Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf



Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf
Лечение заболеваний, связанных с фактором роста эндотелия сосудов (vegf), посредством ингибирования природного антисмыслового транскрипта к vegf

 


Владельцы патента RU 2569182:

КьюРНА,Инк.,US (US)

Изобретение относится к области молекулярной биологии и генетической инженерии. Предложен способ повышения экспрессии полинуклеотида фактора роста эндотелия сосудов (VEGF) в клетках или тканях пациента in vivo, а также соответствующий олигонуклеотид и композиция. 6 н. и 20 з.п. ф-лы, 6 ил., 2 пр.

 

Перекрестная ссылка

Настоящая заявка испрашивает приоритет предварительной заявки на патент США 61/119957, поданной 4 декабря 2008 года, которая полностью включена в настоящую заявку ссылкой.

Область техники, к которой относится изобретение

Варианты осуществления изобретения включают олигонуклеотиды, модулирующие экспрессию и/или функции VEGF и ассоциированных молекул.

Уровень техники

ДНК-РНК и РНК-РНК гибридизация важна для многих аспектов функции нуклеиновых кислот, включая репликацию ДНК, транскрипцию и трансляцию. Гибридизация также является основой для разнообразных технологий, которые направлены либо на обнаружение специфической нуклеиновой кислоты или изменение ее экспрессии. Антисмысловые нуклеотиды, например, прерывают экспрессию генов при гибридизации с РНК-мишенью, нарушая, таким образом, сплайсинг РНК, транскрипцию, трансляцию и репликацию. Антисмысловая ДНК обладает дополнительным свойством, которое состоит в том, что ДНК-РНК гибриды служат субстратом для расщепления рибонуклеазой H, которая присутствует в большинстве типов клеток. Антисмысловые молекулы можно вводить в клетки, как в случае олигодезоксинуклеотидов (ODNs), или они могут экспрессироваться с эндогенных генов в виде молекул РНК. Управление FDA недавно одобрило антисмысловое лекарственное средство VITRAVENE™ (для лечения цитомегаловирусного ретинита), что отражает то, что антисмысловые олигонуклеотиды обладают терапевтической применимостью.

Сущность изобретения

Данный раздел предоставляется в целях изложения изобретения для краткого указания сущности изобретения. Данный раздел представляется с пониманием того, что он не будет использоваться для интерпретации или ограничения объема или значения формулы изобретения.

В одном варианте осуществления изобретение обеспечивает способы ингибирования действия природного антисмыслового транскрипта посредством применения антисмыслового олигонуклеотида (олигонуклеотидов), направленного на любую область природного антисмыслового транскрипта, что приводит к апрегуляции соответствующего смыслового гена. В настоящей заявке также рассматривается, что ингибирование природного антисмыслового транскрипта может быть достигнуто с помощью миРНК, рибозимов и низкомолекулярных соединений, которые, как предполагают, включены в объем настоящего изобретения.

Один вариант осуществления обеспечивает способ модуляции функции и/или экспрессии VEGF полинуклеотида в клетках или тканях пациента, in vivo или in vitro, включающий контакт указанных клеток или тканей с антисмысловым олигонуклеотидом длиной 5-30 нуклеотидов, где указанный олигонуклеотид обладает, по меньшей мере, 50% идентичности последовательности с обратным комплементом полинуклеотида, включающего 5-30 последовательных нуклеотидов в пределах 1-643 нуклеотидов из SEQ ID NO: 2 или 1-513 нуклеотидов из SEQ ID NO: 3 (Фиг. 3), с модуляцией, таким образом, функции и/или экспрессии полинуклеотида VEGF в клетках или тканях пациента in vivo или in vitro.

В другом предпочтительном варианте осуществления олигонуклеотид направлен на природные антисмысловые последовательности VEGF полинуклеотидов, например, нуклеотидов, приведенных в SEQ ID NO: 2 и 3, а также их любых вариантов, аллелей, гомологов, мутантов, производных, фрагментов и комплементарных последовательностей. Примеры антисмысловых олигонуклеотидов представлены как SEQ ID NO: 4-9 (Фиг. 4).

Другой вариант осуществления обеспечивает способ модуляции функции и/или экспрессии VEGF полинуклеотида в клетках или тканях пациента, in vivo или in vitro, включающий контакт указанных клеток или тканей с антисмысловым олигонуклеотидом длиной 5-30 нуклеотидов, где указанный олигонуклеотид обладает, по меньшей мере, 50% идентичности последовательности с обратным комплементом антисмыслового VEGF полинуклеотида, с модуляцией, таким образом, функции и/или экспрессии VEGF полинуклеотида в клетках или тканях пациента in vivo или in vitro.

Другой вариант осуществления обеспечивает способ модуляции функции и/или экспрессии VEGF полинуклеотида в клетках или тканях пациента, in vivo или in vitro, включающий контакт указанных клеток или тканей с антисмысловым олигонуклеотидом длиной 5-30 нуклеотидов, где указанный олигонуклеотид обладает, по меньшей мере, 50% идентичности последовательности с антисмысловым олигонуклеотидом к антисмысловому VEGF полинуклеотиду, с модуляцией, таким образом, функции и/или экспрессии VEGF полинуклеотида в клетках или тканях пациента in vivo или in vitro.

В предпочтительном варианте осуществления композиция включает один или более антисмысловых олигонуклеотидов, которые связываются со смысловыми и/или антисмысловыми VEGF полинуклеотидами.

В другом предпочтительном варианте осуществления олигонуклеотиды включают один или более модифицированных или замещенных нуклеотидов.

В другом предпочтительном варианте осуществления олигонуклеотиды включают одну или более модифицированных связей.

В еще одном варианте осуществления модифицированные нуклеотиды включают модифицированные основания, включающие фосфоротиоат, метилфосфонат, пептид-нуклеиновые кислоты, 2'-O-метил, фтор- или углерод, метилен или другие молекулы блокированных нуклеиновых кислот (LNA). Предпочтительно, модифицированные нуклеотиды представляют собой молекулы блокированной нуклеиновой кислоты, включая α-L-LNA.

В другом предпочтительном варианте осуществления олигонуклеотиды вводят пациенту подкожно, внутримышечно, внутривенно или внутрибрюшинно.

В другом предпочтительном варианте осуществления олигонуклеотиды вводят в фармацевтической композиции. Схема лечения включает введение пациенту антисмысловых соединений, по меньшей мере, однократно; впрочем, указанная схема лечения может быть изменена с включением нескольких доз в течение некоторого периода времени. Лечение может быть скомбинировано с одним или более другими типами терапий.

В другом предпочтительном варианте осуществления олигонуклеотиды инкапсулированы в липосоме или присоединены к молекуле-носителю (например, холестерину, TAT-пептиду).

Другие аспекты описаны ниже.

Краткое описание фигур

Фиг. 1:

Фиг. 1A и 1B: является графиком результатов ПЦР в реальном времени, на котором показан уровень изменения + стандартное отклонение мРНК VEGF после обработки клеток HepG2 фосфотиоатными олигонуклеотидами, введенными с использованием Lipofectamine 2000, по сравнению с контролем. Результаты ПЦР в реальном времени показывают, что уровни мРНК VEGFA в клетках HepG2 значительно увеличивались через 48 ч после обработки с применением одной из миРНК, соданных к vegfaas (vefaas1_2, P=0,05), и, возможно со второй, vefaas1_3 (P=0,1, Фиг. 1A). В тех же образцах уровни РНК vegfaas значительно снижались после обработки с использованием vefaas1_2 или vefaas1_3, но не изменялись после обработки с использованием vefaas1_5, которая также не оказывала влияния на уровни мРНК VEGFA (Фиг. IB). Столбики, обозначенные как vegfas1_2, vegfas1_3, vegfas1_5, соответствуют образцам, обработанным с применением SEQ ID NO: 4, 5 и 6, соответственно.

Фиг. 1C: Фиг. 1 является графиком результатов ПЦР в реальном времени, на котором показан уровень изменения + стандартное отклонение мРНК VEGF после обработки клеток HepG2 фосфотиоатными олигонуклеотидами, введенными с использованием Lipofectamine 2000, по сравнению с контролем. Результаты ПЦР в реальном времени показывают, что уровни мРНК VEGFA в клетках HepG2 значительно увеличились через 48 ч после обработки двумя миРНК, созданными к vegRas (vegRas1_2, P=0,02 и vegRas1_3, P=0,06). Результаты изменения уровней РНК vegRas ожидаются. Столбики, обозначенные как vegRas1_2, vegRas1_3, vegRas1_5, соответствуют образцам, обработанным с применением SEQ ID NO: 7, 8 и 9, соответственно.

На Фиг. 2 показана SEQ ID NO: 1: Фактор роста эндотелия сосудов (VEGF) Homo sapiens, вариант транскрипта 1, мРНК, (регистрационный номер NCBI NM_001025366.1) и SEQ ID NO: 1а: геномная последовательность VEGF (экзоны показаны заглавными буквами, интроны - строчными).

На Фиг. 3 показана SEQ ID NO: 2: Природная антисмысловая последовательность VEGF (регистрационный номер NCBI BI045995) SEQ ID NO: 3: Природная антисмысловая последовательность VEGR (регистрационный номер NCBI BF829784).

На Фиг. 4 показаны антисмысловые олигонуклеотиды, SEQ ID NO: 4-6, созданные к природной антисмысловой последовательности VEGF.

На Фиг. 5 показаны антисмысловые олигонуклеотиды, SEQ ID NO: 7-9, созданные к природной антисмысловой последовательности VEGR.

На Фиг. 6 показана целевая последовательность экзона 1 VEGFA (SEQ ID NO: 10); последовательности прямого праймера (SEQ ID NO: 11 и 12), последовательности обратного праймера (SEQ ID NO: 13 и 14) и репортерные последовательности (SEQ ID NO: 15 и 16) для специализированных анализов, разработанных Applied Biosystems (анализ экспрессии генов Taqman (Hs00173626_m1).

Подробное описание

Некоторые аспекты изобретения описаны ниже со ссылкой на примеры применения для иллюстрации. Следует понимать, что многочисленные конкретные детали, отношения и способы изложены в целях обеспечения полного понимания изобретения. Впрочем, средний специалист в данной области техники с легкостью сумеет понять, что изобретение может быть осуществлено без одной или более конкретных деталей или с применением других способов. Настоящее изобретение не ограничивается определением порядка действий или процессов, поскольку некоторые действия могут происходить в различном порядке и/или одновременно с другими действиями или процессами. Кроме того, не все проиллюстрированные действия или процессы требуются для осуществления методологии согласно настоящему изобретению.

Все гены, названия генов и продукты генов, раскрытые в настоящей заявке, соответствуют гомологам из любых видов, для которых являются применимыми композиции и способы, раскрытые в настоящей заявке. Таким образом, указанные термины включают, помимо прочего, гены и продукты генов людей и мышей. Необходимо понимать, что в случае, когда описывается ген или продукт гена из конкретного вида, данное описание служит исключительно в качестве примера, и не должно быть истолковано как ограничение, если из контекста, в котором оно появляется, прямо не следует иное. Таким образом, например, что касается генов, раскрытых в настоящей заявке, которые в некоторых вариантах осуществления относятся к последовательностям нуклеиновых кислот и аминокислотным последовательностям млекопитающих, они охватывают гомологичные и/или ортологичные гены и продукты генов из других животных, включая, помимо прочего, других млекопитающих, рыб, амфибий, рептилий и птиц. В предпочтительных вариантах осуществления гены или последовательности нуклеиновых кислот являются человеческими.

Определения

Терминология, используемая в настоящей заявке, служит исключительно для описания конкретных вариантов осуществления и не должна ограничивать изобретение. Используемые в тексте настоящего описания существительные единственного числа, также включают формы множественного числа, если из контекста прямо не следует иное. Кроме того, в тех случаях, когда термины "включая", "включает", "имеющий", "имеет", "с" или их варианты используются в подробном описании и/или формуле изобретения, такие термины следует рассматривать как включительные, подобно термину "включающий".

Термин "приблизительно" или "около" означает, в пределах приемлемого диапазона ошибки, конкретное значение, как определяется средним специалистом в данной области техники, которое частично будет зависеть от того, каким способом измеряют или определяют значение, то есть, от ограничений системы измерения. Например, "приблизительно" может означать диапазон в пределах 1 или более чем 1 стандартного отклонения, как принято на практике. В альтернативе, "приблизительно" может означать диапазон до 20%, предпочтительно до 10%, более предпочтительно до 5% и еще более предпочтительно до 1% от данного значения. В альтернативе, особенно в отношении биологических систем или процессов, термин может означать диапазон в пределах 10-кратного, предпочтительно в пределах 5-кратного и более предпочтительно в пределах 2-кратного значения. В тех случаях, когда в заявлении и формуле описаны конкретные значения, если не указано иное, термин "приблизительно" следует применять со значением, указывающим пределы приемлемого диапазона ошибки для конкретного значения.

Используемый в настоящей заявке термин "мРНК" означает известный в настоящий момент мРНК транскрипт(ы) целевого гена, а также любые другие транскрипты, которые могут быть выявлены.

Под "антисмысловыми олигонуклеотидами" или "антисмысловым соединением" понимается молекула РНК или ДНК, которая связывается с другой РНК или ДНК (РНК-, ДНК-мишенью). Например, если она является РНК олигонуклеотидом, она связывается с другой РНК-мишенью посредством РНК-РНК взаимодействий и изменяет активность РНК-мишени (Eguchi et al., (1991) Ann. Rev. Biochem. 60, 631-652). Антисмысловой олигонуклеотид может повышать или понижать экспрессию и/или функцию специфического полинуклеотида. Подразумевается, что данное определение включает любую чужеродную молекулу РНК или ДНК, которая является полезной с терапевтической, диагностической или другой точки зрения. Такие молекулы включают, например, молекулы антисмысловой РНК или ДНК, интерферирующие РНК (РНКи), микро-РНК, РНК молекулы-ловушки, миРНК, ферментативную РНК, терапевтическую редактирующую РНК, а также агонистическую и антагонистическую РНК, антисмысловые олигомерные соединения, антисмысловые олигонуклеотиды, олигонуклеотиды внешних вспомогательных последовательностей (EGS), альтернативные сплайсеры, праймеры, зонды и другие олигомерные соединения, которые гибридизуются, по меньшей мере, с частью целевой нуклеиновой кислоты. Таким образом, указанные соединения могут быть представлены в форме однонитевых, двунитевых, частично однонитевых или кольцевых олигомерных соединений.

В рамках настоящего изобретения термин "олигонуклеотид" относится к олигомеру или полимеру рибонуклеиновой кислоты (РНК) или дезоксирибонуклеиновой кислоты (ДНК) или их миметикам. Термин "олигонуклеотид" также включает линейные или кольцевые олигомеры природных и/или модифицированных мономеров или связей, включая дезоксирибонуклеозиды, рибонуклеозиды, их замещенные и альфа-аномерные формы, пептид-нуклеиновые кислоты (ПНК), блокированные нуклеиновые кислоты (LNA), фосфоротиоат, метилфосфонат и т.п. Олигонуклеотиды способны специфично связываться с полинуклеотидом-мишенью благодаря регулярной структуре мономер-мономерных взаимодействий, например, спариванию оснований Уотсона-Крика, спариванию оснований Хугстина или обратных пар оснований Хугстина и т.п.

Олигонуклеотид может быть "химерным", то есть, составленным из различных областей. В рамках настоящего изобретения "химерные" соединения являются олигонуклеотидами, которые содержат две или более химических областей, например, ДНК область(и), РНК область(и), ПНК область(и) и т.д. Каждая химическая область состоит, по меньшей мере, из одной мономерной единицы, то есть, нуклеотида, в случае олигонуклеотидного соединения. Указанные олигонуклеотиды обычно включают, по меньшей мере, одну область, в которой олигонуклеотид модифицирован с целью проявления одного или нескольких требуемых свойств. Требуемые свойства олигонуклеотида включают, помимо прочего, например, повышенную устойчивость к расщеплению нуклеазами, повышенный клеточный захват и/или повышенную аффинность связывания с целевой нуклеиновой кислотой. Различные области олигонуклеотида, таким образом, могут обладать различными свойствами. Химерные олигонуклеотиды настоящего изобретения могут быть сформированы в виде смешанных структур из двух или более олигонуклеотидов, модифицированных олигонуклеотидов, олигонуклеозидов и/или аналогов олигонуклеотидов, как описано выше.

Олигонуклеотид может состоять из областей, которые могут быть связаны в "регистре", то есть, когда мономеры связаны последовательно, как в нативной ДНК, или связаны через спейсеры. Спейсеры формируют ковалентный "мостик" между областями и в предпочтительных случаях имеют длину, не превышающую приблизительно 100 атомов углерода. Спейсеры могут нести различные функциональные группы, например, имеющие положительный или отрицательный заряд, обладающие специальными связывающими свойствами в отношении нуклеиновой кислоты (интеркаляторы, соединения, связывающиеся по бороздкам нуклеиновой кислоты, токсины, флуорофоры и т.д.), являющиеся липофильными, вызывающие образование специальных вторичных структур, как, например, аланинсодержащие пептиды, которые индуцируют формирование альфа-спиралей.

Используемые в настоящей заявке "VEGF" и "фактор роста эндотелия сосудов" включают всех представителей семейства, мутанты, аллели, фрагменты, виды, кодирующие и некодирующие последовательности, смысловые и антисмысловые полинуклеотидные цепи и т.д.

Используемые в настоящей заявке слова Фактор роста эндотелия сосудов A, VEGF, VEGFA используются в настоящем описании попеременно.

Используемые в настоящей заявке термины "олигонуклеотид, специфичный к" или "олигонуклеотид, направленный на", относятся к олигонуклеотиду, которые имеет последовательность: (i) способную формировать стабильный комплекс с частью целевого гена или (ii) способную формировать стабильный дуплекс с частью мРНК транскрипта целевого гена. Стабильность комплексов и дуплексов может быть определена с помощью теоретических вычислений и/или in vitro анализов. Примерные анализы для определения стабильности гибридизационных комплексов и дуплексов описаны в Примерах ниже.

Используемый в настоящей заявке термин "целевая нуклеиновая кислота" охватывает ДНК, РНК (включая пре-мРНК и мРНК), транскрибированную с такой ДНК, а также кДНК, полученную с такой РНК, кодирующие, некодирующие последовательности, смысловые или антисмысловые полинуклеотиды. Специфичная гибридизация олигомерного соединения с его целевой нуклеиновой кислотой блокирует нормальную функцию нуклеиновой кислоты. Данная модуляция функции целевой нуклеиновой кислоты соединениями, которые специфично гибридизуются с ней, обычно именуется "антисмысловой". Блокируемые функции ДНК включают, например, репликацию и транскрипцию. Блокируемые функции РНК включают все жизненные функции, такие как, например, транслокация РНК к участку трансляции белка, трансляцию белка с РНК, сплайсинг РНК с получением одного или более типов мРНК, а также каталитическая активность, в которой может быть задействована или которой способствует РНК. Полным эффектом такого воздействия на функцию целевой нуклеиновой кислоты является модуляция экспрессии кодируемого продукта или олигонуклеотидов.

РНК интерференция "РНКи" опосредована двунитевыми молекулами РНК (днРНК), которые обладают сиквенс-специфической гомологией к своим "целевым" последовательностям нуклеиновой кислоты (Caplen, N. J., et al. (2001) Proc. Natl. Acad. Sci. USA 98:9742-9747). В некоторых вариантах осуществления настоящего изобретения медиаторами являются "малые интерферирующие" РНК дуплексы (миРНК) длиной 5-25 нуклеотидов. молекулы миРНК образуются в результате процессинга днРНК ферментом РНКазой, известным как дайсер (Bernstein, E., et al. (2001) Nature 409:363-366). Образующиеся продукты дуплексной миРНК включаются в мультибелковый миРНК комплекс, называемый RISC (РНК-индуцированный комплекс сайленсинга). Не желая быть связанными с какой-либо конкретной теорией, RISC, как полагают, затем направляется к нуклеиновой кислоте-мишени (соответственно мРНК), при этом миРНК-дуплекс сиквенс-специфически опосредует каталитическое расщепление (Bernstein, E., et al. (2001) Nature 409:363-366; Boutla, A., et al. (2001) Curr. Biol. 11:1776-1780). Малые интерферирующие РНК, которые могут применяться согласно настоящему изобретению, могут быть синтезированы и применены в соответствии с методиками, известными из уровня техники, которые будут знакомы среднему специалисту в данной области. Малые интерферирующие РНК для применения в способах настоящего изобретения предпочтительно включают от приблизительно 1 до приблизительно 50 нуклеотидов (н). В примерах неограничивающих вариантов осуществления миРНК могут включать от приблизительно 5 до приблизительно 40 н, от приблизительно 5 до приблизительно 30 н, от приблизительно 10 до приблизительно 30 н, от приблизительно 15 до приблизительно 25 н или приблизительно 20-25 нуклеотидов.

Выбор подходящих олигонуклеотидов облегчается при использовании компьютерных программ, которые автоматически выравнивают последовательности нуклеиновых кислот и указывают области идентичности или гомологии. Такие программы применяются для сравнения полученных последовательностей нуклеиновых кислот, например, при поиске в базах данных, таких как GenBank, или при секвенировании ПЦР-продуктов. Сравнение последовательностей нуклеиновых кислот из ряда видов позволяет провести отбор последовательностей нуклеиновых кислот, которые проявляют подходящую степень идентичности между видами. В случае генов, которые не были секвенированы, проводят Саузерн-блоттинг с целью определения степени идентичности между генами в целевых видах и других видах. Выполняя Саузерн-блоттинг при различных степенях строгости, как известно из уровня техники, можно получать приблизительную степень идентичности. Указанные методы позволяют проводить отбор олигонуклеотидов, которые обладают высокой степенью комплементарности к целевым последовательностям нуклеиновых кислот у субъекта, подвергаемого воздействию, и более низкой степенью комплементарности к соответствующим последовательностям нуклеиновых кислот в других видах. Специалист, квалифицированный в данной области техники, поймет, что при отборе подходящих областей генов для применения в настоящем изобретении существует значительная широта.

Под "ферментативной РНК" понимается молекула РНК с ферментативной активностью (Cech, (1988) J. American. Med. Assoc. 260, 3030-3035). Ферментативные нуклеиновые кислоты (рибозимы) действуют при первоначальном связывании с РНК-мишенью. Такое связывание происходит через специфично связывающуюся часть ферментативной нуклеиновой кислоты, которая удерживается в непосредственной близости к ферментативной части молекулы, которая вызывает расщепление РНК-мишени. Таким образом, ферментативная нуклеиновая кислота сначала узнает, а затем связывает РНК-мишень в результате спаривания оснований, и, после связывания с правильным сайтом, вызывает энзиматическое расщепление РНК-мишени.

Под "РНК-ловушкой" понимается молекула РНК, которая имитирует природный связывающий домен для лиганда. Таким способом РНК-ловушка конкурирует с природной связывающей мишенью за связывание специфического лиганда. Например, было показано, что при сверхэкспрессии РНК трансактивируемого элемента (TAR) ВИЧ может действовать в качестве "ловушки" и эффективно связывает tat-белок ВИЧ, препятствуя, таким образом, его связыванию с TAR-последовательностями, кодируемыми в РНК ВИЧ (Sullenger et al. (1990) Cell, 63, 601-608). Подразумеватся, что это - конкретный пример. Специалисты в данной области осведомлены, что это - всего лишь один из примеров, и другие варианты могут быть с легкостью созданы с применением общеизвестных методов из уровня техники.

Используемый в настоящей заявке термин "мономеры" обычно обозначает мономеры, связанные фосфодиэфирными связями или их аналогами, с образованием олигонуклеотидов, имеющих различный размер - от нескольких мономерных звеньев, например, от приблизительно 3-4, до приблизительно нескольких сотен мономерных звеньев. Аналоги фосфодиэфирных связей включают: фосфоротиоат, фосфородитиоат, метилфосфонаты, фосфороселеноат, фосфорамидат и т.п., как более подробно описано ниже.

Термин "нуклеотид" охватывает природные нуклеотиды, а также неприродные нуклеотиды. Специалисту, квалифицированному в данной области, будет очевидно, что различные нуклеотиды, которые ранее считались "неприродными", впоследствии были обнаружены в природе. Таким образом, "нуклеотиды" включают не только известные молекулы, содержащие пуриновые и пиримидиновые гетероциклы, но и их гетероциклические аналоги и таутомеры. Иллюстративными примерами других типов нуклеотидов являются молекулы, содержащие аденин, гуанин, тимин, цитозин, урацил, пурин, ксантин, диаминопурин, 8-оксо-N6-метиладенин, 7-деазаксантин, 7-деазагуанин, N4,N4-этаноцитозин, N6,N6-этано-2,6-диаминопурин, 5-метилцитозин, 5-(C3-C6)-алкинилцитозин, 5-фторурацил, 5-бромурацил, псевдоизоцитозин, 2-гидрокси-5-метил-4-триазолопиридин, изоцитозин, изогуанин, инозин, а также "неприродные" нуклеотиды, описанные в патенте США 5,432,272, Benner et al. Термин "нуклеотид", как предполагают, охватывает все указанные примеры, а также соответствующие аналоги и таутомеры. Наибольший интерес представляют такие нуклеотиды, которые содержат аденин, гуанин, тимин, цитозин и урацил, которые считаются природными нуклеотидами в отношении терапевтического и диагностического применения на людях. Нуклеотиды включают природные 2'-дезокси и 2'-гидрокси сахара, например, как описано в Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992), а также их аналоги.

"Аналоги", применительно к нуклеотидам, включают синтетические нуклеотиды, содержащие модифицированные основания и/или модифицированные сахаридные группы (см., например, обзоры Scheit, Nucleotide Analogs, John Wiley, New York, 1980; Freier & Altmann, (1997) Nucl. Acid. Res., 25(22), 4429-4443, Toulmé, J.J., (2001) Nature Biotechnology 19:17-18; Manoharan M., (1999) Biochemica et Biophysica Acta 1489:117-139; Freier S. M., (1997) Nucleic Acid Research, 25:4429-4443, Uhlman, E., (2000) Drug Discovery & Development, 3:203-213, Herdewin P., (2000) Antisense & Nucleic Acid Drug Dev., 10:297-310); 2'-O, 3'-C-сцепленные [3.2.0] бициклоарабинонуклеозиды (см., например, N.K Christiensen, et al., (1998) J. Chem. Soc., 120:5458-5463; Prakash TP, Bhat B. (2007) Curr. Top Med. Chem. 7(7):641-9; Cho EJ, et al., (2009) Annual Review of Analytical Chemistry, 2, 241-264). Такие аналоги включают синтетические нуклеотиды, созданные в целях улучшения связывающих свойств, например, стабильности дуплекса или триплекса, специфичности и т.п.

Используемая в настоящей заявке "гибридизация" означает спаривание по существу комплементарных цепей олигомерных соединений. Один из механизмов спаривания включает связывание с образованием водородных связей, которое может быть водородным связыванием Уотсона-Крика, Хугстина или обратным водородным связыванием Хугстина между комплементарными нуклеозидными или нуклеотидными основаниями (нуклеотидами) цепей олигомерных соединений. Например, аденин и тимин являются комплементарными нуклеотидами, которые образуют пару посредством образования водородных связей. Гибридизация может происходить при различных обстоятельствах.

Антисмысловое соединение "способно к специфичной гибридизации", если связывание соединения с целевой нуклеиновой кислотой блокирует нормальную функцию целевой нуклеиновой кислоты, вызывая модуляцию функции и/или активности, при этом существует достаточная степень комплементарности, позволяющая избежать неспецифичного связывания антисмыслового соединения с нецелевыми последовательностями нуклеиновых кислот при условиях, в которых требуется специфичное связывание, то есть, при физиологических условиях в случае in vivo анализов или терапевтической обработки, и при условиях, в которых проводят анализы в случае in vitro анализов.

Используемая в настоящей заявке фраза "строгие условия гибридизации" или "строгие условия" относится к условиям, при которых соединение согласно изобретению будет гибридизоваться со своей целевой последовательностью, но при этом с минимальным числом других последовательностей. Строгие условия зависят от последовательности и отличаются при различных обстоятельствах, и в рамках настоящего изобретения "строгие условия", при которых олигомерные соединения гибридизуются с целевой последовательностью определяются свойствами и составом олигомерных соединений, а также анализами, в которых они исследуются. Как правило, строгие условия гибридизации включают низкие концентрации (<0,15 M) солей с неорганическими катионами, такими как Na++ или K++ (то есть, низкую ионную силу), температуру выше 20-25°C, ниже Tm комплекс олигомерного соединения:целевой последовательности и присутствие денатурирующих агентов, таких как формамид, диметилформамид, диметилсульфоксид или детергента додецилсульфата натрия (ДСН). Например, скорость гибридизации уменьшается на 1,1% с каждым 1% формамида. Примером условий гибридизации высокой строгости является 0,1× цитратно-солевой буфер (SSC)/0,1% (в/об) ДСН при 60°C в течение 30 минут.

"Комплементарный", как используется в настоящей заявке, относится к способности точного спаривания между двумя нуклеотидами в одной или двух олигомерных цепях. Например, если нуклеиновое основание в определенном положении антисмыслового соединения способно к образованию водородных связей с нуклеиновым основанием в определенном положении целевой нуклеиновой кислоты, которая является ДНК, РНК или олигонуклеотидной молекулой, то тогда положение водородного связывания между олигонуклеотидом и целевой нуклеиновой кислотой, как предполагают, является комплементарным положением. Олигомерное соединение и другая ДНК, РНК или олигонуклеотидная молекула комплементарны друг к другу, если достаточное число комплементарных положений в каждой молекуле занято нуклеотидами, которые могут образовывать друг с другом водородные связи. Таким образом, "специфично гибридизующийся" и "комплементарный" являются терминами, которые используются для обозначения достаточной степени точного спаривания или комплементарности на протяжении достаточного количества нуклеотидов, при которой между олигомерным соединением и целевой нуклеиновой кислотой происходит стабильное и специфичное связывание.

Из уровня техники известно, что последовательность олигомерного соединения не должна быть обязательно на 100% комплементарна своей целевой нуклеиновой кислоте, чтобы специфично гибридизоваться с ней. Кроме того, олигонуклеотид может гибридизоваться через один или более сегментов, таких как промежуточные или смежные сегменты, которые не участвуют в акте гибридизации (например, петлевая структура, ошибочное спаривание или шпилечная структура). Олигомерные соединения настоящего изобретения включают, по меньшей мере, приблизительно 70% или, по меньшей мере, приблизительно 75%, или, по меньшей мере, приблизительно 80%, или, по меньшей мере, приблизительно 85%, или, по меньшей мере, приблизительно 90%, или, по меньшей мере, приблизительно 95%, или, по меньшей мере, приблизительно 99% комплементарности последовательности к целевой области в пределах целевой последовательности нуклеиновой кислоты, к которой они направлены. Например, антисмысловое соединение, в котором 18 из 20 нуклеотидов комплементарны целевой области и которое, таким образом, способно к специфичной гибридизации, будет обладать 90-процентной комплементарностью. В данном примере остальные некомплементарные нуклеотиды могут быть кластеризованы или распределены между комплементарными нуклеотидами и не должны быть обязательно смежными друг с другом или с комплементарными нуклеотидами. Таким образом, антисмысловое соединение, которое имеет длину 18 нуклеотидов, содержащее 4 (четыре) некомплементарных нуклеотида, которые фланкированы двумя областями полной комплементарности с целевой нуклеиновой кислотой, будет иметь общую комплементарность 77,8% с целевой нуклеиновой кислотой и, таким образом, включено в объем настоящего изобретения. Процент комплементарности антисмыслового соединения с областью целевой нуклеиновой кислоты может быть определен стандартным методом с использованием программ BLAST (basic local alignment search tools) и программ PowerBLAST, известных в уровне техники (Altschul et al, (1990) J. MoI. Biol, 215, 403-410; Zhang and Madden, (1997) Genome Res., 7, 649-656). Процент гомологии, идентичности последовательности или комплементарности может быть определен, например, с помощью программы Gap (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) при использовании параметров по умолчанию, в которой используется алгоритм Смита и Ватермана (Smith and Waterman, Adv. Appl. Math., (1981) 2, 482-489).

Используемый в настоящей заявке термин "температура плавления (Tm)" относится к температуре, в условиях определенной ионной силы, pH и концентрации нуклеиновой кислоты, при которой 50% олигонуклеотидов, комплементарных целевой последовательности, гибридизуются с целевой последовательностью в равновесии. Как правило, строгие условия будут такими условиями, при которых концентрация соли составляет, по меньшей мере, от приблизительно 0,01 до 1,0 М концентрации иона Na (или других солей) при pH 7,0-8,3, а температура равна, по меньшей мере, приблизительно 30°C для коротких олигонуклеотидов (например, 10-50 нуклеотидов). Строгие условия также могут быть достигнуты при добавлении дестабилизирующих агентов, таких как формамид.

Используемая в настоящей заявке "модуляция" означает повышение (стимуляцию) или понижение (ингибирование) экспрессии гена.

Термин "вариант", при использовании применительно к полинуклеотидной последовательности, может охватывать полинуклеотидную последовательность, связанную с геном дикого типа. Данное определение также может включать, например, "аллельные", "сплайсированные", "видовые" или "полиморфные" варианты. Сплайсированный вариант может обладать существенной идентичностью по отношению к референсной молекуле, но обычно содержит большее или меньшее количество полинуклеотидов вследствие альтернативного сплайсинга экзонов в ходе процессинга мРНК. Соответствующий полипептид может обладать дополнительными функциональными доменами или не иметь доменов. Видовые варианты представляют собой полинуклеотидные последовательности, которые варьируют от одного вида к другому. Наиболее применимыми в изобретении являются варианты продуктов генов дикого типа. Варианты могут возникать в результате, по меньшей мере, одной мутации в последовательности нуклеиновой кислоты и могут приводить к изменениям в мРНК или полипептидах, структура или функция которых могут быть изменены или не изменены. Тот или иной природный или рекомбинантный ген может не иметь ни одной, иметь одну или множество аллельных форм. К обыкновенным мутационным изменениям, которые приводят к возникновению вариантов, обычно причисляют природные делеции, вставки или замены нуклеотидов. Каждый из указанных типов изменений может происходить отдельно или в комбинации с другими, один или более раз в данной последовательности.

Получаемые в результате полипептиды обычно имеют существенную аминокислотную идентичность по сравнению друг с другом. Полиморфный вариант представляет собой вариацию полинуклеотидной последовательности конкретного гена у отдельных особей данного вида. Полиморфные варианты также могут охватывать "однонуклеотидные полиморфизмы" (SNP) или мутации одного основания, при которых полинуклеотидная последовательность изменяется на одно основание. Присутствие SNP может служить показателем, например, определенной популяции со склонностью к развитию заболевания, которая является восприимчивостью в отличие от устойчивости.

Производные полинуклеотидов включают нуклеиновые кислоты, подвергнутые химической модификации, например, замене водорода алкильной, ацильной или аминогруппой. Производные, например, производные олигонуклеотиды, могут включать "неприродные" части, такие как измененные сахаридные группы или межсахаридные связи. Их примером является фосфоротиоат и другие серасодержащие варианты, которые известны в уровне техники. Производные нуклеиновые кислоты также могут содержать метки, включая радиоактивно меченые нуклеотиды, ферменты, флуоресцентные агенты, хемилюминесцентные агенты, хромогенные агенты, субстраты, кофакторы, ингибиторы, магнитные частицы и т.п.

"Производный" полипептид или пептид являются такими пептидами, которые изменены, например, гликозилированием, пэгилированием, фосфорилированием, сульфатированием, восстановлением/алкилированием, ацилированием, химическим сшиванием или мягкой обработкой формалином. Производное также может быть изменено путем введения детектируемой метки, прямо или косвенно, включая, помимо прочего, радиоизотопную, флуоресцентную и ферментную метку.

Используемый в настоящей заявке термин "животное" или "пациент" включает, например, людей, овец, лосей, оленей, чернохвостого оленя, норок, млекопитающих, обезьян, лошадей, рогатый скот, свиней, коз, собак, кошек, крыс, мышей, птиц, курицу, рептилий, рыб, насекомых и паукообразных.

"Млекопитающее" охватывает теплокровных млекопитающих, которые обычно находятся на медицинском обслуживании (например, люди и одомашненные животные). Примеры включают кошачих, собачих, лошадиных, бычьих и человека, а также только человека.

"Лечение" охватывает лечение заболевания у млекопитающего и включает: (a) предотвращение развития заболевания у млекопитающего, в частности, когда такое млекопитающее предрасположено к развитию заболевания, но у него еще не было диагностировано наличие заболевания; (b) замедление заболевания, например, остановку его развития; и/или (c) устранение заболевания, например, вызывание регрессии заболевания до достижения требуемой конечной точки. Лечение также включает уменьшение интенсивности симптома заболевания (например, уменьшение боли или дискомфорта), где такое уменьшение интенсивности может непосредственно влиять на заболевание (например, причину, течение, проявление и т.д.), или не влиять.

Используемый в настоящей заявке термин "рак" относится к любой злокачественной опухоли, особенно возникающей в легком, почке или щитовидной железе. Рак проявляется в виде "опухоли" или ткани, включающей злокачественные раковые клетки. Примеры опухолей включают саркомы и карциномы, такие как, помимо прочих: фибросаркома, миксосаркома, липосаркома, хондросаркома, остеогенная саркома, хордома, ангиосаркома, эндотелиосаркома, лимфангиосаркома, лимфангиоэндотелиосаркома, синовиома, мезотелиома, опухоль Юинга, лейомиосаркома, рабдомиосаркома, карцинома толстой кишки, рак поджелудочной железы, рак молочной железы, рак яичников, рак предстательной железы, плоскоклеточная карцинома, базально-клеточная карцинома, аденокарцинома, карцинома потовой железы, карцинома сальной железы, папиллярная карцинома, папиллярные аденокарциномы, цистаденокарцинома, медуллярная карцинома, бронхогенная карцинома, почечноклеточная карцинома, гепатома, карцинома желчных протоков, хориокарцинома, семинома, тератокарцинома, опухоль Вильмса, рак шейки матки, опухоль яичка, карцинома легкого, мелкоклеточная карцинома легкого, карцинома мочевого пузыря, эпителиальная карцинома, глиома, астроцитома, медуллобластома, краниофарингиома, эпендимома, пинеалома, гемангиобластома, акустическая неврома, олигодендроглиома, менингиома, меланома, нейробластома и ретинобластома. Как указано выше, изобретение в частности обеспечивает возможность дифференциальной диагностики опухолей легкого, почки и щитовидной железы.

Полинуклеотидные и олигонуклеотидные композиции и молекулы

Мишени: В одном варианте осуществления мишени включают последовательности нуклеиновой кислоты фактора роста эндотелия сосудов (VEGF), включающие без ограничения смысловые и/или антисмысловые, некодирующие и/или кодирующие последовательности, связанные с VEGF.

Фактор роста эндотелия сосудов (VEGF) является мощным стимулирующим фактором ангиогенеза и проницаемости сосудов. Существует восемь изоформ с различными и иногда совпадающими функциями. Исследуются механизмы действия с появлением понимания дублирующих путей и перекрестного взаимодействия между другими рецепторами, такими как нейропилины, которые ранее не связывались с ангиогенезом. VEGF оказывает важные физиологические действия на развитие эмбриона, заживление и менструальный цикл. Он также играет важную роль в патологических состояниях, которые связаны с аутоиммунными заболеваниями.

Примеры заболеваний и нарушений, опосредуемых фактором роста эндотелия сосудов, которые можно лечить с помощью клеток/тканей, регенерированных из стволовых клеток, полученных с применением антисмысловых соединений, включают заболевания, которые характеризуются избыточной пролиферацией эндотелия сосудов; сердечно-сосудистые заболевания, которые развиваются в результате сердечно-сосудистой недостаточности (например, ишемической болезни сердца, сердечной недостаточности с застойными явлениями и болезни периферических сосудов). Состояния, которые характеризуются или вызваны неправильным или избыточным ангиогенезом, включают, помимо прочего: рак (например, активация онкогенов, потеря супрессоров опухолей); инфекционные заболевания (например, патогены, экспрессирующие ангиогенные гены, активирующие ангиогенные программы); аутоиммунные нарушения (например, активация тучных клеток и других лейкоцитов), включая ревматоидный артрит; врожденные пороки сосудов (например, мутация Tie-2); синдром Ди Джорджи (например, низкая экспрессия VEGF и нейропилина-1); HHT (например, мутации эндоглина или LK-1), кавернозную гемангиому (например, потерю Cx37 и Cx40); атеросклероз; артериопатию трансплантата; ожирение (например, ангиогенез, вызванный жирной пищей, потеря веса под действием ингибиторов ангиогенеза); псориаз; бородавки; аллергический дерматит; келоидные рубцы; пиогенные гранулемы; пузырчатку; саркому Капоши у пациентов со СПИДом; синдром персистирующего гиперпластического стекловидного тела (например, потеря Ang-2 или VEGF164); аутосомно-доминантную поликистозную болезнь почек (АДПБП); диабетическую ретинопатию; ретинопатию недоношенных; возрастную макулярную дистрофию; хориоидальную неоваскуляризацию (например, мутацию TIMP-3); первичную легочную гипертензию (например, генеративная мутация в BMPR-2, соматическая мутация EC); астму; носовые полипы; воспалительную болезнь кишечника; повреждение нервов, травму головного мозга и нейродегенеративные нарушения (например, болезнь Альцгеймера, болезнь Паркинсона, амиотрофический боковой склероз и т.д.); парадонтоз; асцит; спайки брюшной полости; эндометриоз; маточное кровотечение; кисты яичников; гиперстимуляцию яичников; артрит; синовит; остеомиелит и/или формирование остеофитов; образование язв; простые бородавки; ангиофиброму туберозного склероза; капиллярную гемангиому; синдром Стерджа-Вебера; синдром Клиппеля-Треноне-Вебера; синдром Ослера-Вебера-Рандю и любые другие заболевания или состояния, которые связаны с уровнями VEGF-R в клетке или ткани.

В предпочтительном варианте осуществления олигонуклеотиды являются специфичными к полинуклеотидам VEGF, которые включают, без ограничения, некодирующие области. VEGF-мишени включают варианты VEGF; мутанты VEGF, включая SNP; некодирующие последовательности VEGF; аллели, фрагменты и т.п. Предпочтительно олигонуклеотид является молекулой антисмысловой РНК.

В соответствии с вариантами осуществления изобретения целевая молекула нуклеиновой кислоты не ограничена только одними полинуклеотидами VEGF и распространяется на любые изоформы, рецепторы, гомологи, некодирующие области VEGF и т.п.

В другом предпочтительном варианте осуществления олигонуклеотид направлен на природную антисмысловую последовательность (природную антисмысловую последовательность к кодирующим и некодирующим областям) VEGF-мишеней, включая, без ограничения, варианты, аллели, гомологи, мутанты, производные, фрагменты и комплементарные последовательности к ним. Предпочтительно олигонуклеотид является молекулой антисмысловой РНК или ДНК.

В другом предпочтительном варианте осуществления олигомерные соединения настоящего изобретения также включают варианты, в которых другое основание присутствует в одном или более нуклеотидных положениях в соединении. Например, если первым нуклеотидом является аденин, могут быть получены варианты, которые в данном положении содержат тимидин, гуанозин, цитидин или другие природные или неприродные нуклеотиды. Это может быть сделано в любом из положений антисмыслового соединения. Затем указанные соединения тестируют с применением способов, описанных в настоящей заявке, для определения их способности ингибировать экспрессию целевой нуклеиновой кислоты.

В некоторых вариантах осуществления гомология, идентичность последовательности или комплементарность между антисмысловым соединением и мишенью составляет от приблизительно 50% до приблизительно 60%. В некоторых вариантах осуществления гомология, идентичность последовательности или комплементарность составляет от приблизительно 60% до приблизительно 70%. В некоторых вариантах осуществления гомология, идентичность последовательности или комплементарность составляет от приблизительно 70% до приблизительно 80%. В некоторых вариантах осуществления гомология, идентичность последовательности или комплементарность составляет от приблизительно 80% до приблизительно 90%. В некоторых вариантах осуществления гомология, идентичность последовательности или комплементарность составляет приблизительно 90%, приблизительно 92%, приблизительно 94%, приблизительно 95%, приблизительно 96%, приблизительно 97%, приблизительно 98%, приблизительно 99% или приблизительно 100%.

Антисмысловое соединение способно к специфичной гибридизации, когда связывание соединения с целевой нуклеиновой кислотой блокирует нормальную функцию целевой нуклеиновой кислоты, вызывая потерю активности, при этом имеется достаточная степень комплементарности, которая позволяет избежать неспецифичного связывания антисмыслового соединения с нецелевой последовательностью нуклеиновой кислоты при условиях, в которых требуется специфичное связывание. Такие условия включают, например, физиологические условия в случае in vivo анализов или терапевтической обработки, и условия, в которых проводят анализы в случае in vitro анализов.

Антисмысловое соединение, независимо от того, является ли оно ДНК, РНК, химерным, замещенным и т.д., способно к специфичной гибридизации, когда связывание соединения с целевой молекулой ДНК или РНК блокирует нормальную функцию целевой ДНК или РНК, вызывая потерю активности, при этом имеется достаточная степень комплементарности, которая позволяет избежать неспецифичного связывания антисмыслового соединения с нецелевыми последовательностями при условиях, в которых требуется специфичное связывание, то есть, при физиологических условиях в случае in vivo анализов или терапевтической обработки, а в случае in vitro анализов при условиях, в которых проводят анализы.

В другом предпочтительном варианте осуществления направленное воздействие на VEGF, включающее, без ограничения, антисмысловые последовательности, которые идентифицированы и амплифицированы с использованием, например, ПЦР, гибридизации и т.д., одной или более последовательностей, приведенных в SEQ ID NO: 2, и т.п. модулирует экспрессию или функцию VEGF. В одном варианте осуществления экспрессия или функции повышающе регулируются по сравнению с контролем. В другом предпочтительном варианте осуществления экспрессия или функции понижающе регулируются по сравнению с контролем.

В другом предпочтительном варианте осуществления олигонуклеотиды включают последовательности нуклеиновой кислоты, приведенные в SEQ ID NO: 4-9, включая антисмысловые последовательности, которые идентифицированы и амплифицированы с использованием, например, ПЦР, гибридизации и т.д. Указанные олигонуклеотиды могут включать один или более модифицированных нуклеотидов, более коротких или более длинных фрагментов, модифицированных связей и т.п. Примеры модифицированных связей или межнуклеотидных связей включают фосфоротиоат, фосфородитиоат или подобные. В другом предпочтительном варианте осуществления нуклеотиды включают производное фосфора. Производное фосфора (или модифицированная фосфатная группа), которое может быть присоединено к сахаридной группе или аналогу сахаридной группы в модифицированных олигонуклеотидах настоящего изобретения, может быть монофосфатом, дифосфатом, трифосфатом, алкилфосфатом, алканфосфатом, фосфоротиоатом и т.п. Получение вышеуказанных фосфатных аналогов и их включение в нуклеотиды, модифицированные нуклеотиды и олигонуклеотиды по существу также известно и не требует описания в настоящей заявке.

Специфичность и чувствительность антисмысловых соединений также успешно используются специалистами в данной области для терапевтических применений. Антисмысловые олигонуклеотиды применялись в качестве терапевтических соединений при лечении заболеваний у животных и человека. Антисмысловые олигонуклеотиды безопасно и эффективно вводили людям, и в настоящее время проводятся многочисленные клинические испытания. Таким образом, установлено, что олигонуклеотиды могут применяться для терапевтических воздействий в схемах лечения для обработки клеток, тканей и животных, в особенности людей.

В вариантах осуществления настоящего изобретения олигомерные антисмысловые соединения, в частности олигонуклеотиды, связываются с целевыми молекулами нуклеиновой кислоты и модулируют экспрессию и/или функцию молекул, кодируемых геном-мишенью. Блокируемые функции ДНК включают, например, репликацию и транскрипцию. Блокируемые функции РНК включают все жизненные функции, такие как, например, транслокация РНК к участку трансляции белка, трансляция белка с РНК, сплайсинг РНК с образованием одной или более типов мРНК, а также каталитическая активность, в которой может быть задействована или которой способствует РНК. Функции могут повышающе регулироваться или ингибироваться в зависимости от требуемых функций.

Антисмысловые соединения включают антисмысловые олигомерные соединения, антисмысловые олигонуклеотиды, олигонуклеотиды внешних вспомогательных последовательностей (EGS), альтернативные сплайсеры, праймеры, зонды и другие олигомерные соединения, которые гибридизуются, по меньшей мере, с частью целевой нуклеиновой кислоты. Таким образом, указанные соединения могут быть представлены в форме однонитевых, двунитевых, частично однонитевых или кольцевых олигомерных соединений.

Направленное воздействие антисмыслового соединения на конкретную молекулу нуклеиновой кислоты, в рамках настоящего изобретения, может быть многоэтапным процессом. Процесс обычно начинается с идентификации целевой нуклеиновой кислоты, функцию которой требуется модулировать. Указанная целевая нуклеиновая кислота может быть, например, клеточным геном (или мРНК, транскрибированной с гена), чья экспрессия связана со специфическим нарушением или заболеванием, или молекулой нуклеиновой кислоты из инфекционного агента. В настоящем изобретении целевая нуклеиновая кислота кодирует фактор роста эндотелия сосудов (VEGF).

Процесс направления обычно также включает определение, по меньшей мере, одной целевой области, сегмента или сайта в целевой нуклеиновой кислоте для проведения антисмыслового взаимодействия, вызывающего в результате требуемый эффект, например, модуляцию экспрессии. В рамках настоящего изобретения термин "область" определяется как часть целевой нуклеиновой кислоты, имеющая, по меньшей мере, одну идентифицируемую структуру, функцию или свойство. В областях целевых нуклеиновых кислот расположены сегменты. "Сегменты" определяется как меньшие или субфрагменты областей в целевой нуклеиновой кислоте. "Сайты", также используемые в настоящем изобретении, определяются как положения в целевой нуклеиновой кислоте.

В предпочтительном варианте осуществления антисмысловые олигонуклеотиды связываются с природными антисмысловыми последовательностями фактора роста эндотелия сосудов (VEGF) и модулируют экспрессию и/или функцию фактора роста эндотелия сосудов (VEGF) (SEQ ID NO: 1). Примеры антисмысловых последовательностей включают SEQ ID NO: 2-9.

В другом предпочтительном варианте осуществления антисмысловые олигонуклеотиды связываются с одним или более сегментами полинуклеотидов фактора роста эндотелия сосудов (VEGF) и модулируют экспрессию и/или функцию фактора роста эндотелия сосудов (VEGF). Сегменты включают, по меньшей мере, пять последовательных нуклеотидов из смысловых или антисмысловых полинуклеотидов фактора роста эндотелия сосудов (VEGF).

В другом предпочтительном варианте осуществления антисмысловые олигонуклеотиды являются специфичными к природным антисмысловым последовательностям фактора роста эндотелия сосудов (VEGF), где связывание олигонуклеотидов с природными антисмысловыми последовательностями фактора роста эндотелия сосудов (VEGF) модулирует экспрессию и/или функцию фактора роста эндотелия сосудов (VEGF).

В другом предпочтительном варианте осуществления олигонуклеотидные соединения включают последовательности, приведенные в SEQ ID NO: 4-9, антисмысловые последовательности, которые идентифицированы и амплифицированы с использованием, например, ПЦР, гибридизации и т.д. Указанные олигонуклеотиды могут включать один или более модифицированных нуклеотидов, более коротких или более длинных фрагментов, модифицированных связей и т.п. Примеры модифицированных связей или межнуклеотидных связей включают фосфоротиоат, фосфородитиоат или подобное. В другом предпочтительном варианте осуществления нуклеотиды включают производное фосфора. Производное фосфора (или модифицированная фосфатная группа), которое может быть присоединено к сахаридной группе или аналогу сахаридной группы в модифицированных олигонуклеотидах настоящего изобретения, может быть монофосфатом, дифосфатом, трифосфатом, алкилфосфатом, алканфосфатом, фосфоротиоатом и т.п. Получение вышеуказанных фосфатных аналогов и их включение в нуклеотиды, модифицированные нуклеотиды и олигонуклеотиды по существу также известно и не требует описания в настоящей заявке.

Поскольку, как известно из уровня техники, кодоном, инициирующим трансляцию, как правило, является 5'-AUG (в транскрибированных молекулах мРНК; 5'-ATG в соответствующей молекуле ДНК), кодон инициации трансляции также называют "AUG кодоном", "старт-кодоном" или "AUG старт-кодоном". Меньшее число генов имеет кодон инициации трансляции с РНК последовательностью 5'-GUG, 5'-UUG или 5'-CUG; при этом было показано, что 5'-AUA, 5'-ACG и 5'-CUG функционируют in vivo. Таким образом, термины "кодон инициации трансляции" и "старт-кодон" могут охватывать множество последовательностей кодонов, даже несмотря на то, что инициаторной аминокислотой в каждом случае обычно является метионин (у эукариотов) или формилметионин (у прокариотов). Эукариотические и прокариотические гены могут иметь два или более альтернативных старт-кодонов, любой из которых может предпочтительно использоваться для инициации трансляции в специфическом типе клеток или ткани, или в специфическом наборе условий. В рамках изобретения "старт-кодон" и "кодон инициации трансляции" относится к кодону или кодонам, которые используются in vivo для инициации трансляции мРНК, транскрибированной с гена, кодирующего фактор роста эндотелия сосудов (VEGF), независимо от последовательности(ей) таких кодонов. Кодон терминации трансляции (или "стоп-кодон") гена может иметь одну из трех последовательностей, то есть, 5'-UAA, 5'-UAG и 5'-UGA (соответствующие ДНК последовательности - 5'-TAA, 5'-TAG и 5'-TGA, соответственно).

Термины "область старт-кодона" и "область кодона инициации трансляции" относятся к части подобной мРНК или гена, которая охватывает от приблизительно 25 до приблизительно 50 смежных нуклеотидов в любом направлении (то есть, 5' или 3') от кодона инициации трансляции. Аналогичным образом термины "область стоп-кодона" и "область кодона терминации трансляции" относятся к части подобной мРНК или гена, которая охватывает от приблизительно 25 до приблизительно 50 смежных нуклеотидов в любом направлении (то есть, 5' или 3') от кодона терминации трансляции. Таким образом, "область старт-кодона" (или "область кодона инициации трансляции") и "область стоп-кодона" (или "область кодона терминации трансляции") являются областями, на которые можно направленно, эффективно воздействовать антисмысловыми соединениями настоящего изобретения.

Открытая рамка считывания (ORF) или "кодирующая область", которая, как известно из уровня техники, относится к области между кодоном инициации трансляции и кодоном терминации трансляции, также является областью, на которую можно эффективно оказывать направленное воздействие. В рамках настоящего изобретения область-мишенью является внутригенная область, охватывающая кодон инициации или терминации трансляции открытой рамки считывания (ORF) гена.

Другая область-мишень включает 5'-нетранслируемую область (5'UTR), которая, как известно из уровня техники, относится к части мРНК в 5'-направлении от кодона инициации трансляции и, таким образом, включает нуклеотиды между 5'-кэп-сайтом и кодоном инициации трансляции мРНК (или соответствующие нуклеотиды в гене). Еще одна область-мишень включает 5'-нетранслируемую область (3'UTR), которая, как известно из уровня техники, относится к части мРНК в 3'-направлении от кодона терминации трансляции и, таким образом, включает нуклеотиды между кодоном терминации трансляции и 3'-концом мРНК (или соответствующие нуклеотиды в гене). 5'-кэп-сайт мРНК включает N7-метилированный остаток гуанозина, присоединенный к другому 5' остатку мРНК через 5'-5' трифосфатную связь. 5'-кэпирующая область мРНК, как полагают, непосредственно включают 5'-кэп структуру, а также первые 50 нуклеотидов, граничащих с кэп-сайтом. Другой областью-мишенью согласно настоящему изобретению является 5'-кэпирующая область.

Хотя некоторые эукариотические мРНК-транскрипты транслируются напрямую, многие из них содержат одну или более областей, известных как "интроны", которые вырезаются из транскрипта перед его трансляцией. Остающиеся (и поэтому транслируемые) области известны как "экзоны" и соединяются вместе, образуя непрерывную последовательность мРНК. В одном варианте осуществления сайты направленного сплайсинга, то есть, соединения интрона-экзона или соединения экзона-интрона, являются особенно полезными в таких ситуациях, когда в заболевание вовлечено нарушение сплайсинга или оверпродукция конкретного продукта сплайсинга. Нарушенное соединение из-за перестановки или делеции является другим вариантом целевого сайта. мРНК-транскрипты, образованные в результате процесса сплайсинга двух (или больше) мРНК из различных генных источников известны как "слитые транскрипты". На интроны можно эффективно оказывать направленное воздействие с применением антисмысловых соединений, направленных, например, на ДНК или пре-мРНК.

В другом предпочтительном варианте осуществления антисмысловые олигонуклеотиды связываются с кодирующими и/или некодирующими областями полинуклеотида-мишени и модулируют экспрессию и/или функцию молекулы-мишени.

В другом предпочтительном варианте осуществления антисмысловые олигонуклеотиды связываются с природными антисмысловыми полинуклеотидами и модулируют экспрессию и/или функцию молекулы-мишени.

В другом предпочтительном варианте осуществления антисмысловые олигонуклеотиды связываются со смысловыми полинуклеотидами и модулируют экспрессию и/или функцию целевой молекулы.

Альтернативные РНК-транскрипты могут быть синтезированы с одной геномной области ДНК. Указанные альтернативные транскрипты общеизвестны как "варианты". Более конкретно, "пре-мРНК варианты" являются транскриптами, транскрибированными с одной и той же геномной ДНК, которые отличаются от других транскриптов, транскрибированных с той же геномной ДНК, либо начальным, либо конечным положением, и содержат интронную и экзонную последовательность.

При вырезании одного или более экзонных или интронных областей, или их частей в процессе сплайсинга, из пре-мРНК вариантов образуются меньшие "мРНК варианты". Следовательно, мРНК варианты представляют собой процессированные пре-мРНК варианты, при этом из каждого уникального пре-мРНК варианта в результате сплайсинга всегда образуется уникальный мРНК вариант. Указанные мРНК варианты также известны как "альтернативные сплайсированные варианты". Если сплайсинга пре-мРНК варианта не происходит, то тогда пре-мРНК вариант идентичен мРНК варианту.

Варианты могут быть получены с помощью альтернативных сигналов начала или остановки транскрипции. Пре-мРНК и мРНК могут иметь более одного старт-кодона или стоп-кодона. Варианты, которые образуются из пре-мРНК или мРНК, в которых используются альтернативные старт-кодоны, известны как "варианты с альтернативным старт-кодоном" соответствующих пре-мРНК или мРНК. Транскрипты, в которых используется альтернативный стоп-кодон, известны как "варианты с альтернативным стоп-кодоном" соответствующих пре-мРНК или мРНК. Одним специфическим типом варианта с альтернативным стоп-кодоном является "polyA вариант", в котором множество транскриптов образуется в результате альтернативного выбора одного из "polyA стоп-сигналов" аппаратом транскрипции, с получением, таким образом, транскриптов, которые терминируются на уникальных polyA сайтах. В рамках изобретения типы вариантов, описанных в настоящей заявке, также являются вариантами осуществления целевых нуклеиновых кислот.

Участки на целевой нуклеиновой кислоте, с которыми гибридизуются антисмысловые соединения, определяются как имеющие длину, по меньшей мере, 5 нуклеотидов фрагменты целевой области, на которую направлено активное антисмысловое соединение.

Хотя в настоящей заявке представлены конкретные последовательности некоторых примерных целевых сегментов, специалист в данной области техники осведомлен, что они служат для иллюстрации и описания конкретных вариантов осуществления в рамках настоящего изобретения. Дополнительные целевые сегменты могут быть с лёгкостью идентифицированы средним специалистом в данной области техники с учетом настоящего описания.

Целевые сегменты длиной 5-100 нуклеотидов, включающие фрагмент, по меньшей мере, из пяти (5) последовательных нуклеотидов, выбранных из иллюстративных предпочтительных целевых сегментов, как предполагают, также подходят для направленного воздействия.

Целевые сегменты могут включать последовательности ДНК или РНК, которые включают, по меньшей мере, 5 последовательных нуклеотидов с 5'-конца одного из иллюстративных предпочтительных целевых сегментов (остальные нуклеотиды являются последовательным фрагментом той же ДНК или РНК, начинающимся непосредственно перед 5'-концом целевого сегмента и продолжающимся, пока ДНК или РНК не будет содержать от приблизительно 5 до приблизительно 100 нуклеотидов). Аналогичным образом предпочтительные целевые сегменты представлены ДНК или РНК последовательностями, которые включают, по меньшей мере, 5 последовательных нуклеотидов от 3'-конца одного из иллюстративных предпочтительных целевых сегментов (остальные нуклеотиды являются последовательным фрагментом той же ДНК или РНК, начинающимся непосредственно после 3'-конца целевого сегмента и продолжающимся, пока ДНК или РНК не будет содержать от приблизительно 5 до приблизительно 100 нуклеотидов). Специалист, квалифицированный в данной области техники, вооруженный целевыми сегментами, проиллюстрированными в настоящей заявке, сумеет без излишнего экспериментирования идентифицировать дополнительные предпочтительные целевые сегменты.

После идентификации одного или более целевых областей, сегментов или сайтов, выбирают такие антисмысловые соединения, которые являются достаточно комплементарными к мишени, то есть, гибридизуются достаточно хорошо и с достаточной специфичностью, обеспечивая требуемый эффект.

В вариантах осуществления изобретения олигонуклеотиды связываются с антисмысловой цепью конкретной мишени. Олигонуклеотиды имеют длину, по меньшей мере, 5 нуклеотидов и могут быть синтезированы так, чтобы каждый олигонуклеотид был специфичен к перекрывающимся последовательностям, при этом олигонуклеотиды синтезируют таким образом, чтобы они покрывали всю длину целевого полинуклеотида. Мишени также включают как кодирующие, так и некодирующие области.

В одном варианте осуществления предпочтительно, чтобы антисмысловые олигонуклеотиды были направлены на специфические нуклеиновые кислоты. Получение антисмыслового соединения, которое специфично к конкретной нуклеиновой кислоте, является многоэтапным процессом. Процесс обычно начинается с идентификации последовательности нуклеиновой кислоты, функцию которой требуется модулировать. Она может являться, например, клеточным геном (или мРНК, транскрибированной с гена), чья экспрессия связана с конкретным нарушением или заболеванием, или некодирующим полинуклеотидом, таким как, например, некодирующая РНК (нкРНК).

РНК могут быть классифицированы на (1) информационную РНК (мРНК), которая транслируется в белки, и (2) не кодирующую белок РНК (нкРНК). нкРНК включает микроРНК, антисмысловые транскрипты и другие транскрипционные единицы (TU) с высокой плотностью стоп-кодонов и без протяженной "открытой рамки считывания". Многие нкРНК, по-видимому, начинаются с сайтов инициации в 3'-нетранслируемых областях (3'UTR) кодирующих белок локусов. Обычно нкРНК достаточно редки и, по меньшей мере, половина нкРНК, которые были секвенированы консорциумом FANTOM, оказались не полиаденилированными. Большинство исследователей, по очевидным причинам, сосредоточилось на полиаденилированных мРНК, которые процессируются и транспортируются в цитоплазму. Недавно было показано, что набор неполиаденилированных ядерных РНК может быть очень большим, и что многие такие транскрипты образуются из так называемых межгенных областей (Cheng, J. et al. (2005) Science 308 (5725), 1149-1154; Kapranov, P. et al. (2005). Genome Res 15 (7), 987-997). Механизм, по которому нкРНК может регулировать экспрессию генов, основан на спаривании оснований с целевыми транскриптами. РНК, которые функционируют путем спаривании оснований, могут быть сгруппированы в (1) цис-кодируемые РНК, которые кодируются в том же генетическом положении, но на противоположной цепи РНК, на которую они действуют, и поэтому демонстрируют идеальную комплементарность к своей мишени, и (2) транс-кодируемые РНК, которые кодируются в положении хромосомы, отличном от РНК, на которую они действуют, и обычно не проявляют способности совершенного спаривания оснований со своими мишенями.

Не желая связываться с какой-либо теорией, воздействие на антисмысловой полинуклеотид антисмысловыми олигонуклеотидами, описанными в настоящей заявке, может изменять экспрессию соответствующих смысловых информационных РНК. Впрочем, подобная регуляция может быть либо несогласованной (антисмысловой нокдаун приводит к повышению уровня информационной РНК), либо согласованной (антисмысловой нокдаун приводит к сопутствующему снижению уровня информационной РНК). В таких случаях антисмысловые олигонуклеотиды могут быть направлены на перекрывающиеся или не перекрывающиеся части антисмыслового транскрипта, что приводит к его нокдауну или расщеплению. Идентичным путем можно направленно воздействовать как на кодирующие, так и на некодирующие антисмысловые последовательности, и при этом любая категория способна регулировать соответствующие смысловые транскрипты, согласованным или несогласованным способом. Стратегии, которые применяются при идентификации новых олигонуклеотидов для применения против мишени, могут быть основаны на нокдауне антисмысловых РНК транскриптов антисмысловыми олигонуклеотидами или любыми другими средствами модуляции нужной мишени.

Стратегия 1: В случае несогласованной регуляции проведение нокдауна антисмыслового транскрипта приводит к повышению экспрессии обычного (смыслового) гена. В случае если последний ген кодирует известную или предполагаемую мишень лекарственного средства, то тогда нокдаун ее антисмысловой копии может потенциально воспроизводить действие агониста рецептора или стимулятора фермента.

Стратегия 2: В случае согласованной регуляции можно одновременно проводить нокдаун антисмыслового и смыслового транскриптов и, таким образом, достигать синергистического понижения экспрессии обычного (смыслового) гена. Если, например, антисмысловой олигонуклеотид применяют для выполнения нокдауна, то данная стратегия может использоваться для применения одного антисмыслового олигонуклеотида, направленного на смысловой транскрипт, и другого антисмыслового олигонуклеотида, направленного на соответствующий антисмысловой транскрипт, или одного энергетически симметричного антисмыслового олигонуклеотида, который одновременно направлен на перекрывающиеся смысловой и антисмысловой транскрипты.

Согласно настоящему изобретению антисмысловые соединения включают антисмысловые олигонуклеотиды, рибозимы, олигонуклеотиды внешних вспомогательных последовательностей (EGS), миРНК соединения, одно- или двунитевые интерферирующие РНК (РНКи) соединения, такие как миРНК соединения, а также другие олигомерные соединения, которые гибридизуются, по меньшей мере, с частью целевой нуклеиновой кислоты и модулируют ее функцию. Таким образом, они могут представлять собой ДНК, РНК, ДНК-подобные, РНК-подобные молекулы или их смеси, или могут быть миметиками одного или более из них. Указанные соединения могут быть однонитевыми, двунитевыми, кольцевыми или шпилечными олигомерными соединениями и могут содержать структурные элементы, такие как внутренние или концевые выступы, участки ошибочного спаривания или петли. Антисмысловые соединения обычно получают в линейной форме, однако они могут быть соединены или получены иным способом в кольцевой и/или разветвленной форме. Антисмысловые соединения могут включать такие конструкции, как, например, две цепи, гибридизованные с формированием полностью или частично двунитевого соединения или одной цепи с достаточной самокомплементарностью, позволяющей гибридизацию и формирование полностью или частично двунитевого соединения. Две цепи могут быть связаны внутри с оставлением свободных 3' или 5' концов, или они могут быть связаны с формированием непрерывной шпилечной структуры или петли. Шпилечная структура может содержать выступающий конец на 5' или на 3' конце, с получением участка однонитевого характера. Двунитевые соединения необязательно могут включать выступающие концы. Другие модификации могут включать конъюгатные группы, присоединенные на одном из концов, в выбранных положениях нуклеотида, положениях сахаридной группы или к одной из межнуклеозидных связей. В альтернативе, две цепи могут быть связаны через ненуклеиновую или линкерную группу. При формировании только из одной цепи днРНК может принимать форму самокомплементарной молекулы шпилечного типа, которая изгибается сама на себя, формируя дуплекс. Таким образом, днРНК могут быть полностью или частично двунитевыми. Специфическая модуляция экспрессии гена может быть достигнута при стабильной экспрессии шпилек днРНК в трансгенных клеточных линиях, однако, в некоторых вариантах осуществления, экспрессия или функция гена апрегулируются. При формировании из двух цепей или одной цепи, которая принимает форму самокомплементарной молекулы шпилечного типа, которая изгибается сама на себя, формируя дуплекс, две цепи (или дуплекс-формирующие области одной цепи) представляют собой комплементарные цепи РНК, в которых основания спарены в соответствии с моделью Уотсона-Крика.

После введения в систему, соединения изобретения могут активировать действие одного или нескольких ферментов или структурных белков, которые производят расщепление или другую модификацию целевой нуклеиновой кислоты, или могут действовать через механизмы на основе захвата. В большинстве случаев нуклеиновые кислоты (включая олигонуклеотиды) могут быть описаны как "ДНК-подобные" (то есть, которые обычно содержат один или более 2'-дезокси сахара и, как правило, T, а не U основания) или "РНК-подобные" (то есть, которые обычно содержат один или более 2'-гидроксила или 2'-модифицированных сахара и, как правило, U, а не T основания). Спирали нуклеиновой кислоты могут иметь более одного типа структуры, обычно A- и B-формы. Считается, что обычно олигонуклеотиды, которые имеют B-форма-подобную структуру, являются "ДНК-подобными", а олигонуклеотиды, которые имеют A-форма-подобную структуру, являются "РНК-подобными". В некоторых (химерных) вариантах антисмысловое соединение может содержать как области, имеющие A-, так и области, имеющие B-форму.

В другом предпочтительном варианте осуществления требуемые олигонуклеотиды или антисмысловые соединения включают, по меньшей мере, одно из: антисмысловой РНК, антисмысловой ДНК, химерных антисмысловых олигонуклеотидов, антисмысловых олигонуклеотидов, включающих модифицированные связи, интерферирующих РНК (РНКи), малых интерферирующих РНК (миРНК); микро-интерферирующих РНК (мкРНК); малых временных РНК (мвРНК); или малых шпилечных РНК (мшРНК); активации генов, индуцированной малыми РНК (РНКа); малых активирующих РНК (маРНК) или комбинации перечисленного.

днРНК также может активировать экспрессию генов, механизм, который был назван "активацией генов, индуцированной малыми РНК" или РНКа. днРНК, специфичные к промоторам генов, вызывают мощную активацию транскрипции соответствующих генов. РНКа продемонстрировали в человеческих клетках, используя синтетические днРНК, называемые "малыми активирующими РНК" (маРНК). В настоящее время не известно, сохранились ли РНКа в других организмах.

Малая двунитевая РНК (днРНК), такая как малая интерферирующая РНК (миРНК) и микроРНК (мкРНК), как установили, являлась триггером эволюционно консервативного механизма, известного как РНК-интерференция (РНКи). РНКи неизменно приводит к сайленсингу генов через реструктурирование хроматина, с подавлением, таким образом, транскрипции, расщеплением комплементарной мРНК или блокированием трансляции белка. Однако, в случаях, подробно описанных в следующем ниже разделе примеров, олигонуклеотиды, как было показано, повышают экспрессию и/или функцию полинуклеотидов фактора роста эндотелия сосудов (VEGF) и кодируемых ими продуктов. днРНК также могут действовать как малые активирующие РНК (маРНК). Не желая связываться с какой-либо теорией, направленным воздействием последовательностей на промоторы генов, маРНК вызывают экспрессию целевого гена в явлении, называемом активацией транскрипции, индуцированной днРНК (РНКа).

В другом варианте осуществления "предпочтительные целевые сегменты", идентифицированные в настоящей заявке, могут применяться в скрининге дополнительных соединений, которые модулируют экспрессию полинуклеотидов фактора роста эндотелия сосудов (VEGF). "Модуляторы" являются такими соединениями, которые понижают или повышают экспрессию молекулы нуклеиновой кислоты, кодирующей фактор роста эндотелия сосудов (VEGF), и которые включают часть длиной, по меньшей мере, 5 нуклеотидов, которая является комплементарной предпочтительному целевому сегменту. Способ скрининга включает этапы контакта предпочтительного целевого сегмента молекулы нуклеиновой кислоты, кодирующей смысловые или природные антисмысловые полинуклеотиды фактора роста эндотелия сосудов (VEGF), с одним или более модуляторами-кандидатами, и отбора одного или более модуляторов-кандидатов, которые понижают или повышают экспрессию молекулы нуклеиновой кислоты, кодирующей полинуклеотиды фактора роста эндотелия сосудов (VEGF), например SEQ ID NO: 4-9. После того как было показано, что модулятор или модуляторы кандидаты способны модулировать (например, понижать или повышать) экспрессию молекулы нуклеиновой кислоты, кодирующей полинуклеотиды фактора роста эндотелия сосудов (VEGF), модулятор может применяться в последующих исследованиях функции полинуклеотидов фактора роста эндотелия сосудов (VEGF), или применяться в качестве исследовательского, диагностического или терапевтического агента согласно настоящему изобретению.

Направленное воздействие на природную антисмысловую последовательность предпочтительно позволяет модулировать функцию целевого гена. Например, гена VEGF (NM_001025366.1, Фиг. 2). В предпочтительном варианте осуществления мишенью является антисмысловой полинуклеотид гена фактора роста эндотелия сосудов. В предпочтительном варианте осуществления антисмысловой олигонуклеотид направлен на смысловые и/или природные антисмысловые последовательности полинуклеотидов фактора роста эндотелия сосудов (VEGF) (например, NM_001025366.1, Фиг. 2), варианты, аллели, изоформы, гомологи, мутанты, производные, фрагменты и комплементарные последовательности к ним. Предпочтительно олигонуклеотидом является антисмысловая молекула, а мишени включают кодирующие и некодирующие области антисмысловых и/или смысловых полинуклеотидов VEGF.

Предпочтительные целевые сегменты настоящего изобретения также могут быть комбинированы с их соответствующими комплементарными антисмысловыми соединениями настоящего изобретения с формированием стабилизированных двунитевых (дуплексных) олигонуклеотидов.

В уровне техники было показано, что такие двунитевые олигонуклеотидные молекулы модулируют экспрессию мишени и регулируют трансляцию, а также процессинг РНК с помощью антисмыслового механизма. Кроме того, двунитевые молекулы могут быть подвергнуты химическим модификациям (Fire et al., (1998) Nature, 391, 806-811; Timmons and Fire, (1998) Nature, 395, 854; Timmons et al., (2001) Gene, 263, 103-112; Tabara et al., (1998) Science, 282, 430-431; Montgomery et al., (1998) Proc. Natl Acad. Sci. USA, 95, 15502-15507; Tuschl et al., (1999) Genes Dev., 13, 3191-3197; Elbashir et al., (2001) Nature, 411, 494-498; Elbashir et al., (2001) Genes Dev. 15, 188-200). Например, такие двунитевые молекулы, как было показано, ингибируют мишень посредством классической гибридизации антисмысловой цепи дуплекса с мишенью, инициируя, таким образом, ферментативную деградацию мишени (Tijsterman et al., (2002) Science, 295, 694-697).

В предпочтительном варианте осуществления антисмысловой олигонуклеотид направлен на полинуклеотиды фактора роста эндотелия сосудов (VEGF) (например, NM_001025366.1), варианты, аллели, изоформы, гомологи, мутанты, производные, фрагменты и комплементарные последовательности к ним. Предпочтительно олигонуклеотид является антисмысловой молекулой.

В соответствии с вариантами осуществления изобретения целевая молекула нуклеиновой кислоты не ограничена только фактором роста эндотелия сосудов (VEGF), но распространяется на любые изоформы, рецепторы, гомологи и т.п. молекул фактора роста эндотелия сосудов (VEGF).

В другом предпочтительном варианте осуществления олигонуклеотид направлен на природную антисмысловую последовательность полинуклеотидов VEGF, например, полинуклеотиды, приведенные в SEQ ID NO: 2 и 3, а также любые варианты, аллели, гомологи, мутанты, производные, фрагменты и комплементарные последовательности к ним. Примеры антисмысловых олигонуклеотидов приведены в SEQ ID NO: 4-9.

В одном варианте осуществления олигонуклеотиды комплементарны или связываются с последовательностями нуклеиновой кислоты антисмысловой последовательности фактора роста эндотелия сосудов (VEGF), включая без ограничения некодирующие смысловые и/или антисмысловые последовательности, связанные с полинуклеотидами фактора роста эндотелия сосудов (VEGF), и модулируют экспрессию и/или функцию молекул фактора роста эндотелия сосудов (VEGF).

В другом предпочтительном варианте осуществления олигонуклеотиды комплементарны или связываются с последовательностями нуклеиновой кислоты природной антисмысловой последовательности VEGF, приведенной в SEQ ID NO: 2 и 3, и модулируют экспрессию и/или функцию молекул VEGF.

В предпочтительном варианте осуществления олигонуклеотиды включают последовательности длиной, по меньшей мере, 5 последовательных нуклеотидов из SEQ ID NO: 4-9 и модулируют экспрессию и/или функцию молекул фактора роста эндотелия сосудов (VEGF).

Полинуклеотиды-мишени включают VEGF, включая представителей его семейства, варианты VEGF; мутанты VEGF, включая SNP; некодирующие последовательностей VEGF; аллели VEGF; видовые варианты, фрагменты и т.п. Предпочтительно олигонуклеотид является антисмысловой молекулой.

В другом предпочтительном варианте осуществления олигонуклеотид, направленный на полинуклеотиды фактора роста эндотелия сосудов (VEGF), включает: антисмысловую РНК, РНК-интерференцию (РНКи), малую интерферирующую РНК (миРНК); микро-интерферирующую РНК (мкРНК); малую временную РНК (мвРНК); или малую шпилечную РНК (мшРНК); активацию гена, индуцированную малой РНК (РНКа); или малую активирующую РНК (маРНК).

В другом предпочтительном варианте осуществления направленное воздействие на полинуклеотиды фактора роста эндотелия сосудов (VEGF), например, SEQ ID NO: 2 и 3, модулирует экспрессию или функцию указанных мишеней. В одном варианте осуществления экспрессия или функция повышающе регулируются по сравнению с контролем. В другом предпочтительном варианте осуществления экспрессия или функция понижающе регулируется по сравнению с контролем.

В другом предпочтительном варианте осуществления антисмысловые соединения включают последовательности, приведенные в SEQ ID NO: 4-9. Указанные олигонуклеотиды могут включать один или более модифицированных нуклеотидов, более короткие или более длинные фрагменты, модифицированные связи и т.п.

В другом предпочтительном варианте осуществления SEQ ID NO: 4 - 9 включают один или более LNA нуклеотидов.

Модуляция требуемой целевой нуклеиновой кислоты может быть выполнена несколькими способами, известными в уровне техники. Например, с применением антисмысловых олигонуклеотидов, миРНК и т.д. Ферментативные молекулы нуклеиновой кислоты (например, рибозимы) представляют собой молекулы нуклеиновой кислоты, способные к катализации одной или более различных реакций, включая способность многократно расщеплять другие отдельные молекулы нуклеиновой кислоты специфично последовательности нуклеотидных оснований. Такие ферментативные молекулы нуклеиновой кислоты могут применяться, например, для направленного воздействия фактически на любой РНК-транскрипт (Zaug et al., 324, Nature 429 1986; Cech, 260 JAMA 3030, 1988; и Jefferies et al., 17 Nucleic Acids Research 1371, 1989).

Благодаря своей сиквенс-специфичности, транс-расщепляющие ферментативные молекулы нуклеиновой кислоты являются перспективными терапевтическими агентами для лечения заболеваний у человека (Usman & McSwiggen, (1995) Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, (1995) J. Med. Chem. 38, 2023-2037). Ферментативные молекулы нуклеиновой кислоты могут быть созданы для расщепления специфических РНК-мишеней в окружении клеточной РНК. Подобный акт расщепления вызывает потерю функциональности у мРНК и блокирует экспрессию белка с указанной РНК. Таким способом может быть селективно ингибирован синтез белка, ассоциируемого с заболеванием.

В большинстве случаев ферментативные нуклеиновые кислоты, обладающие РНК-расщепляющей активностью, действуют при первичном связывании с РНК-мишенью. Подобное связывание проходит через мишень-связывающую часть ферментативной нуклеиновой кислоты, которая расположена в непосредственной близости с ферментативной частью молекулы, которая производит расщепление РНК-мишени. Таким образом, ферментативная нуклеиновая кислота сначала узнает, а затем связывает РНК-мишень путем спаривания комплементарных оснований, и, после связывания с правильным сайтом, энзиматически расщепляет РНК-мишень. Стратегическое расщепление такой РНК-мишени нарушает ее способность направлять синтез кодируемого белка. После связывания и расщепления РНК-мишени ферментативной нуклеиновой кислотой, последняя освобождается от расщепленной РНК для поиска другой мишени, и может затем многократно связывать и расщеплять новые мишени.

Несколько подходов, таких как стратегии in vitro селекции (эволюции) (Orgel, (1979) Proc. R. Soc. London, B 205, 435), использовали для создания новых катализаторов на основе нуклеиновых кислот, способных катализировать различные реакции, такие как расщепление и лигирование фосфодиэфирных связей и амидных связей (Joyce, (1989) Gene, 82, 83-87; Beaudry et al., (1992) Science 257, 635-641; Joyce, (1992) Scientific American 267, 90-97; Breaker et al., (1994) TIBTECH 12, 268; Bartel et al., (1993) Science 261:1411-1418; Szostak, (1993) TIBS 17, 89-93; Kumar et al., (1995) FASEB J., 9, 1183; Breaker, (1996) Curr. Op. Biotech., 1, 442).

Создание рибозимов, оптимальных для каталитической активности, могло бы внести значительный вклад в любую стратегию, в которой используются расщепляющие РНК рибозимы с целью регуляции экспрессии генов. Молоточковый рибозим (hammerhead), например, функционирует с каталитической скоростью (kcat) приблизительно 1 мин-1 в присутствии насыщающих концентраций (10 мМ) Mg2+ кофактора. Искусственный рибозим "РНК-лигаза", как показали, катализировал соответствующую реакцию самомодификации со скоростью приблизительно 100 мин-1. Кроме того, известно, что некоторые модифицированные молоточковые рибозимы, которые имеют состоящие из ДНК субстрат-связывающие плечи, катализирует расщепление РНК с числом оборотов, которое приближается к 100 мин-1. Наконец, замена определенного остатка в каталитическом ядре молоточковой части некоторыми аналогами нуклеотидов позволяет получать модифицированные рибозимы, которые демонстрируют до 10-кратного повышения каталитической скорости. Подобные результаты демонстрируют, что рибозимы могут активировать химические превращения с каталитическими скоростями, которые значительно превышают скорости, демонстрируемые in vitro большинством природных, саморасщепляемых рибозимов. При этом возможно, что структуры некоторых саморасщепляемых рибозимов могут быть оптимизированы с целью получения максимальной каталитической активности, или что могут быть получены совершенно новые мотивы РНК, которые показывают значительно более высокие скорости при расщеплении фосфодиэфирных связей РНК.

Межмолекулярное расщепление РНК-субстрата РНК-катализатором, который соответствует модели "головка молотка" (hammerhead), впервые было показано в 1987 году (Uhlenbeck, O.C. (1987) Nature, 328:596-600). Был выделен РНК-катализатор, который затем реагировал с несколькими молекулами РНК, подтверждая, что он действительно обладал каталитической активностью.

Каталитические РНК, созданные на основе мотива "hammerhead" использовали для расщепления специфических целевых последовательностей, производя соответствующие замены оснований в каталитической РНК, чтобы обеспечивать правильное спаривание с нужными основаниями целевых последовательностей (Haseloff and Gerlach, (1988) Nature, 334, 585; Walbot and Bruening, (1988) Nature, 334, 196; Uhlenbeck, O. C. (1987) Nature, 328:596-600; Koizumi, M., et al. (1988) FEBS Lett., 228:228-230). Это позволило использовать каталитическую РНК для расщепления специфических целевых последовательностей, указывая на то, что каталитические РНК, созданные в соответствии с моделью "hammerhead" потенциально могут расщеплять специфические РНК-субстраты in vivo, (см. Haseloff and Gerlach, (1988) Nature, 334, 585; Walbot and Bruening, (1988) Nature, 334, 196; Uhlenbeck, O. C. (1987) Nature, 328: 596-600).

РНК-интерференция (РНКи) стала мощным инструментом для модуляции экспрессии генов у млекопитающих и в клетках млекопитающих. Данный подход требует доставки малой интерферирующей РНК (миРНК), либо в виде РНК непосредственно, либо в виде ДНК, с использованием экспрессионной плазмиды или вируса и кодирующей последовательности малых шпилечных РНК, которые процессируются в миРНК. Данная система обеспечивает эффективный транспорт пре-миРНК в цитоплазму, в которой они активны, а также позволяет применять регулируемые и тканеспецифические промоторы для экспрессии генов.

В предпочтительном варианте осуществления олигонуклеотид или антисмысловое соединение включают олигомер или полимер рибонуклеиновой кислоты (РНК) и/или дезоксирибонуклеиновой кислоты (ДНК), или их миметик, химеру, аналог или гомолог. Указанный термин включает олигонуклеотиды, состоящие из природных нуклеотидов, сахаридных групп и ковалентных межнуклеозидных (скелетных) связей, а также олигонуклеотиды, имеющие неприродные части, которые функционируют аналогичным образом. Такие модифицированные или замещенные олигонуклеотиды часто предпочтительны по сравнению с нативными формами из-за желательных свойств, таких как, например, повышенный захват клетками, повышенная аффинность к целевой нуклеиновой кислоте и повышенная стабильность в присутствии нуклеаз.

Согласно настоящему изобретению, олигонуклеотиды или "антисмысловые соединения" включают антисмысловые олигонуклеотиды (например, РНК, ДНК, их миметик, химеру, аналог или гомолог), рибозимы, олигонуклеотиды внешних вспомогательных последовательностей (EGS), миРНК соединения, одно- или двунитевые интерферирующие РНК (РНКи) соединения, такие как соединения миРНК, маРНК, аРНК, а также другие олигомерные соединения, которые гибридизуются, по меньшей мере, с частью целевой нуклеиновой кислоты и модулируют ее функцию. Таким образом, они могут представлять собой ДНК, РНК, ДНК-подобные, РНК-подобные молекулы, или их смеси, или могут быть миметиками одного или более из них. Указанные соединения могут быть однонитевыми, двунитевыми, кольцевыми или шпилечными олигомерными соединениями и могут содержать структурные элементы, такие как внутренние или концевые выступы, участки ошибочного спаривания или петли. Антисмысловые соединения обычно получают в линейной форме, однако их можно соединять или получать иным способом в кольцевой и/или разветвленной форме. Антисмысловые соединения могут включать конструкции, такие как, например, две цепи, гибридизованные с формированием полностью или частично двунитевого соединения или одной цепи с достаточной самокомплементарностью, позволяющей гибридизацию и формирование полностью или частично двунитевого соединения. Две цепи могут быть связаны внутри с оставлением свободных 3' или 5' концов, или они могут быть связаны с формированием непрерывной шпилечной структуры или петли. Шпилечная структура может содержать выступающий конец на 5' или на 3' конце, с получением участка однонитевого характера. Двунитевые соединения необязательно могут включать выступающие концы. Другие модификации могут включать конъюгатные группы, присоединенные на одном из концов, в выбранных положениях нуклеотида, положениях сахаридной группы или к одной из межнуклеозидных связей. В альтернативе, две цепи могут быть связаны через ненуклеиновую или линкерную группу. При формировании только из одной цепи днРНК может принимать форму самокомплементарной молекулы шпилечного типа, которая изгибается сама на себя, формируя дуплекс. Таким образом, днРНК могут быть полностью или частично двунитевыми. Специфическая модуляция экспрессии гена может быть достигнута при стабильной экспрессии шпилек днРНК в трансгенных клеточных линиях (Hammond et al., (1991) Nat. Rev. Genet., 2, 110-119; Matzke et al., (2001) Curr. Opin. Genet. Dev., 11, 221-227; Sharp, (2001) Genes Dev., 15, 485-490). При формировании из двух цепей или одной цепи, которая принимает форму самокомплементарной молекулы шпилечного типа, которая изгибается сама на себя, формируя дуплекс, две цепи (или дуплекс-формирующие области одной цепи) представляют собой комплементарные цепи РНК, в которых основания спарены в соответствии с моделью Уотсона-Крика.

После введения в систему, соединения изобретения могут активировать действие одного или нескольких ферментов или структурных белков, которые производят расщепление или другую модификацию целевой нуклеиновой кислоты, или могут действовать через механизмы на основе захвата. В большинстве случаев нуклеиновые кислоты (включая олигонуклеотиды) могут быть описаны как "ДНК-подобные" (то есть, которые обычно содержат один или более 2'-дезокси сахара и, как правило, T, а не U основания) или "РНК-подобные" (то есть, которые обычно содержат один или более 2'-гидроксила или 2'-модифицированных сахара и, как правило, U, а не T основания). Спирали нуклеиновой кислоты могут иметь более одного типа структуры, обычно A- и B-формы. Считается, что обычно олигонуклеотиды, которые имеют B-форма-подобную структуру, являются "ДНК-подобными", а олигонуклеотиды, которые имеют A-форма-подобную структуру, являются "РНК-подобными". В некоторых (химерных) вариантах антисмысловое соединение может содержать как области, имеющие A-, так и области, имеющие B-форму.

Антисмысловые соединения в соответствии с настоящим изобретением могут включать антисмысловую часть длиной от приблизительно 5 до приблизительно 80 нуклеотидов (то есть, от приблизительно 5 до приблизительно 80 связанных нуклеозидов). Это относится к длине антисмысловой цепи или части антисмыслового соединения. Другими словами, однонитевое антисмысловое соединение согласно изобретению включает от 5 до приблизительно 80 нуклеотидов, а двунитевое антисмысловое соединение согласно изобретению (такое как днРНК, например) включает смысловую и антисмысловую цепь или часть длиной от 5 до приблизительно 80 нуклеотидов. Среднему специалисту в данной области будет очевидно, что под этим подразумеваются антисмысловые части длиной 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 или 80 нуклеотидов, или в пределах любого диапазона между указанными длинами.

В одном варианте осуществления антисмысловые соединения изобретения имеют антисмысловые части длиной 10-50 нуклеотидов. Среднему специалисту в данной области будет очевидно, что это включает в себя олигонуклеотиды, имеющие антисмысловые части длиной 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 или 50 нуклеотидов, или в пределах любого диапазона между указанными длинами. В некоторых вариантах осуществления длина олигонуклеотидов составляет 15 нуклеотидов.

В одном варианте осуществления антисмысловые или олигонуклеотидные соединения изобретения имеют антисмысловые части длиной 12 или 13-30 нуклеотидов. Среднему специалисту в данной области будет очевидно, что это включает в себя антисмысловые соединения, имеющие антисмысловые части длиной 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов, или в пределах любого диапазона между указанными длинами.

В другом предпочтительном варианте осуществления олигомерные соединения настоящего изобретения также включают варианты, в которых в одном или более положениях нуклеотида в соединении присутствует другое основание. Например, если первым нуклеотидом является аденозин, могут быть получены варианты, которые в указанном положении содержат тимидин, гуанозин или цитидин. Это может быть выполнено в любом из положений антисмысловых или днРНК соединений. Затем указанные соединения тестируют с применением способов, описанных в настоящей заявке, чтобы определить их способность ингибировать экспрессию целевой нуклеиновой кислоты.

В некоторых вариантах осуществления гомология, идентичность последовательности или комплементарность между антисмысловым соединением и мишенью составляет от приблизительно 40% до приблизительно 60%. В некоторых вариантах осуществления гомология, идентичность последовательности или комплементарность составляет от приблизительно 60% до приблизительно 70%. В некоторых вариантах осуществления гомология, идентичность последовательности или комплементарность составляет от приблизительно 70% до приблизительно 80%. В некоторых вариантах осуществления гомология, идентичность последовательности или комплементарность составляет от приблизительно 80% до приблизительно 90%. В некоторых вариантах осуществления гомология, идентичность последовательности или комплементарность составляет приблизительно 90%, приблизительно 92%, приблизительно 94%, приблизительно 95%, приблизительно 96%, приблизительно 97%, приблизительно 98%, приблизительно 99% или приблизительно 100%.

В другом предпочтительном варианте осуществления антисмысловые олигонуклеотиды, такие как, например, молекулы нуклеиновой кислоты, приведенные в SEQ ID NO: 4-9, включают одну или более замен или модификаций. В одном варианте осуществления нуклеотиды заменены блокированными нуклеиновыми кислотами (LNA).

В другом предпочтительном варианте осуществления олигонуклеотиды специфично взаимодействуют с одной или более областей смысловых и/или антисмысловых молекул нуклеиновой кислоты кодирующих и/или некодирующих последовательностей, связанных с VEGF, и последовательностями, приведенными в SEQ ID NO: 1-3. Олигонуклеотиды также специфично взаимодействуют с перекрывающимися областями из SEQ ID NO: 1-3.

Некоторые предпочтительные олигонуклеотиды настоящего изобретения являются химерными олигонуклеотидами. "Химерные олигонуклеотиды" или "химеры", в рамках настоящего изобретения, представляют собой олигонуклеотиды, которые содержат две или более химически различных областей, каждая из которых состоит, по меньшей мере, из одного нуклеотида. Указанные олигонуклеотиды обычно содержат, по меньшей мере, одну область модифицированных нуклеотидов, которая придает одно или более полезных свойств (таких как, например, повышенная устойчивость к нуклеазам, повышенный захват клетками, повышенная аффинность связывания с мишенью), и область, которая является субстратом для ферментов, способных расщеплять РНК:ДНК или РНК:РНК гибриды. В качестве примера, РНКаза H представляет собой клеточную эндонуклеазу, которая расщепляет РНК-цепь РНК:ДНК дуплекса. Активация РНКазы H, следовательно, приводит к расщеплению РНК-мишени, сильно повышая, таким образом, эффективность антисмысловой модуляции экспрессии генов. В результате сопоставимые результаты часто могут быть получены с более короткими олигонуклеотидами при использовании химерных олигонуклеотидов, по сравнению с фосфоротиоатными дезоксиолигонуклеотидами, которые гибридизуются с той же целевой областью. Расщепление РНК-мишени может быть обнаружено с помощью стандартного гель-электрофореза и, в случае необходимости, известных из уровня техники сопутствующих методов гибридизации нуклеиновых кислот. В одном предпочтительном варианте осуществления химерный олигонуклеотид включает, по меньшей мере, одну область, модифицированную с целью повышения аффинности связывания с мишенью, и, как правило, области, которая действует в качестве субстрата для РНКазы H. Аффинность олигонуклеотида к его мишени (в данном случае к нуклеиновой кислоте, кодирующей ras) обычно определяют путем измерения Tm пары олигонуклеотида/мишени, которая является температурой, при которой олигонуклеотид и мишень диссоциируют; диссоциацию определяют спектрофотометрически. Чем выше Tm, тем больше аффинность олигонуклеотида к мишени.

Химерные антисмысловые соединения изобретения могут быть сформированы в виде комплексных структур из двух или более олигонуклеотидов, модифицированных олигонуклеотидов, олигонуклеозидов и/или миметиков олигонуклеотидов, как описано выше. Такие соединения также упоминались в уровне техники как гибриды или гэпмеры. Репрезентативные патенты США, в которых описано получение подобных гибридных структур, включают, помимо прочего, патенты США 5013830; 5149797; 5220007; 5256775; 5366878; 5403711; 5491133; 5565350; 5623065; 5652355; 5652356 и 5700922, каждый из которых включен в настоящую заявку ссылкой.

В другом предпочтительном варианте осуществления область олигонуклеотида, которая является модифицированной, включает, по меньшей мере, один нуклеотид, модифицированный в 2'-положении сахара, наиболее предпочтительно 2'-O-алкил, 2'-O-алкил-O-алкил или 2'-фтор-модифицированным нуклеотидом. В других предпочтительных вариантах осуществления РНК модификации включают 2'-фтор, 2'-амино и 2'-O-метил модификации на рибозе пиримидинов, апуриновые остатки или инвертированные основания на 3'-концах РНК. Такие модификации обычно вводят в олигонуклеотиды, причем было показано, что подобные олигонуклеотиды обладают более высокой Tm (то есть, более высокой аффинностью связывания с мишенью), чем 2'-дезоксиолигонуклеотиды против данной мишени. Эффектом такой повышенной аффинности является существенное усиление ингибирования РНКи олигонуклеотидом экспрессии гена. РНКаза H представляет собой клеточную эндонуклеазу, которая расщепляет РНК цепь РНК:ДНК дуплексов; активация данного фермента приводит в результате к расщеплению РНК-мишени и, таким образом, может сильно повышать эффективность РНКи ингибирования. Расщепление РНК-мишени может быть подтверждено с помощью стандартного гель-электрофореза. В другом предпочтительном варианте осуществления химерный олигонуклеотид также модифицирован с целью повышения устойчивости к нуклеазам. Клетки содержат разнообразные экзо- и эндонуклеазы, которые могут расщеплять нуклеиновые кислоты. Ряд модификаций нуклеотидов и нуклеозидов, как было показано, делает олигонуклеотид, в который они были введены, более устойчивым к расщеплению нуклеазами, по сравнению с нативным олигодезоксинуклеотидом. Устойчивость к нуклеазам обычно определяют путем инкубирования олигонуклеотидов с клеточными экстрактами или растворами выделенных нуклеаз и измерения уровня интактного олигонуклеотида, остающегося с течением некоторого времени, обычно с помощью гель-электрофореза. Олигонуклеотиды, которые были модифицированы с целью повышения их устойчивости к нуклеазам, остаются интактными в течение более длительного времени по сравнению с немодифицироваными олигонуклеотидами. Целый ряд олигонуклеотидных модификаций, как было продемонстрировано, повышает или придает устойчивость к нуклеазам. Олигонуклеотиды, которые содержат, по меньшей мере, одну фосфоротиоатную модификацию, на настоящий момент являются более предпочтительными. В некоторых случаях, олигонуклеотидные модификации, которые повышают аффинность связывания с мишенью, также способны независимо повышать устойчивость к нуклеазам. Некоторые требуемые модификации можно найти в De Mesmaeker et al., (1995) Acc. Chem. Res., 28:366-374.

Конкретные примеры некоторых предпочтительных олигонуклеотидов, предусмотренные для настоящего изобретения, включают олигонуклеотиды, которые включают модифицированные основания, например, фосфоротиоаты, фосфотриэфиры, метилфосфонаты, короткие алкильные или циклоалкильные межсахаридные связи, или короткие гетероатомные или гетероциклические межсахаридные связи. Наиболее предпочтительными являются олигонуклеотиды с фосфоротиоатными основаниями и олигонуклеотиды с гетероатомными основаниями, особенно CH2-NH-O-CH2, CH2-N(CH3)-O-CH2 [известный как метилен-(метилимино) или MMI скелет], CH2-O-N(CH3)-CH2, CH2-N(CH3)-N(CH3)-CH2 и O-N(CH3)-CH2-CH2 скелеты, в которых нативный фосфодиэфирный скелет представлен как O-P-O-CH2). Амидные скелеты, раскрытые в De Mesmaeker et al. (1995) Acc. Chem. Res. 28:366-374, также являются предпочтительными. Также предпочтительными являются олигонуклеотиды, содержащие морфолиновые скелетные структуры (Summerton and Weller, патент США 5034506). В других предпочтительных вариантах осуществления, например, в скелете пептид-нуклеиновой кислоты (ПНК), фосфодиэфирный скелет олигонуклеотида заменен полиамидным скелетом, а нуклеотиды связаны напрямую или опосредовано с аза-атомами азота полиамидного скелета (Nielsen et al., (1991) Science 254, 1497). Олигонуклеотиды также могут включать одну или более замещенных сахаридных групп. Предпочтительные олигонуклеотиды в 2'-положении включают одно из следующего: ОН, SH, SCH3, F, OCN, OCH3 OCH3, OCH3 O(CH2)n-CH3, O(CH2)n-NH2 или O(CH2)n-CH3, где n равно от 1 до приблизительно 10; C1-C10 низший алкил, алкоксиалкокси, замещенный низший алкил, алкарил или аралкил; Cl; Br; CN; CF3; OCF3; O-, S- или N-алкил; O-, S- или N-алкенил; SOCH3; SO2-CH3; ONO2; NO2; N3; NH2; гетероциклоалкил; гетероциклоалкарил; аминоалкиламино; полиалкиламино; замещенный силил; РНК-расщепляющую группу; репортерную группу; интеркалятор; группу, улучшающую фармакокинетические свойства олигонуклеотида; или группу, улучшающую фармакодинамические свойства олигонуклеотида, а также другие заместители, обладающие аналогичными свойствами. Предпочтительная модификация включает 2'-метоксиэтокси [2'-O-CH2-CH2-OCH3, также известный как 2'-O-(2-метоксиэтил)] (Martin et al., (1995) Helv. Chim. Acta, 78, 486). Другие предпочтительные модификации включают 2'-метокси (2'-O-CH3), 2'-пропокси (2'-OCH2-CH2CH3) и 2'-фтор (2'-F). Подобные модификации также могут быть сделаны в других положениях олигонуклеотида, особенно в 3'-положении сахара на 3'-концевом нуклеотиде и 5'-положении 5'-концевого нуклеотида. Олигонуклеотиды также могут содержать миметики сахаров, например, циклобутильные вместо пентофуранозильной группы.

Олигонуклеотиды также могут включать, дополнительно или альтернативно, модификации или замены нуклеиновых оснований (часто именуемых в уровне техники просто как "основания"). Используемые в настоящей заявке "немодифицированные" или "природные" нуклеотиды включают аденин (A), гуанин (G), тимин (T), цитозин (C) и урацил (U). Модифицированные нуклеотиды включают нуклеотиды, редко или временно присутствующие в природных нуклеиновых кислотах, например, гипоксантин, 6-метиладенин, 5-Me-пиримидины, в особенности 5-метилцитозин (также называемый 5-метил-2'-дезоксицитозин и часто упоминаемый в уровне техники как 5-Me-C), 5-гидроксиметилцитозин (HMC), гликозил-HMC и гентобиозил-HMC, а также синтетические нуклеотиды, например, 2-аминоаденин, 2-(метиламино)аденин, 2-(имидазолилалкил)аденин, 2-(аминоалкиламино)аденин или другие гетерозамещенные алкиладенины, 2-тиоурацил, 2-тиотимин, 5-бромурацил, 5-гидроксиметилурацил, 8-азагуанин, 7-деазагуанин, N6(6-аминогексил)аденин и 2,6-диаминопурин (Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp75-77; Gebeyehu, G., (1987) et al. Nucl. Acids Res. 15:4513). Может быть включено "универсальное" основание, известное в уровне техники, например, инозин. Было показано, что 5-Me-C замещения повышают стабильность дуплекса нуклеиновой кислоты на 0,6-1,2°C. (Sanghvi, Y.S., in Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, стр. 276-278), и в настоящий момент являются предпочтительными замещениями оснований.

Другая модификация олигонуклеотидов изобретения включает химическое присоединение к олигонуклеотиду одной или более групп или конъюгатов, которые повышают активность или клеточный захват олигонуклеотида. Такие группы включают, помимо прочего, липидные группы, такие как холестериновая группа, холестерильная группа (Letsinger et al., (1989) Proc. Natl. Acad. Sci. USA 86, 6553), холевую кислоту (Manoharan et al., (1994) Bioorg. Med. Chem. Let. 4, 1053), тиоэфир, например, гексил-S-тритилтиол (Manoharan et al. (1992) Ann. N Y. Acad. Sci. 660, 306; Manoharan et al. (1993) Bioorg. Med. Chem. Let. 3, 2765), тиохолестерин (Oberhauser et al., (1992) Nucl. Acids Res. 20, 533), алифатические, например, додекандиоловые или ундецильные остатки (Saison-Behmoaras et al., EMBO J. 1991, 10, 111; Kabanov et al., (1990) FEBS Lett. 259, 327; Svinarchuk et al., (1993) Biochimie 75, 49), фосфолипид, например, ди-гексадецил-рац-глицерин или триэтиламмоний 1,2-ди-O-гексадецил-рац-глицеро-3-H-фосфонат (Manoharan et al., (1995) Tetrahedron Lett. 36, 3651; Shea et al. (1990) Nucl. Acids Res. 18, 3777), полиаминовую или полиэтиленгликолевую цепь (Manoharan et al. (1995) Nucleosides & Nucleotides, 14, 969), или адамантан-уксусную кислоту (Manoharan et al. (1995) Tetrahedron Lett. 36, 3651). Олигонуклеотиды, включающие липофильные группы, а также способы получения таких олигонуклеотидов известны в уровне техники, например, патенты США 5138045, 5218105 и 5459255.

Не обязательно одинаково модифицировать все положения в данном олигонуклеотиде, и фактически больше одной из вышеуказанных модификаций может быть включено в один олигонуклеотид или даже в один нуклеозид в олигонуклеотиде. Настоящее изобретение также включает олигонуклеотиды, которые являются химерным олигонуклеотидами, как определено выше.

В другом варианте осуществления молекула нуклеиновой кислоты настоящего изобретения конъюгирована с другой группой, включая, помимо прочего, апуриновые нуклеотиды, полиэфир, полиамин, полиамиды, пептиды, углеводы, липиды или многоуглеводородные соединения. Специалистам, квалифицированным в данной области техники, известно, что указанные молекулы могут быть связаны с одним или более любыми нуклеотидами, включающими молекулу нуклеиновой кислоты в нескольких положениях на сахаридной группе, основании или фосфатной группе.

Олигонуклеотиды, применяемые в соответствии с настоящим изобретением, могут быть получены удобным и стандартным путем с помощью известной методики твердофазного синтеза. Оборудование для такого синтеза поставляет несколько фирм, включая Applied Biosystems. Для такого синтеза также могут использоваться любые другие средства; практический синтез олигонуклеотидов хорошо знаком среднему специалисту в данной области. Также хорошо известно применение подобных методов для получения других олигонуклеотидов, таких как фосфоротиоаты и алкилированные производные. Также известно применение подобных методов и коммерчески доступных модифицированных амидитов и изделий из стекла с регулируемой пористостью (CPG), таких как биотин, флуоресцеин, акридин или псорален-модифицированных амидитов и/или CPG (поставляемых Glen Research, Sterling VA), для синтеза флуоресцентно меченых, биотинилированных или других модифицированных олигонуклеотидов, таких как олигонуклеотиды, модифицированные холестерином.

В соответствии с изобретением, применение модификаций, например, применение мономеров LNA, для повышения эффективности, специфичности и продолжительности действия и расширения путей введения олигонуклеотидов состоит из современных химических методов, таких как MOE, ANA, FANA, PS и т.д. (Uhlman, et al. (2000) Current Opinions in Drug Discovery & Development Vol. 3 No 2). Это может быть достигнуто путем замены некоторых мономеров в настоящих олигонуклеотидах мономерами LNA. LNA модифицированный олигонуклеотид может иметь размер, аналогичный исходному соединению, или может быть больше или, предпочтительно, меньше. Предпочтительно, такие LNA-модифицированные олигонуклеотиды содержат менее чем приблизительно 70%, более предпочтительно менее чем приблизительно 60%, наиболее предпочтительно менее чем приблизительно 50% LNA мономеров, а их размеры составляют приблизительно 5-25 нуклеотидами, более предпочтительно приблизительно 12-20 нуклеотидами.

Предпочтительные скелеты модифицированных олигонуклеотидов включают, помимо прочего, фосфоротиоаты, хиральные фосфоротиоаты, фосфородитиоаты, фосфотриэфиры, аминоалкилфосфотриэфиры, метил- и другие алкилфосфонаты, включающие 3'-алкилен-фосфонаты и хиральные фосфонаты, фосфинаты, фосфорамидаты, включающие 3'-аминофосфорамидат и аминоалкилфосфорамидаты, тионофосфорамидаты, тионоалкилфосфонаты, тионоалкилфосфотриэфиры и боранофосфаты, имеющие нормальные 3'-5' связи, их 2'-5' связанные аналоги, а также имеющие инвертированную полярность, где смежные пары нуклеозидных звеньев связаны 3'-5'-5'-3' или 2'-5'-5'-2'. Также включены различные соли, смешанные соли и свободные кислотные формы.

Репрезентативные патенты США, в которых описано получение вышеуказанных фосфорсодержащих связей, включают, помимо прочего, патенты США 3687808; 4,469,863; 4476301; 5023243; 5177196; 5188897; 5264423; 5276019; 5278302; 5286717; 5321131; 5399676; 5405939; 5453496; 5455233; 5466677; 5476925; 5519126; 5,536,821; 5541306; 5550111; 5563253; 5571799; 5587361 и 5625050, каждый из которых включен в настоящую заявку ссылкой.

Предпочтительные скелеты модифицированных олигонуклеотидов, которые не включают атом фосфора, сформированы короткими алкильными или циклоалкильными межнуклеозидными связями, смешанными гетероатомными и алкильными или циклоалкильными межнуклеозидными связями, или одной или более короткими гетероатомными или гетероциклическими межнуклеозидными связями. Они включают скелеты, которые содержат морфолиновые связи (частично сформированные из сахаридной части нуклеозида); силоксановые скелеты; сульфидные, сульфоксидные и сульфоновые скелеты; формацетильные и тиоформацетильные скелеты; метилен формацетильные и тиоформацетильные скелеты; алкенсодержащие скелеты; сульфаматные скелеты; метилениминовые и метиленгидразиновые скелеты; сульфонатные и сульфонамидные скелеты; амидные скелеты; и другие, содержащие смешанные N, O, S и CH2 составные элементы.

Репрезентативные патенты США, в которых описано получение вышеуказанных олигонуклеозидов, включают, помимо прочего, патенты США 5034506; 5166315; 5185444; 5214134; 5216141; 5235033; 5264562; 5264564; 5405938; 5434257; 5466677; 5,470,967; 5489677; 5541307; 5561225; 5596086; 5602240; 5610289; 5,602,240; 5608046; 5610289; 5618704; 5623070; 5663312; 5633360; 5677437 и 5677439, каждый из которых включен в настоящую заявку ссылкой.

В других предпочтительных миметиках олигонуклеотидов и сахаридная, и межнуклеозидная связь, то есть, скелет, нуклеотидных звеньев, заменены новыми группами. Звенья-основания сохраняются для гибридизации с соответствующим целевым соединением нуклеиновой кислоты. Одно такое олигомерное соединение, олигонуклеотидный миметик, который, как показали, обладает превосходными гибридизационными свойствами, называется пептид-нуклеиновой кислотой (ПНК). В ПНК соединениях сахаридный скелет олигонуклеотида заменен амидсодержащим скелетом, в частности аминоэтилглициновым скелетом. Нуклеиновые основания сохранены и связаны напрямую или опосредованно с аза-атомами азота амидной части скелета. Репрезентативные патенты США, в которых описано получение ПНК-соединений, включают, помимо прочего, патенты США 5539082; 5714331 и 5719262, каждый из которых включен в настоящую заявку ссылкой. Дополнительное описание ПНК-соединений можно найти в Nielsen, et al. (1991) Science 254, 1497-1500.

В другом предпочтительном варианте осуществления изобретения олигонуклеотиды с фосфоротиоатными скелетами и олигонуклеозиды с гетероатомными основаниями, в частности -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2-, известны как метилен(метилимино) или MMI скелет, -CH2-O-N(CH3)-CH2-, -CH2N(CH3)-N(CH3)-CH2- и -O-N(CH3)-CH2-CH2-, в которых нативный фосфодиэфирный скелет представлен как -O-P-O-CH2- вышеуказанного патента США 5,489,677, и амидные скелеты вышеуказанного патента США 5,602,240. Также предпочтительными являются олигонуклеотиды, содержащие морфолиновые скелетные структуры вышеуказанного патента США 5034506.

Модифицированные олигонуклеотиды могут также содержать одну или более замещенных сахаридных групп. Предпочтительные олигонуклеотиды включают одно из следующего в 2'-положении: ОН; F; O-, S- или N-алкил; O-, S- или N-алкенил; O-, S- или N-алкинил; или O-алкил-O-алкил, где алкил, алкенил и алкинил могут быть замещенными или незамещенными C-CO алкилом или C2-CO алкенилом и алкинилом. Наиболее предпочтительными являются O (CH2)n OmCH3, O(CH2)n, OCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2 и O(CH2nON(CH2)nCH3)2, где n и m могут быть равны от 1 до приблизительно 10. Другие предпочтительные олигонуклеотиды включают одно из следующего в 2'-положении: C-CO, (низший алкил, замещенный низший алкил, алкарил, аралкил, O-алкарил или O-аралкил, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, гетероциклоалкил, гетероциклоалкарил, аминоалкиламино, полиалкиламино, замещенный силил, РНК-расщепляющую группу, репортерную группу, интеркалятор, группу, улучшающую фармакокинетические свойства олигонуклеотида, или группу, улучшающую фармакодинамические свойства олигонуклеотида, и другие заместители, обладающие подобными свойствами. Предпочтительная модификация включает 2'-метоксиэтокси (2'-O-CH2CH2OCH3, также известный как 2'-O-(2-метоксиэтил) или 2'-MOE) (Martin et al., (1995) Helv. Chim. Acta, 78, 486-504), то есть, алкоксиалкоксигруппу. Другая предпочтительная модификация включает 2'-диметиламинооксиэтокси, то есть, O(CH2)2ON(CH3)2 группы, также известные как 2'-DMAOE, как описано в примерах ниже, и 2'-диметиламиноэтоксиэтокси (также известный в уровне техники как 2'-O-диметиламиноэтоксиэтил или 2'-DMAEOE), то есть, 2'-O-CH2-O-CH2-N(CH2)2.

Другие предпочтительные модификации включают 2'-метокси (2'-OCH3), 2'-аминопропокси (2'-OCH2CH2CH2NH2) и 2'-фтор (2'-F). Подобные модификации также могут быть произведены в других положениях олигонуклеотида, особенно в 3'-положении сахара на 3'-концевых нуклеотидах или в 2'-5' связанных олигонуклеотидах и 5'-положении 5'-концевых нуклеотидов. Олигонуклеотиды также могут содержать миметики сахаров, например, циклобутильные группы вместо пентофуранозильного сахара. Репрезентативные патенты США, в которых описано получение таких модифицированных сахаридных структур, включают, помимо прочего, патенты США 4981957; 5118800; 5319080; 5359044; 5393878; 5446137; 5,466,786; 5514785; 5519134; 5567811; 5576427; 5591722; 5597909; 5610300; 5627053; 5639873; 5646265; 5658873; 5670633 и 5700920, каждый из которых включен в настоящую заявку ссылкой.

Олигонуклеотиды также могут включать модификации или замены нуклеиновых оснований (часто называемых в уровне техники просто "основаниями"). Используемые в настоящей заявке "немодифицированные" или "природные" нуклеотиды включают пуриновые основания - аденин (A) и гуанин (G), и пиримидиновые основания - тимин (T), цитозин (C) и урацил (U). Модифицированные нуклеотиды включают другие синтетические и природные нуклеотиды, такие как 5-метилцитозин (5-me-C), 5-гидроксиметилцитозин, ксантин, гипоксантин, 2-аминоаденин, 6-метил и другие алкилпроизводные аденина и гуанина, 2-пропил и другие алкилпроизводные аденина и гуанина, 2-тиоурацил, 2-тиотимин и 2-тиоцитозин, 5-галоурацил и цитозин, 5-пропинилурацил и цитозин, 6-азоурацил, цитозин и тимин, 5-урацил (псевдоурацил), 4-тиоурацил, 8-гало, 8-амино, 8-тиол, 8-тиоалкил, 8-гидроксил и другие 8-замещенные аденины и гуанины, 8-гало, особенно 5-бром, 5-трифторметил и другие 5-замещенные урацилы и цитозины, 7-метилгуанин и 7-метиладенин, 8-азагуанин и 8-азааденин, 7-деазагуанин и 7-деазааденин, а также 3-деазагуанин и 3-деазааденин.

Кроме того, нуклеотиды включают нуклеотиды, раскрытые в патенте США 3687808, 'The Concise Encyclopedia of Polymer Science And Engineering', стр. 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, раскрытые в Englisch et al., Angewandle Chemie, International Edition', 1991, 30, стр. 613, и раскрытые в Sanghvi, Y. S., глава 15, Antisense Research and Applications', стр. 289-302, Crooke, S.T. and Lebleu, B. ea., CRC Press, 1993. Некоторые из указанных нуклеотидов в частности могут применяться для повышения аффинности связывания олигомерных соединений изобретения. Они включают 5-замещенные пиримидины, 6-азапиримидины и N-2, N-6 и 0-6 замещенные пурины, включая 2-аминопропиладенин, 5-пропинилурацил и 5-пропинилцитозин. Было показано, что 5-метилцитозиновые замены повышают стабильность дуплекса нуклеиновой кислоты на 0,6-1,2°C (Sanghvi, Y. S., Crooke, S.T. and Lebleu, B., eds, 'Antisense Research and Applications', CRC Press, Boca Raton, 1993, стр. 276-278), и на настоящий момент являются предпочтительными заменами оснований, еще более предпочтительно в сочетании с 2'-O-метоксиэтил модификациями сахара.

Репрезентативные патенты США, в которых описано получение вышеуказанных модифицированных нуклеотидов, а также других модифицированных нуклеотидов, включают, помимо прочего, патенты США 3687808, а также 4845205; 5130302; 5134066; 5175273; 5367066; 5432272; 5457187; 5459255; 5484908; 5502177; 5,525,711; 5552540; 5587469; 5596091; 5614617; 5750692 и 5681941, каждый из которых включен в настоящую заявку ссылкой.

Другая модификация олигонуклеотидов изобретения включает химическое присоединение к олигонуклеотиду одной или более групп или конъюгатов, которые повышают активность, улучшают клеточное распределение или захват клетками олигонуклеотида.

Такие группы включают, помимо прочего, липида группы, такие как холестериновые группы (Letsinger et al., (1989) Proc. Natl. Acad. Sci. USA, 86, 6553-6556), холевую кислоту (Manoharan et al., (1994) Bioorg. Med. Chem. Let., 4, 1053-1060), тиоэфир, например, гексил-S-тритилтиол (Manoharan et al., (1992) Ann. N. Y. Acad. Sci. 660, 306-309; Manoharan et al., (1993) Bioorg. Med. Chem. Let., 3, 2765-2770), тиохолестерин (Oberhauser et al., (1992) Nucl. Acids Res., 20, 533-538), алифатические, например, додекандиоловые или ундецильные остатки (Kabanov et al., (1990) FEBS Lett., 259, 327-330; Svinarchuk et al., (1993) Biochimie 75, 49-54), фосфолипид, например, ди-гексадецил-рац-глицерин или триэтиламмоний 1,2-ди-O-гексадецил-рац-глицеро-3-H-фосфонат (Manoharan et al., (1995) Tetrahedron Lett., 36, 3651-3654; Shea et al., (1990) Nucl. Acids Res., 18, 3777-3783), полиаминовую или полиэтиленгликолевую цепь (Mancharan et al., (1995) Nucleosides & Nucleotides, 14, 969-973), или адамантан-уксусную кислоту (Manoharan et al., (1995) Tetrahedron Lett., 36, 3651-3654), пальмитильную группу (Mishra et al., (1995) Biochim. Biophys. Acta, 1264, 229-237) или октадециламиновую или гексиламино-арбонил-т-оксихолестериновую группу (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 211, 923-937).

Репрезентативные патенты США, в которых описано получение таких конъюгатов олигонуклеотидов, включают, помимо прочего, патенты США 4828979; 4948882; 5218105; 5525465; 5541313; 5545730; 5552538; 5578717, 5580731; 5580731; 5591584; 5,109,124; 5118802; 5138045; 5414077; 5486603; 5512439; 5578718; 5608046; 4587044; 4605735; 4667025; 4762779; 4789737; 4824941; 4,835,263; 4876335; 4904582; 4958013; 5082830; 5112963; 5214136; 5082830; 5112963; 5214136; 5245022; 5254469; 5258506; 5262536; 5272250; 5292873; 5317098; 5371241, 5391723; 5416203, 5451463; 5,510,475; 5512667; 5514785; 5565552; 5567810; 5574142; 5585481; 5587371; 5595726; 5597696; 5599923; 5599928 и 5688941, каждый из которых включен в настоящую заявку ссылкой.

Поиск новых лекарственных средств: соединения настоящего изобретения также могут быть применены в области поиска новых лекарственных средств и подтверждения специфичности к мишени. Настоящее изобретение предполагает применение соединений и предпочтительных целевых сегментов, идентифицированных в настоящей заявке, при поиске новых лекарственных средств с целью объяснения взаимосвязи, которая существует между полинуклеотидами фактора роста эндотелия сосудов (VEGF) и заболеванием, фенотипом или состоянием. Указанные способы включают обнаружение или модуляцию полинуклеотидов фактора роста эндотелия сосудов (VEGF), включающие контакт образца, ткани, клетки или организма с соединениями настоящего изобретения, измерение уровня нуклеиновой кислоты или белка полинуклеотидов фактора роста эндотелия сосудов (VEGF) и/или соответствующей фенотипической или химической конечной точкой через некоторое время после обработки, и необязательно сравнение измеренного значения с необработанным образцом или образцом, обработанным другим соединением изобретения. Указанные способы также могут быть выполнены параллельно или в комбинации с другими экспериментами, чтобы определить функцию неизвестных генов в процессе подтверждения специфичности к мишени или определения пригодности продукта конкретного гена в качестве мишени при лечении или профилактике конкретного заболевания, состояния, или фенотипа.

Оценка повышающей регуляции или ингибирования экспрессии гена:

Перенос экзогенной нуклеиновой кислоты в хозяйскую клетку или организм может быть оценен с помощью непосредственного обнаружения присутствия нуклеиновой кислоты в клетке или организме. Такое обнаружение может быть выполнено несколькими методами, известными из уровня техники. Например, присутствие экзогенной нуклеиновой кислоты может быть обнаружено с помощью методов Саузерн-блоттинга или полимеразной цепной реакции (ПЦР) с использованием праймеров, которые специфично амплифицируют нуклеотидные последовательности, связанные с нуклеиновой кислотой. Экспрессия экзогенных нуклеиновых кислот также может быть измерена с использованием стандартных методов, включая анализ экспрессии генов. Например, мРНК, синтезированная с экзогенной нуклеиновой кислоты, может быть обнаружена и количественно проанализирована с использованием Нозерн-блоттинга и ПЦР с обратной транскрипции (ОТ-ПЦР).

Экспрессию РНК с экзогенной нуклеиновой кислоты также можно обнаружить путем измерения ферментативной активности или активности белка-репортера. Например, антисмысловая модулирующая активность может быть измерена опосредованно как понижение или повышние экспрессии целевой нуклеиновой кислоты в качестве показателя того, что экзогенная нуклеиновая кислота продуцирует эффекторную РНК. На основе консервативности последовательности можно создать праймеры и использовать их для амплификации кодирующих областей целевых генов. Первоначально, для создания модельного контрольного гена могут использоваться наиболее активно экспрессирующаяся кодирующая область из каждого гена, хотя также может использоваться любая кодирующая или некодирующая область. Каждый контрольный ген собирают, встраивая каждую кодирующую область между репортерной кодирующей областью и ее поли(A) сигналом. Указанные плазмиды будут продуцировать мРНК с репортерным геном в 5'-части гена и потенциальной мишенью РНКи в 3'-некодирующей области. Эффективность отдельных антисмысловых олигонуклеотидов можно оценивать по модуляции репортерного гена. Репортерные гены, которые могут прменяться в способах настоящего изобретения, включают синтетазу ацетогидроксикислот (AHAS), щелочную фосфатазу (AP), бета-галактозидазу (LacZ), бета-глюкуронидазу (ГАС), хлорамфеникол ацетилтрансферазу (CAT), зеленый флуоресцентный белок (GFP), красный флуоресцентный белок (RFP), желтый флуоресцентный белок (YFP), голубой флуоресцентный белок (CFP), пероксидазу хрена (HRP), люциферазу (Luc), нопалинсинтетазу (NOS), октопинсинтетазу (OCS) и их производные. Доступны множественные селективные маркеры, которые придают устойчивость к ампициллину, блеомицину, хлорамфениколу, гентамицину, гигромицину, канамицину, линкомицину, метотрексату, фосфинотрицину, пуромицину и тетрациклину. Способы определения модуляции репортерного гена известны в уровне техники и включают, помимо прочего, флуориметрические методы (например, флуоресцентную спектроскопию, клеточный сортинг с активацией флуоресценции (FACS), флуоресцентная микроскопия), определение устойчивости к антибиотикам.

Наборы, реагенты для анализа, диагностические и терапевтические средства

Соединения настоящего изобретения могут применяться для диагностики, терапии и профилактики, а также в качестве аналитических реагентов и компонентов наборов. Кроме того, антисмысловые олигонуклеотиды, которые могут ингибировать экспрессию генов с тонкой специфичностью, часто применяются специалистами для объяснения функции специфических генов или выявления различий между функциями различных членов биологического пути.

Для применения в наборах и диагностических средствах, а также в различных биологических системах, соединения настоящего изобретения, отдельно или в комбинации с другими соединениями или терапевтическими средствами, могут применяться в качестве инструментов в дифференциальных и/или комбинаторных анализах с целью объяснения профилей экспрессии части или полного набора генов, экспрессируемых в клетках и тканях.

Используемый в настоящей заявке термин "биологическая система" или "система" определяется как любой организм, клетка, культура клеток или ткань, которые экспрессируют или становятся способными экспрессировать продукты генов фактора роста эндотелия сосудов (VEGF). Они включают, помимо прочего, людей, трансгенных животных, клетки, культуры клеток, ткани, ксенотрансплантаты, трансплантаты и их комбинации.

В качестве одного неограничивающего примера, профили экспрессии в клетках или тканях, обработанных одним или более антисмысловыми соединениями, сравнивают с контрольными клетками или тканями, не обработанными антисмысловыми соединениями, и анализируют полученные профили на предмет дифференциальных уровней экспрессии генов, которые относятся, например, к заболеванию, сигнальному пути, клеточной локализации, уровню экспрессии, размеру, структуре или функции исследуемых генов. Указанные анализы могут быть выполнены на стимулированных или нестимулированных клетках, в присутствии или отсутствии других соединений, которые влияют на профили экспрессии.

Примеры методов анализа экспрессии генов, известных в уровне техники, включают ДНК-чипы или микрочипы (Brazma and Vilo, (2000) FEBS Lett., 480, 17-24; Celis, et al., (2000) FEBS Lett., 480, 2-16), SAGE (серийный анализ экспрессии генов) (Madden, et al., (2000) Drug Discov. Today, 5, 415-425), READS (амплификация кДНК, расщепленных рестриктазой) (Prashar and Weissman, (1999) Methods Enzymol, 303, 258-72), TOGA (полный анализ экспрессии генов) (Sutcliffe, et al, (2000) Proc. Natl. Acad. Sci. U.S.A., 97, 1976-81), белковые чипы и протеомика (Celis, et al., (2000) FEBS Lett., 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), секвенирование экспрессируемых маркеров последовательностей (EST) (Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), субтрактивный РНК фингерпринтинг (SuRF) (Fuchs, et al., (2000) Anal. Biochem. 286, 91-98; Larson, et al., (2000) Cytometry 41, 203-208), субтрактивное клонирование, дифференциальный дисплей (DD) (Jurecic and Belmont, (2000) Curr. Opin. Microbiol. 3, 316-21), сравнительная геномная гибридизация (Carulli, et al., (1998) J. Cell Biochem. Suppl., 31, 286-96), методы FISH (флуоресцентная гибридизация in situ) (Going and Gusterson, (1999) Eur. J. Cancer, 35, 1895-904) и масс-спектрометрические методы (To, Comb. (2000) Chem. High Throughput Screen, 3, 235-41).

Соединения изобретения могут применяться для анализа и диагностики, поскольку указанные соединения гибридизуются с нуклеиновыми кислотами, кодирующими фактор роста эндотелия сосудов (VEGF). Например, олигонуклеотиды, которые гибридизуются с такой эффективностью и при таких условиях, как раскрыто в настоящей заявке, что они являются эффективными модуляторами фактора роста эндотелия сосудов (VEGF), являются эффективными праймерами или зондами в условиях, способствующих амплификации или детектированию гена, соответственно. Указанные праймеры и зонды могут применяться в способах, требующих специфичного детектирования молекул нуклеиновой кислоты, кодирующих фактор роста эндотелия сосудов (VEGF), и при амплификации указанных молекул нуклеиновой кислоты с целью детектирования или применения в дальнейших исследованиях фактора роста эндотелия сосудов (VEGF). Гибридизация антисмысловых олигонуклеотидов изобретения, в особенности праймеров и зондов, с нуклеиновой кислотой, кодирующей фактор роста эндотелия сосудов (VEGF), может быть обнаружена способами, известными в уровне техники. Такие способы могут включать конъюгирование фермента с олигонуклеотидом, введение в олигонуклеотид радиоактивной метки, или любые другие подходящие способы обнаружения. Наборы, в которых применяются такие способы обнаружения для детектирования уровня фактора роста эндотелия сосудов (VEGF) в пробе, также могут быть получены.

Специфичность и чувствительность антисмысловых соединений также применяется специалистами в данной области в терапевтических целях. Антисмысловые соединения применялись в качестве терапевтических молекул в лечении заболеваний у животных, включая людей. Антисмысловые олигонуклеотидные лекарственные средства благополучно и эффективно вводили людям, и в настоящий момент проводятся многочисленные клинические испытания. Таким образом, установлено, что антисмысловые соединения могут быть полезными терапевтическими средствами, которые могут быть подготовлены для успешного применения в схемах лечения для обработки клеток, тканей и животных, в особенности людей.

В случае терапевтических средств, животное, предпочтительно человека, подозреваемого на наличие заболевания или нарушения, которое можно лечить посредством модуляции экспрессии полинуклеотидов фактора роста эндотелия сосудов (VEGF), подвергают лечению путем введения антисмысловых соединений в соответствии с настоящим изобретением. Например, в одном неограничивающем варианте осуществления способы включают этап введения животному, испытывающему потребность в лечении, терапевтически эффективного количества модулятора фактора роста эндотелия сосудов (VEGF). Модуляторы фактора роста эндотелия сосудов (VEGF) настоящего изобретения эффективно модулируют активность фактора роста эндотелия сосудов (VEGF) или модулируют экспрессию белка фактора роста эндотелия сосудов (VEGF). В одном варианте осуществления активность или экспрессия фактора роста эндотелия сосудов (VEGF) у животного ингибируется приблизительно на 10% по сравнению с контролем. Предпочтительно, активность или экспрессия фактора роста эндотелия сосудов (VEGF) у животного ингибируется приблизительно на 30%. Более предпочтительно, активность или экспрессия фактора роста эндотелия сосудов (VEGF) у животного ингибируется на 50% или более. Таким образом, олигомерные соединения модулируют экспрессию мРНК фактора роста эндотелия сосудов (VEGF), по меньшей мере, на 10%, по меньшей мере, на 50%, по меньшей мере, на 25%, по меньшей мере, на 30%, по меньшей мере, на 40%, по меньшей мере, на 50%, по меньшей мере, на 60%, по меньшей мере, на 70%, по меньшей мере, на 75%, по меньшей мере, на 80%, по меньшей мере, на 85%, по меньшей мере, на 90%, по меньшей мере, на 95%, по меньшей мере, на 98%, по меньшей мере, на 99% или на 100% по сравнению с контролем.

В одном варианте осуществления активность или экспрессия фактора роста эндотелия сосудов (VEGF) у животного увеличена приблизительно на 10% по сравнению с контролем. Предпочтительно, активность или экспрессия фактора роста эндотелия сосудов (VEGF) у животного увеличена приблизительно на 30%. Более предпочтительно, активность или экспрессия фактора роста эндотелия сосудов (VEGF) у животного увеличена на 50% или более. Таким образом, олигомерные соединения модулируют экспрессию мРНК фактора роста эндотелия сосудов (VEGF), по меньшей мере, на 10%, по меньшей мере, на 50%, по меньшей мере, на 25%, по меньшей мере, на 30%, по меньшей мере, на 40%, по меньшей мере, на 50%, по меньшей мере, на 60%, по меньшей мере, на 70%, по меньшей мере, на 75%, по меньшей мере, на 80%, по меньшей мере, на 85%, по меньшей мере, на 90%, по меньшей мере, на 95%, по меньшей мере, на 98%, по меньшей мере, на 99% или на 100% по сравнению с контролем.

Например, понижение экспрессии фактора роста эндотелия сосудов (VEGF) может быть измерено в сыворотке, крови, жировой ткани, печени или любой другой биологической жидкости, ткани или органе животного. Предпочтительно, клетки, содержащиеся в указанных анализируемых жидкостях, тканях или органах, содержат молекулу нуклеиновой кислоты, кодирующую пептиды фактора роста эндотелия сосудов (VEGF) и/или белок фактора роста эндотелия сосудов (VEGF) непосредственно.

Соединения изобретения могут применяться в фармацевтических композициях посредством добавления эффективного количества соединения в подходящий фармацевтически приемлемый разбавитель или носитель. Применение соединений и способов изобретения также может быть полезным профилактически.

Конъюгаты

Другая модификация олигонуклеотидов изобретения включает в себя химическое связывание олигонуклеотида с одной или более группам или конъюгатами, которые повышают активность, клеточное распределение или захват клетками олигонуклеотида. Указанные группы или конъюгаты могут включать конъюгатные группы, ковалентно связанные с функциональными группами, такими как первичные или вторичные гидроксильные группы. Конъюгатные группы изобретения включают интеркаляторы, репортерные молекулы, полиамины, полиамиды, полиэтиленгликоли, полиэфиры, группы, которые улучшают фармакодинамические свойства олигомеров, и групп, которые улучшают фармакокинетические свойства олигомеров. Типичные конъюгатные группы включают холестерины, липиды, фосфолипиды, биотин, феназин, фолат, фенантридин, антрахинон, акридин, флуоресцеины, родамины, кумарины и красители. Группы, которые улучшают фармакодинамические свойства, в рамках настоящего изобретения включают группы, которые улучшают захват, повышают устойчивость к деградации и/или усиливают сиквенс-специфическую гибридизацию с целевой нуклеиновой кислотой. Группы, которые улучшают фармакокинетические свойства, в рамках настоящего изобретения включают группы, которые улучшают захват, распределение, метаболизм или экскрецию соединений настоящего изобретения. Репрезентативные конъюгатные группы раскрыты в международной заявке PCT/US92/09196, поданной 23 октября 1992 года, и в патенте США 6,287,860, которые включены в настоящую заявку ссылкой. Конъюгатные группы включают, помимо прочего, молекулы липидов, такие как молекулы холестерина, холевой кислоты, тиоэфира, например, гексил-5-тритилтиол, тиохолестерин, алифатические, например, додекандиоловые или ундецильные остатки, фосфолипид, например, ди-гексадецил-рац-глицерин или триэтиламмоний l,2-ди-O-гексадецил-рац-глицеро-3-H-фосфонат, полиаминовую или полиэтиленгликолевую цепь, или адамантан-уксусную кислоту, пальмитильную группу или октадециламин, или гексиламино-карбонил-оксихолестериновую группу. Олигонуклеотиды изобретения также могут быть конъюгированы с активными лекарственными веществами, например, аспирином, варфарином, фенилбутазоном, ибупрофеном, супрофеном, фенбуфеном, кетопрофеном, (S)-(+)-пранопрофеном, карпрофеном, дансилсаркозином, 2,3,5-трииодбензойной кислотой, флуфенаминовой кислотой, фолиновой кислотой, бензотиадиазидом, хлортиазидом, диазепином, индометацином, барбитуратом, цефалоспорином, сульфамидным средством, антидиабетическим средством, антибактериальным средством или антибиотиком.

Репрезентативные патенты США, в которых описано получение таких конъюгатов олигонуклеотидов, включают, помимо прочего, патенты США 4828979; 4948882; 5218105; 5525465; 5541313; 5545730; 5552538; 5578717; 5580731; 5580731; 5591584; 5109124; 5118802; 5138045; 5414077; 5486603; 5512439; 5578718; 5608046; 4587044; 4605735; 4667025; 4762779; 4789737; 4824941; 4835263; 4876335; 4904582; 4958013; 5082830; 5112963; 5214136; 5082830; 5112963; 5214136; 5245022; 5254469; 5258506; 5262536; 5272250; 5292873; 5317098; 5371241 5391723; 5416203 5451463; 5510475; 5512667; 5514785; 5565552; 5567810; 5574142; 5585481; 5587371; 5595726; 5597696; 5599923; 5599928 и 5688941.

Лекарственные формы

Соединения изобретения также могут быть смешаны, инкапсулированы, конъюгированы или иным способом объединены с другими молекулами, молекулярными структурами или смесями соединений, как, например, липосомы, рецептор-специфичные молекулы, пероральные, ректальные, местные или другие лекарственные формы, с целью улучшения усвоения, распределения и/или абсорбции. Репрезентативные патенты США, в которых описано получение таких лекарственных форм, способствующих улучшению усвоения, распределения и/или абсорбции, включают, помимо прочего, патенты США 5108921; 5354844; 5416016; 5459127; 5521291; 5543165; 5547932; 5583020; 5591721; 4426330; 4534899; 5013556; 5108921; 5213804; 5227170; 5264221; 5356633; 5395619; 5416016; 5417978; 5462854; 5469854; 5512295; 5527528; 5534259; 5543152; 5556948; 5580575 и 5595756, каждый из которых включен в настоящую заявку ссылкой.

Хотя антисмысловые олигонуклеотиды не обязательно нужно вводить в случае вектора, чтобы модулировать экспрессию и/или функцию мишени, варианты осуществления изобретения относятся к конструкциям векторов экспрессии для экспрессии антисмысловых олигонуклеотидов, включающим промоторы, гибридные последовательности промоторов и генов, обладающих сильной конститутивной промоторной активностью, или промоторной активностью, которая может быть индуцирована в случае необходимости.

В варианте осуществления практическое применение изобретения включает введение, по меньшей мере, одного из предыдущих антисмысловых олигонуклеотидов с подходящей системой доставки нуклеиновой кислоты. В одном варианте осуществления данная система включает невирусный вектор, функционально связанный с полинуклеотидом. Примеры таких невирусных векторов включают олигонуклеотид, отдельно (например, одну или несколько из SEQ ID NO: 4-9) или в комбинации с подходящей белковой, полисахаридоной или липидной лекарственной формой.

Дополнительно подходящие системы доставки нуклеиновой кислоты включают вирусный вектор, как правило, последовательность, по меньшей мере, из одного из аденовируса, аденоассоциированного вируса (AAV), хэлпер-зависимого аденовируса, ретровируса или липосомного комплекса японского штамма гемагглютинирующего вируса Сендай (HVJ). Предпочтительно, вирусный вектор включает сильный эукариотический промотор, функционально связанный с полинуклеотидом, например, цитомегаловирусный (CMV) промотор.

Дополнительно предпочтительные векторы включают вирусные векторы, слитые белки и химические конъюгаты. Ретровирусные векторы включают вирусы мышиного лейкоза Молони и вирусы на основе ВИЧ. Один из предпочтительных вирусных векторов на основе ВИЧ включает, по меньшей мере, два вектора, в которых гены gag и pol происходят из генома ВИЧ, а ген env - из другого вируса. Предпочтительными являются ДНК-вирусные векторы. Указанные векторы включают поксвирусные векторы, такие как ортопокс или авипокс векторы, векторы на основе герпесвирусов, например, вектор на основе вируса простого герпеса I (HSV) [Geller, A.I. et al., (1995) J. Neurochem, 64: 487; Lim, F., et al., in DNA Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995); Geller, A.I. et al., (1993) Proc. Natl. Acad. Sci.:U.S.A.:90 7603; Geller, A.I., et al., (1990) Proc. Natl. Acad. Sci USA: 87:1149], аденовирусные векторы (LeGal LaSalle et al., Science, 259:988 (1993); Davidson, et al., (1993) Nat. Genet. 3:219; Yang, et al., (1995) J. Virol. 69:2004) и векторы на основе аденоассоциированного вируса (Kaplitt, M.G., et al., (1994) Nat. Genet. 8:148).

Антисмысловые соединения изобретения охватывают любые фармацевтически приемлемые соли, сложные эфиры или соли таких сложных эфиров, или любое другое соединение, которое при введении животному, включая человека, способно обеспечивать (напрямую или опосредованно) биологически активный метаболит или его остаток.

Термин "фармацевтически приемлемые соли" относится к физиологически и фармацевтически приемлемым солям соединений изобретения: то есть, соли, которые сохраняют требуемую биологическую активность исходного соединения и не сообщают ему нежелательные токсические свойства. Применительно к олигонуклеотидам, предпочтительные примеры фармацевтически приемлемых солей и их применений дополнительно описаны в патенте США 6287860, который включен в настоящую заявку ссылкой.

Настоящее изобретение также включает фармацевтические композиции и лекарственные формы, которые включают антисмысловые соединения изобретения. Фармацевтические композиции настоящего изобретения можно вводить множеством способов в зависимости от того, какую терапию требуется произвести в обрабатываемой области, местную или системную. Введение может быть наружным (включая глазное и на слизистые оболочки, включая вагинальную и ректальную доставку), легочным, например, ингаляцией или инсуффляцией порошков или аэрозолей, включая также с помощью небулайзера; внутритрахеальным, интраназальным, эпидермальным и трансдермальным), пероральным или парентеральным. Парентеральное введение включает внутривенную, внутриартериальную, подкожную, внутрибрюшинную или внутримышечную инъекцию или инфузию; или интракраниальное, например, интратекальное или интравентрикулярное введение. Олигонуклеотиды, по меньшей мере, с одной 2'-O-метоксиэтил модификацией, как полагают, являются наиболее пригодными для перорального введения. Фармацевтические композиции и лекарственные формы для наружного применения могут включать трансдермальные пластыри, мази, лосьоны, кремы, гели, капли, суппозитории, спреи, жидкости и порошки. Стандартные фармацевтические носители, водные, порошковые или масляные основы, загустители и т.п. могут быть необходимыми или желательными. Также могут применяться покрытые кондомы, перчатки и т.п.

Лекарственные формы настоящего изобретения, которые могут быть представлены предпочтительно в виде единичной дозированной формы, могут быть приготовлены согласно стандартным методам, известным в фармацевтической промышленности. Такие методы включают этап объединения активных компонентов с фармацевтическим носителем (носителями) или эксципиентом (эксципиентами). Обычно лекарственные формы приготавливают путем однородного и тщательного смешивания активных компонентов с жидкими носителями или тонко измельченными твердыми носителями, или обоими, с последующим, в случае необходимости, формованием готового продукта.

Композиции настоящего изобретения могут быть приготовлены в виде любой из многих возможных дозированных форм, таких как, помимо прочего, таблетки, капсулы, желатиновые капсулы, жидкие сиропы, мягкие гели, суппозитории и клизмы. Композиции настоящего изобретения также могут быть приготовлены в форме суспензий в водных, неводных или смешанных средах. Водные суспензии могут дополнительно содержать вещества, которые повышают вязкость суспензии, включая, например, натриевую соль карбоксиметилцеллюлозы, сорбитол и/или декстран. Суспензия может также содержать стабилизаторы.

Фармацевтические композиции настоящего изобретения включают, помимо прочего, растворы, эмульсии, пены и липосомосодержащие лекарственные формы. Фармацевтические композиции и лекарственные формы настоящего изобретения могут включать один или более усилителей клеточной абсорбции, носителей, эксципиентов или других активных или неактивных компонентов.

Эмульсии обычно представляют собой гетерогенные системы из одной жидкости, которая диспергирована в другой жидкости в форме мелких капель, диаметром обычно больше 0,1 мкм. Эмульсии могут содержать дополнительные компоненты в дополнение к дисперсным фазам, и действующее вещество, которое может присутствовать в виде раствора или в водной фазе, масляной фазе, или самостоятельно, в виде отдельной фазы. Микроэмульсии включены как вариант осуществления настоящего изобретения. Эмульсии и их применения известны в уровне техники и дополнительно описаны в патенте США 6287860.

Лекарственные формы настоящего изобретения включают липосомные лекарственные формы. Используемый в настоящем изобретении термин "липосома" означает пузырек, состоящий из амфифильных липидов, расположенных в сферическом бислое или бислоях. Липосомы представляют собой однослойные или многослойные пузырьки, имеющие мембрану, которая сформирована из липофильного материала, внутри которых находится водная среда, в которой содержится доставляемое соединение. Катионные липосомы являются положительно заряженными липосомами, которые, как полагают, взаимодействуют с отрицательно заряженными молекулами ДНК, формируя стабильный комплекс. Липосомы, чувствительные к pH или имеющие отрицательный заряд, как полагают, захватывают ДНК, а не образуют с ней комплекс. И катионные и некатионные липосомы использовали для доставки ДНК в клетки.

Липосомы также включают "стерически стабилизированные" липосомы, термин, который, как используется в настоящей заявке, относится к липосомам, включающим один или более специализированных липидов. При включении в липосомы, указанные специализированные липиды придают липосомам повышенную продолжительность циркуляции по сравнению с липосомами без подобных специализированных липидов. Примерами стерически стабилизированных липосомы являются такие липосомы, в которых часть везикулообразующей части липида липосомы включает один или более гликолипидов или дериватизирована одним или более гидрофильньными полимерами, например, молекулой полиэтиленгликоля (ПЭГ). Липосомы и их применения дополнительно описаны в патенте США 6287860.

Фармацевтические композиции и лекарственные формы настоящего изобретения могут также включать поверхностно-активные вещества. Применение поверхностно-активных веществ в лекарственных препаратах, лекарственных формах и в эмульсиях известно в уровне техники. Поверхностно-активные вещества и их применения дополнительно описаны в патенте США 6287860, который включен в настоящую заявку ссылкой.

В одном варианте осуществления в настоящем изобретении применяются различные усилители клеточной абсорбции, обеспечивающие эффективную доставку нуклеиновых кислот, в особенности олигонуклеотидов. В дополнение к облегчению диффузии нелипофильных лекарственных соединений через клеточные мембраны, усилители абсорбции также усиливают проникновение в клетки липофильных лекарственных соединений. Усилители клеточной абсорбции могут быть классифицированы как принадлежащие к одной из пяти обширных категорий, то есть, поверхностно-активных веществ, жирных кислот, солей желчных кислот, хелатирующих агентов, а также нехелатирующих веществ, не обладающих поверхностно-активными свойствами. Усилители клеточной абсорбции и их применения дополнительно описаны в патенте США 6287860, который включен в настоящую заявку ссылкой.

Специалисту в данной области известно, что лекарственные формы обычно разрабатывают в соответствии с их предполагаемым применением, то есть путем введения.

Предпочтительные лекарственные формы для наружного введения включают лекарственные формы, в которых олигонуклеотиды изобретения находятся в смеси с агентом местной доставки, таким как липиды, липосомы, жирные кислоты, сложные эфиры жирных кислот, стероиды, хелатирующие агенты и поверхностно-активные вещества. Предпочтительные липиды и липосомы включают нейтральные (например, диолеоилфосфатидилэтаноламин (DOPE), димиристоилфосфатидилхолин (DMPC), дистеароилфосфатидилхолин), анионные (например, димиристоилфосфатидилглицерин DMPG) и катионные (например, диолеоилтетраметиламинопропил (DOTAP) и диолеоилфосфатидилэтаноламин (DOTMA).

Для местного или другого применения олигонуклеотиды изобретения могут быть инкапсулированы в липосомах или могут образовывать с ними комплексы, в особенности с катионными липосомами. В альтернативе олигонуклеотиды могут образовывать комплекс с липидами, в особенности с катионными липидами. Предпочтительные жирные кислоты и сложные эфиры, их фармацевтически приемлемые соли, а также их применения дополнительно описаны в патенте США 6287860.

Композиции и лекарственные формы для перорального применения включают порошки или гранулы, микрочастицы, наночастицы, суспензии или растворы в водных или неводных средах, капсулы, желатиновые капсулы, пакетики, таблетки или минитаблетки. Могут требоваться загустители, ароматизаторы, разбавители, эмульгаторы, диспергирующие добавки или связующие вещества. Предпочтительные пероральные лекарственные формы являются такими формами, в которых олигонуклеотиды изобретения вводят в сочетании с одним или несколькими поверхностно-активными веществами, усилителями клеточной абсорбции и хелатирующими агентами. Предпочтительные поверхностно-активные вещества включают жирные кислоты и/или их сложные эфиры или соли, желчные кислоты и/или их соли. Предпочтительные желчные кислоты/соли желчных кислот, а также жирные кислоты и их применения дополнительно описаны в патенте США 6287860, который включен в настоящую заявку ссылкой. Также предпочтительными являются комбинации усилителей клеточной абсорбции, например, жирных кислот/солей жирных кислот в комбинации с желчными кислотами/солями желчных кислот. Наиболее предпочтительной комбинацией является натриевая соль лауриновой кислоты, каприновой кислоты и урсодезоксихолевой кислоты (UDCA). Дополнительные усилители клеточной абсорбции включают полиоксиэтилен-9-лауриловый эфир, полиоксиэтилен-20-цетиловый эфир. Олигонуклеотиды изобретения можно доставлять перорально, в гранулированной форме, включающей распыляемые высушенные частицы, или в форме комплекса для формирования микро или наночастиц. Агенты, образующие комплексы с олигонуклеотидами, а также их применения дополнительно описаны в патенте США 6287860, который включен в настоящую заявку ссылкой.

Композиции и лекарственные формы для парентерального, интратекального или интравентрикулярного введения могут включать стерильные водные растворы, которые также могут содержать буферы, разбавители и другие подходящие добавки, такие как, помимо прочих, усилители клеточной абсорбции, соединения-носители и другие фармацевтически приемлемые носители или эксципиенты.

Некоторые варианты осуществления изобретения обеспечивают фармацевтические композиции, содержащие один или более олигомерных соединений и один или более других химиотерапевтических агентов, которые функционируют посредством не антисмыслового механизма. Примеры таких химиотерапевтических агентов включают, помимо прочего, противораковые химиотерапевтические средства, такие как даунорубицин, дауномицин, дактиномицин, доксорубицин, эпирубицин, идарубицин, эзорубицин, блеомицин, мафосфамид, ифосфамид, цитозин арабинозид, бисхлорэтил-нитрозомочевина, бусульфан, митомицин C, актиномицин D, митрамицин, преднизон, гидроксипрогестерон, тестостерон, тамоксифен, дакарбазин, прокарбазин, гексаметилмеламин, пентаметилмеламин, митоксантрон, амсакрин, хлорамбуцил, метилциклогексилнитрозомочевина, азотистые иприты, мелфалан, циклофосфамид, 6-меркаптопурин, 6-тиогуанин, цитарабин, 5-азацитидин, гидроксимочевина, дезоксикоформицин, 4-гидроксипероксицикло-фосфорамид, 5-фторурацил (5-FU), 5-фтордезоксиуридин (5-FUdR), метотрексат (MTX), колхицин, таксол, винкристин, винбластин, этопозид (VP-16), триметрексат, иринотекан, топотекан, гемцитабин, тенипозид, цисплатин и диэтилстильбестрол (DES). В случае применения с соединениями изобретения такие химиотерапевтические средства могут использоваться отдельно (например, 5-FU и олигонуклеотид), последовательно (например, 5-FU и олигонуклеотид, затем через некоторый период времени MTX и олигонуклеотид), или в комбинации с одним или более другими такими химиотерапевтическими средствами (например, 5-FU, MTX и олигонуклеотид, или 5-FU, радиотерапия и олигонуклеотид). Противовоспалительные средства, включая, помимо прочих, нестероидные противовоспалительные средства и кортикостероиды, а также противовирусные средства, включая, помимо прочих, рибавирин, видарабин, ацикловир и ганцикловир, также могут быть объединены в композициях изобретения. Комбинации антисмысловых соединений и других неантисмысловых лекарственных средств также включены в объем настоящего изобретения. Два или более комбинированных соединения могут применяться вместе или последовательно.

В другом связанном варианте осуществления соединения изобретения могут содержать один или более антисмысловых соединений, в особенности олигонуклеотидов, направленных на первую нуклеиновую кислоту, и один или более дополнительных антисмысловых соединений, направленных на вторую нуклеиновую кислоту-мишень. Например, первая мишень может быть конкретной антисмысловой последовательностью фактора роста эндотелия сосудов (VEGF), а вторая мишень может быть областью из другой нуклеотидной последовательности. В альтернативе, соединения изобретения могут содержать два или более антисмысловых соединений, направленных на различные области одной и той же нуклеиновой кислоты-мишени фактор роста эндотелия сосудов (VEGF). В настоящей заявке проиллюстрированы многочисленные примеры антисмысловых соединений, а другие могут быть выбраны из подходящих соединений, известных в уровне техники. Два или более комбинированных соединения могут применяться вместе или последовательно.

Дозирование:

Приготовление лекарственных форм терапевтических композиций и их последующее введение (дозирование), как полагают, находится в рамках компетенции специалистов. Дозирование зависит от тяжести и ответной реакции заболевания, подвергаемого лечению, с продолжением курса лечения в течение от нескольких дней до нескольких месяцев, или пока не будет достигнуто выздоровление или ослабление интенсивности заболевания. Оптимальные схемы дозирования могут быть вычислены на основе показателей накопления лекарственного вещества в теле пациента. Средние специалисты могут легко определить оптимальные дозировки, методики введения доз и частоту повтора. Оптимальные дозировки могут изменяться в зависимости от относительной активности отдельных олигонуклеотидов, и в целом могут быть оценены на основе показателей EC50, найденных эффективными в in vitro и in vivo моделях на животных. Как правило, дозировка составляет от 0,01 мкг до 100 г на кг массы тела, и может вводиться один или более раз в день, в неделю, в месяц или год, или даже один раз каждые 2-20 лет. Средние специалисты в данной области техники могут легко оценить частоту повторного дозирования на основе измеренного времени удержания и концентраций лекарственного вещества в физиологических жидкостях или тканях. После успешной терапии может быть желательно подвергнуть пациента поддерживающей терапии, чтобы предотвратить рецидив заболевания, где олигонуклеотид вводят в поддерживающих дозах, в пределах от 0,01 мкг до 100 г на кг массы тела, однин или более раз в день, до одного раза каждые 20 лет.

Хотя различные варианты осуществления настоящего изобретения были описаны выше, следует понимать, что они были представлены исключительно в качестве примера, а не ограничения. В раскрытые варианты осуществления могут быть внесены многочисленные изменения в соответствии с настоящим описанием, без отступления от сущности или объема изобретения. Таким образом, охват и объем настоящего изобретения не должны быть ограничены ни одним из вышеуказанных вариантов осуществления.

Все документы, указанные в настоящем описании, включены в настоящую заявку ссылкой. Все публикации и патентные документы, процитированные в настоящей заявке, включены ссылкой во всех отношениях, в той же степени, как если бы каждая отдельная публикация или патентный документ были указаны индивидуально. Под цитатой различных ссылок в настоящем документе заявители не предполагают, что какая-либо конкретная ссылка составляет "предшествующий уровень техники" в отношении настоящего изобретения. Варианты осуществления композиций и способов изобретения проиллюстрированы в следующих примерах.

ПРИМЕРЫ

Следующие неограничивающие Примеры служат в целях иллюстрации выбранных вариантов осуществления изобретения. Необходимо понимать, что изменения пропорций и альтернатива в элементах показанных компонентов будут очевидны квалифицированным специалистам и находятся в рамках вариантов осуществления настоящего изобретения.

Пример 1: Создание антисмысловых олигонуклеотидов, специфичных к молекуле нуклеиновой кислоты антисмысловой последовательности к и/или смысловой цепи полинуклеотида фактора роста эндотелия сосудов (VEGF)

Как указано выше, термин "олигонуклеотид, специфичный к" или "олигонуклеотид, направленный на" относится к олигонуклеотиду, имеющему последовательность, которая: (i) способна к образованию стабильного комплекса с частью гена-мишени, или (ii) способна к образованию стабильного дуплекса с частью мРНК-транскрипта гена-мишени.

Выбор подходящих олигонуклеотидов облегчается при использовании компьютерных программ, которые автоматически выравнивают последовательности нуклеиновых кислот и указывают области идентичности или гомологии. Такие программы применяются для сравнения последовательностей нуклеиновых кислот, полученных, например, при поиске в базах данных, таких как GenBank, или с помощью секвенирования ПЦР-продуктов. Сравнение последовательностей нуклеиновых кислот из ряда видов позволяет произвести выбор последовательностей нуклеиновых кислот, которые показывают достаточную степень межвидовой идентичности. В случае генов, которые не были секвенированы, проводят Саузерн-блоттинг, позволяющий определить степень идентичности генов в целевых видах и других видах. При выполнении Саузерн-блоттинга с различными степенями строгости, как известно из уровня техники, можно получить приблизительную степень идентичности. Указанные методы позволяют произвести выбор олигонуклеотидов, которые демонстрируют высокую степень комплементарности в отношении целевых последовательностей нуклеиновых кислот у субъекта, подвергаемого воздействию, и более низкую степень комплементарности к соответствующим последовательностям нуклеиновых кислот в других видах. Специалист, квалифицированный в данной области техники, поймет, что при отборе подходящих областей генов для применения в настоящем изобретении существует значительная широта.

Антисмысловое соединение способно к "специфичной гибридизации", если связывание соединения с целевой нуклеиновой кислотой блокирует нормальную функцию целевой нуклеиновой кислоты, вызвая модуляцию функции и/или активности, при этом существует достаточная степень комплементарности, чтобы избежать неспецифичного связывания антисмыслового соединения с нецелевой последовательностей нуклеиновой кислоты при условиях, в которых требуется специфичное связывание, то есть, при физиологических условиях в случае in vivo анализов или терапевтической обработки, и при условиях, в которых проводят анализы в случае in vitro анализов.

Гибридизационные свойства олигонуклеотидов, описанных в настоящей заявке, могут быть определены с помощью одного или более in vitro анализов, известных из уровня техники. Например, свойства олигонуклеотидов, описанных настоящей заявке, могут быть получены путем определения силы связывания между природной антисмысловой последовательностью-мишенью и молекулами потенциальных лекарственных соединений с помощью анализа кривой плавления.

Сила связывания между целевой природной антисмысловой последовательностью и молекулой потенциального лекарственного соединения (молекулой) может быть оценена с помощью любого из известных методов измерения силы межмолекулярных взаимодействий, например, анализа кривой плавления.

Анализ кривой плавления позволяет определить температуру, при которой происходит быстрый переход природного комплекса антисмысловой последовательности/молекулы из двунитевой конформации в однонитевую. Данная температура широко применяется в качестве надежного показателя силы взаимодействия между двумя указанными молекулами.

Анализ кривой плавления может быть выполнен с использованием кДНК копии существующей молекулы природной антисмысловой РНК или синтетического ДНК или РНК нуклеотида, соответствующих сайту савязывания молекулы. Доступны многочисленные наборы, содержащие все необходимые реагенты для выполнения данного анализа (например, набор MeltDoctor от Applied Biosystems Inc.). Указанные наборы включают подходящий буферный раствор, содержащий один из связывающих двойную цепь ДНК (дцДНК) красителей (такой как красители ABI HRM, SYBR Green, SYTO и т.д.). Красители дцДНК обладают такими свойствами, что в свободной форме они практически не испускают флуоресценции, но при связывании с днДНК интенсивно флуоресцируют.

Для выполнения анализа, кДНК или соответствующий олигонуклеотид смешивают с молекулой в концентрациях, определенных в соответствии с методиками конкретного производителя. Смесь нагревают до 95°C для диссоциации всех предварительно сформированных комплексов днДНК, затем медленно охлаждают до комнатной температуры или другой более низкой температуры, определенной производителем набора, для отжига молекул ДНК. Затем образовавшиеся комплексы медленно нагревают до 95°C с одновременным непрерывным сбором данных по количеству флуоресценции, производимой в ходе реакции. Интенсивность флуоресценции обратно пропорциональна количеству днДНК, присутствующей в реакции. Данные могут быть получены с использованием прибора для ПЦР в реальном времени, совместимого с набором (например, ПЦР-системы StepOne ABI Plus Real Time PCR System или системы LightTyper, Roche Diagnostics, Lewes, UK).

Пики плавления строят, нанося отрицательную производную флуоресценции по отношению к температуре (-d(Флуоресценция)/dT) на оси Y), в зависимости от температуры (ось X), используя соответствующее программное обеспечение (например, LightTyper (Roche) или SDS Dissociation Curve, ABI). Данные анализируют, чтобы определить температуру быстрого перехода днДНК комплекса в однонитевые молекулы. Указанная температура называется Tm и непосредственно пропорциональна силе взаимодействия между двумя указанными молекулами. Как правило, Tm превышает 40°C.

Пример 2: Модуляция VEGF полинуклеотидов

Клетки HepG2 из ATCC (кат# HB-8065) выращивали в питательной среде (MEM/EBSS (Hyclone кат# SH30024 или Mediatech кат# MT-10-010-CV) +10% FBS (Mediatech кат# MT35-011-CV) +пенициллин/стрептомицин (Mediatech кат# MT30-002-CI)) при 37°C и 5% CO2. За один день перед экспериментом клетки пересевали при плотности 1,5×105/мл в 6-луночные планшеты и инкубировали при 37°C и 5% CO2. В день эксперимента среду в 6-луночных планшетах заменяли свежей питательной средой. Все антисмысловые олигонуклеотиды разводили до концентрации 20 мкм. Два мкл полученного раствора инкубировали с 400 мкл среды Opti-MEM (Gibco кат# 31985-070) и 4 мкл Lipofectamine 2000 (Invitrogen кат# 11668019) при комнатной температуре в течение 20 минут и вносили в каждую лунку 6-луночных планшетов с клетками HepG2. Аналогичную смесь, включающую 2 мкл воды вместо раствора олигонуклеотидов, использовали в качестве трансфицированного контроля. Через 3-18 ч инкубирования при 37°C и 5% CO2 среду заменяли свежей питательной средой. Через 48 ч после добавления антисмысловых олигонуклеотидов среду удаляли и экстрагировали из клеток РНК, используя систему SV Total RNA Isolation System (Promega, кат# Z3105) или набор RNeasy Total RNA Isolation kit (Qiagen, кат# 74181) согласно инструкциям производителей. 600 нг РНК добавляли к реакции обратной транскрипции, проводимой с использованием набора Verso cDNA kit (Thermo Scientific, кат# AB1453B) или набора High Capacity cDNA Reverse Transcription Kit (кат# 4368813), как описано в методике производителя. кДНК из указанной реакции обратной транскрипции использовали для контроля экспрессии гена с помощью ПЦР в реальном времени при использовании ABI Taqman Gene Expression Mix (кат# 4369510) и праймеров/зондов, разработанных ABI (Applied Biosystems Taqman Gene Expression Assay: Hs00173626_ml от Applied Biosystems Inc., Foster City, CA). Использовался следующий цикл ПЦР: 50°C в течение 2 минут, 95°C в течение 10 минут, 40 циклов (95°C в течение 15 секунд, 60°C в течение 1 минуты) при использовании амплификатора StepOne Plus Real Time PCR (Applied Biosystems).

Кратность изменения экспрессии гена после обработки антисмысловыми олигонуклеотидами вычисляли на основе разности между 18S-нормализованными dCt значениями обработанных и контрольно трансфицированных образцов.

Праймеры и зонд для специализированного Taqman-анализа природной антисмысловой VEGF последовательности VEGFA (SEQ ID NO: 10) (Фиг. 6):

Последовательность-мишень экзон 1 VEGFA:

ATGCCAAGTGGTCCCAGGCTGCACC (SEQ ID NO: 10)

Последовательность прямого праймера:

Vegfas1 ANYf: GTAGCCTGTCCCCTTCAAGAG (SEQ ID NO: 11)

Vegfas2 ANYf: GCGGATAGCCTGGGAGCTA (SEQ ID NO: 12)

Последовательность обратного праймера:

Vegfas1 ANYR: CAGACATCCTGAGGTGTGTTCT (SEQ ID NO: 13)

Vegfas2 ANYR: TGTTCGGTTGCTGTGACTGT (SEQ ID NO: 14)

Репортерный краситель: FAM

Vegfas1 ANYMl: ATGCCTGCCAAGCCCA (SEQ ID NO: 15)

Vegfas2 ANYMl: CAGCCAGCCCTCTGC (SEQ ID NO: 16)

Результаты:

Даунрегуляция VEGFAas РНК

Результаты ПЦР в реальном времени показывают, что уровни VEGFA мРНК в клетках HepG2 значительно увеличивались через 48 ч после обработки одной из миРНК, созданных к vegfaas (vefaas1_2, P=0,05), и возможно второй, vefaas1_3 (P=0,1, Фиг. 1A). В тех же образцах уровни vegfaas РНК значительно уменьшились после обработки vefaas1_2 или vefaas1_3, но не изменились после обработки vefaas1_5, который также не оказывали никакого воздействия на уровни VEGFA мРНК (Фиг. 1B).

Даунрегуляция VEGRas РНК

Результаты ПЦР в реальном времени показывают, что уровни VEGFA мРНК в клетках HepG2 значительно увеличились через 48 ч после обработки двумя миРНК, созданными к vegRas (vegRas1_2, P=0,02 и vegRas1_3, P=0,06, Фиг. 1C). Результаты изменения уровней РНК vegRas ожидаются.

Хотя изобретение было проиллюстрировано и описано относительно одного или более вариантов осуществления, специалистам, квалифицированным в данной области техники, после прочтения и понимания настоящего описания и прилагаемых фигур могут прийти на ум эквивалентные изменения и модификации. Кроме того, хотя конкретный признак изобретения мог быть раскрыт только относительно одного из нескольких вариантов осуществления, такой признак может быть объединен с одним или более другими признаками другого варианта осуществления, что может быть предпочтительно и выгодно для любой данной или конкретной заявки.

Реферат описания позволит читателю быстро установить сущность технического описания. Это представлено с пониманием того, что он не будет использоваться для интерпретации или ограничения объема или значения следующей формулы изобретения.

1. Способ повышения экспрессии полинуклеотида фактора роста эндотелия сосудов (VEGF) в клетках или тканях пациента in vivo, включающий:
приведение указанных клеток или тканей в контакт с антисмысловым одноцепочечным олигонуклеотидом длиной 10-30 нуклеотидов или двухцепочечной миРНК длиной 19-30 нуклеотидов, где указанный олигонуклеотид специфически гибридизуется с природной антисмысловой последовательностью полинуклеотида гена VEGF и идентичен последовательности с обратным комплементом полинуклеотида, включающего 10-30 нуклеотидов в пределах 1-643 нуклеотида SEQ ID NO: 2 или 1-513 нуклеотида SEQ ID NO: 3, повышая, таким образом, экспрессию полинуклеотида VEGF в клетках или тканях пациента in vivo.

2. Способ по п. 1, где олигонуклеотиды включают по меньшей мере одну олигонуклеотидную последовательность из SEQ ID NO: 4-9.

3. Способ повышения экспрессии полинуклеотида фактора роста эндотелия сосудов (VEGF) в клетках или тканях пациента in vitro, включающий:
приведение указанных клеток или тканей в контакт с антисмысловым одноцепочечным олигонуклеотидом длиной 10-30 нуклеотидов, где указанный олигонуклеотид специфически гибридизуется с природным антисмысловым полинуклеотидом гена VEGF, повышая, таким образом, экспрессию полинуклеотида фактора роста эндотелия сосудов (VEGF) в клетках или тканях пациента in vitro.

4. Способ повышения экспрессии полинуклеотида фактора роста эндотелия сосудов (VEGF) в клетках или тканях пациента in vivo, включающий:
приведение указанных клеток или тканей в контакт с антисмысловым одноцепочечным модифицированным олигонуклеотидом длиной 10-30 нуклеотидов, где указанный олигонуклеотид специфически гибридизуется с природным антисмысловым полинуклеотидом гена VEGF, повышая, таким образом, экспрессию полинуклеотида фактора роста эндотелия сосудов (VEGF) в клетках или тканях пациента in vivo.

5. Способ повышения экспрессии полинуклеотида фактора роста эндотелия сосудов (VEGF) в клетках или тканях пациента in vivo, включающий:
приведение указанных клеток или тканей в контакт с антисмысловым одноцепочечным олигонуклеотидом длиной приблизительно 15-30 нуклеотидов, который направленно взаимодействует с комплементарной областью природного антисмыслового транскрипта полинуклеотида фактора роста эндотелия сосудов (VEGF), выбранного из группы, состоящей из SEQ ID NO:2 и 3, повышая, таким образом, экспрессию полинуклеотида фактора роста эндотелия сосудов (VEGF) в клетках или тканях пациента in vivo.

6. Способ по п. 5, где экспрессия фактора роста эндотелия сосудов (VEGF) повышена in vivo по сравнению с контролем.

7. Способ по п. 5, где антисмысловой олигонуклеотид направленно взаимодействует с природным антисмысловым полинуклеотидом, антисмысловым к кодирующим и/или некодирующим нуклеотидным последовательностям полинуклеотида РНК фактора роста эндотелия сосудов (VEGF).

8. Способ по п. 5, где антисмысловые олигонуклеотиды направленно взаимодействуют с природным антисмысловым транскриптом с перекрывающимися и/или неперекрывающимися последовательностями с полинуклеотидом РНК фактора роста эндотелия сосудов (VEGF).

9. Способ по п. 5, где антисмысловые олигонуклеотиды включают одну или несколько модификаций, включающих: модифицированную сахаридную группу, модифицированную межнуклеозидную связь, модифицированный нуклеотид и/или комбинации перечисленного.

10. Способ по п. 9, где модифицированная сахаридная группа включает 2′-O-метоксиэтил модифицированную сахаридную группу, 2′-метокси модифицированную сахаридную группу, 2′-O-алкил модифицированную сахаридную группу или бициклическую сахаридную группу.

11. Способ по п. 9, где модифицированные межнуклеозидные связи включают фосфоротиоат, 2′-О-метоксиэтил (МОЕ), 2′-фтор, алкилфосфонат, фосфородитиоат, алкилфосфонотиоат, фосфорамидат, карбамат, карбонат, фосфатный триэфир, ацетамидат, карбоксиметиловый эфир и/или комбинации перечисленного.

12. Способ по п. 9, где олигонуклеотиды необязательно имеют по меньшей мере один модифицированный нуклеотид, включающий молекулы блокированной нуклеиновой кислоты (LNA), арабино-нуклеиновую кислоту (FANA), пептидо-нуклеиновые кислоты (ПНК), их аналоги или производные.

13. Олигонуклеотид длиной 10-30 нуклеотидов, включающий по меньшей мере одну модификацию, где модификация включает по меньшей мере одну межнуклеотидную связь: алкилфосфоната, фосфоротиоата, фосфородитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, фосфатного триэфира, ацетамидата, карбоксиметилового эфира или их комбинаций,
где олигонуклеотид необязательно включает по меньшей мере один модифицированный нуклеотид, включающий пептид-нуклеиновые кислоты, молекулы блокированной нуклеиновой кислоты (LNA), аналоги, производные и/или комбинации перечисленного, и
где указанный олигонуклеотид является антисмысловым полинуклеотидом, который гибридизуется с природным антисмысловым полинуклеотидом гена VEGF, содержащим 10-30 нуклеотидов в пределах нуклеотидов 1-643 SEQ ID NO: 2 или нуклеотидов 1-513 SEQ ID NO: 3, и повышает экспрессию полинуклеотида VEGF в клетках или тканях пациента in vivo.

14. Олигонуклеотид по п. 13, где по меньшей мере одна модификация включает комбинацию фосфоротиоатных межнуклеотидных связей и по меньшей мере одной межнуклеотидной связи, выбранной из группы, состоящей из: алкилфосфоната, фосфородитиоата, алкилфосфонотиоата, фосфорамидата, карбамата, карбоната, фосфатного триэфира, ацетамидата, карбоксиметилового эфира и/или их комбинаций.

15. Олигонуклеотид по п. 13, где указанный олигонуклеотид включает по меньшей мере одну фосфоротиоатную межнуклеотидную связь.

16. Олигонуклеотид по п. 13, где указанный олигонуклеотид включает скелет из фосфоротиоатных межнуклеотидных связей.

17. Олигонуклеотид по п. 13, где олигонуклеотид включает модифицированную сахаридную группу, включающую 2′-О-метоксиэтил модифицированную сахаридную группу, 2′-метокси модифицированную сахаридную группу, 2′-О-алкил модифицированную сахаридную группу или бициклическую сахаридную группу.

18. Олигонуклеотид по п. 13, где антисмысловой олигонуклеотид имеет длину по меньшей мере приблизительно 15-30 нуклеотидов и гибридизуется с природным антисмысловым полинуклеотидом фактора роста эндотелия сосудов (VEGF), где указанный природный антисмысловой полинуклеотид является антисысловым некодирующей области указанного полинуклеотида VEGF.

19. Олигонуклеотид по п. 13, где олигонуклеотид обладает по меньшей мере приблизительно 80% идентичностью последовательности к последовательности из по меньшей мере приблизительно 19 последовательных нуклеиновых кислот РНК, транскрибированной из полинуклеотида фактора роста эндотелия сосудов (VEGF).

20. Олигонуклеотид по п. 13, где указанный олигонуклеотид гибридизуется с и повышает экспрессию по меньшей мере одного полинуклеотида фактора роста эндотелия сосудов (VEGF), in vivo или in vitro, по сравнению с контролем.

21. Олигонуклеотид по п. 13, где олигонуклеотиды включают последовательности SEQ ID NO: 4-9.

22. Композиция для повышения экспрессии полинуклеотида фактора роста эндотелия сосудов (VEGF) в клетках или тканях пациента ал vivo, включающая один или более олигонуклеотидов по п. 13 и фармацевтически приемлемый разбавитель или носитель.

23. Композиция по п. 22, где олигонуклеотиды включают нуклеотидную последовательность с идентичностью по меньшей мере приблизительно 40% по сравнению с любой из нуклеотидных последовательностей SEQ ID NO: 4-9.

24. Композиция по п. 22, где олигонуклеотиды включают нуклеотидные последовательности SEQ ID NO: 4-9.

25. Композиция по п. 24, где олигонуклеотиды SEQ ID NO: 4-9, включают один или более модифицированных или замещенных нуклеотидов.

26. Композиция по п. 22, где модифицированные нуклеотиды включают модифицированные основания, включающие фосфоротиоат, метилфосфонат, пептид-нуклеиновые кислоты, молекулы блокированной нуклеиновой кислоты (LNA).



 

Похожие патенты:

Изобретение относится к области биотехнологии и раскрывает рекомбинантный экспрессионный вектор, включающий: либо последовательность, кодирующую фосфорилазу пуриновых нуклеозидов (ПНФазу из Sulfolobus solfataricus), либо последовательность, кодирующую уридинфосфорилазу (УФазу из Aeropyrum pernix), либо обе указанные последовательности.

Настоящее изобретение относится к области иммунологии. Предложено антитело против фракталкина (ФКН, CX3CL1) и его фракталкин-связывающий фрагмент, охарактеризованные последовательностями вариабельных доменов.

Изобретение относится к области иммунологии. Предложены выделенное антитело-антагонист против FGFR3 и его функциональный фрагмент, а также полинуклеотид, вектор экспрессии, клетка-хозяин и способ получения антитела против FGFR3 или его функционального фрагмента.

Изобретение относится к области биотехнологии, конкретно к конъюгатам Apo A с терапевтическими полипептидами, и может быть использовано в медицине. Получают конъюгат, содержащий молекулу Apo A-I или ее функционально-эквивалентный вариант, такой как Apo А-IV или Аро A-V, ковалентно связанную с представляющим терапевтический интерес полипептидом, выбранным из интерферона, ингибитора TGF-бета Р144 или Р17, IL-15, кардиотрофина-1, порфобилиногендеаминазы, инсулина и фактора VII.

Настоящее изобретение относится к области биотехнологии. Предложено гуманизированное антитело и его фрагмент, способные специфически связывать бета-амилоид, охарактеризованные фрагментами последовательностей на основе антитела мыши 8F5, и Fc-областью человеческого IgG1, содержащей аминокислотную замену D265A; а также кодирующая нуклеиновая кислота, вектор экспрессии, продуцирующие антитело или его фрагмент клетки, способ продуцирования антитела или его фрагмента; композиция, применение антитела и его фрагмента для изготовления лекарственного средства, способ предупреждения, лечения или облегчения эффектов амилоидоза; способ диагностики амилоид-ассоциированных заболеваний или состояний, способ определения степени нагрузки амилоидогенных бляшек и тест-набор для выявления и диагностики амилоид-ассоциированных бляшек.

Изобретение относится к области биохимии, в частности к антителу или фрагменту этого антитела, которое специфически связывается с TNFα человека, причем антитело или фрагмент антитела содержит последовательность каркасной области тяжелой цепи человека и последовательности CDR, происходящие из антитела кролика, а также к композиции для лечения заболеваний, опосредованных TNFα, содержащей вышеуказанное антитело или фрагмент.

Изобретение относится к области биотехнологии и иммунологии. Представлен акцепторный каркас вариабельной области тяжелой цепи антитела человека или гуманизированного антитела для пересадки CDR от антитела зайцеобразного, где каркас содержит треонин (T) в положении 24; аланин (A) или глицин (G) в положении 56; треонин (T) или аспарагин (N) в положении 84 и лейцин (L) или валин (V) в положении 89 (нумерация AHo).

Изобретение относится в области биотехнологии. Описан фермент сериновая протеаза грибов, имеющая аминокислотную последовательность зрелого фермента, которая по меньшей мере на 86% идентична аминокислотной последовательности зрелого фермента Fe_RF6318, представленной в описании.

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. Раскрыта конструкция, которая, при экспрессии в клетке-хозяине, является способной продуцировать пустые вирусные капсиды.

Изобретение относится к области биотехнологии, генной инженерии и вирусологии. Описан экспрессионный вектор для предотвращения или подавления вхождения, слияния или репликации ВИЧ в клетках млекопитающих.

Изобретение относится к биотехнологии, а именно к выделенному пептиду, который имеет индуцибельность цитотоксических Т-лимфоцитов (CTL), а также к его применению. Предложенный пептид может использоваться в противораковой иммунотерапии, более конкретно, в противораковых вакцинах. Предложенное изобретение позволяет с высокой эффективностью лечить рак. 15 н. и 5 з.п. ф-лы, 8 ил., 5 табл., 2 пр.

Изобретение относится к биотехнологии. Предложены: клещевой аллерген домашней пыли, представляющий собой полипептид, содержащий определенную аминокислотную последовательность, приведенную в описании в перечне списка последовательностей; кодирующая полипептид молекула ДНК; экспрессирующий вектор на её основе и трансформированная им рекомбинантная клетка для экспрессии полипептида. Описаны: вакцинная композиция для иммунотерапии аллергии к клещам домашней пыли на основе полипептида; применение указанного полипептида для диагностики аллергии к клещам домашней пыли; варианты применения полипептида при изготовлении лекарственного средства: для иммунотерапии аллергии к клещам домашней пыли или для предотвращения сенсибилизации клещевым аллергеном домашней пыли. Изобретение обеспечивает полипептид, который может найти применение как в диагностике, так и в терапии аллергии на клещевой аллерген домашней пыли. 8 н. и 5 з.п. ф-лы, 6 ил., 2 табл., 6 пр.

Настоящее изобретение относится к области иммунологии. Предложено антитело и его антигенсвязывающий фрагмент, способные связываться с дельта-подобным лигандом 4 (DLL4) человека, в том числе в форме меченого антитела или его антигенсвязывающего фрагмента, конструкции с константным доменом иммуноглобулина, конъюгата с терапевтическим или цитотоксическим средством и в кристаллизованной форме. Кроме того, рассмотрены: изолированная нуклеиновая кислота, кодирующая антитело или его фрагмент по изобретению, вектор экспрессии, клетка-хозяин и способ получения антитела или его антигенсвязывающего фрагмента; а также фармацевтическая композиция для модуляции заболевания или расстройства, способы снижения активности человеческого DLL4 и способ лечения пациента, страдающего расстройством, ассоциированным с негативным воздействием DLL4. Антитело по настоящему изобретению и его антигенсвязывающий фрагмент обладают способностью блокировать передачу сигнала Notch1, что может найти дальнейшее применение в терапии заболеваний, опосредованных повышенной активностью сигнального пути Notch1. 14 н. и 35 з.п. ф-лы, 31 табл., 11 пр.

Настоящее изобретение относится к области биотехнологии и раскрывает группу гуманизированных рекомбинантных антител, специфически связывающихся с человеческим CDCP1. Настоящее изобретение также раскрывает нуклеиновую кислоту, кодирующую антитело, экспрессионный вектор, содержащий указанную нуклеиновую кислоту и прокариотическую или эукариотическую клетку-хозяин, предназначенную для получения указанных антител. Предусмотрен способ получения указанных антител с применением указанной клетки-хозяина. Использованием в качестве активного указанного антитела получают фармацевтическую композицию для лечения рака, характеризующегося сверхэкспрессией CDCP1. Настоящее изобретение позволяет получить гуманизированные антитела с улучшенными CDCP1 связывающими свойствами. 10 н. и 10 з.п. ф-лы, 5 ил., 4 табл., 6 пр.

Настоящее изобретение относится к биотехнологии, генной инженерии и представляет собой бактериальную клетку, способную реплицироваться в среде, содержащей по меньшей мере один тяжелый металл, выбранный из ртути, кадмия, цинка и свинца. Указанная бактериальная клетка трансформирована по меньшей мере одним хелатирующим агентом, выбранным из генов mt,β-галактозидазы и ppk. При этом указанные гены не экспрессируются как слитый белок в случае использования нескольких генов одновременно, экспрессируются с сильного промотора и по меньшей мере одного из 5'UTR и 3'UTR. Указанная клетка продуцирует более 4000 полных копий мРНК хелатирующего агента на нг суммарной мРНК. Настоящее изобретение раскрывает способы очистки жидкости от загрязнения тяжелыми металлами с использованием культуры указанных бактериальных клеток либо твёрдого матрикса, содержащего β-галактозидазу, а также наборы для обнаружения загрязнения тяжелыми металлами, содержащие культуру указанных бактериальных клеток. Настоящее изобретение позволяет повысить устойчивость конструируемых бактериальных клеток к высоким концентрациям тяжелых металлов. 5 н. и 17 з.п. ф-лы, 11 ил., 7 пр.

Изобретение относится к биотехнологии и иммунологии. Предложены варианты выделенного антитела или его фрагмента, которые специфично связываются с внеклеточным доменом CXCR5 человека. Описаны: фармацевтическая композиция, а также варианты способа лечения пациента, использующие указанные антитело или его фрагмент для лечения заболевания или состояния, вызванного или связанного с CXCR5 человека. Предложена выделенная кодирующая молекула нуклеиновой кислоты, экспрессионный вектор на ее основе и клетка-хозяин для экспрессии антитела или его фрагмента, содержащая указанный вектор. Использование изобретения обеспечивает новые антитела, которые специфично связываются с внеклеточным доменом CXCR5 и блокируют связывание лиганда CXCL13 c CXCR5 человека, что может найти применение в медицине для лечения болезней или нарушений, связанных или вызванных CXCR5. 7 н. и 14 з.п. ф-лы, 2 табл., 19 пр.

Изобретение относится к области ветеринарной вирусологии и генной инженерии. Предложен рекомбинантный штамм вируса африканской чумы свиней с заменой генов EP153R и EP402R, содержащий репортерный ген EGFP, кодирующий зеленый флюоресцентный белок. Штамм DswCongo/FranceLectinCD2 получен из аттенуированного штамма КК-262 вируса африканской чумы свиней путем гомологичной рекомбинации. Штамм содержит в своем составе гены EP153R и EP402R из штамма ФК-32 вируса АЧС. Рекомбинантный штамм является непатогенным для свиней при внутримышечном заражении в дозе 2*106 ГАЕ 50/см3. Также предложена рекомбинационная кассета, которая была использована для получения рекомбинантного штамма DswCongo/FranceLectinCD2, представляющая собой плазмиду на основе вектора pUC19, содержащая фрагменты генов EP152R и EP364R штамма КК-262 вируса АЧС, полноразмерные гены EP153R и EP402R штамма Ф-32, а также репортерный ген EGFP. Изобретение может быть использовано в научно-исследовательских институтах для изучения роли белков вируса АЧС в репродукции вируса в культурах клеток, в восприимчивых животных, а также их функций в модуляции иммунного ответа. 2 н.п. ф-лы, 2 ил., 1 табл., 3 пр.

Изобретение относится к области биотехнологии, конкретно к получению модифицированного фактора FVII, и может быть использовано в медицине. Полипептид FVII модифицируют путем замены аминокислотного остатка, выбранной из D196L, D196I, D196Y, К197Е, K197D, K197L, К197М, K197I, K197V, K197F, K197W, K197Y, K199D и K199E, в аминокислотной последовательности FVII, представленной в виде SEQ ID NO: 3, или в соответствующих остатках его предшественника с SEQ ID NO: 1 или SEQ ID NO: 2. Полипептид может содержать дополнительные модификации аминокислот, улучшающие его функциональные свойства. Изобретение позволяет получить модифицированный полипептид FVII, который при активации обладает увеличенной коагулянтной активностью и/или повышенной устойчивостью к ингибиторам по сравнению с немодифицированным полипептидом FVII с последовательностью, приведенной в SEQ ID NO: 3. 9 н. и 39 з.п. ф-лы, 7 ил., 23 табл., 17 пр.

Группа изобретений относится к биотехнологии. Предложены способ получения терминального алкена, в конкретном варианте - изобутелена, применение мевалонатдифосфат декарбоксилазы и микроорганизма, продуцирующего мевалонатдифосфат декарбоксилазу, для получения терминального алкена, а также композиция для получения терминального алкена. Способ включает превращение 3-гидроксиалканоата формулы с помощью мевалонатдифосфат декарбоксилазы в присутствии АТФ, рНТФ, дНТФ или смеси нескольких таких молекул, полифосфата или пирофосфата в терминальный алкен. R1 и R2 независимо друг от друга выбирают из группы, состоящей из атома водорода и линейной или разветвленной алкильной группы, включающей 1-4 атома углерода. Для получения изобутилена осуществляют превращение 3-гидрокси-3-метилбутирата с помощью мевалонатдифосфат декарбоксилазы, включающей последовательность SEQ ID NO:6, или последовательность, обладающую по крайней мере 15%, и предпочтительно 50, 80 или 90% гомологией последовательности. Композиция для получения терминального алкена включает микроорганизм, продуцирующий мевалонатдифосфат декарбоксилазу, культуральную среду с источником углерода и 3-гидроксиалканоатом. Изобретения обеспечивают новый путь синтеза терминального алкена на основе ферментативного превращения 3-гидроксиалканоатов, что позволяет устранить применение нефтепродуктов и снизить затраты на получение пластиков и топлива. 5 н. и 20 з.п. ф-лы, 15 ил., 13 пр.

Настоящее изобретение относится к области иммунологии и биотехнологии. Предложена нуклеиновая кислота, кодирующая биспецифическое одноцепочечное антитело, направленное против CD3 и CEA человека. При этом CEA, связывающий домен, содержит три CDR легкой и три CDR тяжелой цепи, где CDR-H3 происходит из моноклонального антитела мыши A5B7. Описаны: экспрессионный вектор и клетка-хозяин на основе НК, а также способ получения биспецифического одноцепочечного антитела с использованием клетки. Использование изобретения обеспечивает получение антитела, которое устойчиво к растворимому СЕА человека, что может найти применение в терапии эпителиальных опухолей у пациентов с высоким содержанием СЕА в плазме. 4 н. и 10 з.п. ф-лы, 27 ил., 1 табл.
Наверх