг. 12) содержит TraP5 v1:dgt-14 v2 (SEQ ID NO:26); pDAB105525 (фиг. 13) содержит TraP5 v2:dgt-14 v2 (SEQ ID NO:27); pDAB105526 (фиг. 14) содержит TraP8 v2:dgt-14 v2 (SEQ ID NO:28); pDAB105527 (фиг. 15) содержит TraP9 v2:dgt-14 v2 (SEQ ID NO:29); и pDAB105528 (фиг. 16) содержит TraP12 v2:dgt-14 v2 (SEQ ID NO:30); и pDAB105529 (фиг. 17) содержит TraP13 v2:dgt-14 v2 (SEQ ID NO:31).

Когда конструировали слитые в рамке считывания конструкции, вносили незначительную модификацию в первый остаток метионина кодирующей последовательности dgt-14. Например, метионин заменяли на аланин в кодирующих последовательностях dgt-14 в pDAB105529, pDAB017526, pDAB105525, pDAB105526, pDAB105527 и pDAB105528. Метионин оставляли неизмененным в pDAB102787. Модификации вносили для облегчения клонирования кодирующей последовательности dgt-14 после транзитных пептидов хлоропластов, и список последовательностей, представленный выше, содержит модифицированный аминокислотный остаток.

Пример 6: трансформация в Arabidopsis и селекция

Трансформация Arabidopsis thaliana

Arabidopsis трансформировали с использованием способа погружения цветка от Clough and Bent (1998). Выбранную колонию Agrobacterium, содержавшую одну из бинарных плазмид, описанных выше, использовали для инокуляции одной или нескольких 100-мл предварительный культур среды YEP, содержавшей спектиномицин (100 мг/л) и канамицин (50 мг/л). Культуру инкубировали в течение ночи при 28°C при постоянном встряхивании при 225 об./мин. Клетки осаждали при приблизительно 5000×g в течение 10 минут при комнатной температуре, и полученный супернатант отбрасывали. Клеточный осадок осторожно ресуспендировали в 400 мл среды для погружения, содержавшей: 5% (масс./об.) сахарозу, 10 мкг/л 6-бензиламинопурина и 0,04% Silwet L-77. Растение возрастом приблизительно 1 месяц погружали в среду на 5-10 минут при осторожном встряхивании. Растения клали набок и покрывали прозрачными или непрозрачными пластиковыми мешками на 2-3 часа, а затем располагали вертикально. Растения выращивали при 22°C со световым периодом 16 часов на свету/8 часов в темноте. Приблизительно через 4 недели после погружения семена собирали.

Селекция трансформированных растений

Свежесобранным семенам T1 [содержащие экспрессирующие кассеты dgt-14 и DSM-2] позволяли высохнуть в течение 7 суток при комнатной температуре. Семена T1 высевали в лотки для прорастания размером 26,5×51 см, в каждый из которых добавляли аликвоту массой 200 мг стратифицированных семян T1 (приблизительно 10000 семян), которые предварительно были суспендированы в 40 мл 0,1% раствора агарозы и которые хранили при 4°C в течение 2 суток, чтобы выполнить требования состояния покоя, и обеспечить синхронное прорастание семян.

Sunshine Mix LP5 покрывали мелкоизмельченным вермикулитом и орошали инфильтрацией раствором Хогланда до влажного состояния, а затем ему позволяли дренироваться под действием силы тяжести. Каждую аликвоту стратифицированных семян объемом 40 мл высевали равномерно на вермикулит с помощью пипетки и накрывали увлажняющими купольными камерами на 4-5 суток. Купольные камеры удаляли за 1 сутки до первоначальной селекции трансформантов с использованием послевсходового распыления глюфосината (селекция по котрансформированному гену DSM-2).

Через семь суток после посева (DAP) и снова через 11 DAP, на растения T1 (стадии семядоли и 2-4-листьев, соответственно) распыляли 0,2% раствор гербицида Liberty (200 г.а.и./л (g ai/L) глюфосината, Bayer Crop Sciences, Kansas City, MO) в распыляемом объеме 10 мл/лоток (703 л/га) с использованием наконечника для пневматического распыления DeVilbiss для доставки эффективного количества 280 г.а.и./га глюфосината на внесение. Выжившие растения (активно растущие растения) идентифицировали через 4-7 суток после последнего распыления и пересаживали по отдельности в 3-дюймовые горшки (7,6 см), подготовленные со средой для пересадки в горшки (Metro Mix 360). Пересаженные растения накрывали увлажняющими купольными камерами на 3-4 суток и помещали в камеру для выращивания при 22°C, как и ранее, или прямо переносили в теплицу. Затем купольные камеры удаляли и растения выращивали в теплице (22±5°C, 50±30% RH, 14 ч на свету:10 ч в темноте, минимум 500 мкЕ/м2⋅с1 природный свет + дополнительный свет). Для выживших растений T1 проводили молекулярный подтверждающий анализ для подтверждения того, что ген устойчивости к глифосату стабильно встроился в геном растений.

Молекулярное подтверждение

Присутствие трансгенов dgt-14 и DSM-2 в геноме растений Arabidopsis, которые были трансформированы pDAB105525, pDAB105526, pDAB105527, pDAB105528, pDAB105529, pDAB102787, подтверждали. Присутствие этих полинуклеотидных последовательностей в растениях Arabidopsis T1 первоначально подвергали скринингу посредством анализа гидролиза зондов, аналогично TAQMAN™, для подтверждения присутствия трансгенов DSM-2 и dgt-14. Трансгенные объекты подвергали скринингу посредством ПЦР экспрессирующих гены кассет для определения того, встроилась ли экспрессирующая dgt-14 кассета полностью в геном без перестройки. Данные, полученные в этих исследованиях, использовали для определения количества копий трансгена и идентификации отдельных трансгенных объектов в Arabidopsis для самоопыления и перехода к поколению T2. Развившиеся растения T2 Arabidopsis также подвергали скринингу с помощью анализа гидролиза зондов для подтверждения присутствия и оценки количества копий генов DSM-2 и dgt-14 в геноме растений. Далее, анализ с использованием саузерн-блоттинга использовали для подтверждения оцененного количества копий на подгруппе растений T1 Arabidopsis. Наконец, анализ с использованием вестерн-блоттинг подтвердил, что трансгенные объекты экспрессировали белок DGT-14.

Анализ гидролиза зондов

Количество копий определяли в растениях T1 и T2 Arabidopsis с использованием анализа гидролиза зондов, описанного ниже. Растения с различными количествами трансгенов идентифицировали и выращивали для последующих анализов устойчивости к глифосату.

Образцы тканей собирали в 96-луночные планшеты и лиофилизировали в течение 2 суток. Мацерацию ткани проводили с помощью распылителя для тканей KLECO™ и вольфрамовых гранул (Environ Metal Inc., Sweet Home, Oregon). После мацерации ткани геномную ДНК выделяли в высокопроизводительном формате с использованием набора Biosprint 96 Plant kit® (Qiagen, Germantown, MD) в соответствии с предложенным изготовителем протоколом. Геномную ДНК количественно определяли с помощью набора Quant-IT Pico Green DNA Assay kit™ (Molecular Probes, Invitrogen, Carlsbad, CA). Количественно определенную геномную ДНК доводили до приблизительно 2 нг/мкл для анализа гидролиза зондов с использованием автоматического устройства для обработки жидкостей BIOROBOT3000™ (Qiagen, Germantown, MD). Определение количества копий трансгена с помощью анализа гидролиза зондов проводили способом ПЦР в реальном времени с использованием системы LIGHTCYCLER®480 (Roche Applied Science, Indianapolis, IN). Анализы были разработаны для DSM-2, dgt-14 и внутреннего эталонного гена, TAFII15 (Genbank ID: NC003075; Duarte et al., (201) BMC Evol. Biol., 10:61).

Для амплификации смесь LIGHTCYCLER®480 Probes Master mix (Roche Applied Science, Indianapolis, IN) приготавливали в 1× конечной концентрации в мультиплексной реакционной смеси объемом 10 мкл, содержащей 0,1 мкм каждого праймера для DSM-2 и dgt-14, 0,4 мкм каждого праймера для TAFII15 и 0,2 мкм каждого зонда (таблица 3). Двухстадийную реакцию амплификации проводили с удлинением при 60°C в течение 40 секунд с получением данных флуоресценции. Все образцы анализировали и для анализа каждого образца использовали усредненные величины значения порогового цикла (Ct). Анализ данных ПЦР в реальном времени проводили с использованием программного обеспечения LightCycler® выпуска 1.5 с использованием модуля относительного количественного определения, и он был основан на способе ΔΔCt. Для этого в каждый анализ включали образец геномной ДНК из калибратора единичной копии и известный контроль с 2 копиями. Результаты количества копий в скрининге гидролиза зондов определяли для трансгенных растений T1 и T2 Arabidopsis.

ТАБЛИЦА 3
Информация о праймерах и зондах для анализа гидролиза зондов для DSM-2, dgt-14 и внутреннего эталонного гена (TAFII15)
Название праймера Последовательность
DSM2A (SEQ ID NO:32) 5ʹAGCCACATCCCAGTAACGA 3ʹ
DSM2S (SEQ ID NO:33) 5ʹCCTCCCTCTTTGACGCC3ʹ
Зонд DSM2 Cy5 (SEQ ID NO:34) 5ʹCAGCCCAATGAGGCATCAGC 3ʹ
DGT14F(SEQ ID NO:35) 5ʹCCTCTTAGCTGGACTGTAT3ʹ
DGT14R (SEQ ID NO:36) 5ʹCTTAGGATCAAGGCTAATCGTT 3÷
Зонд UPL145 Каталожный № 04694317001 (Roche, Indianapolis, IN)
Зонд TAFFY-HEX (SEQ ID NO:37) 5ʹAGAGAAGTTTCGACGGATTTCGGGC 3ʹ
TAFII15-F (SEQ ID NO:38) 5ʹ GAGGATTAGGGTTTCAACGGAG 3ʹ
TAFII15-R (SEQ ID NO:39) 5′ GAGAATTGAGCTGAGACGAGG 3′

Подтверждение встраивания dgt-14 с помощью анализа с использованием саузерн-блоттинга

Анализ с использованием саузерн-блоттинга использовали для определения характера встраивания встроенного фрагмента ДНК с T-цепью и идентификации трансгенных объектов, которые содержали dgt-14. Данные получали, чтобы продемонстрировать встраивание и целостность трансгенных вставок в геноме Arabidopsis. Данные саузерн-блоттинга использовали для идентификации простого встраивания интактной копии ДНК с T-цепью. Детальный анализ с использованием саузерн-блоттинга проводили с использованием амплифицированного способом ПЦР зонда, специфичного к экспрессирующей кассете гена dgt-14. Гибридизация зонда с геномной ДНК, расщепленной специфическими ферментами рестрикции, идентифицировала фрагменты геномной ДНК с конкретной молекулярной массой, профили которых использовали для идентификации полноразмерных трансгенных объектов T1 с простой вставкой для развития в следующее поколение.

Образцы тканей собирали в 2-мл конические пробирки (Eppendorf) и лиофилизировали в течение 2 суток. Мацерацию ткани проводили с помощью распылителя для тканей KLECO™ и вольфрамовых гранул. После мацерации ткани геномную ДНК выделяли с использованием методики выделения CTAB. Геномную ДНК далее очищали с использованием набора Qiagen Genomic Tips kit. Геномную ДНК количественно определяли с помощью набора для анализа ДНК Quant-IT Pico Green DNA™ assay kit (Molecular Probes, Invitrogen, Carlsbad, CA). Количественно определенную геномную ДНК доводили до 4 мкг для подходящей концентрации.

Для каждого образца 4 мкг геномной ДНК тщательно расщепляли ферментом рестрикции SwaI (New England Biolabs, Beverley, MA) и инкубировали при 25°C в течение ночи, а затем к реакционной смеси добавляли NsiI и инкубировали при 37°C в течение 6 часов. Расщепленную ДНК концентрировали посредством преципитации с помощью Quick Precipitation Solution™ (Edge Biosystems, Gaithersburg, MD) в соответствии с предлагаемым изготовителем протоколом. Затем геномную ДНК ресуспендировали в 25 мкл воды при 65°C в течение 1 часа. Ресуспендированные образцы наносили на 0,8% агарозный гель, приготовленный в 1× TAE и подвергнутый электрофорезу в течение ночи при 1,1 В/см в 1× буфере TAE. Затем гель подвергали денатурации (0,2 M NaOH/0,6 M NaCl) в течение 30 минут и нейтрализации (0,5 M Tris-HCl (pH 7,5)/1,5 M NaCl) в течение 30 минут.

Перенос фрагментов ДНК на нейлоновые мембраны проводили путем пассивного пропитывания через гель 20× раствором SSC в течение ночи обработанной мембраны для переноса IMMOBILON™ NY+ (Millipore, Billerica, MA) с использованием впитывающего листа из хроматографической бумаги и бумажных полотенец. После переноса мембрану кратковременно промывали 2X SSC, поперечно сшитым с STRATALINKER™ 1800 (Stratagene, LaJolla, CA), и подвергали термической обработке в вакууме при 80°C в течение 3 часов.

Блоты инкубировали с раствором для предгибридизации (Perfect Hyb plus, Sigma, St. Louis, MO) в течение 1 часа при 65°C в стеклянных вращающихся флаконах с использованием инкубатора для гибридизации модели 400 (Robbins Scientific, Sunnyvale, CA). Зонды получали из фрагмента ПЦР, содержавшего всю кодирующую последовательность. Ампликон ПЦР очищали с использованием набора для экстракции из геля QIAEX II gel extraction kit™ и метили α32P-dCTP с помощью набора для мечения Random RT Prime IT™ labeling kit (Stratagene, La Jolla, CA). Блоты гибридизовали в течение ночи при 65°C с денатурированным зондом, добавленным прямо в буфер для гибридизации до приблизительно 2 миллионов импульсов счета на блот на мл. После гибридизации блоты последовательно промывали при 65°C посредством 0,1× SSC/0,1% SDS в течение 40 минут. Наконец, блоты экспонировали на экранах для визуализации фосфора с длительным свечением и визуализировали с использованием системы для визуализации Molecular Dynamics Storm 860™.

Анализы с использованием саузерн-блоттинга, проведенные в этом исследовании, использовали для определения количества копий и подтверждения того, что выбранные трансгенные объекты содержали трансген dgt-14 в геноме Arabidopsis.

Подтверждение экспрессирующей кассеты с геном dgt-14 с помощью анализа с использованием ПЦР

Присутствие гена экспрессирующей кассеты с геном dgt-14 в трансгенных объектах растений T1 выявляли с помощью ПЦР по конечной точке. Для обнаружения использовали праймеры (смотрите таблицу 4), специфичные к промотору v2 AtUbi10 и областям 3′UTR v1 AtuORF23 экспрессирующей кассеты для гена dgt-14.

ТАБЛИЦА 4
Олигонуклеотидные праймеры, использованные для подтверждения экспрессирующей кассеты для гена dgt-14
Название праймера Последовательность
Прямой олигонуклеотид (SEQ ID NO:40) 5ʹ CTGCAGGTCAACGGATCAGGATAT 3ʹ
Обратный олигонуклеотид (SEQ ID NO:41) 5ʹ TGGGCTGAATTGAAGACATGCTCC 3ʹ

Для реакций ПЦР требовался стандартный трехстадийный протокол циклирования ПЦР для амплификации экспрессирующей ген кассеты. Все реакции ПЦР проводили с использованием следующих условий ПЦР: 94°C в течение трех минут, а затем 35 циклов при 94°C в течение тридцати секунд, 60°C в течение тридцати секунд и 72°C в течение трех минут. Реакции проводили с использованием набора для ПЦР EX-TAQ PCR™ (TaKaRa Biotechnology Inc. Otsu, Shiga, Япония) в соответствии с инструкциями изготовителя. После последнего цикла реакционную смесь инкубировали при 72°C в течение 10 минут. Для определения размера ампликона ПЦР использовали электрофорез с агарозным гелем с TAE. Ампликоны ПЦР ожидаемого размера указывали на присутствие на то, что в геноме трансгенных объектов Arabidopsis присутствовала экспрессирующая полноразмерный ген кассета.

Относительное подтверждение транскрипции dgt-14 с помощью анализа с использованием количественной ПЦР с обратной транскрипции

Образцы тканей растений с трансгенным dgt-14 собирали в 96-луночные планшеты и замораживали при 80°C. Мацерацию ткани проводили с помощью распылителя для тканей KLECO™ и вольфрамовых гранул (Environ Metal INC., Sweet Home, Oregon). После мацерации ткани выделяли тотальную РНК в высокопроизводительном формате с использованием набора Qiagen Rneasy 96TM kit (Qiagen, Germantown, MD) в соответствии с предложенным изготовителем протоколом, который включал необязательную обработку ДНК-азой I на колонке. За этой стадией следовала дополнительная обработка ДНК-азой I (Ambion, Austin, TX) элюированной тотальной РНК. Синтез кДНК проводили с использованием тотальной РНК в качестве матрицы с помощью набора High Capacity cDNA Reverse Transcription™ kit (Applied Biosystems, Austin, TX) в соответствии с предложенной изготовителем методикой с добавлением олигонуклеотида TVN. Количественное определение экспрессии проводили с помощью анализа гидролиза зондов, и его осуществляли с помощью ПЦР с использованием системы LIGHTCYCLER®480 (Roche Applied Science, Indianapolis, IN). Анализы разрабатывали для dgt-14 и внутреннего эталонного гена "неизвестный белок" (номер доступа Genbank: AT4G24610) с использованием программного обеспечения LIGHTCYCLER® Probe Design Software 2.0. Для амплификации приготавливали смесь LIGHTCYCLER®480 Probes Master mix (Roche Applied Science, Indianapolis, IN) при 1× конечной концентрации в моноплексной реакционной смеси объемом 10 мкл, содержащей 0,4 мкМ каждого праймера, и 0,2 мкМ каждого зонда (таблица 6).

Проводили двухстадийную реакцию амплификации с удлинением при 60°C в течение 40 секунд с получением данных флуоресценции. Все образцы анализировали в трех экземплярах и для анализа каждого образца использовали усредненные величины значения порогового цикла (Ct). Реакцию обратной транскрипции минус-цепи проводили для каждого образца, чтобы убедиться, что отсутствовала контаминация гДНК. Анализ данных ПЦР в реальном времени проводили на основе способа ΔΔCt. Этот анализ использовали для определения относительной экспрессии dgt-14 в трансгенных объектах Arabidopsis, которые были определены как гемизиготные и гомозиготные. Относительные уровни транскрипции мРНК dgt-14 находились в диапазоне от 25,3 раза до 313,7 раза превышающем внутренний контроль. Эти данные указывают на то, что растения с трансгенным dgt-14 содержали функциональную экспрессирующую кассету для гена dgt-14, и растения были способны транскрибировать трансген dgt-14.

ТАБЛИЦА 5
Праймеры ПЦР, использованные для количественного анализа dgt-14 с использованием ПЦР с обратной транскрипцией
Название праймера Последовательность
T26410LP (SEQ ID NO:42) 5ʹcgtccacaaagctgaatgtg 3ʹ
T26410RP (SEQ ID NO:43) 5ʹcgaagtcatggaagccactt3ʹ
PL146 Каталожный № 04694325001 (Roche, Indianapolis, IN)
GT14F (SEQ ID NO:44) 5ʹCCTCTTAGCTGGACTGTAT3ʹ
GT14R (SEQ ID NO:45) 5ʹCTTAGGATCAAGGCTAATCGTT 3ʹ
Зонд PL145 Каталожный № 04694317001 (Roche, Indianapolis, IN)

Анализ с использованием вестерн-блоттинга

DGT-14 выявляли в образцах листьев, полученных из трансгенных растений Arabidopsis thaliana. Экстракты растений из трансгенных растений dgt-14 и белковых стандартов DGT-14 инкубировали с буфером для денатурации образца с 8 М мочевиной при 90°C в течение 5 минут и разделяли с помощью электрофореза в предварительно залитом акриламидном геле. Затем белки подвергали электропереносу на нитроцеллюлозную мембрану с использованием протокола изготовителя. После блокирования с помощью WESTERNBREEZE® Blocking Mix (Invitrogen) белок DGT-14 выявляли с помощью антисыворотки против DGT-14, а затем антителом козы против фосфатазы кролика. Обнаруженный белок визуализировали с помощью хемилюминесцентного субстрата BCIP/NBT Western Analysis Reagent (KPL, Gaithersburg, MD). Получение интактного белка DGT-14 с помощью вестерн-блоттинга показало, что растения с трансгенным dgt-14, которые анализировали, экспрессировали белок DGT-14.

Пример 7: устойчивость к глифосату

На трансгенные растения T1 Arabidopsis, содержавшие трансген dgt-14, распыляли различные дозы глифосата. Ряд различных концентраций глифосата, включая повышенные дозы, использовали в этом исследовании для определения относительных уровней устойчивости (105, 420, 1680 или 3360 г.э.к/га (g ae/ha)). Типичной 1X используемой в полевых условиях дозой глифосата является 1120 г.э.к./га. Растения T1 Arabidopsis, которые использовали в этом исследовании, варьировали только по количеству копий трансгена dgt-14. Растения T1 Arabidopsis с низким количеством копий dgt-14 идентифицировали с использованием анализов для молекулярного подтверждения, описанных выше, и подвергали самоопылению и использовали для получения растений T2. В таблице 6 представлена устойчивость для трансгенных растений dgt-14 по сравнению с контрольными растениями, содержащими ген устойчивости к гербициду глифосату dgt-1 (как описано в патенте США, выданном под № 12558351, включенном в настоящее описание в качестве ссылки в полном объеме), и контролями дикого типа.

Результаты селекции с глифосатом Arabidopsis растений с трансформированным dgt-14

Сначала проводили селекцию трансформантов T1 Arabidopsis относительно исходных нетрансформированных семян с использованием схемы селекции с глюфосинатом. Для каждой конструкции T1 анализировали три плоских лотка или 30000 семян. Растения T1, отобранные, как описано выше, подвергали молекулярной охарактеризации, а затем растения пересаживали в индивидуальные горшки и на них распыляли различные дозы коммерческого глифосата, как описано ранее. Ответ на дозу этих растений представлен в значениях % видимого повреждения через 2 недели после обработки (WAT). Данные, представленные в таблице, демонстрируют индивидуальные растения, проявляющие небольшое повреждение или отсутствие повреждения (<20%), умеренное повреждение (20-40%) или тяжелое повреждение (>40%). Для каждой конструкции, использованной для трансформации Arabidopsis, представлено арифметическое среднее значение и стандартное отклонение. Диапазон индивидуального ответа также указан в последнем столбце для каждой дозы и трансформации. Нетрансформированные Arabidopsis дикого типа (c.v. Columbia) служили в качестве чувствительного к глифосату контроля.

Уровень ответа растений варьировал в растениях T1 Arabidopsis. Это варьирование может быть связано с тем фактом, что каждое растение соответствует независимому трансформирующему объекту и, таким образом, количество копий представляющего интерес гена варьирует от растения к растению. Среднее повреждение в популяции в зависимости от дозы представлено в таблице 6, чтобы продемонстрировать устойчивость каждой из конструкций dgt-14, связанных с транзитным пептидом хлоропластов, против dgt-1 и нетрансформированных контролей дикого типа для различных доз глифосата. Трансгенные объекты содержали dgt-14, связанный с TraP8 v2 (pDAB105526), TraP9 v2 (pDAB105527), TraP12 v2 (pDAB105528) и TraP13 v2 (pDAB105529). Данные селекции с глифосатом для растений T1 продемонстрировали, что, когда dgt-14 был связан с этими транзитными пептидами хлоропластов, обеспечивалась надежная устойчивость к высоким уровням глифосата. Для сравнения, dgt-14, связанный с TraP4 v5 (pDAB107526), TraP5 v2 (pDAB105525) и TraP5 v1 (pDAB102787), не обеспечил устойчивость к обработке высокими концентрациями глифосата, однако эти конструкции были более устойчивыми, чем нетрансформированные контроли (или контроли дикого типа), которые были обработаны теми же дозами глифосата. Кроме того, существовали примеры, когда трансгенные объекты, для которых было показано, что они содержат три или более копии dgt-14, были более чувствительными к повышенным дозам глифосата. Эти примеры продемонстрированы с помощью диапазона процентного видимого повреждения, представленного в таблице 6. Вероятно, что присутствие высоких количеств копий трансгенов в растениях Arabidopsis приводит к подавлению трансгена или другим эпигенетическим эффектам, которые приводили к чувствительности к глифосату, несмотря на присутствие трансгена dgt-14.

ТАБЛИЦА 6
Ответ T1 Arabidopsis, трансформированных dgt-14, на диапазон доз глифосата, внесенных после всходов, по сравнению с сегрегирующей популяцией dgt-1 (T2) и нетрансформированным контролем. Видимый % повреждений через 2 недели после внесения
TraP4 v5::dgt-14 (pDAB107526) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
105 г.э.к./га глифосата 0 0 4 85,8 4,3 80-90
420 г.э.к./га глифосата 0 0 4 91,0 7,1 85-99
1680 г.э.к./га глифосата 0 0 4 96,5 1,7 95-98
3360 г.э.к./га глифосата 0 0 4 95,8 1,5 95-98
TraP5 v1::dgt-14 (pDAB102787) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 6 0 0 0,0 0,0 0
105 г.э.к./га глифосата 0 0 6 64,0 13,0 50-80
420 г.э.к./га глифосата 0 0 6 99,0 2,0 95-100
1680 г.э.к./га глифосата 0 0 6 100,0 0,0 100
3360 г.э.к./га глифосата NT NT

TraP5 v2::dgt-14 (pDAB105525) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 5 0 0 0,0 0,0 0
105 г.э.к./га глифосата 0 0 5 93,0 2,7 90-95
420 г.э.к./га глифосата 0 0 5 98,6 2,2 95-100
1680 г.э.к./га глифосата 0 0 5 98,0 1,9 95-100
3360 г.э.к./га глифосата 0 0 5 96,0 2,2 95-100
TraP8 v2::dgt-14 (pDAB105526) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
105 г.э.к./га глифосата 0 2 2 40,0 14,1 20-50
420 г.э.к./га глифосата 3 0 1 23,8 31,5 0-70
1680 г.э.к./га глифосата 0 1 3 66,3 28,4 25-85
3360 г.э.к./га глифосата 3 0 1 26,5 42,5 0-90
TraP9 v2::dgt-14 (pDAB105527) диапазон % повреждения (№ реплик) анализ % повреждения

Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
105 г.э.к./га глифосата 2 1 1 23,0 25,7 0-50
420 г.э.к./га глифосата 2 0 2 37,5 37,7 0-70
1680 г.э.к./га глифосата 2 0 2 48,8 39,0 15-85
3360 г.э.к./га глифосата 1 0 3 63,8 39,2 5-85
TraP12 v2::dgt-14 (pDAB105528) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 5 0 0 0,0 0,0 0
105 г.э.к./га глифосата 5 0 0 6,0 6,5 0-15
420 г.э.к./га глифосата 4 1 0 11,0 5,5 5-20
1680 г.э.к./га глифосата 3 1 1 20,4 14,3 10-45
3360 г.э.к./га глифосата 2 3 0 19,0 4,2 15-25
TraP13 v2::dgt-14 (pDAB105529) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
105 г.э.к./га глифосата 2 0 2 34,5 32,4 5-65

420 г.э.к./га глифосата 2 1 1 21,3 27,2 0-60
1680 г.э.к./га глифосата 3 0 1 27,0 35,6 5-80
3360 г.э.к./га глифосата 3 1 0 32,8 31,5 15-80
dgt-1 (pDAB3759) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
105 г.э.к./га глифосата 0 3 1 40,0 14,1 30-60
420 г.э.к./га глифосата 0 4 0 30,0 0,0 30
1680 г.э.к./га глифосата 0 3 1 55,0 30,0 40-100
3360 г.э.к./га глифосата 0 0 4 57,5 8,7 45-65
Нетрансформированный контроль диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
105 г.э.к./га глифосата 0 0 4 100,0 0,0 100
420 г.э.к./га глифосата 0 0 4 100,0 0,0 100
1680 г.э.к./га глифосата 0 0 4 100,0 0,0 100
3360 г.э.к./га глифосата 0 0 4 100,0 0,0 100

Выбранные растения T1 Arabidopsis, для которых было идентифицировано, что они содержат низкие количества копий трансгенных вставок (1-3 копии), подвергали самоопылению с получением второго поколения для дополнительной оценки устойчивости к глифосату. Второе поколение растений Arabidopsis (T2), которые содержали 1-3 копии трансгена dgt-14, далее охарактеризовывали в отношении устойчивости к глифосату и устойчивости к глюфосинату (устойчивость к глюфосинату показала, что экспрессирующая кассета PAT была интактной и не подвергалась перестройкам во время самоопыления растений T1). В поколении T2 гемизиготные и гомозиготные растения были доступны для исследования каждого трансгенного объекта и, таким образом, были включены для каждой исследованной дозы глифосата. Гемизиготные растения содержит два различных аллеля в локусе по сравнению с гомозиготными растениями, которые содержат те же два аллеля в локусе. Количество копий и уровни плоидности растений T2 подтверждали с использованием протоколов молекулярного анализа, описанного выше. Аналогично, глифосат вносили с использованием способов и доз, описанных ранее. Ответ растений представлен в значениях % видимого повреждения через 2 недели после обработки (WAT). Данные представляли в качестве гистограммы для индивидуальных растений, проявляющих небольшое повреждение или отсутствие повреждения (<20%), умеренное повреждение (20-40%) или тяжелое повреждение (>40%). Арифметическое среднее значение и стандартное отклонение представлены для каждой конструкции, использованной для трансформации Arabidopsis. Диапазон индивидуального ответа также указан в последнем столбце для каждой дозы и трансформации. Нетрансформированные Arabidopsis дикого типа (cv. Columbia) служили в качестве чувствительного к глифосату контроля. Кроме того, растения, содержащие ген устойчивости к гербициду глифосату dgt-1 (как описано в патенте США, поданном под номером № 12558351, включенном в настоящее описание в качестве ссылки в полном объеме) были включены в качестве положительного контроля.

В поколении T2 трансгенные объекты dgt-14 как с одной копией, так и с низким числом копий (две или три копии), охарактеризовывали в отношении устойчивости к глифосату. Среднее повреждение в общей популяции на дозу представлено в таблице 7, чтобы продемонстрировать устойчивость, обеспечиваемую каждой из конструкций dgt-14, связанных с транзитным пептидом хлоропластов, против dgt-1 и нетрансформированных контролей дикого типа для различных доз глифосата. Трансгенные объекты поколения T2 содержали dgt-14, связанный с TraP8 v2 (pDAB105526), TraP9 v2 (pDAB105527), TraP12 v2 (pDAB105528) и TraP13 v2 (pDAB105529). Все из этих трансгенных объектов были высокоустойчивыми к глифосату. Результаты показали, что диапазон повреждений для растений T2 Arabidopsis составлял менее чем 20% для всех исследованных концентраций глифосата. Трансгенные объекты T2 Arabidopsis, содержавшие dgt-14, связанный с TraP4 v5 (pDAB107526), TraP5 v2 (pDAB105525) и TraP5 v1 (pDAB102787), не обеспечили надежной устойчивости к глифосату по сравнению с другими конструкциями dgt-14, которые содержали другие транзитные пептиды TraP. Однако конструкции dgt-14, связанные с TraP4 v5 (pDAB107526), TraP5 v2 (pDAB105525) и TraP5 v1 (pDAB102787), не обеспечили низкого уровня устойчивости к глифосату, который был значительно более высоким по сравнению с нетрансформированным контролем. В общем, результаты показали, что растения, содержащие и экспрессирующие DGT-14, обеспечивали коммерческий уровень устойчивости к глифосату на уровнях, вплоть до 3 раз превышающих дозу на поле (1120 г.э.к./га).

ТАБЛИЦА 7
Ответ T2 Arabidopsis, трансформированных dgt-14, на диапазон доз глифосата, внесенных после всходов, по сравнению с сегрегирующей популяцией dgt-1 (T2) и нетрансформированным контролем.
Видимое % повреждение через 2 недели после внесения.
Данные соответствуют выбранной линии с одной копией из каждой конструкции, которая сегрегировала в качестве одного локуса в скрининге наследуемости.
TraP4 v5::dgt-14 (pDAB107526) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 0 0 4 85,0 0,0 85
840 г.э.к./га глифосата 0 0 4 87,5 3,5 85-90
1680 г.э.к./га глифосата 0 0 4 92,5 3,5 90-95
3360 г.э.к./га глифосата 0 0 4 95,0 0,0 95
TraP5 v1::dgt-14 (pDAB102787) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 0 0 4 90,0 0,0 90
840 г.э.к./га глифосата 0 0 4 90,0 0,0 90

1680 г.э.к./га глифосата 0 0 4 88,8 2,5 85-90
3360 г.э.к./га глифосата 0 0 4 94,5 3,3 90-98
TraP5 v2::dgt-14 (pDAB105525) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 0 0 4 86,3 2,5 85-90
840 г.э.к./га глифосата 0 0 4 90,0 4,1 85-95
1680 г.э.к./га глифосата 0 0 4 90,0 7,1 85-100
3360 г.э.к./га глифосата 0 0 4 97,0 2,4 95-100
TraP8 v2::dgt-14 (pDAB105526) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 4 0 0 0,5 1,0 0-2
840 г.э.к./га глифосата 4 0 0 0,0 0,0 0
1680 г.э.к./га глифосата 4 0 0 2,5 2,9 0-5
3360 г.э.к./га глифосата 4 0 0 5,0 4,8 0-10

TraP9 v2::dgt-14 (pDAB105527) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 4 0 0 0,0 0,0 0
840 г.э.к./га глифосата 4 0 0 0,0 0,0 0
1680 г.э.к./га глифосата 4 0 0 1,8 2,4 0-5
3360 г.э.к./га глифосата 2 2 0 17,5 17,6 0-35
TraP12 v2::dgt-14 (pDAB105528) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 4 0 0 1,8 2,4 0-5
840 г.э.к./га глифосата 4 0 0 2,5 2,9 0-5
1680 г.э.к./га глифосата 4 0 0 2,0 4,0 0-8
3360 г.э.к./га глифосата 4 0 0 3,8 4,8 0-10
TraP13 v2::dgt-14 (pDAB105529) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)

0 г.э.к./га глифосата 4 0 0 0 0 0
420 г.э.к./га глифосата 4 0 0 0 0 0
840 г.э.к./га глифосата 4 0 0 1,3 2,5 0-5
1680 г.э.к./га глифосата 4 0 0 1,8 2,4 0-5
3360 г.э.к./га глифосата 4 0 0 3,8 4,8 0-10
dgt-1 (pDAB3759) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 2 0 2 40,0 40,4 5-75
840 г.э.к./га глифосата 0 2 2 47,5 31,8 20-75
1680 г.э.к./га глифосата 0 2 2 41,3 23,9 20-70
3360 г.э.к./га глифосата 0 4 0 35,0 0,0 35
Нетрансформированный контроль диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 0 0 4 100,0 0,0 100
840 г.э.к./га глифосата 0 0 4 100,0 0,0 100

1680 г.э.к./га глифосата 0 0 4 100,0 0,0 100
3360 г.э.к./га глифосата 0 0 4 100,0 0,0 100

Случайным образом отобранные растения T2 Arabidopsis, для которых было идентифицировано, что они содержат низкие количества копий вставок трансгена (1-3 копии), подвергали самоопылению для получения третьего поколения для дополнительной оценки устойчивости к глифосату. Семена Arabidopsis третьего поколения (T3) высевали и оценивали в отношении устойчивости к глифосату с использованием тех же протоколов, которые были описаны выше. Трансгенные объекты, исследованные в поколении T3, содержали реплики из каждой линии, которые были гомозиготными (как определено с использованием скрининга устойчивости к глюфосинату для идентификации того, продемонстрировали ли какие-либо из развившихся растений сегрегацию трансгенов). Эти трансгенные объекты анализировали с помощью ЖХ-МС-МС для подтверждения того, что растения экспрессировали белок DGT-14. Результаты среднего повреждения в общей популяции в зависимости от дозы глифосата для поколения T3 представлены в таблице 8, в которой показана устойчивость к глифосату, обеспечиваемая каждой из конструкций dgt-14, для различных доз глифосата. Иллюстративные устойчивые трансгенные объекты T3 включали dgt-14, связанный с TraP8 v2 (pDAB105526), TraP9 v2 (pDAB105527), TraP12 v2 (pDAB105528) и TraP13 v2 (pDAB105529). Все из этих трансгенных событий были высокоустойчивыми к глифосату. Результаты показали, что диапазон повреждений для растений T3 Arabidopsis составлял менее 20% для всех исследованных концентраций глифосата. Трансгенные объекты T3 Arabidopsis, содержавшие dgt-14, связанный с TraP5 v2 (pDAB105525) и TraP5 v1 (pDAB102787) не обеспечили надежной устойчивости к глифосату по сравнению с другими конструкциями dgt-14, которые содержали различные транзитные пептиды TraP. Однако конструкции dgt-14, связанные с TraP5 v2 (pDAB105525) и TraP5 v1 (pDAB102787), обеспечили низкий уровень устойчивости к глифосату, который был значительно более высоким по сравнению с нетрансформированным контролем. В общем, результаты показали, что растения, содержащие и экспрессирующие DGT-14, обеспечили коммерческий уровень устойчивости к глифосату при уровнях, вплоть до 3 раз превышающих уровни в поле (1120 г.э.к./га).

ТАБЛИЦА 8
Ответ T3 Arabidopsis, трансформированных dgt-14, на диапазон доз глифосата, внесенных после всходов, по сравнению с сегрегирующей популяцией dgt-1 (T2) и нетрансформированным контролем.
Видимое % повреждение через 2 недели после внесения.
Данные соответствуют выбранной популяции с одной копией из каждой конструкцией, которая сегрегировала в качестве одного локуса в скрининге наследуемости T2
TraP5 v1::dgt-14 (pDAB102787) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 0 0 4 85,0 4,1 80-90
840 г.э.к./га глифосата 0 0 4 86,3 2,5 85-90
1680 г.э.к./га глифосата 0 0 4 93,7 4,8 90-100
3360 г.э.к./га глифосата 0 0 4 93,7 4,8 90-100
TraP5 v2::dgt-14 (pDAB105525) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 0 0 4 93,3 3,9 90-98
840 г.э.к./га глифосата 0 0 4 97,5 3,8 92-100

1680 г.э.к./га глифосата 0 0 4 93,0 2,5 90-95
3360 г.э.к./га глифосата 0 0 4 91,7 2,4 90-95
TraP8 v2::dgt-14 (pDAB105526) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 4 0 0 0,0 0,0 0
840 г.э.к./га глифосата 4 0 0 1,3 2,5 0-5
1680 г.э.к./га глифосата 4 0 0 0,0 0,0 0
3360 г.э.к./га глифосата 4 0 0 4,0 4,0 2-10
TraP9 v2::dgt-14 (pDAB105527) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 4 0 0 0,0 0,0 0
840 г.э.к./га глифосата 4 0 0 0,0 0,0 0
1680 г.э.к./га глифосата 4 0 0 0,0 0,0 0
3360 г.э.к./га глифосата 4 0 0 4,3 1,5 2-5
TraP12 v2::dgt-14 (pDAB105528) диапазон % повреждения (№ реплик) анализ % повреждения

Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 4 0 0 0,0 0,0 0
840 г.э.к./га глифосата 4 0 0 0,0 0,0 0
1680 г.э.к./га глифосата 4 0 0 2,5 5,0 0-10
3360 г.э.к./га глифосата 4 0 0 4,8 2,1 2-7
TraP13 v2::dgt-14 (pDAB105529) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 4 0 0 0,0 0,0 0
840 г.э.к./га глифосата 4 0 0 0,0 0,0 0
1680 г.э.к./га глифосата 4 0 0 0,0 0,0 0
3360 г.э.к./га глифосата 4 0 0 1,8 2,4 0-5
dgt-1 (pDAB3759) диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 0 2 2 42,5 9,6 30-50

840 г.э.к./га глифосата 0 4 0 40,0 0,0 40
1680 г.э.к./га глифосата 0 3 1 47,5 15,0 40-70
3360 г.э.к./га глифосата 0 0 4 77,5 17,1 60-100
Нетрансформироваанный контроль диапазон % повреждения (№ реплик) анализ % повреждения
Внесенная доза <20% 20-40% >40% Среднее значение Стандартное отклонение Диапазон (%)
0 г.э.к./га глифосата 4 0 0 0,0 0,0 0
420 г.э.к./га глифосата 0 0 4 100,0 0,0 100
840 г.э.к./га глифосата 0 0 4 100,0 0,0 100
1680 г.э.к./га глифосата 0 0 4 100,0 0,0 100
3360 г.э.к./га глифосата 0 0 4 100,0 0,0 100

dgt-14 в качестве селективного маркера

Применение dgt-14 в качестве селективного маркера для глифосата в качестве агента селекции исследуют для трансформированных растений Arabidopsis, описанных выше. Приблизительно 50 семян Arabidopsis поколения T4 (гомозиготные по dgt-14) добавляют приблизительно к 5000 семенам дикого типа (чувствительные к глифосату). Семена проращивают и на ростки распыляют выбранную дозу глифосата. Сравнивают несколько обработок глифосатом; в каждом лотке проводят либо одно, либо два внесения глифосата по одной из следующих схем обработки: 7 DAP (суток после посева), 11 DAP или 7, а затем 11 DAP. Поскольку все растения также содержат устойчивости к глюфосинату в том же векторе для трансформации, содержащие dgt-14 растения, отобранные с помощью глифосата, можно прямо сравнивать с контрольными растениями, содержащими DSM-2 или pat, отобранными с помощью глюфосината.

Обработки глифосатом осуществляют с помощью наконечника распылителя DeVilbiss, как описано ранее. Трансгенные растения, содержащие dgt-14, идентифицируют как "устойчивые" или "чувствительные" через 17 DAP. Обработка 26,25-1680 г.э.к./га глифосата, внесенного через 7 и 11 суток после посева (DAP), демонстрирует эффективную селекцию для трансгенных растений Arabidopsis, которые содержат dgt-14. Чувствительные и устойчивые растения подсчитывают, и выявляют, что количество устойчивых к глифосату растений коррелирует с исходным количеством трансгенных семян, содержащих dgt-14, которые были посеяны. Эти результаты указывают на то, что dgt-14 можно эффективно использовать в качестве альтернативного селективного маркера для популяции трансформированных Arabidopsis.

Наследуемость dgt-14

Подтвержденные трансгенные объекты T1 Arabidopsis подвергали самоопылению с получением семян T2. Эти семена исследовали в испытании по качеству потомства путем применения гербицида Ignite™, содержащего глюфосинат (200 г.э.к./га), к 100 случайным сибсам T2. Каждое индивидуальное растение T2 пересаживали в 7,5-см квадратные горшки перед применением спрея (гусеничный опрыскиватель при скорости внесения 187 л/га). Семьи T1 (растения T2) сегрегировали согласно ожидаемой модели 3 устойчивых: 1 чувствительный для доминантно-наследуемого единичного локуса с наследованием по менделевскому типу, при определении с помощью критерия хи-квадрат (P>0,05). Процент семей T1, которые сегрегировали с ожидаемым менделевским наследованием, проиллюстрирован в таблице 9, и он демонстрирует, что признак dgt-14 переходит по менделевскому типу наследования в поколение T2. Семена собирали от 5-15 индивидуальных растений T2 (семена T3). Двадцать пять сибсов T3 из каждого из 3-4 случайно выбранных семейств T2 исследовали в испытании по качеству потомства, как описано ранее. Данные показали отсутствие сегрегации, и, таким образом, продемонстрировали что dgt-14 стабильно встраивается в хромосому и наследуется по менделевскому типу по меньшей мере в трех поколениях.

ТАБЛИЦА 9
Процент семей T1 (растения T2), сегрегирующих по менделевскому типу наследования в испытании по качеству потомства для 100 растений
Представляющий интерес ген Исследованные семейства T1, сегрегирующие по 1 локусу (%)
TraP4 v2 - dgt-14 80%
TraP5 v1 - dgt-14 80%
TraP5 v2 - dgt-14 75%
TraP8 v2 - dgt-14 100%
TraP9 v2 - dgt-14 100%
TraP12 v2 - dgt-14 100%
TraP13 v2 - dgt-14 50%
Трансгенный контроль yfp 100%

Пример 8: трансформация дополнительных сельскохозяйственных культур

Сою можно трансформировать генами dgt-14, dgt-11, dgt-12, dgt-18, dgt-29 или dgt-30 для обеспечения высоких уровней устойчивости к гербициду глифосату с испольованием способов, описанных ранее в примере #11 или примере #13 WO 2007/053482.

Хлопок можно трансформировать генами dgt-14, dgt-11, dgt-12, dgt-18, dgt-29 или dgt-30 для обеспечения высоких уровней устойчивости к гербициду глифосату с использованием способов, описанных ранее в примере #14 патента США № 7838733 или примере #12 WO 2007/053482 (Wright et al.).

Канолу можно трансформировать генами dgt-14, dgt-11, dgt-12, dgt-18, dgt-29 или dgt-30 для обеспечения высоких уровней устойчивости к гербициду глифосату с использованием тех же способов, которые ранее были описаны в примере #26 патента США № 7838733 или примере #22 WO 2007/053482 (Wright et al.).

Пример 9: опосредуемая Agrobacterium трансформация других сельскохозяйственных культур

Ввиду настоящего изобретения, дополнительные сельскохозяйственные культуры можно трансформировать в соответствии с вариантами осуществления настоящего изобретения с использованием способов, которые известны в данной области. Для опосредуемой Agrobacterium трансформации ржи, смотрите, например, Popelka JC, Xu J, Altpeter F., "Generation of rye with low transgene copy number after biolistic gene transfer and production of (Secale cereale L.) plants instantly marker-free transgenic rye," Transgenic Res. 2003 Oct; 12(5):587-96.). Для опосредуемой Agrobacterium трансформации сорго, смотрите, например, Zhao et al., "Agrobacterium-mediated sorghum transformation", Plant Mol Biol. 2000 Dec; 44(6):789-98. Для опосредуемой Agrobacterium трансформации ячменя смотрите, например, Tingay et al., "Agrobacterium tumefaciens-mediated barley transformation", The Plant Journal, (1997) 11: 1369-1376. Для опосредуемой Agrobacterium трансформации пшеницы, смотрите, например, Cheng et al., "Genetic Transformation of Wheat Mediated by Agrobacterium tumefaciens," Plant Physiol. 1997 Nov; 115(3):971-980. Для опосредуемой Agrobacterium трансформации риса, смотрите, например, Hiei et al., "Transformation of rice mediated by Agrobacterium tumefaciens", Plant Mol. Biol. 1997 Sep; 35(1-2):205-18.

Латинские названия этих и других растений приведены ниже. Должно быть понятно, что другие (не с помощью Agrobacterium) способы трансформации можно использовать для трансформации dgt-14, например, в эти и другие растения. Примеры включают, но не ограничиваются ими, кукурузу (Zea mays), пшеницу (Triticum spp.), рис (Oryza spp. и Zizania spp.), ячмень (Hordeum spp.), хлопок (Abroma augusta и Gossypium spp.), сою (Glycine max), сахарную свеклу и столовую свеклу (Beta spp.), сахарный тростник (Arenga pinnata), томат (Lycopersicon esculentum и другие spp., Physalis ixocarpa, Solanum incanum и другие spp., и Cyphomandra betacea), картофель (Solanum tuberosum), сладкий картофель (Ipomoea batatas), рожь (Secale spp.), перец (Capsicum annuum, chinense и frutescens), салат-латук (Lactuca sativa, perennis и pulchella), капусту (Brassica spp.), сельдерей (Apium graveolens), баклажан (Solanum melongena), арахис (Arachis hypogea), сорго (Sorghum spp.), люцерну (Medicago sativa), морковь (Daucus carota), бобы (Phaseolus spp. и другие рода), овес (Avena sativa и strigosa), горох (Pisum, Vigna и Tetragonolobus spp.), подсолнечник (Helianthus annuus), тыкву крупноплодную (Cucurbita spp.), огурец (Cucumis sativa), табак (Nicotiana spp.), арабидопсис (Arabidopsis thaliana), траву рулонного газона (Lolium, Agrostis, Poa, Cynodon и другие рода), клевер (Trifolium), вику (Vicia). Трансформация таких растений генами dgt-14, dgt-11, dgt-12, dgt-18, dgt-29 и dgt-30, например, предусматривается в вариантах осуществления настоящего изобретения.

Гены Dgt-14, dgt-11, dgt-12, dgt-18, dgt-29 и dgt-30 имеют потенциал к увеличению применимости ключевых гербицидов на основе глифосата для применения во время сезона во многих сельскохозяйственных системах лиственных и вечнозеленых древесных пород. Устойчивые к гербициду глифосату древесные породы увеличивают универсальность поверхностного применения этих гербицидов без угрозы повреждений. Эти виды включают, но не ограничиваются ими; ольху (Alnus spp.), ясень (Fraxinus spp.), виды осины и тополя (Populus spp.), бук (Fagus spp.), березу (Betula spp.), вишню (Prunus spp.), эвкалипт (Eucalyptus spp.), гикори (Carya spp.), клен (Acer spp.), дуб (Quercus spp.) и сосну (Pinus spp.).

Применение устойчивости к гербициду глифосату для селективной борьбы с сорняками в декоративных и плодоносных видах также находится в объеме вариантов осуществления настоящего изобретения. Примеры включают, но не ограничиваются ими, розу (Rosa spp.), ясенец (Euonymus spp.), петунию (Petunia spp.), бегонию (Begonia spp.), рододендрон (Rhododendron spp.), яблоню лесную или яблоню (Malus spp.), грушу (Pyrus spp.), персик (Prunus spp.) и бархатцы (Tagetes spp.).

Пример 10: трансформация кукурузы

Конструкции ДНК для трансформации кукурузы

Стандартные способы клонирования, как описано выше, используют для конструирования бинарных векторов для применения в опосредуемой Agrobacterium tumefaciens трансформации кукурузы. Следующие элементы генов используют в векторах, которые содержат dgt-14: промотор убиквитина 1 Zea mays (ZmUbi1; патент США № 5510474) используют для контроля кодирующей последовательности dgt-14, которая фланкируется 3′-нетранслируемой областью липазы Zea mays (ZmLip 3′UTR; патент США № 7179902), кассета селективного маркера состоит из промотора убиквитина 1 Zea mays, который использовали для контроля кодирующей последовательности aad-1 (патент США № 7838733), которая фланкируется 3′-нетранслируемой областью липазы Zea mays. Кодирующая последовательность aad-1 сообщает устойчивость к феноксиауксиновым гербицидам, таким как 2,4-дихлорфеноксиуксусная кислота (2,4-D), и к арилоксифеноксипропионатным (AOPP) гербицидам. Конструкции dgt-14 сконструированы в качестве стандартных бинарных векторов и векторов супербинарной системы Agrobacterium (Japan Tobacco, Tokyo, JP).

Стерилизация початков и выделение зародышей

Для получения незрелых зародышей кукурузы растения инбредной линии B104 Zea mays выращивают в теплице и подвергают самоопылению и опылению сибсами для получения початков. Початки собирают приблизительно через 9-12 суток после опыления. В день эксперимента початки подвергают поверхностной стерилизации путем погружения в 20% раствор гипохлорита натрия (5%) и встряхивания в течение 20-30 минут, а затем ополаскивают три раза стерильной водой. После стерилизации незрелые зиготические зародыши (1,5-2,4 мм) в асептических условиях отрезают от початка и случайным образом распределяют в микроцентрифужные пробирки, содеращие жидкую среду для инфицирования (основная питательная среда LS, 4,43 г/л; раствор витаминов N6 [1000×], 1,00 мл/л; L-пролин, 700,0 мг/л; сахароза, 68,5 г/л; D(+) глюкоза, 36,0 г/л; 10 мг/мл 2,4-D, 150 мкл/л). Для данного набора экспериментов используют объединенные зародыши трех початков.

Инициация культуры Agrobacterium

Исходные культуры в глицерине Agrobacterium, содержащие бинарные векторы для трансформации, описанные выше, наносят штрихами на чашки с минимальной средой AB, содержащие соответствующие антибиотики, и выращивают при 20°C в течение 3-4 суток. Единичную колонию отбирают и наносят штрихами на чашки с YEP, содержащие те же антибиотики, и инкубируют при 28°C в течение 1-2 суток.

Культивирование и сокультивирование Agrobacterium

Колонии Agrobacterium отбирают из чашки с YEP, суспендируют в 10 мл среды для инфицирования в 50-мл одноразовой пробирке, и плотность клеток доводят до OD600 нм 0,2-0,4 с использованием спектрофотометра. Культуры Agrobacterium помещают на ротационное устройство для встряхивания при 125 об./мин., комнатная температура, в то время как проводят отделение зародышей. Незрелые зиготические зародышей размером 1,5-2,4 мм выделяют из стерилизованных зерен кукурузы и помещали в 1 мл среды для инфицирования) и промывают один раз той же средой. В каждую пробирку добавляют суспензию Agrobacterium (2 мл) и пробирки помещают на платформу устройства для встряхивания на 10-15 минут. Зародыши переносят на среду для сокультивиования (соли MS, 4,33 гм/л; L-пролин, 700,0 мг/л; миоинозитол, 100,0 мг/л; ферментативный гидролизат казеина 100,0 мг/л; 30 мМ Dicamba-KOH, 3,3 мг/л; сахароза, 30,0 г/л; Gelzan™, 3,00 г/л; модифицированные витамины MS [1000×], 1,00 мл/л; 8,5 мг/мл AgNO3, 15,0 мг/L; DMSO, 100 мкМ), ориентированный щитком зародыша вверх и инкубируют при 25°C, при освещении в течение 24 часов с интенсивностью света 50 мкмоль м-2⋅с-1 в течение 3 суток.

Отбор каллюсов и регенерация предполагаемых трансгенных объектов

После периода сокультивирования зародыши переносят в среду покоя (соли MS, 4,33 г/л; L-пролин, 700,0 5; 1,2,3,5/4,6-гексагидроксициклогексан, 100 мг/л; MES [(2-(н-морфолино)этансульфоновая кислота), свободная кислота] 0,500 г/л; ферментативный гидролизат казеина 100,0 мг/л; 30 мМ Dicamba-KOH, 3,3 мг/л; сахароза, 30,0 г/л; Gelzan 2,30 г/л; модифицированные витамины MS [1000×], 1,00 мл/л; 8,5 мг/мл AgNO3, 15,0 мг/л; карбенициллин, 250,0 мг/л) без агента селекции и инкубируют при освещении в течение 24 часов с интенсивностью света 50 мкмоль м-2⋅с-1 и при 25°C в течение 3 суток. Эксперименты по выявлению ответа на дозировку в виде ингибирования роста показывают, что концентрации глифосата 0,25 мМ и более являются достаточными для ингибирования роста клеток нетрансформированной линии кукурузы B104. Зародыши переносят в среду для селекции 1, содержавшую 0,5 мМ глифосат (соли MS, 4,33 г/л; L-пролин, 700,0 мг/л; миоинозитол, 100,0 мг/л; MES [(2-(н-морфолино)этансульфоновая кислота), свободная кислота] 0,500 г/л; ферментативный гидролизат казеина 100,0 мг/л; 30 мМ Dicamba-KOH, 3,3 мг/л; сахароза, 30,0 г/л; Gelzan™ 2,30 г/л; модифицированные витамины MS [1000×], 1,00 мл/л; 8,5 мг/мл AgNO3, 15,0 мг/л; карбенициллин, 250,0 мг/л) и инкубируют либо в темноте и/либо при освещении в течение 24 часов с интенсивностью света 50 мкмоль м-2⋅с-1 в течение 7-14 суток при 28°C. Пролиферирующие эмбриогенные каллюсы переносят на среду для селекции 2, содержавшую 1,0 мМ глифосат (соли MS, 4,33 г/л; L-пролин, 700,0 мг/л; 1,2,3,5/4,6-гексагидроксициклогексан, 100 мг/л; MES [(2-(н-морфолино)этансульфоновая кислота), свободная кислота] 0,500 г/л; ферментативный гидролизат казеина 100,0 мг/л; 30 мМ Dicamba-KOH, 3,3 мг/л; сахароза, 30,0 г/л; Gelzan™ 2,30 г/л; модифицированные витамины MS [1000×], 1,00 мл/л; 8,5 мг/мл AgNO3, 15,0 мг/л; карбенициллин, 250,0 мг/л; R-галоксифоп-кислота 0,1810 мг/л), и инкубируют либо в темноте и/либо при освещении в течение 24 часов с интенсивностью света 50 мкмоль м-2⋅с-1 в течение 14 суток при 28°C. Эта стадия селекции позволяет трансгенному каллюсу далее пролиферировать и дифференцироваться. Период селекции каллюсов длится от трех до четырех недель. Пролиферирующие эмбриогенные каллюсы переносят в среду PreReg, содержавшую 0,5 мМ глифосат (соли MS, 4,33 г/л; 1,2,3,5/4,6-гексагидроксициклогексан, 100 мг/л; L-пролин, 350,0 мг/л; MES [(2-(н-морфолино)этансульфоновая кислота), свободная кислота] 0,250 г/л; ферментативный гидролизат казеина 50,0 мг/л; NAA-NaOH 0,500 мг/л; ABA-EtOH 2,50 мг/л; BA 1,00 мг/л; сахароза, 45,0 г/л; Gelzan™ 2,50 г/л; модифицированные витамины MS [1000×], 1,00 мл/л; 8,5 мг/мл AgNO3, 1,00 мг/л; карбенициллин, 250,0 мг/л) и культивируют при освещении в течение 24 часов с интенсивностью света 50 мкмоль м-2⋅с-1 в течение 7 суток при 28°C. Эмбриогенные каллюсы с похожими на побеги почками переносят в среду для регенерации, содержащую 0,5 мМ глифосат (соли MS, 4,33 г/л; 1,2,3,5/4,6-гексагидроксициклогексан, 100,0 мг/л; сахароза, 60,0 г/л; Gellan Gum G434™ 3,00 г/л; модифицированные витамины MS [1000×], 1,00 мл/л; карбенициллин, 125,0 мг/л) и культивируют при освещении в течение 24 часов с интенсивностью света 50 мкмоль м-2⋅с-1 в течение 7 суток. Небольшие проростки с первичными корнями переносят в среду для укоренения (соли MS, 4,33 г/л; модифицированные витамины MS [1000×], 1,00 мл/л; 1,2,3,5/4,6-гексагидроксициклогексан, 100 мг/л; сахароза, 60,0 г/л; Gellan Gum G434™ 3,00 г/л; карбенициллин, 250,0 мг/л) в лотки для растений и инкубируют при 16/8 ч свет/темнота при интенсивности света 140-190 мкмоль м-2⋅с-1 в течение 7 суток при 27°C. Предполагаемые трансгенные проростки анализируют в отношении количества копий трансгена с использованием протоколов, описанных выше, и переносят в почву.

Молекулярное подтверждение присутствия трансгенов dgt-14 и aad-1 в растениях кукурузы

Присутствие полинуклеотидных последовательностей dgt-14 и aad-1 подтверждают с помощью анализов гидролиза зондов. Выделенные растения кукурузы T0 сначала подвергают скринингу с помощью анализа гидролиза зондов, аналогичного TAQMAN™, для подтверждения присутствия трансгенов aad-1 и dgt-14. Данные, полученные в этих исследованиях, используют для определения количества копий трансгенов, и их используют для селекции трансгенных объектов кукурузы для обратного скрещивания и перехода к поколению T1. Образцы тканей собирают в 96-луночные планшеты, мацерацию ткани проводят с помощью распылителя для тканей KLECO™ и гранул из нержавеющей стали (Hoover Precision Products, Cumming, GA) в буфере Qiagen™ RLT. После мацерации ткани геномную ДНК выделяют в высокопроизводительном формате с использованием набора Biosprint™ 96 Plant kit (Qiagen™, Germantown, MD) в соответствии с предложенным изготовителем протоколом. Геномную ДНК количественно определяют с помощью набора Quant-IT™ Pico Green DNA assay kit (Molecular Probes, Invitrogen, Carlsbad, CA). Количественно определенную геномную ДНК доводят до приблизительно 2 нг/мкл для анализа гидролиза зондов с использованием автоматического устройства для обработки жидкостей BIOROBOT3000™ (Qiagen, Germantown, MD). Определение количества копий трансгена с помощью анализа гидролиза зондов проводят способом ПЦР в реальном времени с использованием системы LIGHTCYCLER®480 (Roche Applied Science, Indianapolis, IN). Анализы разработаны для aad-1, dgt-14 и внутреннего эталонного гена инвертазы (номер доступа Genbank №: U16123.1) с использованием программного обеспечения LIGHTCYCLER® Probe Design Software 2.0. Для амплификации смесь LIGHTCYCLER®480 Probes Master mix (Roche Applied Science, Indianapolis, IN) приготавливают в 1× конечной концентрации в мультиплексной реакционной смеси объемом 10 мкл, содержащей 0,4 мкм каждого праймера для aad-1 и dgt-14 и 0,2 мкМ каждого зонда. Двухстадийную реакцию амплификации проводят с удлинением при 60°C в течение 40 секунд с получением данных флуоресценции. Все образцы анализируют и для анализа каждого образца используют усредненные величины значения порогового цикла (Ct). Анализ данных ПЦР в реальном времени проводят с использованием программного обеспечения LightCycler™ выпуска 1.5 с использованием модуля относительного количественного определения, и он основан на способе ΔΔCt. Контроли включают образец геномной ДНК из калибратора единичной копии и известный контроль с 2 копиями, которые включают в каждый анализ.

Устойчивость к гербицидам после всходов в трансформированной dgt-14 кукурузе T0

Трансгенным объектам T0 позволяют акклиматизироваться в теплице и их выращивают до тех пор, пока 2-4 новых нормального вида листа не появится из завитка (т.е. растения, которые перенесены из тканевой культуры в условия роста в теплице). Растения выращивают при 27°C в условиях 16 часов на свету:8 часов в темноте в теплице. Затем растения обрабатывают коммерческими составами Durango DMA™ (содержащие гербицид глифосат) с добавлением 2% масс./об. сульфата аммония. Внесение гербицида осуществляют с помощью гусеничного опрыскивателя с объемом распыления 187 л/га, высота распыления 50 смотрите На растения T0 распыляют диапазон доз глифосата 280-4480 г.э.к./га глифосата, способных значительно повреждать нетрансформированные линии кукурузы. Летальную дозу определяют как дозу, которая вызывает >95% инбредной линии B104.

Результаты растений кукурузы T0 dgt-14 демонстрируют, что устойчивость к глифосату обеспечивается при дозах вплоть до 4480 г.э.к./га. Отобранные растения T0 подвергают самоопылению и обратному скрещиванию для дальнейшей охарактеризации в следующем поколении. Дополнителные эксперименты включают испытание 100 растений по качеству потомства, которое проводят для выбранных линий dgt-14, включающих растения T1. На все растения распыляют 140-1120 г.э.к./га глюфосината или 105-1680 г.э.к./га глифосата, как описано ранее. Как ген селективного маркера, так и ген устойчивости к глифосату, сконструированы на одной и той же плазмиде. Таким образом, полагают, что если проводят селекцию одного гена устойчивости к гербициду путем распыления гербицида, то присутствуют оба гена. Через четырнадцать DAT, устойчивые и чувствительные растения подсчитывают для определения процента линий, которые сегрегировали в качестве одного локуса, доминантного менделевского признака (3R:1S), при определении с помощью анализа хи-квадрат. Эти данные демонстрируют, что dgt-14 наследуется в качестве надежного гена устойчивости к глифосату в однодольных видах. Увеличенные дозы глифосата применяют к выжившим растениям T1 или F1, чтобы далее охарактеризовать устойчивость и защиту, которые обеспечиваются геном dgt-14.

Использование устойчивости к послевсходовому внесению глифосата в качестве селективного маркера

Как описано ранее, трансформированные растения T0 перемещают из культуры тканей в теплицу и акклиматизируют. Исследованные трансгенные объекты включают dgt-14, связанный с транзитными пептидами хлоропластов. Показано, что эти растения T0 обеспечивают надежную устойчивость к вплоть до 4480 г.э.к./га глифосата, и контроль в виде нетрансформированных растений осуществляют при концентрации глифосата только 280 г.э.к./га. Эти данные демонстрируют, что dgt-14 можно использовать в качестве селективного маркера с использованием концентрации глифосфата в диапазоне 280-4480 г.э.к./га.

Другой вариант осуществления включает добавление установленных количеств семян из фиксированных линий кукурузы, которые содержат трансген dgt-14, в установленное количество нетрансформированных семян. Семена высевают и позволяют им расти до стадии развития V1-V3, и в это время на ростки распыляют селективную дозу глифосата в диапазоне 280-4480 г.э.к./га. Через 7-10 суток чувствительные и устойчивые растения подсчитывают и выявляют, что количество устойчивых к глифосату растений коррелирует с исходным количеством трансгенных растений, содержащих трансген dgt-14, которые были посеяны.

Пример 11: пакетирование с другими признаками

Трансгенные культуры, содержащие признаки устойчивости к насекомым (IR) распространены среди растений кукурузы, сои и хлопка по всей Северной Америке и использование этих признаков расширяется во всем мире. Коммерческие трансгенные культуры, сочетающие в себе признаки устойчивости к насекомым и устойчивости к гербицидам (HT), разрабатываются многими компаниями по производству семян. Они включают признаки Bacillus thuringiensis (например, токсины Bt, приведенные на web-сайте lifesci.sussex.ac.uk, 2006), признаки устойчивости к насекомым, не являющиеся Bt, и любые или все из признаков HT, упомянутых выше. Возможность борьбы с множеством обусловленных паразитами проблем с помощью признаков IR является ценной концепцией коммерческого продукта. Однако удобство этой концепции продукта ограничивается, если борьба с сорняками и борьба с насекомыми независимы друг от друга. Dgt-24 отдельно или пакетированные с одним или несколькими дополнительными признаками HT можно пакетировать с одним или несколькими дополнительными агротехническими признаками (например, устойчивость к насекомым, устойчивость к грибам или устойчивость к стрессовым воздействиям и т.д.) (смотрите www.isb.vt.edu), либо посредством общепринятого разведения, либо совместно в качестве в качестве нового трансгенного объекта. Иллюстративные признаки IR можно пакетировать с dgt-14. При получении кодирующей последовательности признака IR, специалист в данной области может добавлять элементы экспрессии (например, промотор, интрон, 3′UTR, и т.д.) и признак IR пакетируют в молекуле с dgt-14 способами рекомбинантных ДНК. Иллюстративные признаки-кандидаты для IR включают: Cry1F (патенты США № 5126133; 5188960; 5691308; 6096708; 6573240 и 6737273), Cry1A(c) (патенты США № 6114138; 5710020; 6251656 и 6229004), Cry1F и Cry1A(c) в качестве тройного набора с любым из dgt-14, Cry34Ab(1) (патенты США № 7323556; 7897342; 7888495; 7875430; 7932033; 7956246; 6340593), Cry35 Ab(1) (патенты США № 6340593; 7323556; 7897342; 7888495; 7875430; 7932033; 7956246), или Cry35 Ab(1) и Cry 34 Ab(1) в качестве тройного набора с dgt-14. Преимущества включают улучшенную борьбу с сорняками, обеспечиваемую dgt-14, и описанную в предыдущих примерах, объединенную со способностью контролировать вредных насекомых и/или другие агрономические стрессовые воздействия. Таким образом, варианты осуществления настоящего изобретения можно использовать для обеспечения полного агрономического набора улучшенных качеств сельскохозяйственной культуры и экономичный контроль любого количества агрономических проблем.

Комбинированные признаки IR и HT являются применимыми в большинстве агрономических и садоводческих/декоративных культур и лесоводстве. Комбинацию dgt-14, и соответствующей устойчивости к гербицидам и устойчивости к насекомым, обеспечиваемой любым из ряда генов IR, как Bt, так и не Bt, можно использовать для сельскохозяйственных культур, приведенных (но не ограничиваясь этим) в примерах 8 и 9. Специалисту в области борьбы с сорняками будет понятно, что использование любых из описанных различных коммерческих гербицидов в таких культурах является возможным с помощью трансформации dgt-14 и пакетирования их с соответствующим признаком HT или признаком IR, либо с помощью общепринятого разведения, либо с помощью генетической инженерии. Конкретные дозы гербицидов, репрезентативные для этих химических веществ, определяются ярлыками для гербицидов, собранными в книге CPR (Crop Protection Reference) или сходном сборнике, ярлыками, собранными интерактивно (например, cdms.net/manuf/manuf.asp), или любыми коммерческими или академическими руководствами по защите сельскохозяйственных культур, такими как Crop Protection Guide от Agriliance (2005). Каждый альтернативный гербицид, использование которого стало возможным в HTC с помощью dgt-14 при использовании либо отдельно, либо в баковой смеси, либо последовательно, считается находящимся в объеме вариантов осуществления настоящего изобретения.

Пример 12: признак DGT-14, пакетированный с признаком AAD, в любой культуре

Путем пакетирования признака dgt-14 с признаком aad (например, aad-1, описанный в патенте США 7838733; или aad-12, описанный в WO 2007/053482 A2), либо посредством общепринятого разведения, либо вместе в качестве нового трансгенного события, можно повышать эффективность борьбы с сорняками, универсальность и способность контролировать смену сорняков и развитие устойчивости к гербицидам.

Трансформация культур aad-1 позволяет растениеводу селективно применять арилоксиалканоатные гербициды в однодольных культурах. Такие однодольные культуры будут иметь более высокий предел безопасности феноксиауксина. Кроме того, феноксиауксины можно селективно применять в двудольных культурах, трансформированных aad-1. Трансформация культур aad-12 позволяет растениеводу селективно использовать пиридилоксиауксиновые и арилоксиалканоатные гербициды в двудольных культурах для борьбы с сорными видами. Путем пакетирования dgt-14 с признаками aad-1 или aad-12, растениеводы обеспечивают более широкий спектр гербицидов для борьбы с сорняками. Более того, использование комбинаций гербицидов приведет к большей универсальности для борьбы с устойчивостью к гербицидам в сорных видах.

Может предусматриваться несколько сценариев улучшенной борьбы с сорняками, где признак dgt-14 и признак aad пакетированы в любой однодольной или двудольной сельскохозяйственной культуре:

a) Глифосат можно применять в стандартной послевсходовой вносимой дозе (420-2160 г.э.к./га, предпочтительно, 560-1120 г.э.к./га) для борьбы с большинством травяных и широколистных видов сорняков. Признак dgt-14 может обеспечить устойчивость при этих внесенных дозах глифосата. Для борьбы с устойчивыми к глифосату широколистными сорняками, такими как Conyza Canadensis, или сорняками, которые от природы трудно контролировать с помощью глифосата (например, Commelina spp), 280-2240 г.э.к./га (предпочтительно 560-1120 г.э.к./га) 2,4-D можно применять последовательно, в баковой смеси или в качестве предварительной смеси с глифосатом для обеспечения дополнительного контроля. Как aad-1, так и aad-12 обеспечивают устойчивость к 2,4-D. Кроме того, aad-12 обеспечивает устойчивость к пиридилоксиауксиновым гербицидам, таким как триклопир и флуроксипир. Пиридилоксиауксиновые гербициды можно использовать для борьбы с устойчивыми к глифосату широколистными сорняками, такими как Conyza canadensis и Commelina spp. Для триклопира, внесенные дозы, как правило, могут находиться в диапазоне 70-1120 г.э.к./га, более типично, 140-420 г.э.к./га. Для флуроксипира внесенные дозы, как правило, находятся в диапазоне 35-560 г.э.к./га, например, 70-280 г.э.к./га.

b) Глифосат можно применять в стандартной послевсходовой вносимой дозе (420-2160 г.э.к./га, предпочтительно, 560-1120 г.э.к./га) для борьбы с большинством травяных и широколистных сорных видов. Для борьбы с устойчивыми к глифосату видами трав, такими как Lolium rigidum или Eleusine indica, 10-200 г.э.к./га (предпочтительно, 20-100 г.э.к./га) квизалофопа можно вносить последовательно, в баковой смеси или в качестве предварительно смеси с глифосатом для обеспечения эффективного контроля. Aad-1 обеспечивает устойчивость к квизалофопу. Размещение последовательно aad-1 в комбинации с dgt-14 в сельскохозяйственных видах может обеспечить культуры, которые являются устойчивыми к гербицидам, описанным выше.

с) Глифосат является эффективным для борьбы с видами трав, отличными от широколистных сорных видов. Пакетированные признаки Aad-1 и dgt-14 позволяют внесение эффективных против трав доз глифосата (105-840 г.э.к./га, более предпочтительно, 210-420 г.э.к./га). Затем можно вносить 2,4-D (в дозе 280-2240 г.э.к./га, более предпочтительно, 560-1120 г.э.к./га) последовательно, в качестве баковой смеси или в качестве предварительной смеси с эффективными против трав дозами глифосата для обеспечения необходимой борьбы с широколистными сорняками. Гербицид AOPP, такой как квизалофоп в дозе 10-200 г.э.к./га (предпочтительно, 20-100 г.э.к./га и, более предпочтительно, 20-35 г.э.к./га), можно использовать для более надежного контроля травяных сорняков и/или для замедления развития устойчивых к глифосату трав. Низкая доза глифосата также обеспечит некоторую пользу для борьбы с широколистными сорняками; однако основной контроль будет осуществляться 2,4-D.

d) Аналогично, пакетированные признаки aad-12 и dgt-14 позволят внесение эффективных против трав доз глифосата (105-840 г.э.к./га, более предпочтительно, 210-420 г.э.к./га). Затем можно вносить 2,4-D (в дозе 280-2240 г.э.к./га, более предпочтительно, 560-1120 г.э.к./га) последовательно, в баковой смеси или в качестве предварительной смеси с эффективными против трав дозами глифосата для обеспечения необходимого контроля широколистных сорняков. Триклопир и флуроксипир, используемые в дозах, упомянутых выше, также будут приемлемыми компонентами в режиме обработки. Низкая доза глифосата также обеспечит некоторую пользу для борьбы с широколистными сорняками; однако основной контроль будут осуществялть 2,4-D, триклопир или флуроксипир.

Специалисту в области борьбы с сорняками будет понятно, что применение одного или нескольких коммерческих арилоксиауксиновых гербицидов отдельно или в комбинации (последовательно или независимо) является возможным благодаря трансформации aad-12 в культуры. Аналогично применению одного или нескольких коммерческих феноксиауксиновых гербицидов отдельно или в комбинации (последовательно или независимо) с одним или несколькими коммерческими гербицидами AOPP способствует aad-1. Пакетирование любого из этих признаков с dgt-14 позволяет более надежный контроль сорных видов. Конкретные дозы других гербицидов, репрезентативных для этих химических веществ, могут быть определены на этикетках гербицидов, собранных в книге CPR (Crop Protection Reference) или сходном сборнике, этикетках, собранных интерактивно (например, cdms.net/manuf/manuf.asp) или любых коммерческих или академических руководствах по защите культур, таких как Crop Protection Guide from Agriliance (2005). Каждый альтернативный гербицид, использование которого стало возможным в HTC с помощью aad-12, aad-1 или dgt-14, при использовании либо отдельно, либо в баковой смеси, либо последовательно, считается находящимся в объеме вариантов осуществления настоящего изобретения.

Пример 13: dgt-14, пакетированный с признаком AHAS, в любой сельскохозяйственной культуре

Признаки, кодирующие устойчивость к имидазолиноновым гербицидам (AHAS) в настоящее время присутствуют в ряде сельскохозяйственных культур, выращиваемых в Северной Америке, включая, но не ограничиваясь ими, кукурузу, рис, подсолнечник и пшеницу. В настоящее время разрабатываются дополнительные устойчивые к имидазолинону культуры (например, хлопок и сахарная свекла), но на сегодняшний день они еще коммерчески не реализованы. Многие имидазолиноновые гербициды (например, имазамокс, имазетапир, имазаквин и имазапик) в настоящее время селективно используются в различных общепринятых сельскохозяйственных культурах. Применению имазетапира, имазамокса и неселективного имазапира способствуют с помощью признаков устойчивости к имидазолинонам, таким как AHAS. HTC для устойчивости к имидазолинонам в настоящее время имеют преимущество, состоящее в том, что они не являются трансгенными. Этот класс химических веществ также имеет значительную остаточную активность в почве, таким образом, он способен обеспечить борьбу с сорняками, которая распространяется за пределы времени внесения, в отличие от систем на основе глифосата или глюфосината. Однако спектр сорняков, контролируемых имидазолиноновыми гербицидами, не является настолько широким, как у глифосата (Agriliance, 2003). Кроме того, имидазолиновые гербициды обладают механизмом действия (ингибирование ацетолактатсиснтазы, ALS), к которому у многих сорняков развилась устойчивость (Heap I (2004). The international survey of herbicide resistant weeds, available at www.weedscience.com). Путем пакетирования Dgt-14 с признаком устойчивости к имидазолинонам, либо посредством общепринятого разведения, либо совместно в качестве нового объекта трансформации, может быть улучшена эффективность борьбы с сорняками, универсальность и способность контролировать смену сорняков и развитие устойчивости к гербицидам. Как упоминалось в предшествующих примерах, путем трансформации сельскохозяйственных культур посредством dgt-14, можно селективно использовать гербициды на основе глифосата в однодольных и двудольных культурах. Может быть предусмотрено несколько сценариев для улучшенной борьбы с сорняками, где dgt-14 и признак устойчивости к имидазолинону пакетированы в любом однодольном или двудольном виде сельскохозяйственной культуры.

a) Имазетапир можно вносить в стандартной послевсходовой вносимой дозе (35-280 г.э.к./га, предпочтительно, 70-140 г.э.к./га) для борьбы с многими травяными и широколистными сорными видами.

i) Устойчивые к ингибиторам ALS широколистные сорняки, такие как Amaranthus rudis, Ambrosia trifida, Chenopodium album (среди прочих, Heap, 2004) можно контролировать с помощью баковой смеси глифосата в дозе 420-2160 г.э.к./га, предпочтительно, 560-1120 г.э.к./га.

ii) Широколистные виды, по своей природе более устойчивые к имидазолиноновым гербицидам, такие как Ipomoea spp. также можно контролировать с помощью баковой смеси глифосата в дозе 420-2160 г.э.к./га, например, 560-1120 г.э.к./га.

iii) Устойчивые к ингибиторам ALS травяные сорняки, такие как Sorghum halepense и Lolium spp., можно контролировать с помощью баковой смеси глифосата в дозе 420-2160 г.э.к./га, предпочительно, 560-1120 г.э.к./га.

iv) По своей природе устойчивые травяные сорные виды (например, Agropyron repens) также можно контролировать с помощью баковой смеси глифосата в дозе 420-2160 г.э.к./га, предпочтительно, 560-1120 г.э.к./га.

Специалисту в области борьбы с сорняками будет понятно, что использование любого из различных коммерческих имидазолиноновых гербицидов или глифосатных гербицидов отдельно или в множестве комбинаций способствует трансформация dgt-14 и пакетирование с любым признаком устойчивости к имидазолинону, либо с помощью общепринятых способов разведения, либо с помощью генной инженерии. Конкретные дозы гербицидов, репрезентативные для этих химических веществ могут определяться ярлыками для гербицидов, собранными в книге CPR (Crop Protection Reference) или сходном сборнике, ярлыками, собранными интерактивно (например, cdms.net/manuf/manuf.asp), или любыми коммерческими или академическими руководствами по защите сельскохозяйственных культур, такими как Crop Protection Guide от Agriliance (2005). Каждый альтернативный гербицид, который можно использовать в HTC посредством dgt-14 и признака устойчивости ALS, при использовании либо отдельно, либо в баковой смеси, либо последовательно, находится в объеме настоящего изобретения.

Пример 14: трансформация сои

Трансгенную сою (Glycine max), содержащую стабильно встроенный трансген dgt-14, получают путем опосредуемой Agrobacterium трансформации эксплантатов семядольного узелка сои. Для инициации трансформации используют разоруженный штамм Agrobacterium, содержащий бинарный вектор, включающий функциональный dgt-14.

Опосредуемую Agrobacterium трансформацию осуществляют с использованием модифицированной методики половины семядольного узла Zeng et al. (Zeng P., Vadnais D.A., Zhang Z., Polacco J.C., (2004), Plant Cell Rep., 22(7): 478-482). В кратком изложении, семена сои (cv. Maverick) проращивают на базальной среде и семядольные узлы выделяют и инфицируют Agrobacterium. Среды для закладки побегов, удлинения побегов и укоренения дополняют цефотаксимом, тиментином и ванкомицином для удаления Agrobacterium. Селекцию с помощью гербицида используют для ингибирования роста нетрансформированных побегов. Выбранные побеги переносят в среду для укоренения в целях развития корней, а затем переносят в почвенную смесь для акклиматизации проростков.

Терминальные листки выбранных проростков обрабатывают поверхностно (способ окрашивания листьев) гербицидом для скрининга предполагаемых трансформантов. Подвергнутые скринингу проростки переносят в теплицу, позволяют им акклиматизироваться, а затем листья окрашивают гербицидом для повторного подтверждения устойчивости. Проводят взятие образцов этих предполагаемых трансформированных растений T0 и используют молекулярный анализ для подтверждения присутствия гербицидного селективного маркера и трансгена dgt-14. Растениям T0 позволяют самоопыляться в теплице с получением семян T1.

Для получения дополнительных трансгенных растений сои можно использовать второй способ трансформации сои. Разоруженный штамм Agrobacterium, содержащий бинарный вектор, включающий функциональный dgt-14, используют для инициации трансформации.

Опосредуемую Agrobacterium трансформацию проводят с использованием модифицированной методики половины семени Paz et al. (Paz M., Martinez J., Kalvig A., Fonger T., и Wang K., (2005) Plant Cell Rep., 25: 206-213). В кратком изложении, зрелые семена сои стерилизуют в течение ночи с помощью газообразного хлора и пропитывают стерильной H2O за двадцать часов до опосредуемой Agrobacterium трансформации растений. Семена разрезают пополам путем продольного разреза вдоль рубчика семени для разделения семени и удаления оболочки семени. Эмбриональную ось вырезают и любые осевые побеги/почки удаляют из семядольного узелка. Полученные эксплантаты половин семян инфицируют Agrobacterium. Среды для закладки побегов, удлинения побегов и укоренения дополняют цефотаксимом, тиментином и ванкомицином для удаления Agrobacterium. Селекцию с помощью гербицида используют для ингибирования роста нетрансформированных побегов. Выбранные побеги переносят в среду для укоренения в целях развития корней, а затем переносят в почвенную смесь для акклиматизации проростков.

Терминальные листки выбранных проростков обрабатывают поверхностно (способ окрашивания листьев) гербицидом для скрининга предполагаемых трансформантов. Подвергнутые скринингу проростки переносят в теплицу, позволяют им акклиматизироваться, а затем листья окрашивают гербицидом для повторного подтверждения устойчивости. Проводят взятие образцов этих предполагаемых трансформированных растений T0 и используют молекулярный анализ для подтверждения присутствия гербицидного селективного маркера и трансгена dgt-14. Получают растения сои, содержащие трансген dgt-14. На растения сои с dgt-14 распыляют различные концентрации глифосата и показано, что они обеспечивают устойчивость к глифосату при концентрациях вплоть до 3360 г.э.к./га.

Пример 15: трансформация гена dgt-14 в рис

Трансгенный рис (Oryza sativa), содержащий стабильно встроенный трансген dgt-14, получают с помощью опосредуемой Agrobacterium трансформации эксплантата семядольного узла сои. Для инициации трансформации используют разоруженный штамм Agrobacterium, содержащий бинарный вектор, включающий функциональный dgt-14.

Культуральную среду доводят до pH 5,8 с помощью 1 M KOH и загущают с помощью 2,5 г/л Phytagel (Sigma-Aldrich, St. Louis, MO). Эмбриогенные каллюсы культивируют в чашках Петри размером 100×20 мм, содержащих 40 мл полутвердой среды. Проростки риса выращивают на 50 мл среды в боксах MAGENTA. Суспензии клеток поддерживают в 125-мл конических колбах, содержащих 35 мл жидкой среды и центрифугируют при 125 об./мин. Индукцию и поддержание эмбриогенных культур проводят в темноте при 25-26°C, и регенерацию растений и культивирование цельных растений проводят в освещенной комнате со световым периодом 16 ч (Zhang et al. 1996).

Индукцию и поддержание эмбриогенного каллюса проводят на модифицированной базальной среде NB, как описано ранее (Li et al. 1993), где среда адаптирована так, чтобы она содержала 500 мг/л глутамина. Суспензионные культуры инициируют и поддерживают в жидкой среде SZ (Zhang et al. 1998) с включением 30 г/л сахарозы вместо мальтозы. Осмотическая среда (NBO) состоит из среды NB с добавлением 0,256 M каждого из маннита и сорбита. Селекцию устойчивого к гербицидам каллюса проводят на среде NB, дополненной соответствующим селективным гербицидным агентом, в течение 3-4 недель. Предварительную регенерацию проводят на среде (PRH50) состоящей из среды NB с 2,4-дихлорфеноксиуксусной кислотой (2,4-D), 1 мг/л α-нафталинуксусной кислоты (NAA), 5 мг/л абсцизовой кислоты (ABA) и селективным гербицидом, в течение 1 недели. Регенерацию проростков осуществляют путем культивирования на среде для регенерации (RNH50), содержащей среду NB, содержащую 2,4-D, 0,5 мг/л NAA и селективный гербицид, до тех пор, пока предполагаемые трансгенные побеги не регенерируют. Побеги переносят на среду для укоренения с основными солями Мурасиге-Скуга в половинной концентрации и витаминами B5 Гамборга, дополненную 1% сахарозой и селективным гербицидом.

Зрелые высушенные семена Oryza sativa L. japonica cv. Taipei 309 стерилизуют, как описано в Zhang et al. 1996. Эмбриогенные ткани индуцируют путем культивирования стерильных зрелых семян риса на среде NB в темноте. Первичный каллюс диаметром приблизительно 1 мм удаляют из щитка зародыша и используют для инициации суспензии клеток в жидкой среде SZ. Затем суспензии поддерживают так, как описано в Zhang 1996. Происходящие из суспензии эмбриогенные ткани извлекают из жидкой культуры через 3-5 суток после предшествующего субкультивирования и помещают на осмотическую среду NBO для формирования круга размером приблизительно 2,5 см на чашке Петри и культивируют в течение 4 ч перед бомбардировкой. Через от шестнадцати до двадцати часов после бомбардировки ткани переносят из среды NBO на селективную среду NBH50, контролируя, чтобы подвергнутая бомбардировке поверхность была направлена вверх, и инкубируют в темноте в течение 14-17 суток. Затем вновь образованный каллюс отделяют от исходных подвергнутых бомбардировке эксплантатов и помещают рядом на ту же среду. После дополнительных 8-12 суток, относительно компактный непрозрачный каллюс визуально идентифицируют и переносят в предрегенерационную среду PRH50 на 7 суток в темноте. Затем растущий каллюс, который становится более компактным и непрозрачным, субкультивируют в среде для регенерации RNH50 в течение периода 14-21 суток при световом периоде 16 ч. Регенерирующие побеги переносят в боксы MAGENTA, содержащие среду 1/2 MSH50. Множество растений, регенерировавших из одного эксплантата, считают сибсами, и их обрабатывают как одну независимую линию растений. Растение оценивают как положительное по гену dgt-14, если оно образует толстые белые корни и энергично растет на среде 1/2 MSH50. После того, как ростки достигают верха боксов MAGENTA, их переносят в почву в 6-см горшках при 100% влажности на неделю, а затем переносят в камеру для выращивания со световым периодом в течение 14 ч при 30°C и в темноте при 21°C на 2-3 недели, перед пересадкой в 13-см горшки в теплице. Семена собирают и сушат при 37°C в течение одной недели перед хранением при 4°C.

На предполагаемые трансгенные ростки риса на стадии 3-5 листьев распыляют раствор глифосата. После распыления росткам позволяют высохнуть в течение одного часа, а затем извлекают из вытяжного шкафа. Оценку чувствительности или устойчивости к глифосату проводят через 10-14 суток после обработки (DAT). Идентифицируют устойчивые к глифосату ростки риса, которые содержат полностью встроенную копию растения dgt-14. Получают растения риса. содержащие трансген dgt-14. На растения риса с dgt-14 распыляют различные концентрации глифосата и показано, что они обладают устойчивостью к глифосату при концентрациях вплоть до 3360 г.э.к./га.

Пример 16: методики трансформации травы рулонного газона

Опосредуемую Agrobacterium tumefaciens генетическую трансформацию трансгена dgt-14 в полевице болотной обеспечивают с помощью эмбриогенного каллюса, полученного из семян (cv. Penn-A-4). Смотрите "Efficiency of Agrobacterium tumefaciens-mediated turfgrass (Agrostis stolonifera L) transformation" (Luo et. al., 2004).

Клетки каллюса инфицируют штаммом A. tumefaciens, содержащим супербинарный вектор, который содержит трансген устойчивости к гербицидам (например dgt-14), контролируемый специфическим для однодольных растений промотором. Общая эффективность стабильной трансформации находится в диапазоне от 18% до 45%. Саузерн-блоттинг и генетический анализ подтверждают встраивание гена в геном полевицы болотной и нормальную передачу и стабильную экспрессию трансгена в поколении T1. Все независимые трансгенные объекты включают от одной до трех копий трансгена и большинство из них (60-65%) включают только одну копию трансгена без наблюдаемых перестроек.

Зрелые семена вылущивают с помощью шлифовальной бумаги и подвергают поверхностной стерилизации в 10% (об./об.) отбеливателе Clorox™ (6% гипохлорит натрия) с 0,2% (об./об.) Tween 20 (полисорбат 20) при энергичном встряхивании в течение 90 мин. После промывания пять раз в стерильной дистиллированной воде, семена помещают на среду для индукции каллюса (базальные соли и витамины MS, 30 г/л сахарозы, 500 мг/л гидролизата казеина, 6,6 мг/л 3,6-дихлор-o-анисовой кислоты (дикамба), 0,5 мг/л 6-бензиламинопурина (BAP) и 2 г/л Phytagel. pH среды доводят до 5,7, а затем автоклавируют при 120°C в течение 20 мин).

Чашки для культивирования, содержащие приготовленные эксплантаты семян, держат в темноте при комнатной температуре в течение 6 недель. Проводят визуальную селекцию эмбриогенных каллюсов и их субкультивируют на свежей среде для индукции каллюса в темноте при комнатной температуре в течение 1 недели перед сокультивированием.

За одни сутки до опосредуемой Agrobacterium инфекции, эмбриогенный каллюс разделяют на фрагменты размером 1-2-мм и помещают на среду для индукции каллюса, содержащую 100 мкМ ацетосирингон. Затем на каждый фрагмент каллюса наносят аликвоту объемом 10 мкл суспензии Agrobacterium (OD=1,0 при 660 нм), которая содержит трансген dgt-14, а затем проводят сокультивирование в течение 3 суток в темноте при 25°C. Затем каллюс переносят и культивируют в течение 2 недель на среде для индукции каллюса с 125 мг/л цефотаксима и 250 мг/л карбенициллина для подавления роста бактерий.

Селекцию трансгенных растений проводят, когда каллюс переносят на среду для индукции каллюса, содержащую 250 мг/л цефотаксима и гербицид. Материал каллюса поддерживают на этой среде в течение 8 недель с интервалом селекции субкультуры 3 недели. Процесс селекции проводят при комнатной температуре в темноте.

Для регенерации растений сначала трансгенные объекты с устойчивым к гербицидам каллюсом с перемещают на среду для регенерации (базальная среда MS, 30 г/л сахарозы, 100 мг/л миоинозитола, 1 мг/л BAP и 2 г/л Phytagel), дополненную цефотаксимом и гербицидом для селекции. Эти каллюсы поддерживают в темноте при комнатной температуре в течение 1 недели, а затем перемещают на свет на 2-3 недели для развития побегов.

Развившиеся побеги отделяют и переносят на не содержащую гормонов среду для регенерации, содержащую гербицид и цефотаксим, для обеспечения роста корней при поддержании селективного давления и подавлении любых оставшихся клеток Agrobacterium. Затем проростки с хорошо развившимися корнями (3-5 недель) переносят на почву и выращивают либо в теплице, либо на поле.

Трансгенные растения поддерживают на открытом воздухе в изолированном питомнике (3-6 месяцев) до момента зимнего солнцестояния в декабре. Затем яровизированные растения переносят в теплицу и держат при 25°C при световом периоде 16/8 ч и окружают нетрансгенными контрольными растениями, которые физически изолируют трансгенные растения от других источников пыльцы. Трансгенные растения начинают цвести через 3-4 недели после перемещения обратно в теплицу. Эти растения подвергают ауткроссингу с пыльцой из окружающих контрольных растений. Семена, собранные с каждого индивидуального трансгенного растения, проращивают в почве при 25°C, и растения T1 выращивают в теплице для дальнейшего анализа.

Другие травы, предусматриваемые для трансформации посредством dgt-28 в соответствии с описанным протоколом, включают мятник однолетний (Poa annua), гречку заметную, полевицу, бермудскую траву, пырей, бородатую траву, брахиурию, костер, просо дикое (Agrostis capillaries), бизоную траву, канареечник, аксонопус, эремохлою змеехвостую, овсяницу красную (Festuca rubra commutate), ползучий сорняк, полевицу болотную (Agrostis stolonifera), тонконог пирамидальный (Koeleria macrantha), паспалум расширенный, овсяницу, фестулолиум, овсяницу жестковатую/овсяницу овечью (Festuca ovina), пастбищную траву, аиру голубую, джонсонову траву, полевичку, смеси (травы для лошадей, пастбищные травы, и т.д.), дикие травы, ежу сборную, райграсс пастбищный (Lolium perenne), полевицу белую, костер униольный, однолетний и многолетний плевел, овсяницу красную волосовидную (Festuca rubra trichophylla), мятлик луговой (Poa pratensis), августинову траву, ползучую красную овсяницу (Festuca rubra rubra), суданскую траву, просо прутьевидное, овсяницу высокую (Festuca arundinacea), луговик дернистый (Deschampsia caespitosa), траву газонного рулона, пырей ползучий и цойсию.

Пример 17: DGT-14 в рапсе (Brassica napus)

Ген dgt-14, сообщающий устойчивость к глифосату, используют для трансформации Brassica napus сорта Nexera™ 710 путем опосредуемой Agrobacterium трансформации.

Семена Brassica napus подвергают поверхностной стерилизации с помощью 10% коммерческого отбеливателя в течение 10 минут и ополаскивают 3 раза стерильной дистиллированной водой. Затем семена помещают на половину концентрации базальной среды MS (Murashige and Skoog, 1962) и поддерживают в режиме роста при 25°C и световом периоде 16 часов на свету/8 часов в темноте.

Сегменты гипокотиля (3-5 мм) вырезают из проростков в возрасте 5-7 суток и помещают на среду для индукции каллюса K1D1 (среда MS с 1 мг/л кинетина и 1 мг/л 2,4-D) на 3 суток в качестве предварительной обработки. Затем сегменты переносят на чашку Петри и обрабатывают штаммом Agrobacterium tumefaciens, содержащим конструкцию, содержащую dgt-14. Agrobacterium tumefaciens выращивают в течение ночи при 28°C в темноте на устройстве для качания при 150 об./мин., а затем ресуспендируют в культуральной среде.

После обработки в течение 30 мин сегментов гипокотиля посредством Agrobacterium, эти сегменты помещают обратно на среду для индукции каллюса на 3 суток. После сокультивирования сегменты помещают в K1D1TC (среда для индукции каллюса, содержащая 250 мг/л карбенициллина и 300 мг/л тиментина) на одну неделю для восстановления. Альтернативно сегменты помещают прямо на селективную среду K1D1H1 (указанная выше среда с гербицидом). Карбенициллин и тиментин представляют собой антибиотики, используемые для уничтожения Agrobacterium. Селективный агент обеспечивает рост трансформированных клеток.

Образцы каллюса из выделенных трансгенных объектов трансформации исследуют с помощью ПЦР. Образцы, которые являются положительными в отношении присутствия dgt-14 в исследовании, подтверждают и переносят на среду для регенерации. Затем сегменты гипокотиля каллюса помещают на среду для регенерации побегов B3Z1H1 (среда MS, 3 мг/л бензиламинопурина, 1 мг/л зеатина, 0,5 г/л MES [2-(N-морфолино)этансульфоновая кислота], 5 мг/л нитрата серебра, селективный гербицид, карбенициллин и тиментин). Через 3 недели побеги начинают регенерировать. Сегменты гипокотиля вместе с побегами переносят на среду B3Z1H3 (среда MS, 3 мг/л бензиламинопурина, 1 мг/л зеатина, 0,5 г/л MES [2-(N-морфолино)этансульфоновая кислота], 5 мг/л нитрата серебра, селективный гербицид, карбенициллин и тиментин) в течение других 3 недель.

Побеги вырезают из сегментов гипокотиля и переносят на среду для удлинения побегов MESH10 (MS, 0,5 г/л MES, селективный гербицид, карбенициллин, тиментин) на 2-4 недели. Удлиненные побеги культивируют для индукции корней на MSI.1 (MS с 0,1 мг/л индолмасляной кислотой). После развития у растения корневой системы, растения пересаживают в почву. Растения подвергают акклиматизации в контролируемых условиях окружающей среды в Conviron™ в течение 1-2 недель, а затем переносят в теплицу.

Трансформированные растения T0 подвергают самоопылению в теплице с получением семян T1. На растения T0 и потомков T1 распыляют диапазон концентраций гербицида глифосата для установления уровня защиты геном dgt-28.

Пример 18: трансформация табака

Фрагменты листьев табака (cv. Petit Havana) трансформируют с использованием Agrobacterium tumefaciens, содержащих трансген dgt-14. Единичные колонии, содержащие плазмиду, которая содержит трансген dgt-14, инокулируют в 4 мл среды YEP, содержащей антибиотики для селекции вектора, содержащего dgt-14, и инкубируют в течение ночи при 28°C на устройстве для встряхивания при 190 об./мин. Затем культуру семян объемом 4 мл используют для инокуляции 25-мл культуры с той же средой в 125-мл колбе с перегородками Erlenmeyer. Эту культуру инкубируют при 28°C при встряхивании при 190 об./мин. до тех пор, пока она не достигнет OD600 приблизительно 1,2. Затем десять мл суспензии Agrobacterium помещают в стерильные чашки Petri™ 60×20 мм.

Свежеразрезанные фрагменты листьев (0,5 см2) из растений, выращенных в асептических условиях на среде MS (Phytotechnology Labs, Shawnee Mission, KS,) с 30 г/л сахарозы в PhytaTrays (Sigma, St. Louis, MO), погружают в 10 мл ночной культуры Agrobacterium на несколько минут, промакивают насухо на стерильной фильтровальной бумаге, а затем помещают на ту же среду с добавлением 1 мг/л индолуксусной кислоты и 1 мг/л 6-бензиламинопурина. Через трое суток фрагменты листьев сокультивированные с Agrobacterium, содержащими трансген dgt-14, переносят в то же среду с 5 мг/л Basta™ и 250 мг/л цифотаксима.

Через 3 недели индивидуальные проростки T0 переносят в среду MS с 10 мг/л Basta™ и 250 мг/л цефотаксима на дополнительные 3 недели перед пересадкой в почву и переносом в теплицу. Выбранным растениям T0 (идентифицированные с использованием протоколов молекулярного анализа, описанного выше) позволяют самоопылиться и собирают семена из капсул, когда они полостью высыхают. Проростки T1 подвергают скринингу в отношении зиготности и экспрессии репортерного гена (как описано ниже) и идентифицируют отдельные растения, содержащие трансген dgt-14.

Хотя аспекты настоящего изобретения были описаны в определенных вариантах осуществления, их можно далее модифицировать в пределах сущности и объема настоящего изобретения. Таким образом, подразумевается, что настоящая заявка охватывает любые изменения, применения или доработку вариантов осуществления изобретения с использованием его общих принципов. Кроме того, подразумевается, что настоящее заявка охватывает такие отклонения от настоящего изобретения, которые соответствуют известной или обычной практике в области, к которой эти варианты осуществления относятся, и которые входят в пределы прилагаемой формулы изобретения.

1. Выделенная молекула нуклеиновой кислоты для обеспечения в растении устойчивости к глифосату, где молекула нуклеиновой кислоты характеризуется нуклеотидной последовательностью, которая кодирует полипептид с SEQ ID NO: 1.

2. Молекула нуклеиновой кислоты по п. 1, где нуклеотидной последовательностью является SEQ ID NO: 2 или SEQ ID NO: 3.

3. Экспрессирующий вектор, содержащий молекулу нуклеиновой кислоты по п. 1.

4. Устойчивая к глифосату клетка-хозяин, которая содержит полинуклеотид, кодирующий полипептид с SEQ ID NO: 1, функционально связанный с промотором.

5. Устойчивая к глифосату клетка-хозяин по п. 4, где промотор представляет собой промотор AtUbi10.

6. Клетка растения, содержащая полипептид с SEQ ID NO: 1, отличающаяся тем, что клетка растения толерантна к глифосату, по сравнению с клеткой растения дикого типа того же вида.

7. Трансгенное растение, которое содержит клетку растения по п. 6, где растение толерантно к глифосату, по сравнению с растением дикого типа того же вида.

8. Трансгенное растение по п. 7, отличающееся тем, что растение выбрано из группы, состоящей из пшеницы, кукурузы, сои, табака, брахиурии, риса, проса, ячменя, томата, яблока, груши, клубники, апельсина, люцерны, хлопка, моркови, картофеля, сахарной свеклы, ямса, салата-латука, шпината, петунии, розы, хризантемы, травы рулонного газона, сосны, пихты, ели, накапливающих тяжелые металлы растений, подсолнечника, сафлора, рапса и Arabidopsis.

9. Часть трансгенного растения, содержащая клетку растения по п. 6, отличающаяся тем, что часть растения толерантна к глифосату по сравнению с частью растения дикого типа того же вида.

10. Семя трансгенного растения для выращивания растения, устойчивого к глифосату, отличающееся тем, что семя растения содержит клетку растения по п. 6.

11. Культура ткани из клеток трансгенного растения по п. 6 для регенерации растения, устойчивого к глифосату.

12. Культура ткани по п. 11, где клетки трансгенного растения из типа ткани, выбранной из группы, состоящей из листьев, пыльцы, зародышей, семядолей, гипокотилей, клеток меристемы, корней, корневых кончиков, пыльников, цветков, стеблей и стручков.

13. Способ получения трансгенного растения, части растения, органа растения, семени растения или клетки растения, которая устойчива к глифосату, причем способ включает:

трансформацию растения, части растения, органа растения, семени растения или клетки растения молекулой нуклеиновой кислоты по п. 1, и, таким образом, получение трансгенного растения, части растения, органа растения, семени растения или клетки растения, экспрессирующей полипептид с SEQ ID NO: 1, трансгенное растение, часть растения, орган растения, семя растения или клетка растения толерантна к глифосату по сравнению с растением дикого типа того же вида.

14. Способ борьбы с сорняками на возделываемой посевной площади, содержащей устойчивые к гербицидам семена растения, причем способ включает:

a) посев семени трансгенного растения по п. 10, на возделываемой посевной площади; и

b) внесение на возделываемую посевную площадь достаточного количества глифосата для борьбы с сорняками на возделываемой посевной площади без существенного влияния на семя трансгенного растения.

15. Способ борьбы с сорняками на возделываемой посевной площади, содержащей устойчивые к гербицидам растения, причем способ включает:

a) высаживание трансгенного растения по п. 7, на возделываемой посевной площади; и

b) внесение на возделываемую посевную площадь достаточного количества глифосата для борьбы с сорняками на возделываемой посевной площади без существенного влияния на трансгенное растение.

16. Способ по п. 14, где семя трансгенного растения содержит второй гетерологичный полипептид.

17. Способ по п. 16, в котором вторым гетерологичным полипептидом является фермент 1 α-кетоглутарат-зависимой диоксигеназа (AAD-1) или фермент 12 α-кетоглутарат-зависимой диоксигеназа (AAD-12).

18. Способ по п. 15, в котором трансгенное растение содержит второй гетерологичный полипептид.

19. Способ по п. 18, где вторым гетерологичным полипептидом является фермент 1 α-кетоглутарат-зависимой диоксигеназа (AAD-1) или фермент 12 α-кетоглутарат-зависимой диоксигеназа (AAD-12).

20. Способ обеспечения устойчивости к глифосату в растении, причем способ включает:

a) трансформацию растения конструкцией ДНК, причем указанная конструкция содержит промотор, функционально связанный с нуклеотидной последовательностью SEQ ID NO: 2 или SEQ ID NO: 3;

b) регенерацию трансформированного растения, которое экспрессирует полипептид с SEQ ID NO: 1.

21. Способ по п. 20, где конструкция ДНК содержит вторую нуклеотидную последовательность, кодирующую гетерологичный полипептид, экспрессирующийся в растении.

22. Способ по п. 21, где второй нуклеотидной последовательностью является фермент 1 α-кетоглутарат-зависимой диоксигеназа (aad-1) или фермент 12 α-кетоглутарат-зависимой диоксигеназа (aad-12).

23. Устойчивое к глифосату растение, обладающее стабильно встроенной в его геном нуклеиновой кислотой по п. 2 в качестве гетерологичной нуклеиновой кислоты, где нуклеиновая кислота функционально связана с промотором.

24. Растение по п. 23, где растение представляет собой растение сои.

25. Растение по п. 23, где растение представляет собой растение кукурузы.

26. Растение по п. 23, где растение выбрано из группы, состоящей из пшеницы, табака, брахиурии, риса, проса, ячменя, томата, яблока, груши, клубники, апельсина, люцерны, хлопка, моркови, картофеля, сахарной свеклы, ямса, салата-латука, шпината, петунии, розы, хризантемы, травы рулонного газона, сосны, пихты, ели, накапливающих тяжелые металлы растений, подсолнечника, сафлора, рапса и Arabidopsis.

27. Растение по п. 23, где растение представляет собой вид, выбранный из группы, состоящей из родов Asparagus, Avena, Brachiaria, Brassica, Citrus, Citrullus, Capsicum, Cucurbita, Daucus, Erigeron, Glycine, Gossypium, Hordeum, Helianthus, Lactuca, Lolium, Lycopersicon, Malus, Manihot, Nicotiana, Orychophragmus, Oryza, Persea, Phaseolus, Pisum, Pyrus, Prunus, Raphanus, Secale, Solanum, Sorghum, Triticum, Vitis, Vigna и Zea.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к конструкции нуклеиновой кислоты и химерному белку для локализации полипептида в хлоропласт, а также к конструкции для экспрессии нацеливающего хлоропласты полипептида в клетке растения.

Изобретение относится к области биохимии, в частности к способу получения безмаркерных трансгенных растений каланхоэ, экспрессирующих ген цекропина P1. Изобретение позволяет создавать биобезопасные лекарственные растения каланхоэ с высоким уровнем накопления целевого продукта и в сокращенные по времени сроки.

Изобретение относится к области биохимии, в частности к трансгенному растению для замедления или предотвращения развития устойчивости к белкам Cry1Ab и DIG-3 у кукурузного мотылька (ЕСВ), его семени, а также к способу предотвращения развития устойчивости к белку Cry1Ab и DIG-3 у ECB с его использованием.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК, указывающей на присутствие трансгенного события, где репрезентативный образец семени, содержащий указанное трансгенное событие, депонирован как АТСС РТА-9670.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК, указывающей на присутствие трансгенного события, где репрезентативный образец семени, содержащий указанное трансгенное событие, депонирован как АТСС РТА-7899.

Изобретение относится к области биохимии, в частности к способу трансформации растительной клетки, где способ включает контакт растительных клеток незрелых зародышей кукурузы с клетками Agrobacterium в жидкой среде, содержащей неионное трисилоксановое поверхностно-активное вещество.

Изобретение относится к области биохимии, в частности к зерну пшеницы Triticum aestivum, имеющему повышенное содержание амилозы по сравнению с зерном пшеницы дикого типа, к растению пшеницы Triticum aestivum, которое продуцирует зерно, которое имеет пониженный уровень или активность общего белка SBEII, а также к способу получения указанного зерна.

Изобретение относится к генетическому контролю нападения видов насекомых-вредителей. В частности, к предотвращению или борьбе с нападением вредителей на растения с применением молекулы интерферирующей рибонуклеиновой кислоты (РНК).

Изобретение относится к области биохимии, в частности к конструкту нуклеиновой кислоты для экспрессии множественных генов в клетках и тканях растений, а также к способу получения трансгенного растения и способу получения трансгенной клетки с его использованием.

Изобретение относится к области биохимии, в частности к способу идентификации растения, включающего последовательность ДНК, вносящую вклад в устойчивость к заболеванию килой крестоцветных у Brassica napus.

Данное изобретение относится к иммунологии. Предложено антитело, связывающее кластерин, и его антигенсвязывающий фрагмент.

Группа изобретений относится к получению 2,4-дигидроксимасляной кислоты (2,4-ДГМ). Предложен способ получения 2,4-ДГМ, включающий первую стадию превращения малата в 4-фосфомалат с использованием фермента, способного осуществить подобное превращение, вторую стадию превращения 4-фосфомалата в малат-4-полуальдегид с использованием фермента, способного осуществить подобное превращение, и третью стадию превращения малат-4-полуальдегида в 2,4-ДГМ с использованием фермента, способного осуществить подобное превращение.

Настоящее изобретение относится к биохимии, в частности к полипептиду, обладающему активностью цитохрома P450. Указанный полипептид способен окислять такие соединения терпена, как моно- или полициклические монотерпены и сесквитерпены.

Настоящее изобретение относится к биохимии, в частности к мутантному полипептиду полимеразы ВГВ, содержащему мутантный домен полимеразы ВГВ с внутренней делецией, которая подавляет функциональную активность полимеразы, и мутантный домен РНКазы Н с внутренней делецией и мутациями, которые подавляют функциональную активность РНКазы Н.

Изобретение относится к области биохимии, в частности к способу получения безмаркерных трансгенных растений каланхоэ, экспрессирующих ген цекропина P1. Изобретение позволяет создавать биобезопасные лекарственные растения каланхоэ с высоким уровнем накопления целевого продукта и в сокращенные по времени сроки.

Изобретение относится к области биотехнологии, конкретно к гипоаллергенным вариантам главного аллергена Malus domectica, и может быть использовано в медицине для лечения аллергических заболеваний.

Изобретение относится к области биохимии, в частности к выделенной нуклеиновой кислоте, кодирующей полипептид слияния, обладающий активностью бета-1,4-N-ацетилглюкозаминилтрансферазы III (GnTIII) или бета-1,4-галактозилтрансферазы (GalT).

Изобретение относится к области биохимии. Описаны антиген-связывающие фрагменты (Fab), селективно связывающиеся с ботулиническим нейротоксином С, в частности гуманизированные Fab.

Настоящее изобретение относится к биохимии, в частности к искусственному гену, позволяющему экспрессировать в клетках бактерий изолированный домен 1 протективного антигена PAG из Bacillus anthracis 55-ВНИИВВиМ.

Изобретение относится к области биохимии. Предложены антитела, которые специфически связываются с Notch1.

Изобретение относится к области биохимии, в частности к способу борьбы с насекомыми-вредителями, такими как Pseudoplusia includens (соевая совка), Anticarsia gemmatalis (гусеница бархатных бобов), Spodoptera frugiperda (травяная совка).
Наверх