Синтетические олигонуклеотидные праймеры и их использование в способе идентификации штаммов и изолятов бактерии pasteurella multocida серогруппы d у крупного рогатого скота в полимеразной цепной реакции.


 


Владельцы патента RU 2562167:

Государственное научное учреждение Институт экспериментальной ветеринарии Сибири и Дальнего Востока Российской академии сельскохозяйственных наук (ГНУ ИЭВСиДВ Россельхозакадемии) (RU)

Изобретения относятся к области ветеринарной микробиологии и касаются олигонуклеотидных праймеров для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы D, а также способа с их использованием. Предложенный способ включает выделение культур микроорганизмов из патологического материала на искусственных питательных средах. Проведение ПЦР с синтетическими олигонуклеотидными праймерами, имеющими нуклеотидные последовательности SEQ ID NO:1 - 5' catcgcatccagaatagcaaact 3', SEQ ID NO:2 - 5' ctccgatgctttggttgtg 3' на район гена dcbF, отвечающего за синтез гепарозансинтетазы. Перенос продукта амплификации на гель и оценку проведения реакции. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 355 п.н. Представленные изобретения могут быть использованы в ветеринарной микробиологии для диагностики пастереллеза сельскохозяйственных животных. 2 н.п. ф-лы, 5 табл., 1 ил., 4 пр.

 

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии, и может быть использовано для диагностики пастереллеза сельскохозяйственных животных.

Pasteurella multocida - условно-патогенная грамотрицательная бактерия, постоянно обитающая на слизистой оболочки верхних дыхательных путей животных и птиц. На основании строения капсульного антигена все штаммы бактерии делятся на 5 серогрупп.Штаммы серогруппы D вызывают пневмонии у крупного рогатого скота и овец, а также атрофический ринит у свиней (Griffin, D. Bovine Pasteurellosis and Other Bacterial Infections of the Respiratory Tract / D. Griffin // Vet. Clin. Food. Anim. - 2010. №26. - P.57-71).

В нашей стране нашел применение способ типизации штаммов и изолятов Р. multocida серогруппы D методом акрифлавиновой пробы, основанный на способности к флокуляции культур бактерий этой серогруппы в растворе акрифлавина, включающий, получение бульонной культуры, ее отмывку, смешивание с водным раствором акрифлавина и оценку образовавшегося в течение 10-15 минут флокулята (Методические указания по лабораторной диагностике пастереллезов животных и птиц. Утверждены главным управлением ветеринарии министерства сельского хозяйства РФ. - 1992. - 20 с.).

К недостаткам данного способа можно отнести то, что флокулят могут образовывать диссоциированные культуры других серогрупп, что затрудняет интерпретацию результата. Требуется выделение и очистка на питательных средах культур Р. multocida. Очень низкая специфичность.

До настоящего времени за рубежом для типизации штаммов и изолятов Р. multocida серогруппы D, применяются серологические методы, основанные на реакции непрямой гемагглютинации или встречного иммуноэлектрофореза с использованием типоспецифических гипериммунных сывороток. (Chengappa, M.M. Identification of type D Pasteurella multocida by counterimmunoelectrophoresis. / M.M. Chengappa, G.R. Carter, W.E. Bailie // J. Clin. Microbiol. - 1986. - 24(5). - P.721-723).

Эти методы обладают более высокой специфичностью, по сравнению с акрифлавиновой пробой. К их недостаткам следует отнести необходимость получения чистых культур, невозможность типирования бескапсульных вариантов Р. multocida, длительность и трудоемкость.

Наиболее приемлемым, с точки зрения описанных недостатков и принятым за прототип, является способ, основанный на мультиплексной ПЦР для выявления Р. multocida и одновременного типирования капсульных групп А, В, D, E, F при помощи специфических праймеров: CAPA-F 5′-TGCCAAAATCGCAGTCAG-3′, CAPA-R5′-TTGCCATCATTGTCAGTG-3′, CAPB-F 5′-CATTTATCCAAGCTCCACC-3′, САРВ-R 5′-GCCCGAGAGTTTCAATCC-3′, CAPD-F 5′-TTACAAAAGAAAGACTAGGAGCCC-3′, CAPD-R 5′-CATCTACCCACTCAACCATATCAG-3′, CAPE-F 5′-TCCGCAGAAAATTATTGACTC-3′, CAPE-R 5′- GCTTGCTTGATTTTGTC-3′, CAPF-F 5′-AATCGGAGAACGCAGAAATCA-3, CAPF-R 5′-TTCCGCC-GTCAATTACTCTG-3′, KMT1T7- 5′-ATCCGCTATTTACCCAGTGG-3′ KMT1SP6 5′-GCTGTAAACGAACTCGCCAC-3′. В ходе реакции со штаммами и изолятами Р. multocida серогруппы D синтезируются 2 фрагмента, размером 460 и 657 п.н. (Townsend, K.M. Genetic organization of Pasteurella multocida cap loci and development of a multiplex capsular PCR typing system / K.M. Townsend, J.D. Boyce, J.Y. Chung, A.J. Frost, B. Adier // Journal of Clinical Microbiology. - 2001. - №39. - P.924-929).

Способ используется в качестве быстрого альтернативного метода типирования и, в отличие от серологических методов, позволяет определять принадлежность к серогруппе бескапсульных вариантов бактерии. Как и любая мультиплексная ПЦР, данный способ имеет низкую чувствительность и предназначен только для типирования чистых культур.

Задачей изобретения является разработка высокоспецифичного и чувствительного способа на основе полимеразной цепной реакции (ПЦР), позволяющего идентифицировать штаммы и изоляты бактерии Pasteurella multocida серогруппы D у крупного рогатого скота в пробах патологического материала от больных животных, смешанных и чистых бактериальных культурах.

Поставленная задача решается тем, что подобраны и синтезированы синтетические олигонуклеотидные праймеры для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы D у крупного рогатого скота, согласно изобретению, праймеры имеют нуклеотидные последовательности: SEQ ID NO:1-5′ catcgcatccagaatagcaaact 3′, SEQ ID NO:2-5′ ctccgatgctttggttgtg 3′.

Задача решается также тем, что в способе идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы D у крупного рогатого скота с помощью синтетических олигонуклеотидных праймеров в полимеразной цепной реакции, включающем выделение ДНК из проб биоматериала или бактериальных культур и проведение полимеразной цепной реакции, согласно изобретению, используют синтетические олигонуклеотидные праймеры SEQ ID NO:1-5′ catcgcatccagaatagcaaact 3′, SEQ ID NO:2-5′ ctccgatgctttggttgtg 3′, полимеразную цепную реакцию проводят в 1 раунд, при получении фрагмента, соответствующего размеру 355 п.н., диагностируют штаммы и изоляты бактерии Pasteurella multocida серогруппы D.

Изобретение иллюстрируется следующими примерами.

Пример 1. Получение синтетических олигонуклеотидных праймеров.

Поиск новых синтетических олигонуклеотидных праймеров осуществляют на основе полного генома штамма Pasteurella multocida «HN06» в базе данных GenBank (http://www.ncbi.nlm.nih.gov/GenBank/GenBankSearch.html), при помощи пакета программного обеспечения «Lasergen». Полученные последовательности нескольких пар праймеров дополнительно тестируют на специфичность с помощью моделирования ПЦР в программе "Vector NTI Suite" с последовательностями геномов представителей семейства Pasteurellaceae и Enterobacteriaceae, представленных в базе данных GenBank.

Окончательный выбор праймеров основывают на следующих критериях: высокий индекс сходства фрагмента и ДНК различных штаммов Pasteurella multocida серогруппы D, высокая температура отжига (GC- метод), большая длина консенсусов, отсутствие гетеродуплексов.

Химический синтез праймеров осуществляют амидофосфитным методом на автоматическом синтезаторе ASM-102U. Концентрацию синтетических олигонуклеотидных праймеров в маточном растворе определяют спектрометрическим методом.

Таким образом, были выбраны синтетические олигонуклеотидные праймеры, комплементарные высоко консервативной области генома Pasteurella multocida участка гена dcbF, отвечающего за синтез гепарозансинтетазы:

SEQ ID NO:1-5′ catcgcatccagaatagcaaact 3′,

SEQ ID NO:2-5′ ctccgatgctttggttgtg 3′.

Пример 2. Способ выявления бактерии Pasteurella multocida серогруппы D с помощью синтетических олигонуклеотидных праймеров в полимеразной цепной реакции (ПЦР) в пробах патологического материала и культурах бактерий.

Способ осуществляется в несколько этапов.

Этап 1. Подготовка проб патологического материала и бактериальных культур для исследования

Для исследования от павших или вынужденно убитых животных с признаками бронхопневмонии отбирают пробы внутренних органов (легких на границе нормального и измененного участка, бронхиальных и средостенных лимфатических узлов) не позднее 3-5 часов после гибели животного.

Из полученных проб делают посев методом отпечатков на мясопептонный агар с добавлением 5% дефибрированной крови барана (кровяной мясопептонный агар). Инкубируют в термостате при температуре 37°С в атмосфере 5% CO2.

Через 24±2 часа инкубации просматривают чашки Петри с агаром на наличие типичных для пастерелл колоний (прозрачных, диаметром до 3 мм, округлых с ровными краями, слизистой консистенции, серого цвета). Их этих колоний делают мазки на стекле и окрашивают их по Грамму для предварительного типирования. При обнаружении в мазке грамотрицательных кокобактерий, колонию отбирают для исследования в ПЦР.

Для этого отдельные колонии, не смешивая, снимают с поверхности агара, переносят в отдельные стерильные стеклянные пробирки, содержащие 200 мкл стерильной дистиллированной воды, перемешивают на вортексе. Взвесь бактерий разводят стерильной дистиллированной водой до концентрации 109 КОЕ/мл.

Пробы органов животных помещают в фарфоровые ступки, растирают с песком и разводят физиологическим раствором в соотношении 1/5-1/10, затем центрифугируют и надосадочную жидкость используют для выделения ДНК.

Взвесь бактерий к концентрации 109 КОЕ/мл используют для выделения ДНК без подготовки.

Этап 2. Выделение ДНК из проб биоматериала или взвеси бактерий.

Выделение ДНК проводят любым доступным способом, включающим лизис клеток, депротеинизацию лизата, осаждением ДНК из раствора, отмывку спиртами, высушивание и растворение ДНК в буферном растворе.

Этап 3. Амплификация участка ДНК Pasteurella multocida

Полимеразная цепная реакция. Состав реакционной смеси: ПНР-буфер (60 mM Tris-HCl [рН 8.5],1,5 мМ MgCl2, 25 тМ КСl, 10 мМ 2-меркаптэтанола, 0,1% Тритон Х-100), 0,2 мМ dNTP, no 0,2 мкг каждого праймера, 1.25 е.а. Taq-ДНК-полимеразы, 5 мкл выделенной ДНК.

Температурный режим проведения ПНР: 95°С - 5 мин - 1 цикл; 95°С - 10 сек, 55°С - 15 сек, 72°С - 20 сек - 35 циклов; 72°С - 5 мин.

Этап 4. Определение размера продуктов ПНР.

Продукты ПНР анализируют методом электрофореза в 2%-ном агарозном геле в стандартном трис-боратном буфере (рН 8,0) по стандартной методике. Результаты электрофореза учитывают, просматривая гель в ультрафиолетовом свете с длиной волны 254 нм на приборе «Трансиллюминатор».

Используют маркер молекулярного веса 100 bp. Результат ПНР считают положительным, если продукт ПЦР соответствует размеру фрагмента в 355 нуклеотидных пар.

Таким образом, предлагаемый способ позволяет эффективно выявлять штаммы и изоляты бактерий вида Pasteurella multocida серогруппы D при помощи ПНР.

Пример 3. Определение чувствительности, специфичности и эффективности ПНР по заявленному способу и по способу, взятому за прототип

Для определения чувствительности реакции по заявленному способу в сравнении с прототипом суточную культуру контрольного штамма Pasteurella multocida «T80», выращенную на кровяном агаре, переносят в бактериологическую пробирку, содержащую 1000 мкл стерильной дистиллированной воды или физиологического раствора, разводят до концентрации 1011 КОЕ/мл, титруют методом 10-кратных разведений до разведения 101 КОЕ/мл, каждое разведение подвергают исследованию в ПЦР. Чувствительность разработанной ПЦР составляет 103 КОЕ/мл.

Результаты опытов по определению чувствительности реакции представлены в таблице 1.

Таблица 1
Концентрация Pasteurella multocida серогруппы D в пробе, КОЕ/мл Результаты ПЦР по заявленному способу Результаты ПЦР по способу, взятому за прототип
107 + +
106 + +
105 + +
104 + +
103 + -
102 - -

Результаты опытов по определению специфичности реакции заявленному способу в сравнении с прототипом представлены в таблице 2.

Таблица 2
Бактерии Результаты ПЦР по заявленному способу Результаты ПЦР по способу, взятому за прототип
Pasteurella multocida серогруппа D (штамм Т80) + +
Pasteurella multocida серогруппа А (штамм «W13Ф») - -
Pasteurella multocida серогруппа В (штамм 681) - -
Salmonella typhimurium - -
Е. coli - -
Примечание: «+»- положительный результат;
«-» - отрицательный результат.

Результаты опытов по сравнению эффективности реакции при исследовании патологического материала, полученного от больных телят, и культур бактерий, выделенных на искусственных питательных средах из органов телят по заявленному способу в сравнении с прототипом, представлены в таблице 3.

Таблица 3
№ п/п Исследованные пробы Количество Количество положителных проб по заявленному способу/% от исследованных Количество положителных проб по способу, взятому за прототип/% от исследованных
1 Легкое 30 30/100 15/50
2 Бронхиальные лимфатические узлы 30 30/100 14/47
3 Средостенные лимфатические узлы 30 30/100 12/40
4 Культура бактерий, выделенная из органов телят 30/100 30/100 25/83

Таким образом, предлагаемый способ обладает высокой чувствительностью (103 КОЕ/мл), специфичностью и эффективностью при выявлении участка гена dcbF бактерии Pasteurella multocida серогруппы D. в пробах патологического материала, полученного от больных телят, культурах бактерий, выделенных на искусственных питательных средах. Способ, принятый за прототип, обладает более низкой чувствительностью (10 КОЕ/мл) и на 17-33% менее эффективен при исследовании проб легких, бронхиальных и средостенных лимфоузлов от больных животных.

Пример 4. Сравнение эффективности идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы D по заявленному способу и по способу, взятому за аналог.

Преимущества разработанного способа представлены в таблицах 4 и 5.

Таблица 4
Штаммы и изоляты Pasteurella multocida Результаты типирования Pasteurella multocida серогруппы D по заявленному способу Результаты типирования Pasteurella multocida серогруппы D по способу, взятому за аналог (акрифлавиновая проба)
1 2 3
Штамм Т80 (серогруппа В) - -
Штамм 681 (серо группа А) - -
Изолят Л31 - +
Изолят К35 + +
1 2 3
Изолят Алмаз - -
Изолят НВ-53 + -
Изолят Б-37 - -
Изолят АГМ + -
Примечание: «+» - положительный результат;
«-» - отрицательный результат.
Таблица 5
Показатель Типирование Pasteurella multocida серогруппы А по заявленному способу Типирование Pasteurella multocida серогруппы А по способу, взятому за аналог (акрифлавиновая проба)
Время исследования одной пробы биоматериала 4 часа 10 суток
Себестоимость исследования одной пробы (руб.):
Трудозатраты (чел). 2 3
Оплата труда сотрудников 500 2750
Стоимость реактивов и питательных сред 60 120
Прочие расходы 200 500
Необходимость получения чистой культуры Не обязательно Обязательно

Таким образом, заявляемый способ позволяет идентифицировать участок гена dcbF, отвечающего за синтез гепарозансинтетазы Pasteurella multocida, непосредственно в пробах легких, бронхиальных и средостенных лимфоузлов и культурах бактерий. Он позволяет сократить сроки проведения исследований до четырех часов, снизить себестоимость диагностики в 4,5 раза, трудозатраты в 1,5 раза, исключить необходимость выделения чистой культуры.

1. Синтетические олигонуклеотидные праймеры для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы D у крупного рогатого скота, имеющие нуклеотидные последовательности:
SEQ ID NO: 1-5′ catcgcatccagaatagcaaact 3′,
SEQ ID NO: 2-5′ ctccgatgctttggttgtg 3′.

2. Способ идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы D у крупного рогатого скота с помощью синтетических олигонуклеотидных праймеров в полимеразной цепной реакции, включающий выделение ДНК из проб биоматериала или бактериальных культур и проведение полимеразной цепной реакции, отличающийся тем, что используют синтетические олигонуклеотидные праймеры SEQ ID NO: 1-5′ catcgcatccagaatagcaaact 3′, SEQ ID NO: 2-5′ ctccgatgctttggttgtg 3′, полимеразную цепную реакцию проводят в 1 раунд, при получении фрагмента, соответствующего размеру 355 п.н., диагностируют штаммы и изоляты бактерии Pasteurella multocida серогруппы D.



 

Похожие патенты:

Изобретение относится к биотехнологии, а именно к способу количественного определения нуклеиновых кислот. Способ включает мечение универсального эталонного олигонуклеотида флуоресцентным маркером.

Изобретение относится к области биотехнологии. Раскрываются способы и композиции для определения наличия рака у субъекта и оценки эффективности лечения у него же.

Изобретение относится к молекулярной биологии и касается биочипа для типирования вирусов Lassa (LASV), Junin (JUNV), Machupo (MACV), Guanarito (GTOV) и вирусов Ebola (EBOV) и Marburg (MARV), а также способа типирования указанных вирусов.

Изобретение относится к области биохимии, в частности к способу определения геновариантов штаммов возбудителя чумы методом мультилокусного секвенирования. Заявленный способ предусматривает выделение хромосомной ДНК исследуемого штамма, амплификацию ДНК мишеней в полимеразной цепной реакции с использованием сконструированных праймеров, секвенирование амплифицированных фрагментов.

Изобретение относится к области биохимии, в частности к несортовому растению кукурузы с увеличенным по сравнению с контролем урожаем, включающему набор аллелей из соответствующего набора QTL, каждый из которых вносит вклад в фенотипический признак урожая зерна, причем указанный набор аллелей обоюдно комплементарен набору аллелей, имеющихся в линии Zea mays, выбранной из группы, состоящей из линии NP 1902, депонированной под номером NCIMB 41577, линии NP 1941, депонированной под номером NCIMB 41576, и линии NPNW 0351, депонированной под номером NCIMB 41578, а также к зерну или семени, им продуцируемому.

Изобретение относится к молекулярной биологии, генетической инженерии, медицине и предназначено для типирования вируса гриппа А. Предлагаемый способ типирования вируса гриппа основан на проведении двухэтапной полимеразной цепной реакции (ПЦР) кДНК вируса с последующей гибридизацией меченных биотином ампликонов с ДНК-микрочипом, содержащим соответствующие дискриминирующие гибридизационные зонды.

Изобретение относится к области биотехнологии и представляет собой набор олигонуклеотидных праймеров для идентификации ДНК животных, входящих в группу: свинья, бык, курица, овца, индейка, мышь, крыса, собака, кошка, и ДНК человека в сухих или консервированных кормах для животных и в сырых или подвергшихся кулинарной обработке мясных продуктах.

Предлагаемая группа изобретений относится к области биотехнологии, а именно к способу диагностики йерсиниоза лососевых рыб и набору для его осуществления. Данная группа изобретений может быть использована для выявления возбудителя йерсиниоза лососевых - Yersinia ruckeri - в пробах для диагностики болезней рыб в ветеринарии.

Изобретение относится к области биохимии, в частности к одновременной идентификации токсигенных штаммов геновариантов Vibrio cholerae О1 серогруппы биовара Эль Тор и их дифференциации по эпидемическому потенциалу.

Изобретение относится к области биотехнологии. Система состоит из следующих элементов: а) модуля подготовки образца, выполненного с возможностью захвата аналита из биологического образца в немикрожидкостном объеме на захватывающей частице, реагирующей на магнитное поле, и направления связанной с аналитом захватывающей частицы, реагирующей на магнитное поле, через первый микрожидкостный канал; б) реакционного модуля, включающего реакционную камеру, имеющую жидкостное сообщение с первым микрожидкостным каналом, и выполненного с возможностью иммобилизации связанной с аналитом захватывающей частицы, реагирующей на магнитное поле, и проведения реакции амплификации множества STR-маркеров аналита.

Изобретение относится к области биохимии. Предложено средство, в качестве которого используют штамм Rhodococcus wratislaviensis ВКМ Ac-2623D, для очистки почв, загрязненных гексахлорбензолом, линданом, дихлордифенилтрихлорэтаном, дихлордифенилдихлорэтаном, триаллатом и эфирами фталиевой кислоты (дибутилфталатом, диоктилфталатом).

Предложен штамм Streptomyces flavogriseus, способный продуцировать антибиотический комплекс, содержащий гексаеновый антибиотик подгруппы медиоцидина и неполиеновый антибиотик гетероциклической структуры.
Изобретение относится к биотехнологии, а именно к получению питательных сред для выращивания Deinococcus radiodurans. Питательная среда содержит соевое молоко, глюкозу, MgSO4×7H2O, MnCl2, FeSO4×7H2O и дистиллированную воду в заданном соотношении компонентов.
Изобретение относится к биотехнологии. Штамм бактерий Bacillus stratosphericus Сол.
Изобретение относится к микробиологии и биотехнологии. Предложен штамм бактерий Bacillus stratosphericus ВКПМ В-11677, продуцирующий этанол из лигноцеллюлозной биомассы.

Изобретение относится к области биотехнологии и касается применения штамма Rickettsia sibirca subsp. sibirica.

Группа изобретений относится к композиции, включающей штаммы Lactobacillus plantarum, и применению штаммов и композиции. Композиция со снижающей холестерин активностью эффективное количество по меньшей мере, одного из штаммов, выбранных из группы штамм Lactobacillus plantarum CECT 7527, штамм Lactobacillus plantarum CECT 7528 и штамм Lactobacillus plantarum CECT 7529.

Изобретение относится к области биотехнологии. Предложено применение соли угольной кислоты в качестве стабилизатора цвета в бактериальной композиции, содержащей бактериальные клетки, относящиеся к роду Bifidobacterium, и аскорбат.

Изобретение относится к области биотехнологии и касается применения штамма Rickettsia slovaca. Представлено применение штамма Rickettsia slovaca "Карпунино-19/69", депонированного во Всероссийском музее риккетсиозных культур ФГБУ НИИЭМ им.

Изобретение относится к области микробиологии. Штамм бактерий Kocuria sp., обладающий способностью быстро утилизировать нефть и нефтепродукты (дизельное топливо, масло моторное, масло гидравлическое, газовый конденсат), депонирован в ВКМ под регистрационным номером Kocuria sp.

Изобретение относится к области биотехнологии. Предложен способ подготовки культур сульфидогенных бактерий для выделения ДНК. В способе используют 15 мл культуральной жидкости. Центрифугируют культуральную жидкость при 1000 об/мин. Проводят трехкратную отмывку клеток фосфатно-солевым буфером в соотношении 10:1. Перемешивают в течение 10 секунд и центрифугируют при 1000 об/мин в течение 10 мин. Преимуществом изобретения является эффективность выделения ДНК и возможность быстрого и точного проведения последующего молекулярно-биологического анализа. 2 табл., 2 пр.
Наверх