Пробиотическая композиция для применения в лечении воспаления кишечника



Пробиотическая композиция для применения в лечении воспаления кишечника
Пробиотическая композиция для применения в лечении воспаления кишечника
Пробиотическая композиция для применения в лечении воспаления кишечника
Пробиотическая композиция для применения в лечении воспаления кишечника
Пробиотическая композиция для применения в лечении воспаления кишечника
Пробиотическая композиция для применения в лечении воспаления кишечника
Пробиотическая композиция для применения в лечении воспаления кишечника
Пробиотическая композиция для применения в лечении воспаления кишечника
Пробиотическая композиция для применения в лечении воспаления кишечника
Пробиотическая композиция для применения в лечении воспаления кишечника
Пробиотическая композиция для применения в лечении воспаления кишечника

 


Владельцы патента RU 2563525:

АБ-БИОТИКС С.А. (ES)

Группа изобретений относится к биотехнологии. Предложены штаммы Lactobacillus plantarum CECT 7484, Lactobacillus plantarum CECT 7485 и Pediococcus acidilactici CECT 7483, проявляющие противовоспалительную активность, иммуномодулирующую активность, активность в отношении IBS или активность в отношении вздутия живота. Предложена также фармацевтическая композиция, содержащая эффективное количество по меньшей мере одного штамма, выбранного из указанных выше, а также фармацевтически приемлемые эксципиенты. Эффективное количество указанной композиции может быть использовано при профилактике или лечении воспаления кишечника, воспалительного заболевания кишечника (IBD), синдрома раздраженного кишечника (IBS), растяжения и вздутия живота у животного, включая человека. Группа изобретений позволяет значительно уменьшить вздутие и растяжение живота, снизить висцеральную чувствительность, снизить уровень IFNγ, улучшить качество жизни пациентов с желудочно-кишечными заболеваниями или состояниями. 6 н. и 13 з.п. ф-лы, 8 ил., 10 табл., 13 пр.

 

По данной заявке испрашивается приоритет по предварительной заявке на патент США № 61/299116 и европейской патентной заявке EP10151998, одновременно поданным 28 января 2010, и которые включены в настоящий документ в качестве ссылки.

Настоящее изобретение относится к областям медицины, микробиологии и питания и, в частности, к новой пробиотической композиции. В частности, новые штаммы Lactobacillus plantarum и Pediococcus acidilactici были выделены и объединены в препарат, применимый для лечения желудочно-кишечных заболеваний, таких как воспаление кишечника (например, воспалительное заболевание кишечника) и синдром раздраженного кишечника.

УРОВЕНЬ ТЕХНИКИ ИЗОБРЕТЕНИЯ

Язвенный колит (UC), паучит и болезнь Крона являются примерами воспалительных заболеваний кишечника (IBD), характеризующихся хроническим воспалением в кишечнике. Клиническими симптомами являются диарея, боль в животе, периодическое кровотечение из прямой кишки, потеря веса, утомляемость и в ряде случаев лихорадка. IBD, хотя встречается в любом возрасте, наиболее распространено у подростков и молодежи, которые, таким образом, могут страдать от отставания в развитии и задержки роста. Частота встречаемости заболевания схожа с частотой для диабета 1 типа в Европе и США. Течение болезни IBD значительно варьирует. Пациентов с симптомами от легкой до умеренной степени можно лечить без госпитализации. Однако 10-15% пациентов подвержены тяжелому течению болезни, которая во многих случаях сопровождается хирургическим вмешательством.

IBD лечат, с медицинской точки зрения, уменьшая воспаление и, в силу этого, борясь с желудочно-кишечными симптомами. Однако в настоящее время не существует никакого медицинского лечения IBD. Колэктомия может устранить UC, но снижает качество жизни и увеличивает риск возникновения осложнений. Доступное терапевтическое лечение включает в себя применение 5-аминосалициловой кислоты (5-ASA), кортикостероидов и иммуномодулирующих лекарственных препаратов. Продолжительное лечение от легких до умеренных симптомов IBD обычно проводят с использованием 5-ASA, в то время как кортикостероиды и иммуномодулирующие лекарственные препараты применяют для лечения тяжелых симптомов. Диарея или боль в животе проявляются как побочные эффекты 5-ASA, тогда как при долговременном использовании кортикостероидов часто появляются серьезные побочные эффекты, включающие в себя потерю костной массы, инфекции, диабет, мышечную атрофию и психиатрические нарушения.

Иммуномодулирующие лекарственные препараты подавляют иммунную систему, которая контролирует симптомы IBD. Однако, получающееся в результате состояние с ослабленным иммунитетом делает пациента восприимчивым к множеству заболеваний.

Синдром раздраженного кишечника (IBS) представляет собой состояние, характеризующееся болью в животе и/или дискомфортом, который ассоциирован с измененным ритмом опорожнения кишечника или дефекации, где симптомы не объясняются структурными или биохимическими отклонениями. Императивные позывы, вздутие живота и ощущение недостаточных опорожнений кишечника также распространены при IBS. Поэтому, данное заболевание классифицируют в числе функциональных нарушений со стороны желудочно-кишечного тракта, которые включают в себя такие заболевания, как функциональное вздутие живота, некардиальная боль в грудной клетке, неязвенная диспепсия и хронический запор или диарея (Longstreth G. H. et al., 2006). Примечательно, что IBS оказывает существенное влияние на заболеваемость и качество жизни, не говоря о боли в животе и дискомфорте, поскольку ассоциированные симптомы сказываются как на чувстве благополучия больного, так и на способности нормально функционировать (Dean B. B. et al., 2005).

Огромная активность имеет место в области разработки лекарственного средства для лечения IBS. В этом отношении завоевали популярность различные антидепрессанты, хотя эффективность их в клинических испытаниях была небольшой и их клиническое применение ограничено неблагоприятными побочными эффектами. Серотонергические средства продемонстрировали эффективность при общих симптомах IBS. Однако недавно возникшие опасения по поводу безопасности сильно ограничили их применение. Следовательно, разработка новых способов лечения IBS представляет очень большой интерес.

Пробиотики определяют как «живые микроорганизмы, которые при приеме в пищу в определенных количествах оказывают пользу для здоровья помимо изначального основного питания» (Araya M. et al., 2002; Guarner F. et al., 1998). Несколько молочнокислых бактерий и видов из рода Bifidobacterium являются пробиотиками, что обозначает, что они, как показано, обеспечивают специфическое воздействие на здоровье. Пробиотические бактерии должны соответствовать нескольким требованиям, касающихся отсутствия токсичности, жизнеспособности, адгезии и положительных воздействий. Такие пробиотические характеристики являются зависимыми от штамма, даже среди бактерий одного и того же вида. Следовательно, важно обнаружить такие штаммы, которые обладают лучшими качествами в отношении всех требований к пробиотикам. Были проведены клинические испытания на людях с использованием одних только пробиотиков или в сочетании с антибиотиками для того, чтобы определить штаммы и/или препараты для лечения пациентов с IBD или IBS, или для того, чтобы уже поддержать ремиссию у получающих лечение пациентов с IBD.

В WO 96/29083 и EP 554418 описаны два заселяющих кишечник штамма Lactobacillus, включающих в себя Lactobacillus plantarum 299v (DSM 6595) и Lactobacillus casei ssp. rhamnosus 271 (DSM 6594). В EP 415941 описаны способы получения питательной композиции, включающие обработку жидкой овсяной каши ферментами до смешивания с лактобациллами. В патенте США 7195906 описан штамм Bifidobacterium, выделенный из резецированного и промытого желудочно-кишечного тракта человека, для лечения воспалительных заболеваний, особенно, желудочно-кишечного воспалительного процесса, такого как IBD, и IBS.

Несмотря на многообещающий потенциал, требуется значительное усовершенствование воздействия пробиотиков для применения в лечении воспалительных заболеваний кишечника (таких как IBD), а также других желудочно-кишечных заболеваний (таких как IBS).

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Авторы настоящего изобретения обнаружили, что композиция, содержащая штаммы Lactobacillus и Pediococcus, эффективна при лечении воспалений кишечника. В частности, выделили три новых пробиотических штамма, принадлежащих роду Lactobacillus plantarum и роду Pediococcus acidilactici, причем указанные штаммы позволяют осуществлять эффективное лечение воспаления кишечника при объединении в виде одного препарата.

Таким образом, в первом аспекте настоящее изобретение относится к композиции, содержащей эффективное количество Lactobacillus plantarum CECT 7484, Lactobacillus plantarum CECT 7485 и Pediococcus acidilactici CECT 7483 или их мутантов или вариантов.

Штаммы Lactobacillus plantarum CECT 7485 и CECT 7484 и штамм Pediococcus acidilactici CECT 7483 депонировали в Испанской коллекции типовых культур (Валенсия, Испания) 04.02.2009. Все три депонированных штамма жизнеспособны и сохраняют все свои характеристики, связанные с их депонированием.

Термин «эффективное количество», как применяют в настоящем документе, обозначает количество активного вещества достаточно высокого для того, чтобы обеспечивать положительное воздействие, но достаточно низкого для того, чтобы избежать серьезных побочных эффектов в рамках медицинской оценки.

Ясно, что, используя депонированные штаммы в качестве исходного материала, специалист в данной области может обычным способом посредством общепринятых методик мутагенеза или повторного выделения получить дополнительные мутанты или их производные, в которых сохранены или усилены описанные в настоящем документе соответствующие характеристики и преимущества штаммов, составляющих композицию по изобретению. Специалист в данной области примет решение о подходящем способе, который необходимо применить для определения противовоспалительной, иммуномодулирующей активности штаммов либо в отношении IBS, либо в отношении вздутия живота. Примеры возможных способов для определения такой активности показаны ниже в примерах.

В одном из вариантов осуществления мутант представляет собой генетически модифицированный мутант.

В другом варианте осуществления первого аспекта по изобретению вариант представляет собой встречающийся в природе вариант.

Штаммы, составляющие часть композиции по первому аспекту изобретения, могут находиться в виде жизнеспособных клеток. Альтернативно, штамм может находиться в виде нежизнеспособных клеток.

Основное применение штаммов P. acidilactici CECT 7483, а также L. plantarum CECT 7484 и CECT 7485 имеет место в виде жизнеспособных клеток. Тем не менее, применение можно также расширить на нежизнеспособные клетки, такие как инактивированные культуры или композиции, содержащие полезные факторы, продуцируемые P. acidilactici CECT 7483, а также L. plantarum CECT 7484 и CECT 7485. Они могут включать в себя термоинактивированные микроорганизмы или микроорганизмы, инактивированные под воздействием измененной величины pH, ультразвука, радиации или при применении давления. С нежизнеспособными клетками получение продукта является более простым, клетки можно легко вводить в состав фармацевтических препаратов, и требования к их хранению намного менее ограничены, чем для жизнеспособных клеток.

При применении в виде композиции по изобретению штаммы находятся, предпочтительно, в соотношении концентраций 1:1:1.

Штаммы CECT 7483, CECT 7484 и CECT 7485 проявляют значительную ингибиторную активность в отношении нескольких патогенных и потенциально патогенных бактериальных штаммов, в тоже время, проявляя минимальный антагонизм в отношении общеизвестных условно-патогенных штаммов желудочно-кишечной флоры человека. Кроме того, данные три штамма демонстрируют отсутствие значительной ингибиторной активности между ними, таким образом, позволяя осуществлять их совместное применение в одном препарате. Это является уместным, поскольку означает, что композиция, как определено в первом аспекте по изобретению, проявляет положительное воздействие в кишечнике вследствие «интактного» действия каждого из трех штаммов. Объединение данных штаммов в один препарат (то есть, в композицию по изобретению) демонстрирует способность смягчить клинические симптомы (такие как потеря веса и диарея) в различных моделях воспаления кишечника у животных. В соответствии с данными результатами, композиция по изобретению демонстрирует уникальную способность значительно снижать цитокины острой (IL-6) и хронической (IFNγ) фазы.

Большое количество видов молочнокислых бактерий обладает продолжительным опытом бесспорного безопасного применения. Европейское ведомство по безопасности пищевых продуктов разработало систему, предоставляющую статус «квалифицированной презумпции безопасности» (QPS) таксономическим единицам с подтвержденным продолжительным опытом бесспорного безопасного применения. Штаммы CECT 7483, CECT 7484 и CECT 7485 принадлежат к бактериальным видам, которые обладают статусом QPS (Andreoletti O. et al., 2008).

Штаммы по настоящему изобретению обладают преимуществом, что они особенно пригодны в качестве пробиотиков. Как указано выше, пробиотические бактерии должны соответствовать нескольким требованиям, касающимся отсутствия токсичности, жизнеспособности, адгезии и положительного воздействия. Такие пробиотические характеристики являются зависимыми от штамма, даже среди бактерий одного и того же вида. Следовательно, важно обнаружить такие штаммы, которые обладают лучшими качествами в отношении всех требований к пробиотикам. В примерах, приведенных ниже, представлены (в качестве примера) протоколы для определения каждой из пробиотических характеристик и также продемонстрировано, что указанные штаммы обладают превосходными пробиотическими характеристиками.

Появление и распространение устойчивости к антибактериальным препаратам у бактерий ставят под угрозу здоровье человека и животных и представляют крупные финансовые и социальные затраты. Когда устойчивость к антибактериальному препарату у бактериального вида является врожденной, ее, как правило, обозначают как «первичная устойчивость» (иногда называемая «естественная устойчивость»). Первичная устойчивость, как предполагают, представляет собой минимальный потенциал для горизонтального распространения, тогда как приобретенную устойчивость, опосредованную дополнительными генами, рассматривают как обладающую большим потенциалом для широкого распространения. Авторы настоящего изобретения обнаружили, что штаммы, составляющие композицию по изобретению, не проявляют никакой значительной устойчивости к антибиотикам человеческой и/или ветеринарной значимости (ампициллину, гентамицину, стрептомицину, эритромицину, тетрациклину, клиндамицину и хлорамфениколу) согласно нормативам Европейского ведомства по безопасности пищевых продуктов (Anadon A. et al., 2005; Bories G. et al., 2008), таким образом устраняя риск возможной передачи патогенному виду устойчивости к антибиотику.

Дополнительно, авторы настоящего изобретения обнаружили, что штаммы CECT 7483, CECT 7484 и CECT 7485 можно вводить совместно с другими лекарственными препаратами, применяемыми для лечения IBD (такими как месалазин). Как показано ниже, рост указанных штаммов полностью не ингибировался даже при использовании насыщенных концентраций месалазина. Другими словами, даже при применении высоких концентраций месалазина эффективность композиции по изобретению, содержащей пробиотические штаммы, не снижалась и, следовательно, она может проявлять как пробиотические, так и противовоспалительные функции.

Штаммы по изобретению, как продемонстрировали, высоко устойчивы к условиям желудочно-кишечной среды у млекопитающих (кислая среда, соли желчных кислот и высокое содержание лизоцима и концентрации перекиси кислорода), таким образом, являясь способными выдерживать прохождение через желудочно-кишечный тракт (в дальнейшем также обозначаемый как «ЖКТ»). Штаммы также обладают хорошей адгезией к кишечному эпителию, которая позволяет им оставаться в кишечнике и проявлять их пробиотические воздействия.

Дополнительно, данные штаммы обладают несколькими положительными воздействиями на хозяина. В дополнение к противовоспалительной активности в кишечнике, они оказывают положительное воздействие на баланс микрофлоры кишечника вследствие их антагонистической активности. Термин «антагонистическая активность» относится к ингибированию роста желудочно-кишечных неполезных бактерий посредством активности пробиотических бактерий. Состояние при наличии несоответствующего желудочно-кишечного баланса микрофлоры известно как дисбиоз и имеет множество негативных последствий для здоровья человека. Ниже будет показано, что штаммы обладают большой способностью ингибировать рост патогенных штаммов, когда их сравнивают с другими коммерческими штаммами. Дополнительно, как указано выше, авторы изобретения обнаружили, что новые штаммы по изобретению не проявляют значительной ингибиторной активности среди друг друга.

Дополнительно, было обнаружено, что штаммы, составляющие композицию по первому аспекту изобретения, продуцируют большие количества короткоцепочечных жирных кислот (SCFA). Продукция SCFA из неперевариваемой клетчатки является интересной особенностью пробиотика. Данная особенность желательна у пробиотика, поскольку продуцируемая SCFA проявляет несколько благоприятных свойств для хозяина. Среди их различных свойств, SCFA, особенно масляная кислота, с легкостью всасываются слизистой оболочкой кишечника, стимулируют всасывание натрия и воды в толстой кишке, и являются тропными к слизистой оболочке кишечника (D'Argenio G. et al., 1999; Tedelind S. et al., 2007). Кроме того, масляная кислота используется колоноцитами в качестве топлива. Каждый штамм в препарате является строгим продуцентом различной SCFA, или уксусной, или пропионовой, или масляной, которые представляют собой три основные SCFA, обнаруженные в кишечнике. Лучшее понимание того, как короткоцепочечные жирные кислоты действуют при воспалительном процессе, может способствовать усовершенствованию эффективности современного лечения воспаления кишечника. В этом отношении, было доложено о взаимосвязи между SCFA и регуляцией воспалительных состояний через сопряженные с G-белком рецепторы (Maslowski K. M. et al., 2009).

Кроме того, штаммы CECT 7483, CECT 7484 и CECT 7485 стимулируют иммуномодулирующие эффекты у хозяина, поскольку они вызывают появление нормализованного цитокинового паттерна в слизистой оболочке кишечника. Такие иммуномодулирующие эффекты являются благоприятными для хозяина, поскольку они помогают достичь повышенной сопротивляемости к заболеванию и сниженного риска возникновения аллергий. Известно, что грамотрицательные бактерии в ЖКТ экспонируют молекулу липополисахарида (LPS) на их поверхности, которые индуцируют продукцию провоспалительных сигналов клетками слизистой оболочки кишечника. Пробиотическая добавка может изменить данную ситуацию, чтобы способствовать еще большему присутствию грамположительных бактерий в ЖКТ (объединенных в группу молочнокислых бактерий) с лучшей экологической приспособляемостью или с антагонистическими свойствами в отношении некоторых грамотрицательных микроорганизмов. Несмотря на это, некоторые пробиотические микроорганизмы демонстрируют способность модулировать per se продукцию цитокинов, которые являются сигнализирующими молекулами, которые регулируют воспаление и иммунные реакции в организме. В частности, некоторые пробиотические бактерии индуцируют появление более сбалансированного паттерна между про/антивоспалительной передачей сигналов в слизистой оболочке кишечника (независимо от влияния на грамотрицательные бактерии). Как будет проиллюстрировано ниже, было обнаружено, что штаммы композиции по изобретению способствуют снижению уровней воспалительных цитокинов (IFN-γ и IL-6), таким образом, индуцируя появление нормализованного паттерна цитокинов в слизистой оболочке кишечника. Такой иммуномодулирующий эффект дополнен антагонистическими свойствами штамма в отношении снижения присутствия патогенных грамотрицательных бактерий в ЖКТ.

Известно, что нежизнеспособные бактерии, так же как бактериальные компоненты могут обладать иммуномодулирующими эффектами per se. Например, клеточные компоненты вида Lactobacilli, как сообщили, индуцировали противовоспалительные цитокины (Pathmakanthan S. et al., 2004) или снижали провоспалительные цитокины (Zhang L. et al., 2005). При выделении таких компонентов предполагается операция фармацевтической категории.

Принимая во внимание показанные ниже результаты, ясно, что штаммы CECT 7483, CECT 7484 и CECT 7485, составляющие композицию по первому аспекту изобретения, характеризуются определенными особенностями, такими как: выживание при прохождении в желудочно-кишечном тракте, адгезия к слизистой оболочке кишечника, устойчивость к окислительному стрессу, продукция метаболитов с противовоспалительной активностью (или короткоцепочечных жирных кислот, или других продуктов с указанной активностью) и отсутствие антагонизма между ними. Композиция и выделенные штаммы по настоящему изобретению, очевидно, не происходят из известного уровня техники, поскольку они являются результатом комплексного исследования, и результаты, которые были получены в отношении действия на воспаление кишечника, являются неожиданными. Протоколы определения каждой из указанных особенностей приведены ниже. Из содержания настоящей заявки специалист в данной области может обнаружить другие штаммы, принадлежащие Lactobacillus и роду Pediococcus, и, более конкретно, к виду Lactobacillus plantarum и Pediococcus acidilactici, которые при введении отдельно или совместно в одной композиции проявляют такие же пробиотические и терапевтические эффекты, что и штаммы, описываемые в настоящей заявке.

Во втором аспекте, изобретение относится к композиции, содержащей эффективное количество штаммов по изобретению или их мутантных штаммов для применения в качестве лекарственного препарата.

В частности, было обнаружено, что композиция, содержащая штаммы CECT 7483, CECT 7484 и CECT 7485 обладает противовоспалительной активностью в кишечнике в моделях IBD. Как объяснялось выше, воспаление кишечника представляет собой одну из основных характеристик IBD. Таким образом, композиция по первому аспекту изобретения применима для профилактики или лечения указанного заболевания.

Следовательно, в третьем аспекте, изобретение относится к композиции, как определено в первом аспекте изобретения, для применения в профилактике или лечении воспаления кишечника у животного, включая человека. Данный аспект можно альтернативно сформулировать как применение композиции, как определено в первом аспекте изобретения, для получения лекарственного препарата для профилактики лечения воспаления кишечника. Данный аспект можно альтернативно сформулировать как способ профилактики и/или лечения воспаления кишечника у животного, включая человека, включающий введение указанному животному при необходимости эффективного количества композиции, как определено в первом аспекте изобретения.

В одном из вариантов осуществления третьего аспекта по изобретению, композицию применяют для лечения или профилактики воспалительного заболевания кишечника.

Из данных, полученных при использовании моделей IBD, описанных в примерах (смотри ниже), получается, что введение штаммов по изобретению, которые эффективны при лечении состояний, характеризующихся воспалением кишечника и диареей, также может быть применимо для лечения других состояний, характеризующихся воспалением слизистой оболочки или подслизистой оболочки кишечника и где преобладающей является диарея, таких как энтерит, вызванный лучевой терапией или химиотерапией. Энтерит является распространенным побочным эффектом при лучевой терапии брюшной полости и таза, поражая 60-70% пациентов. Энтерит может вынудить изменить график в режиме лучевой терапии для уменьшения побочных эффектов, потенциально приводя к недостаточно оптимальной противоопухолевой эффективности лечения. В настоящий момент не существует превентивных стратегий вызванного лучевой терапией энтерита. Однако, некоторые пробиотики, как было показано, являются весьма перспективными в рандомизированных клинических испытаниях (RCT). Пробиотическая композиция, такая как по настоящему изобретению, сочетающая способствующие укреплению здоровья эффекты продукции SCFA, способность противостоять активным формам кислорода и азота, обнаруженным в воспаленной слизистой оболочке, и противомикробную активность в отношении условно-патогенных микроорганизмов, может быть применима для лечения вызванного лучевой терапией и химиотерапией энтерита.

С другой стороны, авторы настоящего изобретения обнаружили, что штаммы по настоящему изобретению эффективны в лечении IBS. Как показано ниже, композиция по первому аспекту изобретения применима для лечения IBS, как оценено в рандомизированном двойном слепом контролируемом плацебо интервенционном исследовании.

Следовательно, в четвертом аспекте настоящее изобретение относится к композиции по первому аспекту изобретения для применения в профилактике и/или лечении IBS. Данный аспект можно альтернативно сформулировать как применение композиции, как определено в первом аспекте изобретения, для получения лекарственного препарата для профилактики и/или лечения IBS. Данный аспект можно альтернативно сформулировать как способ профилактики и/или лечения IBS у животного, включая человека, включающий введение указанному животному, нуждающемуся в этом, эффективного количества композиции, как определено в первом аспекте изобретения.

Кроме того, авторы настоящего изобретения обнаружили, что благодаря характеристикам штаммов композиция по первому аспекту изобретения применима для лечения вздутия и растяжения живота. Как показано ниже, когда композицию по изобретению вводят людям, страдающим от вздутия и растяжения живота, наблюдают неожиданное улучшение.

Следовательно, в пятом аспекте настоящее изобретение относится к композиции по первому аспекту изобретения для применения в лечении вздутия и растяжения живота. Данный аспект можно альтернативно сформулировать как применение композиции, как определено в первом аспекте изобретения, для получения лекарственного препарата для лечения вздутия и растяжения живота. Данный аспект можно альтернативно сформулировать как способ лечения вздутия и растяжения живота у животного, включая человека, включающий введение указанному нуждающемуся в этом животному эффективного количества композиции, как определено в первом аспекте изобретения.

Неожиданное положительное воздействие, наблюдаемое у людей, страдающих IBS и/или от вздутия и растяжения живота, может являться следствием факта, что штаммы по изобретению CECT 7483, CECT 7484 и CECT 7485 обладают способностью продуцировать SCFA, перечисленные в таблице 6, и антагонистической активностью, показанной в таблице 3.

На существующем уровне техники хорошо известно, что SCFA модулируют перистальтику кишечника. В частности, SCFA, как известно, стимулируют высвобождение серотонина (5-HT) в толстой кишке крысы (Fukumoto S. et al., 2003; Tazoe H. et al., 2008), который играет основную роль в регуляции как перистальтики, так и чувствительности кишечника. Схожим образом, масляная кислота, как было описано, снижает висцеральную чувствительность кишечника у людей-добровольцев (Vanhoutvin S. A. et al., 2009). Из этого можно заключить, что штаммы, составляющие композицию по изобретению, можно применять для лечения не только IBS или боли в животе, но также других состояний, связанных с желудочно-кишечной перистальтикой и/или желудочно-кишечной болью, таких как функциональный запор или функциональная диарея.

Композиция и выделенные штаммы по настоящему изобретению, очевидно, не происходят из известного уровня техники, поскольку они являются результатом комплексного исследования, и результаты, которые были получены в отношении эффективности при лечении IBS и вздутия и растяжения живота являются неожиданными.

К удивлению, авторы настоящего изобретения впервые обнаружили штамм Pediococcus acidilactici со способностью лечения IBD и IBS. Указанная способность, как полагают, не будучи связанной с теорией, является следствием определенных свойств выделенного штамма Pediococcus, на которые указывается на всем протяжении описания. В свете идей и протоколов, предлагаемых в настоящем описании, специалист в данной области сможет обнаружить дополнительные штаммы P. acidilactici с такими же пробиотическими и терапевтическими характеристиками, что и объект настоящей заявки.

Композиции по изобретению, которые содержат эффективное количество штаммов по изобретению или их мутантов, можно приготовить как пригодные к употреблению в пищу, фармацевтические или ветеринарные продукты, в которых указанные штаммы представляют собой единственные активные вещества или которые смешаны с одним или несколькими другими активными веществами и/или смешаны с фармацевтически приемлемыми или приемлемыми в ветеринарной практике наполнителями (в случае фармацевтического или ветеринарного продукта) или подходящими добавками (в случае пригодного к употреблению в пищу продукта). В конкретном варианте осуществления изобретения продукты дополнительно содержат одно или несколько дополнительных активных веществ. Предпочтительно, дополнительное активное вещество или вещества представляют собой другие пробиотические бактерии, которые не являются антагонистичными штаммам, составляющим композицию по изобретению. В зависимости от препарата штаммы можно добавлять как очищенные бактерии, как бактериальную культуру, как часть бактериальной культуры, как бактериальную культуру, которая подвергалась обработке, и как таковые или совместно с подходящими носителями или ингредиентами. Также можно добавлять пребиотики.

В других аспектах изобретение относится к фармацевтическим и ветеринарным продуктам, которые содержат эффективное количество композиции по изобретению совместно с соответствующим количеством фармацевтически приемлемых или приемлемых в ветеринарной практике наполнителей. В этом отношении, фармацевтический препарат можно получать в любом подходящем виде, который не влияет негативно на биодоступность штаммов, составляющих композицию по изобретению. Таким образом, композицию по изобретению, которую будут вводить перорально, можно приготовить, например, в виде лиофилизированного порошка, капсул, жидких препаратов и так далее. Выбор наполнителей и наиболее подходящих способов для препарата, принимая во внимание конкретную цель композиции, находится в рамках компетенции обычных специалистов в данной области фармацевтической технологии. Хотя пероральное введение является предпочтительным, возможны другие формы, такие как инъекционные, ректальные или местные.

Термин «фармацевтически приемлемый» как применяют в настоящем документе относится к соединениям, веществам, композициям и/или лекарственным формам, которые в рамках тщательной медицинской оценки, пригодны для использования в контакте с тканями пациента (например, человека) без избыточной токсичности, раздражения, аллергической реакции или другой проблемы или осложнения, в соответствии с целесообразным соотношением благоприятное воздействие/риск. Каждый носитель, наполнитель и так далее также должен быть «приемлемым» в смысле того, чтобы быть совместимым с другими ингредиентами препарата.

Подходящие носители, наполнители и так далее можно найти в стандартных фармацевтических руководствах. Аналогично, термин «приемлемый в ветеринарной практике» означает пригодный для использования в контакте с тканями не принадлежащего человеку животного.

Штаммы по изобретению могут также входить в состав различных продуктов питания, таких как молочные продукты, йогурт, творог, сыр (например, кварк, сливочный, плавленый, мягкий и твердый), сквашенное молоко, сухое молоко, продукт на основе сквашенного молока, мороженое, продукт на основе сбродившей злаковой культуры, порошок на основе молока, напиток, соус и корм для животных. Термин «продукт питания» применяется в настоящем документе в своем самом широком значении, включающем любой тип продукта, в любом виде представления, который может проглотить животное, но, исключая фармацевтические и ветеринарные продукты. Примеры других продуктов питания представляют собой мясные продукты (например, паштет из печени, сосиски и колбаса типа салями или мясная паста), шоколадную пасту, начинки (например, трюфель, сливки) и глазури, шоколад, кондитерские изделия (например, карамель, помадки или ириска), хлебобулочные изделия (пироги, печенья), соусы и супы, фруктовые соки и сливки для кофе. Особенно интересные пищевые продукты представляют собой диетические добавки и детские смеси. В смысле настоящего изобретения диетические добавки также включают в себя нутрицевтики, которые, как известно, являются экстрактами продуктов питания, которые обладают медицинским эффектом на здоровье человека. Корма для питания животных также включены в объем изобретения. Композиции по изобретению можно также использовать в качестве ингредиента в других пищевых продуктах.

Соответственно, в другом аспекте по изобретению, описан продукт питания, который содержит композицию по изобретению совместно с подходящими количествами пригодных к употреблению в пищу ингредиентов. Предпочтительно, композиция по изобретению представляет собой диетическую добавку.

Эффективное количество колониеобразующих единиц (КОЕ) для каждого штамма в композиции будет определяться специалистом в данной области и будет зависеть от готового препарата. Например, в продуктах питания штамм или штаммы присутствуют в количестве приблизительно от 105 КОЕ/г до приблизительно 1012 КОЕ/г, предпочтительно, в количестве приблизительно от 107 КОЕ/г до приблизительно 1012 КОЕ/г, согласно действующему законодательству. Термин «колониеобразующие единицы» («КОЕ») определяется как количество бактериальных клеток, как выявляется при микробиологическом подсчете на чашке с агаровой средой.

Диетические добавки обычно содержат пробиотические штаммы в количестве в диапазоне от 107 и 1012 КОЕ/г. В конкретном варианте осуществления композиция по изобретению представляет собой диетическую добавку, содержащую в диапазоне 109-1011 КОЕ/г.

Штаммы по изобретению получают культивированием бактерий в подходящей среде и при подходящих условиях. Штаммы можно культивировать отдельно для получения чистой культуры или как смешанную культуру совместно с другими микроорганизмами или, культивируя бактерии различных типов раздельно и затем объединяя их в необходимых соотношениях. После культивирования клеточную суспензию отбирают и используют как таковую или обрабатывают желаемым образом, например, концентрируя или лиофилизируя, чтобы далее применять в приготовлении фармацевтических продуктов или продуктов питания. Иногда пробиотические препараты подвергают способу иммобилизирования или инкапсулирования для того, чтобы увеличить срок годности. Несколько методик для иммобилизирования или инкапсулирования бактерий известны в данной области.

Если композицию по изобретению применяют в качестве диетической добавки, ее можно вводить как таковую, можно смешивать с подходящей пригодной для питья жидкостью, такой как вода, йогурт, молоко или фруктовый сок, или можно смешивать с твердой или жидкой пищей. В данном контексте диетическая добавка может находиться в виде таблеток, драже, капсул, гранул, порошков, суспензий, саше, пастилок, конфет, пластинок, сиропов и соответствующих форм введения, обычно в виде однократной дозы. Предпочтительно, композицию по изобретению вводят в виде таблеток, капсул или порошков, полученных общепринятыми способами получения фармацевтических препаратов.

На всем протяжении описания и формулы изобретения слово «содержать» и его варианты не предназначены для того, чтобы исключить другие технические характеристики, добавки, компоненты или стадии. Дополнительные объекты, преимущества и особенности изобретения станут очевидными для специалистов в данной области при изучении описания или их можно узнать при практическом применении изобретения. Кроме того, настоящее изобретение охватывает все возможные комбинации особенных и предпочтительных вариантов осуществления, описываемых в настоящем документе.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фиг.1 представлены паттерны расщепленной Not-I или Sfi-I (слева) и Sma-I (справа) геномной ДНК при гель-электрофорезе в пульсирующем поле для: 1, Pediococcus acidilactici CECT 7483; 2, Lactobacillus plantarum CECT 7484; 3, Lactobacillus plantarum CECT 7485. В качестве контроля: 4, коммерческий штамм P. acidilactici Rossell1001 (Institut Rossell, Канада); 5, L. plantarum 299v (Probi AB, Швеция); и 6, штамм L. plantarum, выделенный из коммерческого продукта VSL#3 (VSL Pharmaceuticals, США). Данная фигура относится к разделу «генотипирование штамма».

На фиг.2 представлен индекс активности болезни (Y-ось) в группе мышей, страдающих от вызванного DSS воспаления кишечника. На X-оси представлено введение: a, пробиотического препарата по изобретению в группе мышей, страдающих от вызванного DSS воспаления кишечника; b, коммерческого пробиотического препарата (VSL#3) в группе мышей, страдающих от вызванного DSS воспаления кишечника; c, носителя в группе мышей, страдающих от вызванного DSS воспаления кишечника; и d, носителя в здоровой контрольной группе. Данная фигура относится к разделу «Воздействие in vivo на химически вызванное воспаление кишечника».

На фиг.3 представлены уровни IL-6 (Y-ось) в группе мышей, страдающих от вызванного DSS воспаления кишечника. По X-оси представлены: a, пробиотический препарат по изобретению, вводимый группе мышей, страдающих от вызванного DSS воспаления кишечника; b, коммерческий пробиотический препарат (VSL#3), вводимый группе мышей, страдающих от вызванного DSS воспаления кишечника; c, носитель, вводимый группе мышей, страдающих от вызванного DSS воспаления кишечника; и d, носитель в здоровой контрольной группе. Данная фигура относится к разделу «Воздействие in vivo на химически вызванное воспаление кишечника».

На фиг.4 представлено количество бессимптомных недель (то есть, количество недель до появления первого симптома, таким образом, при индексе активности болезни равным нулю) (Y-ось) в модели мыши, нокаутированной по гену IL-10. На X-оси представлено введение: a, пробиотического препарата по изобретению группе мышей, нокаутированных по гену IL-10; b, коммерческого пробиотического препарата VSL#3 группе мышей, нокаутированных по гену IL-10; c, PBS группе мышей, нокаутированных по гену IL-10; и d, носителя в здоровой контрольной группе. Данная фигура относится к разделу «Воздействие in vivo на спонтанное воспаление кишечника».

На фиг.5 представлены уровни IFN-γ (Y-ось) в модели мышей, нокаутированных по гену IL-10. На X-оси представлен: a, пробиотический препарат по изобретению в группе мышей, нокаутированных по гену IL-10; b, коммерческий пробиотический препарат VSL#3 в группе мышей, нокаутированных по гену IL-10; c, носитель в группе мышей, нокаутированных по гену IL-10; и d, носитель в здоровой контрольной группе. Данная фигура относится к разделу «Воздействие in vivo на химически вызванное воспаление кишечника».

На фиг.6 представлены уровни IL-6 (Y-ось) в модели мышей, нокаутированных по гену IL-10. На X-оси представлен: a, пробиотический препарат по изобретению в группе мышей, нокаутированных по гену IL-10; b, коммерческий пробиотический препарат VSL#3 в группе мышей, нокаутированных по гену IL-10; c, носитель в группе мышей, нокаутированных по гену IL-10; и d, носитель в здоровой контрольной группе. Данная фигура относится к разделу «Воздействие in vivo на химически вызванное воспаление кишечника».

На фиг.7 представлено изменение оценки IBSQoL по сравнению с исходным уровнем (Y-ось) у добровольцев, получавших капсулы, содержащие композицию (черный прямоугольник) или плацебо (белый прямоугольник). На X-оси представлено изменение оценки на 21 день и через 42 дня лечения. Данная фигура относится к части «Улучшение связанного с состоянием здоровья качества жизни» в разделе «Эффективность in vivo у пациентов с IBS».

На фиг.8 представлено изменение оценки VSI по сравнению с исходным уровнем (Y-ось) у добровольцев, получавших капсулы, содержащие композицию (черный прямоугольник) или плацебо (белый прямоугольник). На X-оси представлено изменение оценки после трех недель и после шести недель лечения. Данная фигура относится к части «Улучшение висцеральной чувствительности» в разделе «Эффективность in vivo у пациентов с IBS».

ПРИМЕРЫ

В следующих ниже разделах описаны характеристики штаммов по изобретению, их специфические пробиотические особенности и их физиологические воздействия на желудочно-кишечную и иммунную системы. Как применяют в дальнейшем, штамм F1033 соответствует CETC 7483 Pediococcus acidilactici, штамм F2064 соответствует CECT 7484 Lactobacillus plantarum и штамм F2076 соответствует CECT 7485 Lactobacillus plantarum.

1. Выделение микроорганизмов

A) Способы

Для выделения микроорганизмов собирали свежий стул и слюну (Daniel C. et al., 2006) у детей в возрасте 0-5 лет и растворяли в буфере PBS (pH 7,4), делили на аликвоты и помещали в MRS, дополненную различными комбинациями антибиотиков. Штаммы культивировали в условиях, благоприятных для микроаэрофилов (5% CO2) при 37°C. Время инкубации зависело от скорости роста, но нормально проходило от 24 ч до 3 дней. Окрашивание по Граму проводили для того, чтобы получить первую идентификацию. Как только они вырастали, выделенные штаммы хранили при лиофилизации в PBS 0,1Х с 15% сухим обезжиренным молоком.

B) Результаты

Новые штаммы F2064, F2076 и F1033 выращивали на агаре MRS, дополненном ванкомицином в количестве 10 г/мл. Микроскопическое исследование показало, что штаммы F2064 и F2076 являются грамположительными бациллами, в то время как штамм F1033 является грамположительным с морфологией, свойственной кокковым микроорганизмам.

2. Идентификация

A) Способы

Геномную ДНК извлекали, используя набор для очистки геномной ДНК Wizard (Promega). Для каждого выделяемого штамма ген 16S амплифицировали при помощи ПЦР, применяя универсальные праймеры 27f, 357f, 907r и 1492r (Weisburg W.G. et al., 1991 ), которые позволяют получить почти полноразмерный фрагмент рРНК 16S (1465 п.н.). ДНК отмывали, используя набор Quiaquick kit (Quiagene, GmbH, Хильден, Германия) и четыре реакции секвенирования на образец проводили, используя набор BigDye v.3.1, на анализаторе Genetic Analyzer 3130 (Applied Biosystems). Программное обеспечение для выбранных праймеров для секвенирования DNA Sequence Analysis v.5.2 (Applied Biosystems) применяли для сбора данных и построения хроматограмм, которые анализировали посредством программного обеспечения Chromas (Technelysium Pty Ltd.) и BioEdit (Ibis Biosciencies). Идентификацию рода и вида проводили, сравнивая полученную последовательность с последовательностями 16S известных организмов как из базы данных RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq/) посредством поиска BLASTN (Altschul S.F. et al., 1990), так и из Ribosomal Database Project (Wang Q. et al., 2007).

Таблица 1
Праймеры, использованные для амплификации и секвенирования гена 16S
Стадия Праймер Направление Последовательность 5'→3'
Амплификация 27f прямой AGAGTTTGATCCTGGCTCAG (SEQ ID NO:1)
1492r обратный GGTTACCTTGTTACGACTT (SEQ ID NO:2)
Секвенирование 27f прямой AGAGTTTGATCCTGGCTCAG (SEQ ID NO:1)
357f прямой CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCCCTACGGGAGGCAGCAG (SEQ ID NO:3)
907r обратный CCGTCAATTCCTTTGAGTTT (SEQ ID NO:4)
1492r обратный GGTTACCTTGTTACGACTT (SEQ ID NO:2)

B) Результаты

Штаммы F2064 и F2076 идентифицировали в качестве представителей группы Lactobacillus plantarum. Штамм F1033 идентифицировали как Pediococcus acidilactici.

3. Выживаемость в ЖК тракте

A) Способы

Для того чтобы оценить устойчивость к кислой среде, аликвоты по 20 мкл культуры каждого бактериального штамма помещали в 96-луночные планшеты вместе с аликвотами по 200 мкл среды MRS, доведенной при помощи HCl до величины pH 2 и 3 (Panreac). Планшеты держали при 37°C в течение 1 ч и измеряли оптическую плотность при 620 нм. В конце, жизнеспособные клетки определяли, подсчитывая микроорганизмы на чашках и сравнивая с количеством жизнеспособных клеток в инокуляте.

Для того чтобы оценить устойчивость к солям желчных кислот, аликвоты по 20 мкл культуры каждого бактериального штамма помещали в 96-луночный планшет вместе с аликвотами по 200 мкл среды MRS, дополненной 0,5% Oxgall (Sigma). Планшеты инкубировали при 37°C и 5% CO2 в течение 3 часов и затем измеряли оптическую плотность. В конце, жизнеспособные клетки определяли, подсчитывая микроорганизмы на чашках и сравнивая с количеством жизнеспособных клеток в инокуляте.

B) Результаты

Все три штамма показали хорошую способность выживать в кислой среде при снижении менее чем на единицу по логарифмической шкале через 1 ч инкубации в MRS при величине pH=2 или pH=3. Штаммы также обладали выраженной устойчивостью к солям желчных кислот при снижении числа жизнеспособных клеток менее чем на 50% через 3 ч инкубации в MRS, дополненной 0,5% солями желчных кислот.

4. Адгезия

A) Способы

Свиной кишечник промывали PBS с величиной pH 7,4, содержащим 0,01% желатин и смесь ингибиторов протеаз (Complete®, Sigma). Слизистую оболочку разрезали на мелкие куски и растворяли в буфере HEPES-Hank (10 мМ HEPES, pH 7,4) (Collado M. et al., 2007), содержащем указанные выше ингибиторы. Затем, слизь центрифугировали при 13000 об./мин. в течение 10 мин, используя тот же самый буфер. Надосадочные жидкости извлекали и определяли содержание белка по протоколу Брэдфорда. За 24 ч до анализа 1 мл раствора слизи в концентрации 0,5 мг/мл инкубировали в лунках 24-луночного планшета для ELISA.

Каждый штамм, который будут тестировать, выращивали в течение ночи в среде MRS, дополненной меченным тритием тимидином (5 мкл в 3 мл MRS). Культуры центрифугировали и доводили до 108 КОЕ/мл в PBS, подсчитывая в камере с сеткой Нейбауэра, и образцы каждой культуры забирали, чтобы определить количество встроенного меченного тритием тимидина, посредством сцинтилляционного устройства для считывания. Затем 0,5 мл добавляли к содержащим слизь лункам 24-луночного планшета и инкубировали при 37°C в течение 60 мин. Надосадочную жидкость в каждой лунке удаляли и лунки дважды промывали средой MEM Alpha (Gibco), чтобы удалить слабо прилипшие бактерии. В конце, лунки разламывали, чтобы получить слизь вместе с прилипшими бактериями, и измеряли радиоактивность. Специфическую активность (имп/мин/КОЕ) каждой культуры вычисляли из общей радиоактивности, включенной в суспензию PBS, доведенную до 108 КОЕ/мл. Lactobacillus rhamnosus GG (Valio Ltd, Финляндия) применяли в качестве положительного контроля из-за его необыкновенно высокой адгезии к эпителию кишечника (Jacobsen C. N. et al., 1999).

Клетки Caco-2 были получены из ATCC (ECACC № 86010202). Клетки высевали в 24-луночные планшеты и позволяли им расти в DMEM до слияния (37°C, 5% CO2). Экспериментальная процедура для получения количества бактерий, которые прилипают на единицу площади клеток caco-2, является по существу такой же как приведенная выше для адгезии к слизи.

B) Результаты

Способность к адгезии штаммов F1033, F2064 и F2076 измеряли по сцинтилляции меченного тритием тимидина и сравнивали с сцинтилляцией для коммерческого штамма GG L. rhamnosus. Адгезия к эпителиальным клеткам с использованием модели Caco-2 является распространенным анализом для пробиотических штаммов. По сравнению с L. rhamnosus GG штаммы F2064 и F2076 показали на 60% меньшую аффинность к эпителиальным клеткам. Однако, принимая во внимание высокую аффинность L. rhamnosus GG к эпителиальным клеткам, такие значения сравнимы с другими хорошо известными пробиотиками, такими как L. Plantarum 299v, и выше чем для множества других пробиотических штаммов (Jacobsen C. N. et al., 1999). С другой стороны, адгезия штамма F1033 к эпителиальным клеткам в 2,5 раза выше, чем у L. rhamnosus GG. Кроме того, штаммы F2076 и F2064 проявили намного более высокую аффинность к слизи кишечника, чем для эпителиальных клеток, в то время как штамм F1033 продемонстрировал противоположное поведение. Результаты показаны в следующей ниже таблице.

Таблица 2
Адгезия к слизи пробиотических бактериальных штаммов [*От общей концентрации бактерий 108 КОЕ]
Штамм Caco-2 (КОЕ/см2) Слизь (КОЕ/см2)
F1033 1,21±0,17·105 КОЕ 6,06±0,73·104 КОЕ
F2064 1,89±0,12·104 КОЕ 2,25±0,12·106 КОЕ
F2076 1,71±0,16·104 КОЕ 5,91±0,03·105 КОЕ
L.rhamnosus GG 4,41±0,22·104 КОЕ 3,29±0,57·106 КОЕ

5. Антагонистическая способность

A) Способы

Применяли следующие ниже индикаторные штаммы: P. mirabilis CECT 4557, K. oxytoca CIP 103434, C. perfrinqens ATCC 13124, C. ramosum ATCC 25582, E. faecalis CETC 795, Y. pseudotuberculosis ATCC29833, B. vulqatus ATCC 8482 и B. thetaiotaomicron ATCC2079 представляли собой коллекционные штаммы. C. albicans, S. enterica thyphimurium, S. enterica cholerasuis, C. jejuni, E. coli и P_. aeruginosa представляли собой лабораторные изоляты. Индикаторные штаммы единообразно наносили тампоном в планшеты, содержащие подходящую среду (Oxoid) и выращивали до слияния при подходящей температуре в условиях, благоприятных для микроаэрофилов (5% CO2). Затем, цилиндрические участки по 6 мм (в диаметре) агаровых пластин со слившимися F1033, F2064 или F2076 помещали вверх дном на пластины с индикаторным штаммом и инкубировали в течение ночи при 37°C. На следующий день измеряли зоны ингибирующего действия, размещая агаровую пластину по правилу плоской поверхности. Ингибирующую рост активность (GI) вычисляли, как указано ниже:

где IZD представляет собой диаметр зоны ингибирующего действия и CD представляет собой диаметр цилиндра, измеренный в миллиметрах.

B) Результаты

Таблица 3
Ингибирующая рост активность (GI) пробиотических штаммов в отношении 12 патогенных или потенциально патогенных штаммов и в отношении 2 общеизвестных условно-патогенных штаммов желудочно-кишечной флоры
F2064 F2076 F1033
Патогенные микроорганизмы
C.albicans 2 0,5 1,25
S.enterica typhimurium 1 1 0,25
S.enterica cholerasuis 1 1 0,5
E.coli 1,75 3,7 1,1
C.jejuni 0 0 4,75
K.oxytoca 0,5 1 2
P.mirabilis 4 1,5 0,5
P.aeruqinosa 3 3,75 4,5
E.faecalis 1,75 1 1,25
C.perfrinqens 2,25 3,75 1,75
C.ramosum 1,25 1,75 0,5
Y.pseudotuberculosis 5,5 3,4 4,5
Условно-патогенные микроорганизмы
B.thetaiotaomicron 0,4 0,4 0,5
B.vulqatus 0,3 0,5 0,7

Штаммы F2064, F2076 и F1033 проявляли значительную ингибиторную активность в отношении Candida albicans и нескольких потенциально патогенных бактерий. С другой стороны, штаммы проявляли минимальную активность в отношении условно-патогенных штаммов повсеместно встречающегося во врожденной желудочно-кишечной флоре рода Bacteroides. Также штаммы F2064, F2076 и F1033 между собой не проявляли значительной ингибиторной активности. Примечательно, что штамм F1033 является единственным штаммом, проявляющим высокую ингибиторную активность в отношении Campylobacter jejuni, в то время как штамм F2076 выделяется при ингибировании Escherichia coli и штамм F2064 - при ингибировании и Candida albicans, и Proteus mirabilis.

6. Антиоксидантная способность

A) Способы

Аликвоты по 20 мкл оставленных на ночь культур каждого штамма (приблизительно 109 КОЕ/мл) помещали в 96-луночный планшет. 200 мкл MRS, дополненной 10 мМ параквата (C12H14Cl2N2, донором супероксид-аниона) или 10 мМ нитропруссида натрия (Na2[Fe(CN)5NO], донором оксида азота), добавляли в лунки и планшеты инкубировали при 37°C и 5% CO2. Оптические плотности считывали при 620 нм через 6 ч. Результаты выражали как процент роста по сравнению с ростом в стандартной среде MRS. Такого же протокола придерживались для штамма GG L. rhamnosus и штамма L. plantarum, выделенного из коммерческого препарата VSL#3 (выделение проводили, применяя стандартные способы).

B) Результаты

Окислительный стресс определяют как нарушение баланса между появлением активных форм кислорода (ROS) и ослабленными антиоксидантными защитными системами. Окислительный стресс развивается, в частности, при воспалительных реакциях, поскольку воспалительные клетки, нейтрофилы, и макрофаги продуцируют большие количества ROS (Rezaie A. et al., 2007; Roessner A. et al., 2008). Штаммы F1033, F2064 и F2076 продемонстрировали способность выживать в жестких окислительных условиях по сравнению с хорошо известным штаммом L. rhamnosus GG, а также со штаммом L. Plantarum, выделенным из препарата VSL#3. Стоит отметить, что штамм F2076 проявлял более высокую устойчивость как параквату (донору супероксид-аниона), так и к нитропруссиду натрия (донору оксида азота). Устойчивость к окислительному стрессу является желательной особенностью для пробиотических штаммов, которые, как ожидают, выживают в окружении воспаленной слизистой оболочки.

Таблица 4
Процент роста в среде, содержащей 10 мМ параквата или нитропруссида натрия, по сравнению со стандартной средой MRS
Штамм % роста в параквате % роста в нитропруссиде натрия
L.rhamnosus GG 70±10 99±17
L.plantarum VSL#3 61±4 88±10
F1033 67±9 76±22
F2064 61±18 67±8
F2076 72±1 104±19

7. Генотипирование штамма

A) Способы

Штаммы F1033, F2064 и F2076 подвергались обработке по раннее описанному протоколу (Rodas A. M. et al., 2005) с незначительными модификациями. Штаммы растили на чашках с агаровой средой MRS и инкубировали при 37°C 5% CO2 в течение 18 ч. Клетки собирали и 3 раза промывали в 8 мл PET (10 мМ Tris pH 7,6, 1M NaCl), затем 10 мин центрифугировали при 6000 об./мин. Осадки ресуспендировали в 700 мл лизирующего буфера (6 мМ Tris, 1M NaCl, 0,1M ЭДТА, 0,5% SLS, 0,2% дезоксихолевая кислота; лизоцим 1 мг/мл; мутанолизин 40 ед/мл; 20 мг/мл RNase). Равный объем 1,6% агарозы с низкой температурой плавления (FMC BioProducts, Рокленд, ME, США) добавляли к ресуспендированным клеткам и позволяли произойти отвердеванию при 4°C в течение 1 ч. Вставки переносили к 2 мл лизирующего буфера II (0,5M ЭДТА pH 9,2, 1% N-лаурилсаркозин и 1 мг/мл проназы) и инкубировали при 50°C в течение 48 ч. Затем вставки промывали при комнатной температуре буфером TE (10 мМ Tris, 1 мМ ЭДТА pH 8,0). Расщепление полной ДНК проводили отдельно рестрикционными ферментами Sfi-I и Sma-I (Roche Diagnostics).

Электрофорез в пульсирующем поле проводили, применяя устройство CHEF DRIII (BioRad Laboratories). Вставки загружали в 1% агарозный гель (агароза SeaKem ME, FMC BioProducts, ME, США). ДНК-маркеры MW представляли собой Lambda ladder PFG Marker и Low Range PFG Marker (New England Biolabs). После электрофореза гели окрашивали бромистым этидием и УФ, используя систему GelDoc (BioRad).

B) Результаты

На фиг.1 показаны полученные профили на электрофорезе в пульсирующем поле. Для штамма F1033 показан геномный рестрикционный профиль схожий с P. acidilactici R1001 после расщепления с использованием Sma-I. Однако, геномный профиль, получаемый после расщепления с использованием фермента Not-I, явно отличается. С другой стороны, геномные рестрикционные профили штаммов F2064 и F2076 явно различаются между собой и также по сравнению и с L. plantarum 299v, и со штаммом L. plantarum, содержащимся в препарате VSL#3.

8. Продукция короткоцепочечных жирных кислот

A) Способы

Штаммы инкубировали в течение ночи в минимальной среде (смотри таблицу 5), дополненной различными волокнами, каждое (инулин, пектин и FOS) в определенном количестве, в условиях, благоприятных для микроаэрофилов (5% CO2) при 37°C. Далее, клетки удаляли посредством центрифугирования при 12000 об./мин. в течение 10 мин и надосадочные жидкости фильтровали и замораживали в жидком азоте и хранили при -80°C до анализа посредством газовой хроматографии, обращая особое внимание на количество уксусных, пропионовых и масляных кислот.

Таблица 5
Соединение Концентрация
Пептон 2 г/л
Дрожжевой экстракт 2 г/л
NaCl 0,1 г/л
K2HPO4 0,04 г/л
KH2PO4 0,04 г/л
MgSO4·7H2O 0,01 г/л
CaCl2·6H2O 0,01 г/л
NaHCO3 2 г/л
Гемин 0,05 г/л
HCl цистеин 0,5 г/л
Соль желчной кислоты 0,5 г/л
Tween 80 2 г/л
Витамин К1 10 мкл
Инулин 10 г/л
Пектин 10 г/л
FOS 10 г/л

B) Результаты

Короткоцепочечные жирные кислоты (SCFA) являются конечными продуктами расщепления углеводов анаэробными бактериями в толстой кишке. SCFA, в основном, ацетат, пропионат и бутират составляют приблизительно 80% концентрации анионов в толстой кишке и продуцируются в почти постоянном молярном соотношении 62:22:15. Среди их различных свойств, SCFA, особенно, масляная кислота, но также и уксусная и пропионовая кислота, легко всасываются слизистой оболочкой кишечника, с относительно высоким содержанием калорий, метаболизируются колоноцитами и гепатоцитами, стимулируют всасывание натрия и воды в толстой кишке и тропны к слизистой оболочке кишечника (D'Argenio G. et al., 1999). С другой стороны, высокие количества уксусной кислоты, как длительное время было известно, раздражают слизистую оболочку кишечника (Yamada Y. et al., 1992). Штаммы F1033, F2064 и F2076 являются мощными продуцентами или уксусной, или пропионовой, или масляной кислоты.

Таблица 6
Продуцирование уксусной, пропионовой и масляной кислот штаммами, выращенными на минимальной среде, обогащенной инулином, пектином и FOS
Штамм Уксусная кислота (мг/мл) Пропионовая кислота (мг/мл) Масляная кислота (мг/мл)
L.rhamnosus GG n.d. n.d. 7,7
F1033 n.d. n.d. 21,4
F2064 n.d. 30,2 9,7
F2076 46,5 n.d. n.d.
(n.d.=не определено)

9. Совместимость с препаратами для лечения IBD

A) Способ

Бульон с добавками готовили, растворяя 5-аминосалициловую кислоту (Pentasa®, Ferring Pharmaceuticals) в максимально растворимой концентрации (0,84 г/л) и в половине от данной концентрации (0,42 г/л) в жидком бульоне MRS. Штаммы по изобретению выращивали в стандартном бульоне MRS или в бульоне, дополненном 5-аминосалициловой кислотой, в течение 4 ч при 37°C в условиях, благоприятных для микроаэрофилов (5% CO2) и рост оценивали, измеряя оптическую плотность при 620 нм. Результаты выражали как процент роста в стандартной среде MRS.

B) Результаты

Длительное лечение от легких до умеренных симптомов IBD обычно проводят, применяя аминосалицилаты (производные 5-ASA) для перорального применения (Katz J.A., 2007). Следовательно, интересно оценить, можно ли пробиотические штаммы по изобретению вводить совместно с производными 5-ASA. Принимая во внимание, что рост ни одного из указанных штаммов полностью не ингибируется, несмотря на высокую строгость условий, авторы заявки могут заключить, что совместное введение месалазина, вероятно, не уменьшает эффективность пробиотика, даже при использовании насыщенной концентрации месалазина (0,84 г/л), как показано в таблице 7:

Таблица 7
4 ч (% роста) 8 ч (% роста)
0,42 г/л 0,84 г/л 0,42 г/л 0,84 г/л
VSL#3 56,2 38,1 43,2 35,1
F1033 72,7 60,6 51,8 42,3
F2064 59,7 48,0 62,3 55,1
F2076 51,6 22,1 50,2 22,5

10. Воздействие in vivo на химически вызванное воспаление кишечника

A) Способы

Терапевтический эффект композиции по изобретению на легкую степень воспаления кишечника исследовали при 5-дневном многократном пероральном введение декстрана сульфата натрия (DSS) мыши (Okayasu I. et al., 1990). При применении в низкой дозе (2,5-3%) в течение короткого периода времени (5 дней) DSS вызывает легкий колит с кишечным воспалением на гистологическом уровне, но без значительных макроскопических изменений (например, укорочения толстой кишки, мезентериального слипания).

Внешние симптомы включают в себя потерю веса и диарею с редкими случаями крови в кале. Следовательно, данная модель является репрезентативной для язвенного колита в легкой форме.

Штаммы F1033, F2064 и F2076 лиофилизировали в стерильной воде с 15% обезжиренным молоком и 4% сахарозой в качестве криопротекторов и смешивали в равных количествах (соотношение в концентрации 1:1:1).

Мышей Balb/c в возрасте восьми недель (Charles River, Барселона, Испания), весящих 20-25 г, содержали в беспатогенных (SPF) условиях в изоляторе (Harlan Iberica, Барселона, Испания) при постоянной температуре (22°C) с 12-часовым циклом чередования света/темноты. Две мыши выступали в качестве однопометных животных. Мыши имели свободный доступ к стерильной пище (стандартная диета для лаборатории; Harlan Iberica, Барселона, Испания) и к питьевой жидкости. Мышей в течение 7 дней содержали в виварии до начала эксперимента (карантин). Мышей распределяли в одну из четырех групп: a) пробиотическая композиция по изобретению + DSS (n=8); b) VSL#3 (VSL Pharmaceuticals, США) + DSS (n=8); c) носитель + DSS (n=8); и d) носитель + здоровые контроли (n=6).

Пробиотики (или носитель) вводили посредством перорального принудительного питания в течение десяти дней (день - 10) до начала введения DSS (день 0). Каждая мышь ежедневно получала 2,5×108 КОЕ пробиотика в 0,1 мл стерильной воды (носитель) посредством принудительного питания. Не получавшие пробиотика мыши получали такой же объем носителя (дистиллированная вода с 15% обезжиренным молоком и 4% сахарозой).

Мышам давали 3% (масс./об.) DSS (мол. в. 40 кДа, Applichem Lifescience, VWR, Барселона) в их питьевой воде в течение 5 дней (дни с 0 по 4, после чего следовало три дня без DSS) согласно ранее описанному протоколу с небольшими модификациями (Okayasu I, et al. Gastroenterol 1990). Здоровые контроли никогда не получали DSS.

Клинические симптомы отслеживали ежедневно. Индекс активности болезни вычисляли по следующей ниже формуле и таблице интерпретации данных:

DAI = Оценкапотеря веса+Оценкакровь в кале+Оценкаконсистенция кала

Результаты показаны в таблице 8:

Таблица 8
Потеря веса Оценка Кровь в кале Оценка Консистенция кала Оценка
<1% 0 Отсутствие 0 Оформленный и твердый 0
1-5% 1 Оформленный, но мягкий 1
5-10% 2 Наличие 2 Жидкий стул 2
10-15% 3 Легкая форма диареи (водянистая) 3
>15% 4 Обильное кровотечение 4 Сильная диарея 4

Оценка индекса активности болезни, применяемая в настоящем документе, впервые описана Cooper et al. и объединяет несколько клинических симптомов в одну нормализованную оценку (Cooper H.S. et al., 1993). Максимальная оценка составляет 12 единиц. Данная оценка широко использовалась для оценки эффективности экспериментальных терапий - пробиотиками среди них - в моделях IBD на животных (Fitzpatrick L.R. et al., 2007; Grabig A. et al., 2006; Sasaki M. et al., 2005).

После умерщвления передозировкой анестезирующего средства вдыхаемого галотана (Fluotane®, Zeneca Ltd, Великобритания), образцы толстой кишки животных собирали и промывали в холодном PBS. Регистрировали соотношение веса/длины толстой кишки. Образцы для определения цитокинов замораживали в жидком азоте и гомогенизировали в 1 мл холодного PBS со смесью ингибиторов протеаз (Sigma-Aldrich Chem., Испания) и центрифугировали (15000×g, 10 мин). Концентрации IL-6, IL-10, IL23p19, IFN-γ и TNF-α измеряли в надосадочных жидкостях толстой кишки, применяя Cytokine 6-Plex Assay (Procarta™ Cytokine Profiling Kit, PANOMICS, Испания) для платформы Luminex® (Luminex® Co, Остин, США). Бусы с флуоресцентными микрочастицами с предварительно нанесенными специфичными для цитокинов антителами инкубировали с 50 мкл разбавленной в соотношении 1:5 надосадочной жидкости. Последовательно добавляли специфично биотинилированные вторичные антитела и стрептавидин-фикоэритрин (S-PE). Данные выражали как пг цитокина на мг белка (Quick Start Bradford Protein Assay, BIO-RAD, CA, США). Все измерения проводили в двух повторах.

B) Результаты

Индекс активности болезни

Как показано на фиг.2, группа, получавшая пробиотический препарат по изобретению, продемонстрировала значительное улучшение клинических симптомов при сравнении с получавшими DSS контролями, как оценивали по индексу активности болезни (p<0,05, двусторонний ANOVA с апостериорным критерием Тьюки-Крамера). Здоровые контроли также демонстрировали более низкий индекс активности болезни (p<0,05).

Уровни цитокинов

Анализ различных цитокинов в слизистой оболочке кишечника выявил, что пробиотический препарат по изобретению значительно снижает уровень IL-6 при сравнении с получавшими DSS контролями (p<0,01, двусторонний ANOVA с апостериорным критерием Тьюки-Крамера), в то время как эффект коммерческого пробиотического препарата VSL#3 не достиг значимости (p>0,05). IL-6 представляет собой маркер острого воспаления (фиг.3). Как ожидали, уровни IL-6 у здоровых контролей были также значительно ниже, чем у получавших DSS контролей (p<0,05). Обнаружили статистически значимую корреляцию между клиническими симптомами (оценка DAI) и уровнями IL-6 в слизистой оболочке кишечника (p<0,05, критерий рангов Спирмэна) (данные не показаны). С другой стороны, корреляция между клиническими симптомами и IL-10, IL-23, TNFα или IFNγ не являлась статистически значимой, и пробиотический препарат по изобретению значительно не влиял на уровни данных цитокинов.

11. Воздействие in vivo на спонтанное воспаление кишечника

A) Способы

Терапевтический эффект пробиотического препарата по изобретению также исследовали в модели мыши, нокаутированной по гену IL-10. В данной модели спонтанно развивается воспаление кишечника в возрасте от 8 до 12 недель с пенетрантностью 80-90% (Scheinin T. et al., 2003). Интерлейкин 10 (IL-10) является важным регуляторным цитокином, который подавляет эффекторные функции макрофагов/моноцитов, клеток Т-хелперов типа 1 (Th1) и естественных клеток-киллеров. Кроме того, IL-10 усиливает пролиферацию и дифференцировку B-клеток. В мышиных моделях с отсутствием гена IL-10 спонтанно развивается воспалительное заболевание кишечника и желудочно-кишечные опухоли. Желудочно-кишечная флора была вовлечена в патогенез данных болезненных состояний, поскольку стерильные животные не заболевали. Мышь, нокаутированная по гену IL-10, широко применялась для оценки новых терапевтических возможностей в отношении IBD.

Мышей C57B6J, лишенных IL-10, или дикого типа в возрасте шести недель (Charles River, Барселона, Испания) содержали в беспатогенных (SPF) условиях в изоляторе (Harlan Iberica, Барселона, Испания) при постоянной температуре (22°C) с 12-часовым циклом чередования света/темноты. Мыши имели свободный доступ к стерильной пище (диета, основанная на AIN-93 для содержания мышей, состояла из 12% воды, 14,5% белка, 4% жира, 4,5% клетчатки и 4,7% зольных веществ; Harlan Interfauna Iberica S.A., Барселона, Испания) и к питьевой жидкости.

Мышей распределяли в одну из трех групп: a) пробиотический препарат I.3.1 (n=12 IL-10-/-; дикий тип n=5); b) VSL#3 (n=12 IL-10-/-; дикий тип n=5); и c) носитель (n=12 IL-10-/-; дикий тип n=5). Каждая мышь в группе «a» и «b» ежедневно получала 109 КОЕ пробиотика в стерильной питьевой воде (носитель). Не получающим пробиотик мышам давали только носитель. Пробиотики (или носитель) вводили в течение десяти недель. Клинические симптомы отслеживали ежедневно. Индекс активности болезни (Cooper H. S. et al., 1993) вычисляли, как в модели вызванного DSS воспаления кишечника (смотри выше).

Мышей в возрасте шестнадцать недель умерщвляли посредством передозировки анестезирующего средства вдыхаемого галотана (Fluotane®, Zeneca Ltd, Великобритания). Образцы толстой кишки животных собирали и промывали в холодном PBS. Образцы крови также собирали при пункции сердца для анализа гематокрита и концентрации гемоглобина (анализатор Coulter MaxM с автоматической загрузкой, Izasa, Испания). Регистрировали соотношение веса/длины толстой кишки. Затем толстые кишки замораживали в жидком азоте и измеряли цитокины IL-6 и IFNγ, используя такой же протокол, как и в модели вызванного DSS воспаления кишечника (смотри выше).

B) Результаты

Индекс активности болезни

Как показано на фиг.4, значительную задержку появления клинических симптомов наблюдали в группе, получавшей композицию по изобретению и коммерческого препарата VSL#3 при сравнении с получавшими носитель контролями (p<0,01, двусторонний ANOVA с апостериорным критерием Тьюки-Крамера). Дополнительно, получавшие лечение группы имели склонность проявлять более низкие оценки индекса активности болезни, хотя различия не достигали значимости (данные не показаны).

Уровни цитокинов

Анализ различных цитокинов показал, что пробиотическая композиция по изобретению значительно снижает уровни IFNγ у нокаутированных мышей, когда их сравнивали с нокаутированными животными, получавшими как носитель (p<0,01, двусторонний непараметрический ANOVA с апостериорным критерием Данна), так и коммерческий препарат VLS#3 (p<0,05). Фактически, как показано на фиг.5, уровни IFNγ достигали таких же уровней, как и уровни здоровых контролей дикого типа. Дополнительно, как получается из фиг.6, также имела место явная тенденция пробиотических препаратов к снижению уровней IL-6, хотя результаты не достигали значимости из-за большого стандартного отклонения среди нокаутированных мышей с носителем.

Значительную корреляцию обнаружили между тяжестью клинических симптомов (индекс активности болезни) и уровнями IFNγ в конце исследования в слизистой оболочке толстой кишки, измеренными после умерщвления (p<0,05, критерий рангов Спирмэна) (данные не показаны).

Безопасность пробиотического препарата

Клинические симптомы (потеря веса, изменившееся поведение, вид шкурки, диарея и кровь в кале) отслеживали ежедневно у мышей дикого типа, получавших суточные дозы пробиотического препарата по изобретению, препарата VSL#3 или носителя в течение 10 недель. Никаких признаков заболевания не определили во время исследования. При умерщвлении животных подвергали общему вскрытию. Анализ всех основных полостей и органов не выявил никаких патологических изменений (данные не показаны).

12. Эффективность in vivo у пациентов с IBS

A) Способы

Дизайн исследования

Многоцентровое рандомизированное двойное слепое контролируемое при помощи плацебо испытание проводили для исследования воздействия композиции по изобретению на пациентов с IBS.

Гидроксиметилпропилцеллюлозные капсулы наполняли: (1) 150 мг мальтодекстрина, (2) 5 мг стеарата магния, (3) 5 мг диоксида кремния и (4) 200 мг смеси 1:1:1 трех штаммов по изобретению (в концентрации 5·1010 КОЕ/капсула). Кроме того, изготовили плацебо с таким же перечнем наполнителей и количествами, но, не включая композицию по изобретению. Содержание капсул на всем протяжении исследования находилось в диапазоне от 5·1010 до 1·1010 КОЕ.

33 пригодных взрослых пациента обоих полов, отвечающих Римским критериям III для синдрома раздраженного кишечника (Longstreth G. F. et al., 2006), включали в испытание и случайным образом распределяли в одну из следующих ниже групп терапии в течение 6 недель: a) капсула, содержащая композицию по изобретению, один раз в день (n=18); и b) капсула с плацебо один раз в день (n=15). Исследование проводилось согласно Хельсинской декларации для клинических испытаний, и оно одобрено соответствующим этическим комитетом.

Оценка эффективности

Главный ожидаемый результат представлял собой связанное с состоянием здоровья качество жизни (в дальнейшем также обозначаемого как «HRQOL»), как оценивалось, используя определенный опросный лист для IBS: утвержденной испанской версии опросного листа IBSQOL (Badia X. et al., 2000). Следуя рекомендациям от Испанской гастроэнтерологической ассоциации, оценки стандартизировали по шкале 0-100. Второстепенный ожидаемый результат представлял собой оценку тревожности, связанной с желудочно-кишечной чувствительностью и симптомами, при помощи утвержденного опросного листа для индекса висцеральной чувствительности (в дальнейшем также обозначаемого как «VSI») (Labus J.S. et al., 2004). Добровольцев просили заполнить данные опросные листы на исходном уровне (1 день), на 21 день и на 42 день. Данные оценивали по анализу на выборке «все пациенты, начавшие получать лечение». Результаты показаны на фиг.7 и 8.

B) Результаты

Исходные характеристики

Никаких существенных различий не заметили между группами относительно исходных характеристик, как видно в таблице 9, указывающей на то, что пациенты в обеих группах являлись сопоставимыми относительно оцениваемых переменных. Группы были также сопоставимы относительно исходных стандартных биохимических параметров крови, антропометрических параметров, возраста и пола.

Таблица 9
Исходные оценки для двух групп, получавших лечение
Группа Капсула, содержащая композицию по изобретению Плацебо (n=15)
IBSQOL 45,7±7,9 48,2±19,2
VSI 34,9±13,3 41,2±11,8

Улучшение связанного с состоянием здоровья качества жизни (фиг.7)

Композиция по изобретению значительно улучшает связанное с состоянием здоровья качество жизни по сравнению с плацебо, когда его оценивали через 21 день и 42 дня лечения (p<0,05, T-критерий). Следовательно, продемонстрировано, что композиция по настоящему изобретению значительно снижает клинические проявления и улучшает качество жизни пациентов с IBS много больше эффекта плацебо. Положительные эффекты композиции включают в себя области опросного листа HRQOL относительно связанного с питанием расстройства, тревожности, влияния на повседневную деятельность и нарушение сна. Улучшения в данной шкале предполагают снижение боли в животе, дискомфорта и изменение ритма дефекации. Насколько известно авторам изобретения, это впервые, что показана пробиотическая композиция, демонстрирующая достоверный эффект на общее связанное с состоянием здоровья качество жизни пациентов с IBS.

Улучшение висцеральной чувствительности (фиг.8)

Композиция по настоящему изобретению значительно снижает желудочно-кишечную специфичную для симптома висцеральную чувствительность у пациентов с IBS по сравнению с плацебо. Эффект почти приравнивался к значительному через 21 день лечения и был явно значительным через 42 дня лечения (p<0,01, T-критерий), дополнительно подтверждая применимость композиции по настоящему изобретению в лечении IBS. Наиболее явное улучшение наблюдалось по пунктам опросного листа, связанных с желудочно-кишечным дискомфортом и вздутием живота. В частности, в таблице 10 показано количество пациентов, сообщающих о значительном улучшении, связанном с вздутием и растяжением живота (как определено по увеличению, по меньшей мере, двух пунктов по сравнению с исходным уровнем по шкале из 6 пунктов опросного листа VSI, который определяет тревожность, связанную с вздутием и растяжением живота) в конце лечения. Различия между двумя группами статистически значимы (p<0,05, точный критерий Фишера).

Таблица 10
Влияние на связанную с вздутием и растяжением живота тревожность согласно опросному листу VSI через 42 дня лечения
Связанная со вздутием и растяжением живота тревожность Капсула, содержащая композицию по изобретению (n=18) Плацебо (n=15)
Пациенты, сообщающие об улучшении по сравнению с исходным уровнем 7 1
Пациенты, не сообщающие об улучшении по сравнению с исходным уровнем 11 14

Из полученных результатов, следовательно, приходят к заключению, что композиция по изобретению эффективна при лечении растяжения и вздутия живота.

13. Воздействие на вздутие живота и сниженную кишечную перистальтику

Женщина в возрасте 25 лет страдала от хронического вздутия живота и измененной перистальтики кишечника, иногда сообщая о нескольких испражнениях в неделю. Диагностика выявила гипотоничный и гипокинетический желудок без признаков других структурных изменений в желудочно-кишечном тракте.

Пациентка проводила лечение по одной капсуле в день (как описано в примере 12). Через одну неделю лечения пациентка сообщала о значительном уменьшении вздутия и растяжения живота и нормализации ритма опорожнения кишечника. Симптомы снова появлялись после прекращения лечения на несколько дней. После повторного начала лечения в виде одной капсулы в каждые два дня пациентка снова сообщала о значимом и длительном положительном воздействии как на вздутие живота, так и на ритм опорожнения кишечника.

Данный пример дополнительно говорит в пользу применения композиции по изобретению для лечения вздутия живота и измененной перистальтики кишечника у пациентов, которые не классифицировались, как страдающие синдромом раздраженного кишечника.

БИБЛИОГРАФИЧЕСКИЕ ССЫЛКИ

Altschul, S.F., et al. "Basic local alignment search tool", J. Mol. Biol., 1990, vol.215, p. 403-410.

Anadon, A., et al. "Opinion of the Scientific Panel on Additives and Products or Substances used in Animal Feed on the updating of the criteria used in the assessment of bacteria for resistance to antibiotics of human veterinary importance", The EFSA Journal, 2005, vol. 233, p. 1-12.

Andreoletti, O., et al. "The maintenance of the list of QPS microorganisms intentionally added to food or feed. Question no: EFSA-Q-2008-006", The EFSA Journal, 2008, vol. 923, p. 1-48.

Araya, M., et al. (2002) Guidelines for the Evaluation of Probiotics in Food -Joint FAO/WHO Working Group. FAG7WHO, Ontario, Canada.

Badia, X., et al. "Adaptacion al espanol del cuestionario IBSQoL para la medicion de la calidad de vida en pacientes con sfndrome de intestino irritable.", Rev Esp Enferm Dig, 2000, vol. 92, p. 637-643.

Bories, G., et al. "Update on the criteria used in the assessment of bacterial resistance to antibiotics of human or veterinary importance", The EFSA Journal, 2008, vol. 732, p. 1-15.

Collado, M., et al. "Probiotic Strains and Their Combination Inhibit In Vitro Adhesion of Pathogens to Pig Intestinal Mucosa", Current Microbiology, 2007, vol. 55, p. 260-265.

Cooper, H.S., et al. "Clinicopathologic study of dextran sulfate sodium experimental murine colitis", Lab Invest., 1993, vol. 69, p. 238-249.

D'Argenio, G. and Mazzacca, G. "Short-chain fatty acid in the human colon. Relation to inflammatory bowel diseases and colon cancer", Adv Exp Med Biol, 1999, vol. 472, p. 149-158.

Daniel, C, et al. "Selecting Lactic Acid Bacteria for Their Safety and Functionality by Use of a Mouse Colitis Model", Appl. Environ. Microbiol., 2006, vol.72, p. 5799-5805.

Dean, B.B., et al. "Impairment in work productivity and health-related quality of life in patients with IBS", Am J Manaq Care., 2005, vol. 11, p. S17-26.

Fitzpatrick, L.R., et al. "Effects of the probiotic formulation VSL#3 on colitis in weanling rats", J Pediatr Gastroenterol Nutr., 2007, vol. 44, p. 561-570.

Fukumoto, S., et al. "Short-chain fatty acids stimulate colonic transit via intraluminal 5-HT release in rats", Am J Phvsiol Regul IntegrComp Phvsiol, 2003, vol.284, p. R1269-1276.

Grabig, A., et al. "Escherichia coli Strain Nissle 1917 Ameliorates Experimental Colitis via Toll-Like Receptor 2- and Toll-Like Receptor 4-Dependent Pathways", Infect. Immun., 2006, vol. 74, p. 4075-4082.

Guarner, F. and Schaafsma, G.J. "Probiotics", Int J Food Microbiol., 1998, vol.39, p. 237-238.

Jacobsen, C.N., et al. "Screening of Probiotic Activities of Forty-Seven Strains of Lactobacillus spp. by In Vitro Techniques and Evaluation of the Colonization Ability of Five Selected Strains in Humans", Appl. Environ. Microbiol., 1999, vol. 65, p. 4949-4956.

Katz, J., A. "Management of inflammatory bowel disease in adults", Journal of Digestive Diseases, 2007, vol. 8, p. 65-71.

Labus, J.S., et al. "The Visceral Sensitivity Index: development and validation of a gastrointestinal symptom-specific anxiety scale", Alimentary Pharmacology & Therapeutics, 2004, vol. 20, p. 89-97.

Longstreth, G.F., et al. "Functional Bowel Disorders", Gastroenterology, 2006, vol. 130, p. 1480-1491.

Maslowski, K.M., et al. "Regulation of inflammatory responses by gut microbiota and chemoattractant receptor GPR43", Nature, 2009, vol. 461, p. 1282-1286.

Okayasu, I., et al. "A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mic", Gastroenterology., 1990, vol. 98, p. 694-702.

Pathmakanthan, S., et al. "Lactobacillus plantarum 299: Beneficial in vitro immunomodulation in cells extracted from inflamed human colon", Journal of Gastroenteroloqy and Hepatoloqy, 2004, vol. 19, p. 166-173.

Rezaie, A., et al. "Oxidative Stress and Pathogenesis of Inflammatory Bowel Disease: An Epiphenomenon or the Cause?", Digestive Diseases and Sciences, 2007, vol. 52, p. 2015-2021.

Rodas, A.M., et al. "Polyphasic study of wine Lactobacillus strains: taxonomic implications", Int J Sjst Evol Microbiol, 2005, vol. 55, p. 197-207.

Roessner, A., et al. "Oxidative stress in ulcerative colitis-associated carcinogenesis", Pathol Res Pract., 2008, vol. 204, p. 511-524.

Sasaki, M., et al. "Reversal of experimental colitis disease activity in mice following administration of an adenoviral IL-10 vector", Journal of Inflammation, 2005, vol. 2, p. 13.

Scheinin, T., et al. "Validation of the interleukin-10 knockout mouse model of colitis: antitumour necrosis factor-antibodies suppress the progression of colitis.", Clin Exp Immunol, 2003, vol. 133, p. 38-43.

Tazoe, H., et al. "Roles of short-chain fatty acids receptors, GPR41 and GPR43 on colonic functions", J Phvsiol Pharmacol., 2008, vol. 59, p. 251-262.

Tedelind, S., et al. "Anti-inflammatory properties of the short-chain fatty acids acetate and propionate: a study with relevance to inflammatory bowel disease", World J Gastroenterol., 2007, vol. 13, p. 2826-2832.

Vanhoutvin, S.A., et al. "The effects of butyrate enemas on visceral perception in healthy volunteers", Neurogastroenterology & Motility, 2009, vol. 21, p. 952-e976.

Wang, Q., et al. "Naive Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy", Appl. Environ. Microbiol., 2007, vol.73, p. 5261-5267.

Weisburg, W.G., et al. "16S ribosomal DNA amplification for phylogenetic study", J. Bacteriol., 1991, vol. 173, p. 697-703.

Yamada, Y., et al. "A comparative analysis of two models of colitis in rats", Gastroenteroloqy, 1992, vol. 102, p. 1524-1534.

Zhang, L, et al. "Alive and Dead Lactobacillus rhamnosus GG Decrease Tumor Necrosis Factor-alpha-induced lnterleukin-8 Production in Caco-2 Cells", J. Nutr., 2005, vol. 135, p. 1752-1756.

1. Фармацевтическая композиция обладающая противовоспалительной активностью, иммуномодулирующей активностью, активностью в отношении IBS (анти-IBS) или активностью в отношении вздутия живота, содержащая:
- эффективное количество по меньшей мере одного штамма, выбранного из группы, состоящей из Lactobacillus Plantarum, депонированного в Испанской Коллекции Типовых Культур (СЕСТ) под номером доступа СЕСТ 7484, Lactobacillus Plantarum, депонированного в Испанской Коллекции Типовых Культур под номером доступа СЕСТ 7485, и Pediococcus acidilactici, депонированного в Испанской Коллекции Типовых Культур под номером доступа СЕСТ 7483, все из которых обладают противовоспалительной активностью, иммуномодулирующей активностью, активностью в отношении IBS или активностью в отношении вздутия живота, и
- фармацевтически приемлемые эксципиенты.

2. Композиция по п. 1, которая включает эффективное количество по меньшей мере одного из штаммов, выбранных из группы, состоящей из Lactobacillus plantarum СЕСТ 7484, Lactobacillus plantarum СЕСТ 7485 и Pediococcus acidilactici СЕСТ 7483.

3. Композиция по п. 2, которая включает эффективное количество штаммов, выбранных из группы, состоящей из Lactobacillus plantarum СЕСТ 7484, Lactobacillus plantarum CECT 7485 и Pediococcus acidilactici CECT 7483.

4. Композиция по любому из пп. 1-3 для применения в качестве пробиотика.

5. Композиция по любому из пп. 1-3 для применения в качестве лекарственного средства.

6. Композиция по любому из пп. 1-3 для применения в качестве иммуномодулирующего средства.

7. Композиция по любому из пп. 1-3 для профилактики и/или лечения воспаления кишечника.

8. Композиция по любому из пп. 1-3 для профилактики и/или лечения воспалительного заболевания кишечника.

9. Композиция по любому из пп. 1-3 для профилактики и/или лечения синдрома раздраженного кишечника.

10. Композиция по любому из пп. 1-3 для профилактики и/или лечения вздутия и растяжения живота.

11. Композиция по любому из пп. 1-3, где композиция находится в форме фармацевтического продукта.

12. Композиция по любому из пп. 1-3, где композиция находится в форме ветеринарного продукта вместе с приемлемыми в ветеринарной практике наполнителями.

13. Композиция по любому из пп. 1-3, где композиция находится в форме пищевого продукта вместе с пищевыми ингредиентами.

14. Композиция по любому из пп. 1-3, которая является диетической добавкой.

15. Штамм Lactobacillus Plantarum, проявляющий противовоспалительную активность, иммуномодулирующую активность, активность в отношении IBS или активность в отношении вздутия живота, депонированный в СЕСТ под номером СЕСТ 7484.

16. Штамм Lactobacillus Plantarum, проявляющий противовоспалительную активность, иммуномодулирующую активность, активность в отношении IBS или активность в отношении вздутия живота, депонированный в СЕСТ под номером СЕСТ 7485.

17. Штамм Pediococcus acidilactici, имеющий противовоспалительную активность, иммуномодулирующую активность, активность в отношении IBS или активность в отношении вздутия живота, депонированный в СЕСТ под номером СЕСТ 7483.

18. Способ профилактики или лечения воспаления кишечника, воспалительного заболевания кишечника (IBD), синдрома раздраженного кишечника (IBS), растяжения и вздутия живота у животного, включая человека, включающий введение указанному животному, нуждающемуся в этом, эффективного количества композиции согласно любому из пп. 1-3.

19. Применение эффективного количества композиции согласно любому из пп. 1-3 для профилактики или лечения воспаления кишечника, воспалительного заболевания кишечника (IBD), синдрома раздраженного кишечника (IBS), растяжения и вздутия живота у животного, включая человека.



 

Похожие патенты:

Настоящее изобретение относится к биотехнологии и представляет собой способы продуцирования изопрена культивированием рекомбинантных клеток грибов или микроогранизмов.

Изобретение относится к области биотехнологии и трансмутации химических элементов. Радиоактивное сырье, содержащее радиоактивные химические элементы или их изотопы, обрабатывают водной суспензией бактерий рода Thiobacillus в присутствии элементов с переменной валентностью.

Изобретение относится к микробиологии и биотехнологии и может быть использовано в производстве физиологически активных соединений. Способ получения бактериородопсина предусматривает выращивание в ферментере в течение шести суток штамма Halobacterium salinarum ВКПМ В-11953 с последующим отделением биомассы центрифугированием и разрушением ее при инкубации в дистиллированной воде в течение ночи при постоянном перемешивании.

Изобретение относится к микробиологии, а именно к санитарно-гигиеническому контролю объектов. Способ культивирования листериозного микроба предусматривает приготовление питательной среды, содержащей маточный раствор сока листового салата, агар и фосфатный буфер в заданном соотношении.

Изобретение относится к области биотехнологии. Предложен способ подготовки культур сульфидогенных бактерий для выделения ДНК.

Изобретения относятся к области ветеринарной микробиологии и касаются олигонуклеотидных праймеров для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы D, а также способа с их использованием.

Изобретение относится к области биохимии. Предложено средство, в качестве которого используют штамм Rhodococcus wratislaviensis ВКМ Ac-2623D, для очистки почв, загрязненных гексахлорбензолом, линданом, дихлордифенилтрихлорэтаном, дихлордифенилдихлорэтаном, триаллатом и эфирами фталиевой кислоты (дибутилфталатом, диоктилфталатом).

Предложен штамм Streptomyces flavogriseus, способный продуцировать антибиотический комплекс, содержащий гексаеновый антибиотик подгруппы медиоцидина и неполиеновый антибиотик гетероциклической структуры.
Изобретение относится к биотехнологии, а именно к получению питательных сред для выращивания Deinococcus radiodurans. Питательная среда содержит соевое молоко, глюкозу, MgSO4×7H2O, MnCl2, FeSO4×7H2O и дистиллированную воду в заданном соотношении компонентов.
Изобретение относится к биотехнологии. Штамм бактерий Bacillus stratosphericus Сол.

Изобретение относится к способу получения продукта, обладающего биологически активными свойствами, из голотурий. Способ получения продукта, обладающего биологически активными свойствами, из голотурий заключается в освобождении голотурий от внутренних органов, промывании кожно-мускульного мешка, измельчении его до однородной массы, выделении из нее биологически активных компонентов, выделении биологически активных компонентов проводят в два этапа, на первом этапе измельченную кожно-мускульную массу смешивают с водой, далее проводят обработку ультразвуком, затем проводят щелочной гидролиз, далее нейтрализуют до pH 7,0, полученный гидролизат сушат, сухой продукт измельчают до порошкообразного состояния, а на втором этапе порошок смешивают с подсолнечным или рапсовым маслом и выдерживают при постоянном перемешивании, полученную жировую суспензию стабилизируют с помощью диспергатора.

Изобретение относится к фармацевтической промышленности, а именно к способу получения масляного экстракта из голотурий. Способ получения масляного экстракта из голотурий, обладающего антиоксидантными и иммунозащитными свойствами, заключающийся в подготовке внутренностей голотурий, их гомогенизировании и воздействии ультразвуком, далее гомогенат подкисляют, выдерживают, нейтрализуют, гомогенат перемешивают с растительным маслом, полученную смесь выдерживают при температуре 55-60°C, затем масляный экстракт отделяют при определенных условиях (варианты).

Изобретение относится к способу получения биологически активного средства из голотурий. Способ получения биологически активного средства из голотурий, обладающего общеукрепляющими и иммуномодулирующими свойствами, заключающийся в измельчении очищенного мускульного мешка, смешивании сырья с водой, обработке полученной смеси ультразвуком, далее проводят ферментативный гидролиз смеси ферментными препаратами протеолитического действия, после инактивируют фермент, фильтруют и сушат при определенных условиях.

Изобретение относится к иммуностимулирующим соединениям формулы: (I), где L1, L2, L3, L4, L5 и L6 независимо представляют собой -O- или -NH-; L7, L8, L9 и L10 независимо отсутствуют или представляют собой -С(=O)-; Y1 представляет собой -OP(O)(OH)2; Y2, Y3 и Y4 каждый представляет -ОН; R1, R3, R5 и R6 независимо представляют собой C8-13алкил; и R2 и R4 независимо представляют собой C6-11алкил.

Изобретение относится к области биотехнологии, конкретно к рекомбинантным вакцинам против Candida albicans, и может быть использовано в медицине. Вакцина для лечения или предупреждения кандидозной инфекции содержит выделенный полипептид с SEQ ID NO: 2 в эффективном количестве, который может быть слит с партнером слияния.

Изобретение относится к области биохимии, в частности к гуманизированному антителу к фактору некроза опухоли опухоли-α или его антигенсвязывающему фрагменту Fab. Также раскрыты ген, кодирующий белок антитела или Fab, генетический материал, экспрессирующий указанное антитело или Fab-фрагмент.

Изобретение относится к медицине, а именно к кардиологии, и касается профилактики развития постперикардиотомного синдрома у больных ишемической болезнью сердца, подвергшихся коронарному шунтированию.

Настоящее изобретение относится к биотехнологии и представляет собой иммуногенную композицию для предупреждения и лечения раковых заболеваний, которая содержит нефункциональный BORIS белок, в последовательности которого отсутствуют все «цинковые пальцы».

Изобретение относится к области биохимии. Предложена конкатемерная молекула некодирующей нуклеиновой кислоты, содержащая по меньшей мере четыре одноцепочечных участка с неметилированными CG-мотивами, для модуляции активности иммунной системы человека и животного.

Изобретение относится к фармацевтической промышленности и представляет собой противоэнтеровирусное и иммуностимулирующее средство для перорального применения в виде капсул, содержащее интерферон и вспомогательные вещества, отличающееся тем, что в качестве лекарственного вещества содержит интерферон альфа-2b человеческий рекомбинантный, иммобилизированный на полиэтиленгликоле молекулярной массой 1,5 кДа с помощью физического способа связывания потоком ускоренных электронов в дозе 1,5 Мрад, причем компоненты в средстве находятся в определенном соотношении.

Предложена питательная композиция, содержащая штамм Bifidobacterium lactis CNCM I-3446 и оболочки жировых шариков молока (MFGM), в которой MFGM усиливают биологическое действие указанного штамма.
Наверх