Интегративная генетическая конструкция pwpr-le



Интегративная генетическая конструкция pwpr-le
Интегративная генетическая конструкция pwpr-le
Интегративная генетическая конструкция pwpr-le
Интегративная генетическая конструкция pwpr-le

 


Владельцы патента RU 2539768:

Общество с ограниченной ответственностью "ЭдиВак" (RU)

Изобретение относится к области биотехнологии, в частности к интегративной генетической конструкции pWpr-le. Предложенное изобретение может использоваться для введения в хромосому клетки Bacillus subtilis и родственных видов рода Bacillus гена релизинг фактора гормона роста человека/свиньи и последующей его экспрессии в указанных клетках. Интегративная генетическая конструкция pWpr-le характеризуется нуклеотидной последовательностью, приведенной на Фиг.2. Предложенное изобретение позволяет получить векторную систему для экспрессии гена пептида GHRH_le в бактериях, обладающую высокой стабильностью при получении бактерийного препарата пробиотического назначения в промышленных условиях. 4 ил., 3 пр.

 

Область техники, к которой относится изобретение

Изобретение относится к области биотехнологии, в частности к созданию интегративной генетической конструкции для экспрессии гена релизинг фактора гормона роста человека/свиньи (GHRH_le) в бактериях.

Уровень техники

Известен способ создания рекомбинантных продуцентов интерферона альфа человека на базе Bacillus licheniformis (см. патент RU №98112850/13 кл. C12N 1/20, А61К 35/74, C12N 1/20, C12R 1:10 2001.08.20). Способ основан на использовании автономно реплицирующегося плазмидного вектора рВМВ 105, несущего целевой ген и ген канамицинфосфотрансферазы, обеспечивающего устойчивость к канамицину. Способ обеспечивает возможность продукции целевого белка при поддержании бациллярной культуры в стерильных условиях в присутствии канамицина. Однако за счет низкой репликативной стабильности плазмида быстро утрачивается при культивировании штамма в отсутствии селекции антибиотиком. Плазмидный вектор способен легко переноситься в клетки широкого круга грамположительных микроорганизмов, в том числе, представителей резидентной микрофлоры кишечника человека и животных. Таким образом, ввиду низкой стабильности и биологической опасности штамм оказывается непригоден для производства пробиотических препаратов зооветеринарного назначения.

Настоящее изобретение состоит в создании новой векторной системы для экспрессии гена пептида GHRH_le в бактериях, обладающей высокой стабильностью при получении бактерийного препарата пробиотического назначения в промышленных условиях и его пероральной доставки животным.

Раскрытие изобретения

Сущностью изобретения является способ создания интегративной генетической конструкции для экспрессии гена пептида GHRH_le в бактериях. Для интеграции гена пептида GHRH_le в хромосомный локус Wpr бактерий рода Bacillus создана конструкция, состоящая из следующих компонентов (фиг.1).

1. Промотор гена Wpr A (1000 п.н.)

Ген wprA кодирует субтилизиноподобную протеиназу, прочно связанную с клеточной стенкой (CWBP). Использование нуклеотидной последовательности, соответствующей последовательности промотора данного гена, предполагает интеграцию целевой конструкции (pWpr-le) в геном В.subtilis AJ73. При этом выключение гена WprA, происходящее в результате рекомбинации, не приводит к нарушению жизнедеятельности клетки, а активность промотора гена wprA обеспечивает синтез целевого белка (GHRH_le) в цитоплазму.

2. Мини-ген (15 п.н.) пентапептида (Е-пептид), экспрессия которого придает клеткам бацилл устойчивость к эритромицину. Использование мини-гена Е-пептида в качестве транскрипционного репортера позволяет существенно облегчить поиск наиболее продуктивных клонов путем выращивания культур на постепенно повышающихся концентрациях эритромицина и отбора наиболее устойчивых к антибиотику.

3. Последовательность, кодирующая GHRH_le (100 п.н.)

Таким образом, настоящее изобретение относится к способу получения интегративной генетической конструкции для экспрессии гена пептида GHRH_le в бактериях.

Способ предусматривает:

- получение плазмидной конструкции pWpr-le, несущей трифункциональный слитой ген;

- введение конструкции в геном В.subtilis AJ73 методом химической трансформации по Спицайзену.

Краткое описание графических изображений

Фиг.1. Плазмидная конструкция pWpr-le: принципиальная схема. Фиг.2. Последовательность трифункционального слитого гена, кодирующего GHRH_le, в составе конструкции pWpr-le.

Фиг.3. Электрофорез геномной ДНК, выделенной из клонов (изолятов) бацилл, предназначенной для детекции интегрированной конструкции pWpr-le методом ПЦР.

Фиг.4. Электрофоретический анализ продуктов ПЦР с целью идентификации конструкции pWpr_le, в том числе интегрированной в геном бацилл, с использованием праймеров SLN-H1 и SLN-H2.

Осуществление изобретения

Методология исследования:

1) получение конструкции pWpr-le,

2) введение в геном В.subtilis AJ73 полученной конструкции,

3) выделение геномной ДНК из В.subtilis AJ73 и детекция трансгена с помощью ПЦР.

1) Получение конструкции pWpr-lе

Получение конструкции проводили по следующей схеме:

1. ПЦР-клонирование кодирующей области зрелой формы GHRH_le с использованием праймеров ПЦР проводили с использованием праймеров к гену пептида GHRH_le:

SLN_H1: GGGGATCCTATGCAGATGCCATCTTCAC

SLN_H2: GGGTCGACTATCCCTGCTGCCTGCTCATGA

Размер ПЦР-продукта - 105 п.н. В качестве матрицы используется геномная ДНК человека.

2. Обработка продукта ПЦР 1 эндонуклеазами рестрикции BamHI и SalI, клонирование в вектор pQE30 (Qiagen), расщепленный по сайтам BamHI и SalI.

3. Получение ДНК-дуплекса искусственного мини-гена Е-пептида путем смешивания праймеров Еm2 и Em1.1 в эквимолярном соотношении с последующей достройкой полимеразой Pfu или обратной транскриптазой Mu-MLV (Promega).

4. Обработка ДНК-дуплекса эндонуклеазой рестрикции NdeI с последующим клонированием в вектор рЕТ23а, рЕТ23b или рЕТ23c, обработанный эндонуклеазами рестрикции NdeI и Ecl136.II.

5. ПЦР-амплификация на матрице геномной ДНК В. subtilis AJ73 фрагмента, содержащего промотор гена wprA с праймерами Wpr41 и Wpr42 (размер продукта 935 п.н.).

6. Обработка продукта ПЦР 3 эндонуклеазами рестрикции BglII и XbaI, лигирование с плазмидной ДНК конструкции 2 на базе вектора рЕТ23, несущей мини-ген Е-пептида устойчивости к эритромицину.

7. Перенос фрагмента ДНК, содержащего промотор гена wprA и мини-ген Е-пептида устойчивости к эритромицину, из конструкции 6 в конструкцию 2. Для этого проводится обработка ДНК обеих конструкций эндонуклеазами рестрикции XhoI и EcoRI, проводится препаративная очистка фрагмента конструкции 6 длиной 999 п.н. элюцией из агарозного геля, лигирование очищенного фрагмента с расщепленной и очищенной фенольной экстракцией плазмидной ДНК конструкции 2.

В составе конструкции (фиг.1 и фиг.2) можно выделить следующие элементы:

- экспрессионный вектор pQE30 (Qiagen);

- промотор гена WprA;

- мини-ген Е-пептида, обеспечивающий устойчивость бацилл к эритромицину;

- ген, кодирующий зрелый ген пептида GHRH_le;

- фрагмент полилинкера вектора рЕТ32 (Novagen).

2) Введение в геном В.subtilis AJ73 полученной конструкции. Конструкцию pWpr-le вводили в клетки штамма В.subtilis AJ73 (ВКПМ В-5036) методом химической трансформации по Спицайзену [11].

Бактериальную культуру выращивали в течение 14-18 часов в бульоне Леннокса (дрожжевой экстракт (Difco) 5 г/л, бактопептон (Difco) 10 г/л, NaCl 5 г/л) при 37°С. Культуру разводили в 20 раз средой SpI и подращивали в течение 4-5 часов. Затем ее разводили теплой (37°С) средой SpII в 10 раз и добавляли MgCl2 до 2,5 мМ. Культуру инкубировали при аэрации на 37°С еще 2 часа. Затем добавляли ДНК (1-2 мкг/мл в случае плазмидной ДНК), клетки инкубировали 1,5-2 часа при 37°С и высевали на сухие чашки с LB - агаром и эритромицином.

Селекцию колоний осуществляли по возникновению устойчивости к эритромицину в концентрации 15 мкг/мл.

В дальнейшем хранение рекомбинантных штаммов проводилось на чашках Петри с LB - агаром (дрожжевой экстракт (Difco) 5 г/л, бактопептон (Difco) 10 г/л, NaCl 5 г/л, бактоагар (Ferak) 12 г/л), содержащим эритромицин (15 мкг/мл) при +4°С, повторно пересевая 1 раз в месяц.

3) Выделение геномной ДНК из культуры клеток В.subtilis AJ73 и детекция трансгена с помощью ПЦР.

Для выделения геномной ДНК культуру клеток клеток В.subtilis AJ73 выращивали в 3 мл среды Леннокса в течение 16 часов при 37°С в условиях интенсивной аэрации. Клетки осаждали центрифугированием при 5000 об/мин. Выделение геномной ДНК из полученных клеток В.subtilis AJ73 проводили с использованием «Комплекта реагентов для выделения ДНК на сорбенте «S-сорб» («Синтол»). Расход реагентов при выделении геномной ДНК из 3 мл культуры соответствовал указанным в инструкции к набору. Полученную геномную ДНК растворяли в 40-50 мкл элюирующего раствора №6 (фиг.3).

Для детекции трансгена с помощью ПЦР были использованы следующие пары праймеров для получения ПЦР-продукта, включающего последовательность ДНК, соответствующую гену пептида GHRH-le - SLN_H1 - SLN_H2:

SLN_H1: GGGGATCCTATGCAGATGCCATCTTCAC

SLN_H2: GGGTCGACTATCCCTGCTGCCTGCTCATGA,

Размер ПЦР-продукта - 105 п.н.

ПЦР проводили с использованием четырехканального термоциклера ТП4-ПЦР-01-«Терцик» (ООО «НПО ДНК-Технология») в матричном режиме.

Температура отжига праймеров (Та) составляла +60°С.

Объем ПЦР-смеси составил 20 мкл, использована ДНК-полимераза Taq (Fermentas).

Электрофорез ПЦР-продуктов проводили в агарозном геле (3%), в буфере ТАЕ (трис (основание) - 40 мМ, ЭДТА - 1 мМ, уксусная кислота - 31 мМ) с использованием молекулярно-весового стандарта GeneRuler™ 50 bp DNA Ladder (MBI Fermentas, кат. № SM 0373) (размеры фрагментов: 50-1000 п.н.) (фиг.4).

Аутентичность продукта ПЦР в качестве фрагмента гена пептида GHRH_le может быть проконтролирована прямым секвенированием с использованием праймеров SLN-H1 или SLN-H2.

Список использованных источников

1. Bohlen P. Isolation and characterization of the porcine hypothalamic growth hormone releasing factor / Bohlen P., Esch F., Brazeau P., Ling N. and Guillemin R. // Biochem. Biophys. Res. Commun. - 1983. - V.116, N.2. - P.726-734.

2. Cravador A. Total DNA synthesis and cloning in Escherichia coli of a gene coding for the human growth hormone releasing factor / Cravador A., Jacobs P., Van Elsen A., Lacroix C., Colau В., Van Alphen P., Herzog A. and Bollen A. // Biochimie - 1985. - V.67. - N.7-8. - P.829-834.

3. Draghia-Akli R. High-efficiency growth hormone releasing hormone plasmid vector administration into skeletal muscle mediated by electroporation in pigs. / Draghia - Akli R, Elllis KM, Hill L-A, Malone PB, Fiorotto ML // FASEB J. - 2003. - 17. - P.526-528.

4. Hirose I. Proteome analysis of Bacillus subtilis extracellular proteins: a two-dimensional protein electrophoretic study / Hirose I., Sano K., Shioda I., Kumano M., Nakamura K. and Yamane К. // Microbiology. - 2000. - 14. - P.65-75.

5. Lee S.J. Enhancement of secretion and extracellular stability of staphylokinase in Bacillus subtilis by wprA gene disruption / Lee S.J., Kim D.M., Bae K.H, Byun S.M. and Chung J.H. // Appl. Environ. Microbiol. - 2000. - 66. - P.476-480.

6. Stephenson K. Influence of a cell wall associated protease on production of alpha-amylase by Bacillus subtilis / Stephenson K., Harwood C.R. // Appl. Environ. Microbiol. - 1998. - 64. P.2875-2881.

7. Stephenson K. The influence of protein folding on the late stages of the secretion of α-amylases from Bacillus subtilis / Stephenson K., Carter N.M., Harwood C.R., Petit Glatron M.F. and Chambert R. // FEBS Lett. - 1998. - 430. - P.385-389.

8. Tjalsma H. et al. Proteomics of Protein Secretion by Bacillus subtilis: Separating the "Secrets" of the Secretome / Microbiology and molecular biology reviews. - 2004. - Vol.68. - No.2. - P.207-233.

9. Margot, P. The wprA gene of Bacillus subtilis 168, expressed during exponential growth, encodes a cell-wall-associated protease / Margot, P., and D.Karamata. // Microbiology. - 1996. - 142. - P.3437-3444.

10. Белявская В.А., Сорокулова И.Б., Ромашова Н.Г., соавт. Штамм бактерий Bacillus licheniformis, обладающий антивирусной и антибактериальной активностью. - патент РФ.

11. Anagnostopoulos С.Requirements for transformation in Bacillus subtilis / Anagnostopoulos C., Spizizen J. // J. Bacteriol. - 1961. - V.81. - P.741-746.

Интегративная генетическая конструкция pWpr-le, предназначенная для введения в хромосому клетки Bacillus subtilis и родственных видов рода Bacillus гена релизинг фактора гормона роста человека/свиньи и последующей его экспрессии в указанных клетках, характеризующаяся нуклеотидной последовательностью, которая приведена на Фиг.2.



 

Похожие патенты:

Изобретение относится к биотехнологии, в частности к опухолеспецифичным промоторам, и может быть использовано в противоопухолевой терапии. Сконструированы опухолеспецифичные промоторы широкого спектра действия, обеспечивающие экспрессию терапевтического гена внутри раковой клетки.

Изобретение относится к области иммунологии и биотехнологии. Описаны гуманизированное антитело и его антигенсвязывающий фрагмент (Fab), которые селективно связывают человеческий ИФН-γ и содержат вариабельный участок тяжелой цепи (VH) и вариабельный участок легкой цепи (VL), где VH и VL имеют последовательности аминокислот соответственно SEQ ID NO:1 и 2, представленные в описании.

Изобретение относится к области биотехнологии или генной инженерии. Описана система модулирования экспрессии рекомбинантного гена, вектор экспрессии и клетка-хозяин.

Настоящее изобретение относится к области иммунологии. Предложены: антитело, связывающееся с интерлейкином-17 (ИЛ-17), характеризующееся 6 CDR из лёгкой и тяжёлой цепи, а также кодирующая нуклеиновая кислота и вектор для экспрессии указанного антитела.

Группа изобретений относится к биотехнологии. Предложена клетка мицелиального гриба Penicillium canescens со снятой катаболитной репрессией и арабинозной индукцией, продуцирующая ксиланазу и лакказу.

Настоящее изобретение относится к функциональным мутантам белка индуцируемой активацией цитидиндеаминазы (AID), которые обладают более высокой активностью по сравнению с белком AID дикого типа.

Настоящее изобретение относится к вирусологии и предполагает использование однодоменных мини-антител для профилактики и терапии гриппа. Заявлено однодоменное мини-антитело, специфически связывающееся с определенным эпитопом гемагглютинина вируса гриппа типа A (H5N2) и подавляющее инфекцию вируса гриппа типа A (H5N2).

Настоящее изобретение относится к области иммунологии. Предложен полипептид, содержащий два связывающих фрагмента, представленных антителами, причем первый из них связывается с эпитопом СD3ε(эпсилон)-цепи человека и примата, не являющегося шимпанзе, в частности Callithrix jacchus, Saguinus oedipus и Saimirí sciureus, а второй - с EGFR, Her2/neu или IgE человека и/или примата, не являющегося шимпанзе, причем упомянутый эпитоп СD3ε включает аминокислотную последовательность Gln-Asp-Gly-Asn-Glu.

Изобретение относится к биотехнологии, в частности к способу продуцирования происходящих из аспартата аминокислот с использованием рекомбинантного микроорганизма, обладающего по меньшей мере следующими свойствами по сравнению с исходным микроорганизмом: (a) увеличенной активностью глюкозо-6-фосфатдегидрогеназы, (b) увеличенной активностью фруктозо-1,6-бифосфатазы, (c) ослабленной активностью изоцитратдегидрогеназы, (d) увеличенной активностью диаминопимелатдегидрогеназы и (e) увеличенной активностью аспартаткиназы, где микроорганизм представляет собой Corynebacterium.

Изобретение относится к биотехнологии и генной инженерии и представляет собой рекомбинантный слитый белок формулы S-L-R, в том числе SR10, SR13, SR15, SdR10, SdR13 или SdR15, специфически узнающий меланомные клетки, в котором S - мономер стрептавидина, L - линкер, имеющий аминокислотную последовательность Ser-Arg-Asp-Asp-Asp-Asp-Lys, содержащую сайт расщепления энтеропептидазой и обозначаемую как «d», или аминокислотную последовательность Ser-Arg-Ala-Gly-Ala,R - меланома-адресующий олигопептид, представляющий собой R10, имеющий аминокислотную последовательность Asp-Gly-Ala-Arg-Tyr-Cys-Arg-Gly-Asp-Cys-Phe-Asp-Gly, или R13, имеющий аминокислотную последовательность Leu-Ser-Gly-Cys-Arg-Gly-Asp-Cys-Phe-Glu-Glu, или R15, имеющий аминокислотную последовательность Asp-Gly-Phe-Pro-Gly-Cys-Arg-Gly-Asp-Cys-Ser-Gln-Glu.

Изобретение относится к области биотехнологии, конкретно к способу получения субстанции рекомбинантного эритропоэтина и ее нанокапсулированной форме, и может быть использовано в медицине.

Изобретение относится к области иммунологии. Описаны антитела против VEGF, одно из которых содержит комплементарные регионы с аминокислотными последовательностями SEQ ID NO:1, 2, 3, 4, 6 и 7, другое содержит комплементарные регионы с аминокислотными последовательностями SEQ ID NO:1, 2, 3, 5, 6 и 7, раскрытыми в описании.

Изобретение относится к области биотехнологии, конкретно к агонистам рецептора РТН, и может быть использовано в медицине. Конструируют полипептид формулы PTH(1-X)/PTHrP(Y-36), где X обозначает целое число между 11 и 18 и Y=X+1, где PTH(1-X) представляет аминокислоты с 1 по X последовательности PTH человека (SEQ ID NO:5) и PTHrP(Y-36) представляет аминокислоты с Y по 36 последовательности PTHrP человека (SEQ ID NO:6).

Изобретение относится к области молекулярной биологии и генетики и может быть использовано в медицине. .

Изобретение относится к биотехнологии, конкретно к получению гормонов, и может быть использовано в разведении беспозвоночных. .

Изобретение относится к области генной инженерии и биотехнологии и может быть использовано в медицине и фармацевтической промышленности. .

Группа изобретений относится к области биотехнологии. Предложены синтетическая ДНК, кодирующая эритропоэтин человека, имеющая последовательность Seq ID No. 1, содержащий ее вектор экспрессии, способ получения штамма-продуцента эритропоэтина и штамм клеток яичников китайского хомячка - продуцент рекомбинантного эритропоэтина человека, депонированный под номером РККК(П) 761 Д. Изобретение позволяет повысить уровень экспрессии рекомбинантного эритропоэтина человека. 5 н.п. ф-лы, 1 табл., 8 ил., 4 пр.
Наверх