Антигены вируса гриппа h1n1 с широким спектром активности, оптимизированные с применением вычислительных средств



Антигены вируса гриппа h1n1 с широким спектром активности, оптимизированные с применением вычислительных средств
Антигены вируса гриппа h1n1 с широким спектром активности, оптимизированные с применением вычислительных средств
Антигены вируса гриппа h1n1 с широким спектром активности, оптимизированные с применением вычислительных средств
Антигены вируса гриппа h1n1 с широким спектром активности, оптимизированные с применением вычислительных средств
Антигены вируса гриппа h1n1 с широким спектром активности, оптимизированные с применением вычислительных средств
Антигены вируса гриппа h1n1 с широким спектром активности, оптимизированные с применением вычислительных средств
Антигены вируса гриппа h1n1 с широким спектром активности, оптимизированные с применением вычислительных средств
Антигены вируса гриппа h1n1 с широким спектром активности, оптимизированные с применением вычислительных средств

 


Владельцы патента RU 2612900:

ЮНИВЕРСИТИ ОФ ПИТТСБУРГ - ОФ ЗЕ КОММОНВЭЛС СИСТЕМ ОФ ХАЙЕ ЭДЬЮКЕЙШН (US)

Изобретение относится к области биотехнологии и вирусологии. Описано получение оптимизированных полипептидов HA вируса гриппа H1N1, вызывающих иммунный ответ с широким спектром активности в отношении изолятов вируса гриппа H1N1. Оптимизированные полипептиды HA разрабатывали путем проведения серии выравниваний последовательностей белков HA и последующего образования консенсусных последовательностей на основании строения определенных вирусов H1N1, выделенных с 1918 по 2011 гг. Описаны также композиции, слитые белки и VLP, содержащие полипептиды HA. Также описаны последовательности нуклеиновых кислот, подвергнутые оптимизации кодонов, кодирующие полипептиды HA, и способы вызова иммунного ответа в отношении вируса гриппа у субъекта. Предложенная группа изобретений может быть использована в медицине. 10 н. и 13 з.п. ф-лы, 7 ил., 3 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА HA РОДСТВЕННЫЕ ЗАЯВКИ

Настоящая заявка заявляет приоритет по предварительной заявке на патент США №61/498800, поданной 20 июня 2011 г., которая включена в данный документ посредством ссылки во всей своей полноте.

ОБЛАСТЬ ТЕХНИКИ

Настоящее изобретение относится к оптимизированным белкам-гемагглютининам вируса гриппа, которые вызывают иммунный ответ с широким спектром активности в отношении изолятов вируса гриппа H1N1, и к их применению в качестве вакцин.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

Вирус гриппа является представителем семейства Orthomyxoviridae. Существует три подтипа вирусов гриппа, обозначаемые как вирус гриппа A, вирус гриппа B и вирус гриппа C. Вирион вируса гриппа содержит геном, состоящий из сегментированной отрицательно-полярной нити РНК, которая кодирует следующие белки: гемагглютинин (HA), нейраминидазу (NA), матриксный белок (M1), белок протонного канала (M2), нуклеопротеин (NP), основный белок полимеразного комплекса 1 (PB1), основный белок полимеразного комплекса 2 (PB2), кислый белок полимеразного комплекса (PA) и неструктурный белок 2 (NS2). Белки HA, NA, M1 и M2 являются белками, ассоциированными с мембраной, тогда как NP, PB1, PB2, PA и NS2 являются белками, ассоциированными с нуклеокапсидом. Белок М1 является наиболее распространенным белком в частицах вируса гриппа. Белки HA и NA являются гликопротеинами оболочки, которые отвечают за прикрепление вируса и проникновение вирусных частиц в клетку, а также являются источниками основных иммунодоминантных эпитопов для нейтрализации вируса и защитного иммунитета. Как белок HA, так и белок NA считаются наиболее важными компонентами профилактических вакцин против гриппа.
Ежегодно сезонные вспышки гриппа являются причиной более 300000 случаев госпитализации и 36000 смертельных случаев только в США (Simonsen et al., Lancet Infect Dis 7:658-66, 2007). Появление нового вируса гриппа H1N1 в 2009 г. показало, насколько быстро пандемия нового вида гриппа может распространиться по всему миру.
В настоящее время в США лицензированы два типа подходов к вакцинации против гриппа – применение инактивированной сплит-вакцины и применение вакцины на основе живого ослабленного вируса. Инактивированные вакцины могут эффективно индуцировать гуморальный иммунный ответ, но, как правило, вызывают только незначительный клеточный иммунный ответ. Вакцины на основе живого вируса не могут вводиться пациентам с ослабленным иммунитетом или беременным таковым в связи с имеющимся у них повышенным риском развития инфекции. Таким образом, существует потребность в вакцине против вируса гриппа, обладающей широким спектром защитной активности.

КРАТКОЕ ОПИСАНИЕ

В данном документе раскрывается создание оптимизированных полипептидов HA вируса гриппа H1N1, вызывающих иммунный ответ с широким спектром активности в отношении изолятов вируса гриппа H1N1. Оптимизированные полипептиды HA разрабатывали путем проведения серии выравниваний последовательностей белков HA и последующего образования консенсусных последовательностей на основании строения определенных вирусов H1N1, выделенных с 1918 по 2011 гг.
В данном документе обеспечиваются рекомбинантные полипептиды HA вируса гриппа, имеющие оптимизированную аминокислотную последовательность, вызывающие иммунный ответ с широким спектром активности в отношении вируса гриппа H1N1. В некоторых вариантах осуществления полипептид HA содержит аминокислотную последовательность, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентичную SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 или SEQ ID NO: 11. В некоторых вариантах осуществления аминокислотная последовательность полипептида содержит не более 5, не более 6, не более 7, не более 8, не более 9 или не более 10 аминокислотных замен по сравнению с SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 или SEQ ID NO: 11. В некоторых вариантах осуществления в полипептиде HA вируса гриппа отсутствует N-концевой метиониновый остаток.
Молекулы выделенных нуклеиновых кислот и векторы, кодирующие рекомбинантные полипептиды HA, также обеспечиваются в настоящем раскрытии. Дополнительно обеспечиваются выделенные клетки, содержащие такие векторы.
Также представлены вирусоподобные частицы (VLP), сходные с частицами вируса гриппа, и белки слияния, содержащие оптимизированные полипептиды HA, раскрытые в данном документе.
Дополнительно представлены композиции, которые содержат оптимизированные полипептиды HA вируса гриппа, белки слияния или VLP, раскрытые в данном документе, в фармацевтически приемлемом носителе. Способы вызова иммунного ответа в отношении вируса гриппа у субъекта путем введения раскрываемых композиций, белков слияния или VLP также обеспечиваются в настоящем раскрытии.

Также представлены способы иммунизации субъекта против вируса гриппа путем введения субъекту композиции, содержащей VLP, которая содержит оптимизированный полипептид HA.

Вышеизложенные и другие цели, признаки и преимущества настоящего изобретения станут более очевидными из следующего подробного описания, которое приводится со ссылкой на прилагаемые фигуры.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

ФИГУРА 1 представляет собой схематическое изображение способа, применяемого для образования консенсусной последовательности HA H1N1 в соответствии со cпособом 1.

ФИГУРА 2 представляет собой схематическое изображение способа, применяемого для образования консенсусной последовательности HA H1N1 в соответствии со способом 2.

ФИГУРА 3 представляет собой схематическое изображение способа, применяемого для образования консенсусной последовательности HA H1N1 в соответствии со способом 4.

ФИГУРА 4 представляет собой схематическое изображение способа, применяемого для образования консенсусной последовательности HA H1N1 в соответствии со способом 5.

ФИГУРА 5 представляет схематическое изображение способа, применяемого для образования консенсусной последовательности HA H1N1 в соответствии со способом 6.

ФИГУРА 6 представляет собой диаграмму, на которой изображены сывороточные титры антител, ингибирующих гемагглютинацию (HAI), индуцированные инфицированием мышей COBRA H1N1. У мышей, инфицированных COBRA VLP, сходных с частицами вируса гриппа H1N1, определяли сывороточные титры HAI-антител (COBRA, способ 1). Антисыворотку тестировали в отношении сезонного вируса гриппа H1N1 A/Новая Каледония/20/1999. Результаты представлены как трансформированное путем логарифмирования по основанию 2 среднее геометрическое значение титра (+S.E.M.) антисыворотки, отобранной на 3, 5, 8 и 12 неделе после инфицирования.

ФИГУРА 7 представляет собой результат вестерн-блоттинга, демонстрирующий экспрессию белка COBRA HA (консенсусная последовательность, способ 1). Белок COBRA HA H1N1 образовывался в результате трансляции in vitro, и лизаты культур клеток анализировали с помощью SDS-PAGE и вестерн-блоттинга. Дорожка 1, вирус A/Новая Каледония/20/1999; дорожка 2, секретируемый COBRA HA H1N1; дорожка 3, 5 мкг VLP, сходных с частицами H1N1, с COBRA; дорожка 4, 10 мкг VLP с COBRA. COBRA HA (дорожка 2) мигрирует соответственно его ожидаемому молекулярному весу, что подтверждает экспрессию синтетического белка.

ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

Последовательности нуклеиновых кислот и аминокислотные последовательности, перечисленные в прилагаемом перечне последовательностей, показаны с помощью стандартных буквенных обозначений для нуклеотидных оснований и трехбуквенного кода для аминокислот, как определено в §1.822 главы 37 Свода федеральных нормативных актов США. Показана только одна цепь каждой последовательности нуклеиновой кислоты, но подразумевается, что комплементарная цепь включена в документ посредством любой ссылки на указываемую цепь. В прилагаемом перечне последовательностей:
SEQ ID NO: 1-11 являются аминокислотными последовательностями оптимизированных белков HA H1N1;
SEQ ID NO: 12 является консенсусной аминокислотной последовательностью, образованной на основании сравнения оптимизированных белков HA H1N1;
SEQ ID NO: 13 является последовательностью нуклеиновой кислоты, соответствующей HA H1N1, ген которого был подвергнут оптимизации кодонов.

ПОДРОБНОЕ ОПИСАНИЕ

I. Сокращения

COBRA: антиген с широким спектром активности, оптимизированный с применением вычислительных средств

HA: гемагглютинин

HAI: ингибирование гемагглютинации

HRP: пероксидаза хрена

M1: матриксный белок 1

NA: нейраминидаза

PFU: бляшкообразующая единица

VLP: вирусоподобная частица

II. Термины и способы

Если не указано иное, технические термины используются согласно традиционному способу употребления. Определения часто используемых терминов в области молекулярной биологии могут быть найдены в Benjamin Lewin, Genes V, опубликованном в Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (под ред.), The Encyclopedia of Molecular Biology, опубликованном в Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); и Robert A. Meyers (под ред.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, опубликованном в VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

Для того чтобы облегчить обзор различных вариантов осуществления настоящего раскрытия, представлены следующие объяснения конкретных терминов.

Адъювант. Вещество или среда, которые неспецифически усиливают иммунный ответ в отношении антигена. Адъюванты могут включать суспензию минеральных веществ (квасцы, гидроксид алюминия или фосфат алюминия), на которой адсорбируется антиген; или эмульсию типа “вода в масле”, в которой раствор антигена эмульгирован в минеральном масле (например, неполный адъювант Фрейнда), иногда с включением убитых микобактерий (полный адъювант Фрейнда) для дополнительного усиления антигенных свойств. Иммуностимулирующие олигонуклеотиды (как, например, содержащие мотив CpG) можно также применять в качестве адъювантов (например, см. патенты США №№6194388; 6207646; 6214806; 6218371; 6239116; 6339068; 6406705; и 6429199). Адъюванты также включают биологические молекулы, такие как костимулирующие молекулы. Иллюстративные биологические адъюванты включают IL-2, RANTES, GM-CSF, TNF-α, IFN-γ, G-CSF, LFA-3, CD72, B7-1, B7-2, OX-40L и 41 BBL.

Вводить. Как применяется в данном документе, введение композиции субъекту означает предоставление, нанесение или приведение композиции в контакт с субъектом. Введение может осуществляться любым из ряда путей, как, например, местный, пероральный, подкожный, внутримышечный, внутрибрюшинный, внутривенный, подоболочечный и внутрикожный пути.

Антитело. Молекула иммуноглобулина, вырабатываемая B-лимфоцитами с определенной аминокислотной последовательностью. Выработка антител у людей или других животных происходит под действием специфического антигена (иммуногена). Антитела характеризуются специфической реакцией с антигеном, происходящей некоторым очевидным образом, при этом каждый из терминов “антитело” и “антиген” определен в отношении другого. Выражение “вызывать ответ с формированием антител” относится к способности антигена или другой молекулы индуцировать выработку антител.

Антиген. Соединение, композиция или вещество, которое может стимулировать выработку антител или Т-клеточный ответ у животного, в том числе композиции, инъецируемые животному или поглощаемые им. Антиген реагирует с продуктами специфических гуморальных или клеточных иммунных реакций, в том числе с таковыми, индуцируемыми гетерологичными иммуногенами. В некоторых вариантах осуществления раскрытых композиций и способов антиген представляет собой белок HA вируса гриппа.

Подвергнутый оптимизации кодонов. Термин “нуклеиновая кислота, подвергнутая оптимизации кодонов” относится к последовательности нуклеиновой кислоты, которая была изменена таким образом, что кодоны являются оптимальными для экспрессии в конкретной системе (такой как конкретный вид из группы видов). Например, нуклеотидная последовательность может быть оптимизирована для экспрессии в клетках млекопитающих. Оптимизация кодонов не изменяет аминокислотную последовательность кодируемого белка.

Белок слияния. Белок, образуемый путем экспрессии последовательности нуклеиновой кислоты, сконструированной из последовательностей нуклеиновых кислот, которые кодируют по меньшей мере часть двух различных (гетерологичных) белков. Для создания белка слияния последовательности нуклеиновых кислот должны находиться в одной той же рамке считывания и не содержать внутренних стоп-кодонов. Например, белок слияния содержит HA вируса гриппа, слитый с гетерологичным белком.

Гемагглютинин (HA). Поверхностный гликопротеин вируса гриппа. HA опосредует связывание вирусной частицы с клетками-хозяевами и последующее проникновение вируса в клетку-хозяина. Нуклеотидные и аминокислотные последовательности многочисленных белков HA вируса гриппа известны в данной области техники и являются общедоступными, такие как депонированные в GenBank. HA (наряду с NA) является одной из двух основных антигенных детерминант вируса гриппа.

Иммунный ответ. Ответ клетки иммунной системы, такой как В-клетка, Т-клетка, макрофаг или полиморфноядерный лейкоцит, на стимул, такой как антиген или вакцина. Иммунный ответ может затрагивать любую клетку тела, участвующую в защитной реакции организма-хозяина, включая, например, эпителиальную клетку, которая секретирует интерферон или цитокин. Иммунный ответ включает, но без ограничений, врожденный иммунный ответ или воспаление. Как применяется в данном документе, защитный иммунный ответ относится к иммунному ответу, который защищает субъекта от инфекции (предупреждает инфекцию или предупреждает развитие заболевания, ассоциированного с инфекцией). Способы оценивания иммунных ответов хорошо известны в данной области техники и включают, например, оценивание пролиферации и/или активности лимфоцитов (таких как B- или Т-клеток), секреции цитокинов или хемокинов, воспаления, выработки антител и т.п.

Иммуноген. Соединение, композиция или вещество, которое в соответствующих условиях способно стимулировать иммунный ответ, такой как выработка антител или Т-клеточный ответ, у животного, в том числе композиции, инъецируемые животному или поглощаемые им. Как применяется в данном документе, “иммуногенная композиция” представляет собой композицию, которая содержит иммуноген (например, полипептид HA).

Подвергать иммунизации. Предоставлять субъекту защиту от инфекционного заболевания, например, путем вакцинации.

Вирус гриппа. Вирус с сегментированной отрицательно-полярной нитью РНК, который принадлежит к семейству Orthomyxoviridae. Существует три типа вирусов гриппа: А, В и С. Вирусы гриппа А инфицируют большое число видов птиц и млекопитающих, в том числе людей, лошадей, морских млекопитающих, свиней, хорьков и кур. У животных большинство вирусов гриппа A вызывают локализованные инфекции дыхательных путей и кишечника в легкой форме. Тем не менее, высокопатогенные штаммы вируса гриппа A, такие как H5N1, вызывают системные инфекции домашней птицы, при которых смертность может достигать 100%. В 2009 г. вирус гриппа H1N1 был наиболее частой причиной заболевания людей гриппом. Новый штамм H1N1, происходящего от свиней, появился в 2009 г. и был объявлен пандемическим Всемирной организацией здравоохранения. Этот штамм был назван “вирусом свиного гриппа”. Вирусы гриппа A H1N1 также были причиной пандемии испанского гриппа в 1918 г., вспышки заболевания в Форт-Дикс в 1976 г. и эпидемии гриппа в России в 1977-1978 гг.

Выделенный. “Выделенный” биологический компонент (такой как нуклеиновая кислота, белок или вирус) был практически отделен или очищен от других биологических компонентов (таких как клеточный дебрис или другие белки или нуклеиновые кислоты). Биологические компоненты, которые были “выделены”, включают компоненты, очищенные с помощью стандартных способов очистки. Этот термин также охватывает рекомбинантные нуклеиновые кислоты, белки или вирусы (или VLP), а также химически синтезированные нуклеиновые кислоты или пептиды.

Линкер. Одна или несколько аминокислот, которые служат в качестве спейсера между двумя полипептидами белка слияния.

Матриксный белок (M1). Структурный белок вируса гриппа, обнаруживаемый в оболочке вируса. Полагают, что M1 участвует в сборке и отпочковании.

Нейраминидаза (NA). Мембранный гликопротеин вируса гриппа. NA участвует в разрушении клеточного рецептора к HA вируса за счет отщепления концевых остатков сиаловой кислоты от углеводных фрагментов, расположенных на поверхности инфицированных клеток. NA также отщепляет остатки сиаловой кислоты от вирусных белков, предупреждая агрегацию вирусов. NA (наряду с HA) является одной из двух основных антигенных детерминант вируса гриппа.

Функционально связанный. Первая последовательность нуклеиновой кислоты является функционально связанный со второй последовательностью нуклеиновой кислоты в том случае, когда первая последовательность нуклеиновой кислоты размещена в функциональной взаимосвязи со второй последовательностью нуклеиновой кислоты. Например, промотор является функционально связанным с кодирующей последовательностью, если этот промотор влияет на транскрипцию или экспрессию кодирующей последовательности. Как правило, функционально связанные последовательности ДНК являются смежными и, при необходимости соединения двух областей, кодирующих белок, находятся в одной и той же рамке считывания.

Оптимизированный белок HA вируса гриппа. Как применяется в данном документе, “оптимизированный белок HA вируса гриппа” относится к консенсусной последовательности белка HA, образованной с помощью выравниваний последовательностей определенных вирусов H1N1, выделенных с 1918 по 2011 гг. (как описано в примере 1 ниже). Нуклеотидные последовательности, кодирующие оптимизированные белки HA, были (или могут быть) дополнительно оптимизированы для экспрессии в клетках млекопитающих посредством оптимизации кодонов и оптимизации РНК (так, чтобы повысить стабильность РНК). Оптимизированные белки HA вируса гриппа, раскрываемые в данном документе (и приведенные в данном документе как SEQ ID NO: 1-11), также называют последовательностями “COBRA”. Оптимизированные полипептиды HA предназначены для того, чтобы вызывать у субъекта иммунный ответ с широким спектром активности. Применительно к настоящему раскрытию “с широким спектром активности” означает, что белковая последовательность вызывает такой иммунный ответ у субъекта, который является достаточным для ингибирования, нейтрализации или предупреждения инфицирования широким спектром вирусов гриппа (таких как большинство вирусов гриппа или все таковые в рамках определенного подтипа). В некоторых случаях оптимизированный белок HA вируса гриппа способен вызывать иммунный ответ, такой как защитный иммунный ответ, в отношении большинства изолятов вируса гриппа H1N1 или всех таковых.

Вспышка. Как применяется в данном документе, “вспышка” вируса гриппа относится к накоплению изолятов вируса внутри отдельной страны в определенный год.

Фармацевтически приемлемые среды. Фармацевтически приемлемые носители (среды), применимые в настоящем раскрытии, являются традиционными. В Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975) описаны композиции и составы, пригодные для фармацевтической доставки одной или нескольких терапевтических композиций, таких как одна или несколько вакцин против гриппа, и дополнительных фармацевтических средств.

В целом, природа носителя будет зависеть от конкретного используемого способа введения. Например, составы для парентерального применения обычно содержат инъекционные жидкости, которые в качестве среды включают фармацевтически и физиологически приемлемые жидкости, такие как вода, физиологический раствор, сбалансированные солевые растворы, водный раствор декстрозы, глицерин или т.п. В случае твердых композиций (например, в форме порошка, гранул, таблеток или капсул) обычные нетоксичные твердые носители могут включать, например, маннит, лактозу, крахмал или стеарат магния фармацевтической степени чистоты. Вводимые фармацевтические композиции в дополнение к биологически нейтральным носителям могут содержать незначительные количества нетоксичных вспомогательных веществ, таких как смачивающие или эмульгирующие средства, консерванты и буферные средства, поддерживающие pH, и т.п., например, ацетат натрия или сорбитанмонолаурат.

Полипептид. Полимер, мономерами в котором являются аминокислотные остатки, соединенные друг с другом посредством амидных связей. Если аминокислоты представляют собой альфа-аминокислоты, можно применять L-оптический изомер или D-оптический изомер. Термины “полипептид” или “белок”, применяемые в данном документе, предназначены для охвата любой аминокислотной последовательности и включают модифицированные последовательности, такие как гликопротеины. Термин “полипептид” конкретно предназначен для распространения на белки, встречающиеся в природе, а также полученные рекомбинантным или синтетическим путем. Термин “остаток” или “аминокислотный остаток” включает ссылку на аминокислоту, которая встроена в белок, полипептид или пептид.

Консервативные аминокислотные замены являются заменами, которые в случае их осуществления нарушают свойства исходного белка в наименьшей степени, то есть структура и в особенности функция белка сохраняются и существенно не изменяются вследствие таких замен. Примеры консервативных замен показаны ниже.

При консервативных заменах, как правило, сохраняется (a) структура полипептидного остова в области замены, например, в виде складчатой или спиральной конформации, (b) заряд или гидрофобность молекулы в целевом сайте или (c) объем боковой цепи.

Замены, которые в общем, как ожидается, приведут к наибольшим изменениям свойств белка, будут неконсервативными, например, изменениями, при которых (а) гидрофильный остаток, например, серил или треонил, заменяется гидрофобным остатком, например, лейцилом, изолейцилом, фенилаланилом, валилом или аланилом; (b) цистеин или пролин заменяется любым другим остатком, (с) остаток, имеющий электроположительную боковую цепь, например, лизил, аргинил, или гистидил, заменяется электроотрицательным остатком, например, глутамилом или аспартилом; или (d) остаток, имеющий объемную боковую цепь, например, фенилаланин, заменяется остатком, который не имеет боковой цепи, например, глицином.

Предупреждение, лечение или уменьшение интенсивности заболевания. “Предупреждением” заболевания называется ингибирование полного развития заболевания. “Лечением” называется терапевтическое вмешательство, которое уменьшает интенсивность признака или симптома заболевания или патологического состояния после начала его развития. “Уменьшением интенсивности” называется снижение числа или уменьшение степени тяжести признаков или симптомов заболевания.

Промотор. Промотор представляет собой совокупность контрольных последовательностей нуклеиновых кислот, управляющих транскрипцией нуклеиновой кислоты. Промотор содержит необходимые последовательности нуклеиновых кислот, располагающиеся возле сайта инициации транскрипции. Промотор также необязательно содержит дистальные энхансерные или репрессорные элементы. “Конститутивный промотор” представляет собой промотор, который является постоянно активным и не подвергается регуляции внешними сигналами или молекулами. В отличие от этого, активность “индуцибельного промотора” регулируется внешними сигналами или молекулами (например, фактором транскрипции). В некоторых вариантах осуществления, представленных в данном документе, промотор представляет собой промотор CMV.

Очищенный. Термин “очищенный” не подразумевает абсолютную чистоту; его, скорее, предполагается использовать как относительный термин. Таким образом, например, очищенные пептид, белок, вирус, VLP или другое активное соединение представляют собой таковые, выделенные полностью или частично из белков и других примесей, которые в естественных условиях ассоциированы с ними. В некоторых вариантах осуществления термин “практически очищенный” относится к пептиду, белку, вирусу, VLP или другому активному соединению, выделенным из клетки, среды для культивирования клеток или другого неочищенного препарата и подвергнутым фракционированию для удаления различных компонентов из исходного препарата, таких как белки, клеточный дебрис и другие компоненты.

Рекомбинантный. Рекомбинантные нуклеиновая кислота, белок, вирус или VLP представляют собой таковые, содержащие последовательность, которая не встречается в природе, или содержащие последовательность, созданную путем искусственного объединения двух сегментов последовательности, которые в остальных случаях отделены друг от друга. Это искусственное объединение часто выполняют путем химического синтеза или, более часто, путем искусственного воздействия на выделенные сегменты нуклеиновых кислот, например, при помощи методик генной инженерии.

Идентичность последовательностей. Подобие между аминокислотными последовательностями или последовательностями нуклеиновых кислот выражается в аспекте подобия между последовательностями, которое иначе называют идентичностью последовательностей. Идентичность последовательностей часто выражается в аспекте процентной идентичности (или подобия, или гомологии); чем выше процентное значение, тем более высоким является подобие двух последовательностей. Гомологи или варианты данного гена или белка будут обладать относительно высокой степенью идентичности последовательностей при выравнивании с применением стандартных способов.
Способы выравнивания последовательностей для сравнения хорошо известны в данной области техники. Различные программы и алгоритмы выравнивания описаны в Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444, 1988; Higgins and Sharp, Gene 73:237-244, 1988; Higgins and Sharp, CABIOS 5:151-153, 1989; Corpet et al., Nucleic Acids Research 16:10881-10890, 1988; и Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444, 1988; Altschul et al., Nature Genet. 6:119-129, 1994.

Cредство поиска основного локального выравнивания (BLASTTM) NCBI (Altschul et al., J. Mol. Biol. 215:403-410, 1990) доступно из нескольких источников, включая Национальный центр биотехнологической информации (NCBI, Бетесда, Мэриленд) и Интернет, для применения вместе с программами анализа последовательностей blastp, blastn, blastx, tblastn и tblastx.

Субъект. Живые многоклеточные позвоночные организмы, категория, которая включает как человека, так и млекопитающих, отличных от человека, таких как приматы, отличные от человека.

Терапевтически эффективное количество. Количество определенного средства, достаточное для достижения желаемого эффекта у субъекта, подвергающегося лечению с помощью этого средства. Например, это может быть количеством вакцины против вируса гриппа, пригодным для вызова иммунного ответа у субъекта и/или предупреждения инфекции или заболевания, вызываемых вирусом гриппа. В идеале, применительно к настоящему раскрытию, терапевтически эффективным количеством вакцины против гриппа является количество, достаточное для повышения резистентности к инфекции, вызываемой вирусом гриппа, ее предупреждения, уменьшения интенсивности и/или лечения у субъекта, которое при этом не вызывает значительного цитотоксического эффекта у субъекта. Эффективное количество вакцины против гриппа, пригодное для повышения резистентности к инфекции, ее предупреждения, уменьшения интенсивности и/или лечения у субъекта, будет зависеть, например, от субъекта, подвергающегося лечению, способа введения терапевтической композиции и других факторов.

Трансформированный. Трансформированная клетка представляет собой клетку, в которую ввели молекулу нуклеиновой кислоты при помощи методик молекулярной биологии. Как применяется в данном документе, термин “трансформация” охватывает все методики, при помощи которых молекулу нуклеиновой кислоты можно вводить в такую клетку, в том числе трансфекцию с применением вирусных векторов, трансформацию с применением плазмидных векторов и введение “голой” ДНК путем электропорации, липофекции и ускорения частиц при помощи генной пушки.

Вакцина. Препарат на основе иммуногенного материала, способного стимулировать иммунный ответ, вводимый для предупреждения, уменьшения интенсивности или лечения заболевания, такого как инфекционное заболевание. Иммуногенный материал может включать, например, ослабленные или убитые микроорганизмы (например, ослабленные вирусы) или антигенные белки, пептиды или ДНК, полученные из них. Вакцины могут вызвать как профилактический (предупредительный), так и терапевтический ответ. Способы введения варьируют в зависимости от вакцины, но могут включать прививку, проглатывание, ингаляцию или другие формы введения. Прививки могут производиться с помощью ряда различных путей, включая парентеральный, например, внутривенный, подкожный или внутримышечный. Вакцины можно вводить с адъювантом, чтобы форсировать иммунный ответ.

Вектор. Вектор представляет собой молекулу нуклеиновой кислоты, которая позволяет производить вставку чужеродной нуклеиновой кислоты без нарушения способности вектора к репликации и/или интеграции в клетке-хозяине. Вектор может включать последовательности нуклеиновых кислот, которые позволяют ему реплицироваться в клетке-хозяине, например, точку начала репликации. Инсерционный вектор способен вставляться в нуклеиновую кислоту хозяина. Вектор может также содержать один или несколько селектируемых маркерных генов и других генетических элементов. Вектор экспрессии представляет собой вектор, содержащий необходимые регуляторные последовательности, позволяющие осуществлять транскрипцию и трансляцию вставленного гена или генов. В некоторых вариантах осуществления настоящего раскрытия вектор кодирует белок HA, NA или М1 вируса гриппа. В некоторых вариантах осуществления вектор представляет собой вектор экспрессии pTR600 (публикация заявки на патент США № 2002/0106798; Ross et al., Nat Immunol. 1(2):102-103, 2000; Green et al., Vaccine 20:242-248, 2001).

Вирусоподобная частица (VLP). Вирусные частицы, образованные одним или несколькими структурными белками вируса, но не имеющие вирусного генома. Поскольку VLP не имеют вирусного генома, они являются неинфекционными. Кроме того, VLP часто могут быть получены путем гетерологичной экспрессии и могут быть легко очищены. Большинство VLP содержат по меньшей мере сердцевинный вирусный белок, который управляет отпочкованием и высвобождением частиц из клетки-хозяина. Одним из примеров такого сердцевинного белка является M1 вируса гриппа. В некоторых вариантах осуществления, описываемых в данном документе, VLP, сходная с частицей вируса гриппа, содержит белки HA, NA и/или М1. VLP, сходные с частицами вируса гриппа, могут быть получены путем трансфекции клеток-хозяев с помощью плазмид, которые кодируют белки HA и NA и необязательно белок М1. После инкубирования трансфицированных клеток в течение соответствующего периода времени, необходимого для обеспечения экспрессии белка (как, например, в течение приблизительно 72 часов), VLP можно выделять из надосадочной жидкости культуры клеток. В примере 2 приводится иллюстративный протокол очистки VLP, сходных с частицами вируса гриппа, от надосадочной жидкости культуры клеток. В этом примере VLP выделяют путем низкоскоростного центрифугирования (для удаления клеточного дебриса), вакуум-фильтрации и ультрацентрифугирования в 20% глицерине. Другие способы получения VLP, сходных с частицами вируса гриппа, известны в данной области техники (см., например, публикации заявки на патент США №№ 2006/0263804; 2008/0031895; 2010/0166769 и 2010/0239610).

Если не истолковывается иначе, все технические и научные термины, применяемые в данном документе, имеют то же значение, что и обычно понимаемое средним специалистом в той области техники, к которой принадлежит настоящее раскрытие. Термины в единственном числе включают в себя определяемые объекты во множественном числе, если из контекста явно не следует иное. Точно так же, слово “или” подразумевает включение слова “и”, если из контекста явно не следует иное. Поэтому “содержащий A или B” означает содержащий А, или В, или А и B. Дополнительно следует понимать, что все размеры оснований или размеры аминокислот и все значения молекулярного веса или молекулярной массы, приведенные для нуклеиновых кислот или полипептидов, являются приблизительными и предназначены для описания. Хотя способы и материалы, подобные или эквивалентные описываемым в данном документе, можно применять в практическом осуществлении или тестировании настоящего изобретения, подходящие способы и материалы описаны ниже. Все публикации, заявки на патенты, патенты и другие ссылки, упоминаемые в данном документе, включены посредством ссылки во всей своей полноте. В случае конфликта в качестве контрольного документа будет выступать настоящее описание, включая пояснения терминов. Кроме того, материалы, способы и примеры являются только иллюстративными и не предназначены быть ограничивающими.

III. Обзор некоторых вариантов осуществления

В данном документе раскрывается образование оптимизированных полипептидов HA вируса гриппа H1N1, вызывающих иммунный ответ с широким спектром активности в отношении вируса гриппа H1N1. Оптимизированные полипептиды HA разрабатывали путем проведения серии выравниваний последовательностей белков HA и последующего образования консенсусных последовательностей на основании строения определенных вирусов H1N1, выделенных с 1918 по 2011 гг. Способы, применяемые для образования 11 консенсусных последовательностей HA, описаны в примере 1 и на фигурах 1-5. Аминокислотные последовательности 11 консенсусных полипептидов HA приведены в данном документе как SEQ ID NO: 1-11. Кроме того, аминокислотная консенсусная последовательность, образованная на основании сравнения SEQ ID NO: 1-11, представлена в данном документе как SEQ ID NO: 12.

В данном документе представлены рекомбинантные полипептиды HA вируса гриппа, которые имеют оптимизированную аминокислотную последовательность, вызывающие иммунный ответ с широким спектром активности в отношении вируса гриппа H1N1. В некоторых вариантах осуществления полипептид HA содержит аминокислотную последовательность, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентичную SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 или SEQ ID NO: 11. В других вариантах осуществления аминокислотная последовательность полипептида содержит не более 5, не более 6, не более 7, не более 8, не более 9 или не более 10 аминокислотных замен по сравнению с SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 или SEQ ID NO: 11.

В конкретных вариантах осуществления обеспечивается рекомбинантный полипептид HA вируса гриппа, содержащий аминокислотную последовательность, по меньшей мере на 99% идентичную SEQ ID NO: 1; по меньшей мере на 99,2% идентичную SEQ ID NO: 2; по меньшей мере на 99% идентичную SEQ ID NO: 3; по меньшей мере на 99% идентичную SEQ ID NO: 4; по меньшей мере на 98% или по меньшей мере на 99% идентичную SEQ ID NO: 5; по меньшей мере на 99% идентичную SEQ ID NO: 6; по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентичную SEQ ID NO: 7; по меньшей мере на 99% идентичную SEQ ID NO: 8; содержащую SEQ ID NO: 9; по меньшей мере на 99% идентичную SEQ ID NO: 10 или по меньшей мере на 99% идентичную SEQ ID NO: 11.

В других конкретных вариантах осуществления рекомбинантный полипептид HA вируса гриппа содержит аминокислотную последовательность, по меньшей мере на 99% идентичную остаткам 2-566 последовательности SEQ ID NO: 1; по меньшей мере на 99,2% идентичную остаткам 2-566 последовательности SEQ ID NO: 2; по меньшей мере на 99% идентичную остаткам 2-566 последовательности SEQ ID NO: 3; по меньшей мере на 99% идентичную остаткам 2-566 последовательности SEQ ID NO: 4; по меньшей мере на 98% или по меньшей мере на 99% идентичную остаткам 2-566 последовательности SEQ ID NO: 5; по меньшей мере на 99% идентичную остаткам 2-566 последовательности SEQ ID NO: 6; по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентичную остаткам 2-566 последовательности SEQ ID NO: 7; по меньшей мере на 99% идентичную остаткам 2-566 последовательности SEQ ID NO: 8; содержащую остатки 2-566 последовательности SEQ ID NO: 9; по меньшей мере на 99% идентичную остаткам 2-566 последовательности SEQ ID NO: 10 или по меньшей мере на 99% идентичную остаткам 2-566 последовательности SEQ ID NO: 11.

В других вариантах осуществления аминокислотная последовательность полипептида HA содержит (i) не более 5, не более 4, не более 3, не более 2 или не более 1 аминокислотной замены (замен) по сравнению с SEQ ID NO: 1; (ii) не более 4, не более 3, не более 2 или не более 1 аминокислотной замены (замен) по сравнению с SEQ ID NO: 2; (iii) не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 аминокислотной замены (замен) по сравнению с SEQ ID NO: 3; (iv) не более 8, не более 7, не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 аминокислотной замены (замен) по сравнению с SEQ ID NO: 4; (v) не более 10, не более 9, не более 8, не более 7, не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 аминокислотной замены (замен) по сравнению с SEQ ID NO: 5; (vi) не более 8, не более 7, не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 аминокислотной замены (замен) по сравнению с SEQ ID NO: 6; (vii) не более 10, не более 9, не более 8, не более 7, не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 аминокислотной замены (замен) по сравнению с SEQ ID NO: 7; (viii) не более 10, не более 9, не более 8, не более 7, не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 аминокислотной замены (замен) по сравнению с SEQ ID NO: 8; (ix) не более 8, не более 7, не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 аминокислотной замены (замен) по сравнению с SEQ ID NO: 10 или (x) не более 5, не более 4, не более 3, не более 2 или не более 1 аминокислотной замены (замен) по сравнению с SEQ ID NO: 11.

В некоторых примерах полипептид HA вируса гриппа содержит аминокислотную последовательность, содержащую остатки 2-566 SEQ ID NO: 1, остатки 2-566 SEQ ID NO: 2, остатки 2-566 SEQ ID NO: 3, остатки 2-566 SEQ ID NO: 4, остатки 2-566 SEQ ID NO: 5, остатки 2-566 SEQ ID NO: 6, остатки 2-566 SEQ ID NO: 7, остатки 2-566 SEQ ID NO: 8, остатки 2-566 SEQ ID NO: 9, остатки 2-566 SEQ ID NO: 10 или остатки 2-566 SEQ ID NO: 11, или состоит из таковой.

В других примерах рекомбинантный полипептид HA содержит аминокислотную последовательность SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 или SEQ ID NO: 11 или состоит из таковой.

В другом примере рекомбинантный полипептид HA содержит аминокислотную последовательность SEQ ID NO: 12 или состоит из таковой. В еще одном примере рекомбинантный полипептид HA содержит аминокислотную последовательность, содержащую остатки 2-566 SEQ ID NO: 12, или состоит из таковой.

Дополнительно обеспечиваются молекулы выделенных нуклеиновых кислот, кодирующие рекомбинантные полипептиды HA, раскрываемые в данном документе. В некоторых вариантах осуществления молекула нуклеиновой кислоты подвергнута оптимизации кодонов для экспрессии в клетках млекопитающих. Молекула нуклеиновой кислоты необязательно дополнительно оптимизирована для обеспечения стабильности РНК. В некоторых вариантах осуществления последовательность молекулы нуклеиновой кислоты по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентична SEQ ID NO: 13. В конкретных примерах последовательность молекулы нуклеиновой кислоты содержит SEQ ID NO: 13 или состоит из таковой.

Векторы, содержащие молекулы нуклеиновых кислот, кодирующие рекомбинантные полипептиды HA, также обеспечиваются в настоящем раскрытии. Вектором может быть любой вектор, подходящий для экспрессии полипептида HA, такой как вектор экспрессии у млекопитающих. В конкретных примерах вектор представляет собой вектор экспрессии pTR600 (публикация заявки на патент США №2002/0106798, которая включена в данный документ посредством ссылки; Ross et al., Nat Immunol. 1(2):102-103, 2000; Green et al., Vaccine 20:242-248, 2001).

В некоторых примерах вектор содержит промотор, функционально связанный c нуклеотидной последовательностью, кодирующей полипептид HA. В конкретных примерах промотор представляет собой промотор CMV.

Также обеспечиваются выделенные клетки, содержащие раскрываемые векторы. В некоторых случаях клетка представляет собой клетку любого типа, подходящего для выработки и экспрессии VLP, такую как клетка млекопитающего.

Дополнительно обеспечиваются VLP, сходные с частицами вируса гриппа, содержащие оптимизированный полипептид HA, раскрываемый в данном документе. VLP, сходные с частицами вируса гриппа, могут дополнительно содержать любые дополнительные белки вируса гриппа, необходимые для формирования вирусной частицы. В некоторых вариантах осуществления VLP, сходные с частицами вируса гриппа, дополнительно содержат белок нейраминидазу (NA) вируса гриппа, матриксный белок (M1) вируса гриппа или оба эти белка.

Также представлены VLP, сходные с частицами вируса гриппа, содержащие полипептид HA вируса гриппа, раскрываемый в данном документе, получаемые путем трансфекции клетки-хозяина с помощью вектора, кодирующего полипептид HA, вектора, кодирующего белок NA вируса гриппа, и вектора, кодирующего белок М1 вируса гриппа, в условиях, достаточных для обеспечения экспрессии белков HA, M1 и NA.

Белки слияния, содержащие оптимизированный полипептид HA вируса гриппа, дополнительно обеспечиваются в настоящем раскрытии.

Также в данном документе обеспечиваются композиции, содержащие оптимизированный белок HA вируса гриппа, описываемый в данном документе, или белок слияния или VLP, содержащие оптимизированный белок HA вируса гриппа. В некоторых вариантах осуществления композиции дополнительно содержат фармацевтически приемлемый носитель и/или адъювант. Например, адъювант может представлять собой квасцы, полный адъювант Фрейнда, биологический адъювант или иммуностимулирующие олигонуклеотиды (такие как CpG-олигонуклеотиды).

Дополнительно обеспечивается способ вызова иммунного ответа в отношении вируса гриппа у субъекта путем введения оптимизированного белка HA вируса гриппа, белков слияния, содержащих оптимизированный полипептид HA вируса гриппа, VLP, содержащих оптимизированный HA вируса гриппа, или их композиций, описываемых в данном документе. В некоторых вариантах осуществления вирус гриппа представляет собой вирус гриппа H1N1. В некоторых вариантах осуществления белок HA, белок слияния, содержащий HA, или VLP можно вводить с помощью любого подходящего пути введения, такого как, например, внутримышечный. В некоторых вариантах осуществления белок HA, белок слияния или VLP вводят в форме композиции, дополнительно содержащей фармацевтически приемлемый носитель и/или адъювант. Например, адъювант может представлять собой квасцы, полный адъювант Фрейнда, биологический адъювант или иммуностимулирующие олигонуклеотиды (такие как CpG-олигонуклеотиды).

Также обеспечивается способ иммунизации субъекта против вируса гриппа путем введения субъекту VLP, содержащих оптимизированный белок HA вируса гриппа, раскрываемый в данном документе, или путем введения их композиции. В некоторых вариантах осуществления способа композиция дополнительно содержит фармацевтически приемлемый носитель и/или адъювант. Например, адъювант может представлять собой квасцы, полный адъюванта Фрейнда, биологический адъювант или иммуностимулирующие олигонуклеотиды (такие как CpG-олигонуклеотиды). В некоторых вариантах осуществления VLP (или их композиции) вводят внутримышечно.

В некоторых вариантах осуществления способов вызова иммунного ответа или иммунизации субъекта субъекту вводят от около 1 до около 25 мкг VLP, содержащих оптимизированный белок HA. В конкретных примерах субъекту вводят от около 5 до около 20 мкг VLP или от около 10 до около 15 мкг VLP. В одном конкретном неограничивающем примере субъекту вводят около 15 мкг VLP. Однако, специалист в данной области способен определить терапевтически эффективное количество (например, количество, обеспечивающее защиту от инфекции, вызываемой вирусом гриппа H1N1) VLP, которое необходимо ввести субъекту.

IV. Оптимизированные полипептиды HA и полинуклеотиды вируса гриппа H1N1

В данном документе обеспечиваются 11 различных оптимизированных последовательностей полипептида HA H1N1. Аминокислотные последовательности HA H1N1 загружали из базы данных ресурсов по вирусу гриппа NCBI. Белки HA H1N1 из 1134 изолятов, выделенных с 1918 по 2011 гг., применяли для образования консенсусных последовательностей. В примере 1 описаны способы, применяемые для образования каждой консенсусной последовательности (см. также фигуры 1-5).

COBRA, СПОСОБ 1 (SEQ ID NO: 1)

mkakllvllcaftatyadticigyhannstdtvdtvleknvtvthsvnlledshngklcrlkgiaplqlgncsiagwilgnpeceslfskeswsyivetpnsengtcypgyfadyeelreqlssvssferfeifpkesswpnhtvtkgvtascshngkssfyrnllwltekngsypnlsksyvnnkekevlvlwgvhhpsnigdqraiyhtenayvsvvsshysrrftpeiakrpkvrdqegrinyywtllepgdtiifeangnliapwyafalsrgfgsgiitsnasmdecdakcqtpqgainsslpfqnvhpvtigecpkyvrstklrmvtglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaingitnkvnsviekmntqftavgkefnklerrmenlnkkvddgfldiwtynaellvllenertldfhdsnvknlyekvksqlknnakeigngcfefyhkcnnecmesvkngtydypkyseesklnrekidgvklesmgvyqilaiystvasslvllvslgaisfwmcsngslqcrici

COBRA, Способ 2 (SEQ ID NO: 2)

mkakllvllcaltatdadticigyhannstdtvdtvleknvtvthsvnlledshngklcrlkgiaplqlgncsiagwilgnpeceslfskkswsyiaetpnsengtcypgyfadyeelreqlssvssferfeifpkesswpnhtvtkgvtaacshKgkssfyrnllwltekngsypnlsksyvnnkekevlvlwgvhhpsnigdqraiyhtenayvsvvsshynrrftpeiakrpkvrdqegrinyywtllepgdtiifeangnliapwyafalsrgfgsgiitsnasmdecdakcqtpqgainsslpfqnvhpvtigecpkyvrstklrmvtglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaingitnkvnsviekmntqftavgkefnklekrmenlnkkvddgfldiwtynaellvllenertldfhdsnvknlyekvksqlknnakeigngcfefyhkcnnecmesvkngtydypkyseesklnrekidgvklesmgvyqilaiystvasslvllvslgaisfwmcsngslqcrici

COBRA, Способ 3 (SEQ ID NO: 3)

mkakllvllcaftatyadticigyhannstdtvdtvleknvtvthsvnlledshngklcrlkgiaplqlgncsvagwilgnpecesliskeswsyivetpnpengtcypgyfadyeelreqlssvssferfeifpkesswpnhtvtkgvtascshngkssfyrnllwlteknglypnlsksyvnnkekevlvlwgvhhpsnigdqralyhtenayvsvvsshysrrftpeiakrpkvrdqegrinyywtllepgdtiifeangnliapwyafalsrgfgsgiitsnasmdecdakcqtpqgainsslpfqnvhpvtigecpkyvrstklrmvtglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaingitnkvnsviekmntqftavgkefnklerrmenlnkkvddgfldiwtynaellvllenertldfhdsnvknlyekvksqlknnakeigngcfefyhkcnnecmesvkngtydypkyseesklnrekidgvklesmgvyqilaiystvasslvllvslgaisfwmcsngslqcrici

COBRA, СПОСОБ 4 (SEQ ID NO: 4)

mkakllvllcaltatdadticigyhannstdtvdtvleknvtvthsvnlledshngklcrlkgiaplqlgkcsiagwilgnpecesllskkswsyiaetpnsengtcypgyfadyeelreqlssvssferfeifpkesswpnhnvtkgvtascshkgkssfyrnllwltekngsypnlsksyvnnkekevlvlwgvhhpsnigdqrtiyrtenayvsvvssnynrrftpeiakrpkvrdqegrinyywtllepgdtiifeangnliapwyafalsrgfgsgiitsnasmdecdtkcqtpqgainsslpfqnvhpvtigecpkyvrstklrmvtglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaingitnkvnsviekmntqftavgkefnklekrmenlnkkvddgfldiwtynaellvllenertldfhdsnvknlyekvksqlknnakeigngcfefyhkcnnecmesvkngtydypkyseesklnrekidgvklesmgvyqilaiystvasslvllvslgaisfwmcsngslqcrici

COBRA, СПОСОБ 5 (SEQ ID NO: 5)

mkakllvllctftatdadticigyhannstdtvdtvleknvtvthsvnlledshngklcrlkgiaplqlgncsiagwilgnpecesllskkswsyivetpnsengtcypgdfidyeelreqlssvssferfeifpkesswpnhtvtkgvtaacshagkssfyrnllwltekngsypnlsksyvnnkgkevlvlwgvhhpsnigdqqalyqtenayvsvvsshynrkftpeiakrpkvrdqegrinyywtllepgdtiifeangnliapwyafalsrgfgsgiitsnasmhecdtkcqtpqgainsslpfqnihpvtigecpkyvrstklrmvtglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaingitnkvnsviekmntqftavgkefnklekrmenlnkkvddgfldiwtynaellvllenertldfhdsnvknlyekvksqlknnakeigngcfefyhkcnnecmesvkngtydypkyseesklnrekidgvklesmgvyqilaiystvasslvllvslgaisfwmcsngslqcrici

COBRA, СПОСОБ 6 (SEQ ID NO: 6)

mkakllvllcaftatdadticigyhannstdtvdtvleknvtvthsvnlledshngklcklkgiaplqlgkcsiagwilgnpecesllskkswsyivetpnsengtcypgdfadyeelreqlssvssferfeifpkesswpnhtvtkgvtaacshagkssfyrnllwltekngsypnlsksyvnnkekevlvlwgvhhpsnigdqralyhtenayvsvvsshynrrftpeiakrpkvrdqegrinyywtllepgdtiifeangnliapwyafalsrgfgsgiitsnasmdecdakcqtpqgainsslpfqnvhpvtigecpkyvrstklrmvtglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaingitnkvnsviekmntqftavgkefnklerrmenlnkkvddgfldiwtynaellvllenertldfhdsnvknlyekvksqlknnakeigngcfefyhkcnnecmesvkngtydypkyseesklnrekidgvklesmgvyqilaiystvasslvllvslgaisfwmcsngslqcrici

COBRA, СПОСОБ 5 С ДЕГЛИКОЗИЛИРОВАНИЕМ (SEQ ID NO: 7)

mkakllvllctftatdadticigyhannstdtvdtvleknvtvthsvnlledshngklcrlkgiaplqlgncAiagwilgnpecesllskkswsyivetpnsengtcypgdfidyeelreqlssvssferfeifpkesswpnhAvtkgvtaacshagkssfyrnllwltekngsypnlAksyvnnkgkevlvlwgvhhpsnigdqqalyqtenayvsvvsshynrkftpeiakrpkvrdqegrinyywtllepgdtiifeangnliapwyafalsrgfgsgiitsnaAmhecdtkcqtpqgainsslpfqnihpvtigecpkyvrstklrmvtglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaingitnkvnsviekmntqftavgkefnklekrmenlnkkvddgfldiwtynaellvllenertldfhdsnvknlyekvksqlknnakeigngcfefyhkcnnecmesvkngtydypkyseesklnrekidgvklesmgvyqilaiystvasslvllvslgaisfwmcsngslqcrici

COBRA 1918-1957 (SEQ ID NO: 8)

mkarllvllcalaatdadticigyhannstdtvdtvleknvtvthsvnlledshngklcrlkgiaplqlgkcniagwilgnpecesllsnrswsyivetpnsengtcypgdfidyeelreqlssvssferfeifpkesswpkhnttkgvtaacshagkssfyrnllwltekngsypnlsnsyvnnkgkevlvlwgvhhpsniddqqtlyqkenayvsvvssnynrrftpeiaerpkvrgqagrmnyywtllepgdtiifeangnliapwyafalsrgfgsgiitsnasmhecdtkcqtpqgainsslpfqnihpvtigecpkyvrstklrmvtglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaingitnkvnsviekmntqftavgkefnnlekrmenlnkkvddgfldiwtynaellvllenertldfhdsnvknlyekvksqlrnnakeigngcfefyhkcdnecmesvkngtydypkyseesklnrekidgvklesmgvyqilaiystvasslvllvslgaisfwmcsngslqcrici

COBRA 1977-2005 (SEQ ID NO: 9)

mkakllvllcaftatdadticigyhannstdtvdtvleknvtvthsvnlledshngklcrlkgiaplqlgncsiagwilgnpeceslfskkswsyiaetpnsengtcypgyfadyeelreqlssvssferfeifpkesswpnhtvtkgvtascshkgkssfyrnllwltekngsypnlsksyvnnkekevlvlwgvhhpsnigdqraiyhtenayvsvvsshynrrftpeiakrpkvrdqegrinyywtllepgdtiifeangnliapwyafalsrgfgsgiitsnasmdecdakcqtpqgainsslpfqnvhpvtigecpkyvrstklrmvtglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaingitnkvnsviekmntqftavgkefnklerrmenlnkkvddgfldiwtynaellvllenertldfhdsnvknlyekvksqlknnakeigngcfefyhkcnnecmesvkngtydypkyseesklnrekidgvklesmgvyqilaiystvasslvllvslgaisfwmcsngslqcrici

COBRA ВИРУСА СВИНОГО ГРИППА ЧЕЛОВЕКА (SEQ ID NO: 10)

mkaillvllctfaatnadtlcigyhannstdtvdtvleknvtvthsvnlledkhngklcklkgiaplhlgkcniagwllgnpecellltasswsyivetsnsdngtcypgdfidyeelreqlssvssferfeifpktsswpnhetnkgvtaacpyagassfyrnliwlvkkgnsypklsksyvnnkgkevlvlwgihhpptstdqqslyqnadayvfvgsskynrkfkpeiaarpkvrdqagrmnyywtliepgdtitfeatgnlvvpryafamnrgsgsgiiisdapvhdcntkcqtpkgaintslpfqnihpvtigecpkyvkstklrmatglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaidgitnkvnsviekmntqftavgkefnhlekrienlnkkvddgfldiwtynaellvllenertldfhdsnvknlyekvrsqlknnakeigngcfefyhkcddtcmesvkngtydypkyseesklnreeidgvklestriyqilaiystvasslvllvslgaisfwmcsngslqcrici

COBRA ВИРУСА СВИНОГО ГРИППА (SEQ ID NO: 11)

mkaillvllctftaanadtlcigyhannstdtvdtvleknvtvthsvnlledrhngklcklggiaplhlgkcniagwllgnpecellltasswsyivetsnsdngtcypgdfinyeelreqlssvssferfeifpkasswpnhetnrgvtaacpyagansfyrnliwlvkkgnsypklsksyvnnkgkevlvlwgihhpptstdqqslyqnadayvfvgsskynrkfkpeiaarpkvrgqagrmnyywtllepgdtitfeatgnlvvpryafamnrgsgsgiiisdapvhdcntkcqtpkgaintslpfqnihpvtigecpkyvkstklrmatglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaidgitnkvnsviekmntqftavgkefnhlekrienlnkkvddgfldvwtynaellvllenertldfhdsnvknlyekvrsqlrnnakeigngcfefyhkcddtcmesvkngtydypkyseesklnreeidgvklestriyqilaiystvasslvllvslgaisfwmcsngslqcrici

Консенсусная последовательность, образованная на основании сравнения SEQ ID NO: 1-11 (SEQ ID NO: 12)

mkaXllvllcXXXaXXadtXcigyhannstdtvdtvleknvtvthsvnlledXhngklcXlXgiaplXlgXcXXagwXlgnpeceXlXXXXswsyiXetXnXXngtcypgXfXXyeelreqlssvssferfeifpkXsswpXhXXXXgvtaXcXXXgXXsfyrnlXwlXXkXXXypXlXXsyvnnkXkevlvlwgXhhpXXXXdqXXXYXXXXayvXvXssXyXrXfXpeiaXrpkvrXqXgrXnyywtlXepgdtiXfeaXgnlXXpXyafaXXrgXgsgiiXsXaXXXXcXXkcqtpXgainXslpfqnXhpvtigecpkyvXstklrmXtglrnipsiqsrglfgaiagfieggwtgmidgwygyhhqneqgsgyaadqkstqnaiXgitnkvnsviekmntqftavgkefnXleXrXenlnkkvddgfldXwtynaellvllenertldfhdsnvknlyekvXsqlXnnakeigngcfefyhkcXXXcmesvkngtydypkyseesklnreXidgvklesXXXyqilaiystvasslvllvslgaisfwmcsngslqcrici

В некоторых вариантах осуществления, раскрываемых в данном документе, у полипептидов HA отсутствует N-концевой метиониновый остаток. Таким образом, в некоторых примерах обеспечиваются полипептиды HA, которые содержат остатки 2-566 любой из SEQ ID NO: 1-12.
Аминокислотные последовательности COBRA могут подвергаться обратной трансляции и оптимизации для экспрессии в клетках млекопитающих, включая оптимизацию частоты использования кодонов и РНК (GeneArt; Регенсбург, Германия). Оптимизированные последовательности нуклеиновых кислот могут быть вставлены в соответствующий вектор экспрессии, такой как вектор экспрессии pTR600 (публикация заявки на патент США №2002/0106798; Ross et al., Nat Immunol. 1(2):102-103, 2000; Green et al., Vaccine 20:242-248, 2001).
Оптимизированная последовательность нуклеиновой кислоты, соответствующая последовательности COBRA HA согласно способу 1, представляет собой (SEQ ID NO: 13):

AAGCTTATGAAGGCCAAGCTGCTGGTGCTGCTGTGCGCCTTCACAGCCACCTACGCCGACACCATCTGCATCGGCTACCACGCCAACAACAGCACCGACACCGTGGATACCGTGCTGGAAAAGAACGTGACCGTGACCCACAGCGTGAACCTGCTGGAAGATAGCCACAACGGCAAGCTGTGCCGGCTGAAGGGAATCGCCCCTCTGCAGCTGGGCAACTGCTCTATCGCCGGCTGGATTCTGGGCAACCCCGAGTGCGAGAGCCTGTTCAGCAAAGAGTCCTGGTCCTACATCGTGGAAACCCCCAACAGCGAGAACGGCACCTGTTACCCCGGCTACTTCGCCGACTACGAGGAACTGCGGGAACAGCTGAGCAGCGTGTCCAGCTTCGAGAGATTCGAGATTTTCCCCAAAGAGAGCAGCTGGCCCAACCACACCGTGACCAAAGGCGTGACCGCCTCCTGCTCCCACAATGGCAAGAGCAGCTTCTACAGAAACCTGCTGTGGCTGACCGAGAAGAACGGCAGCTACCCCAACCTGAGCAAGAGCTACGTGAACAACAAAGAAAAAGAGGTGCTGGTGCTGTGGGGCGTGCACCACCCTAGCAACATCGGCGACCAGCGGGCCATCTACCACACCGAGAATGCCTACGTGTCCGTGGTGTCCAGCCACTACAGCAGACGGTTCACCCCCGAGATCGCCAAGAGGCCCAAAGTGCGGGACCAGGAAGGCCGGATCAACTACTACTGGACACTGCTGGAACCCGGCGATACCATCATCTTCGAGGCCAACGGCAACCTGATCGCCCCTTGGTACGCCTTCGCCCTGAGCAGAGGCTTTGGCAGCGGCATCATCACCAGCAACGCCAGCATGGACGAGTGCGACGCCAAGTGCCAGACACCTCAGGGCGCCATCAATAGCAGCCTGCCCTTCCAGAACGTGCACCCCGTGACCATCGGCGAGTGCCCCAAATACGTGCGGAGCACCAAGCTGCGGATGGTCACCGGCCTGAGAAACATCCCCAGCATCCAGAGCAGGGGCCTGTTCGGAGCCATTGCCGGCTTTATCGAGGGCGGCTGGACCGGCATGATCGACGGGTGGTACGGCTATCACCACCAGAACGAGCAGGGCAGCGGCTACGCCGCCGATCAGAAGTCTACCCAGAACGCCATCAACGGCATCACCAACAAAGTGAACAGCGTGATCGAGAAGATGAACACCCAGTTCACCGCCGTGGGCAAAGAGTTCAACAAGCTGGAACGGCGGATGGAAAACCTGAACAAGAAGGTGGACGACGGCTTCCTGGACATCTGGACCTACAACGCCGAACTGCTGGTGCTGCTGGAAAACGAGCGGACCCTGGACTTCCACGACAGCAACGTGAAGAACCTGTACGAGAAAGTGAAGTCCCAGCTGAAGAACAACGCCAAAGAGATCGGCAACGGCTGCTTCGAGTTCTACCACAAGTGCAACAACGAGTGCATGGAAAGCGTGAAGAATGGCACCTACGACTACCCCAAGTACAGCGAGGAAAGCAAGCTGAACCGCGAGAAGATCGACGGCGTGAAGCTGGAATCCATGGGCGTGTACCAGATCCTGGCCATCTATAGCACCGTGGCCAGCAGCCTGGTGCTGCTGGTGTCTCTGGGCGCCATCAGCTTTTGGATGTGCAGCAACGGCAGCCTGCAGTGCCGGATCTGTATCGGCAGCATCGGATCC.

V. Вирусы гриппа

Вирусы гриппа представляют собой вирусы с сегментированной отрицательно-полярной нитью РНК, которые принадлежат к семейству Orthomyxoviridae. Существует три типа вирусов гриппа: А, В и С. Вирусы гриппа А инфицируют большое число видов птиц и млекопитающих, в том числе людей, лошадей, морских млекопитающих, свиней, хорьков и кур. У животных большинство вирусов гриппа A вызывают локализованные инфекции дыхательных путей и кишечника в легкой форме. Тем не менее, высокопатогенные штаммы вируса гриппа A, такие как H5N1, вызывают системные инфекции домашней птицы, при которых смертность может достигать 100%. Животные, инфицированные вирусом гриппа А, часто выступают в роли резервуара вирусов гриппа, и было показано, что определенные подтипы могут преодолевать межвидовой барьер, инфицируя людей.

Вирусы гриппа A могут быть классифицированы на подтипы на основании аллельных вариаций антигенных областей двух генов, которые кодируют поверхностные гликопротеины, а именно, гемагглютинин (HA) и нейраминидазу (NA), которые необходимы для прикрепления вируса и высвобождения из клетки. В настоящее время известно шестнадцать подтипов HA (H1-H16) и девять антигенных вариантов NA (N1-N9) вируса гриппа A. Ранее были известны только три подтипа, циркулирующие в крови человека (H1N1, H1N2 и H3N2). Однако в последние годы сообщалось о том, что патогенный подтип H5N1 птичьего гриппа A преодолевает межвидовой барьер и инфицирует людей, что было документально зафиксировано в Гонконге в 1997 и 2003 гг. и привело к смерти нескольких пациентов.

У животных большинство вирусов гриппа A вызывают локализованные инфекции дыхательных путей и кишечника в легкой форме. Тем не менее, высокопатогенные штаммы вируса гриппа A, такие как H5N1, вызывают системные инфекции домашней птицы, при которых смертность может достигать 100%. В 2009 г. вирус гриппа H1N1 был наиболее частой причиной заболевания людей гриппом. Новый штамм H1N1, происходящего от свиней, появился в 2009 г. и был объявлен пандемическим Всемирной организацией здравоохранения. Этот штамм был назван “вирусом свиного гриппа”. Вирусы гриппа A H1N1 также были причиной пандемии испанского гриппа в 1918 г., вспышки заболевания в Форт-Дикс в 1976 г. и эпидемии гриппа в России в 1977-1978 гг.

Геном вируса гриппа A кодирует девять структурных белков и один неструктурный (NS1) белок с регуляторными функциями. Сегментированный геном вируса гриппа содержит восемь генных сегментов отрицательно-полярной нити РНК (nsRNA) (PB2, PB1, PA, NP, M, NS, HA и NA), которые кодируют по меньшей мере десять полипептидов, включая белки РНК-полимеразы, управляемые РНК (PB2, PB1 и PA), нуклеопротеин (NP), нейраминидазу (NA), гемагглютинин (субъединицы HA1 и HA2), матриксные белки (M1 и M2) и неструктурные белки (NS1 и NS2) (Krug et al., в “The Influenza Viruses”, R. M. Krug, ed., Plenum Press, N.Y., 1989, pp. 89-152).

Способность вируса гриппа вызывать широко распространенное заболевание связана с его способностью избегать действия иммунной системы благодаря подверганию антигенным изменениям, которые, как полагают, происходят в том случае, когда хозяин одновременно инфицирован как вирусом гриппа животных, так и вирусом гриппа человека. Во время мутации и реассортации, происходящих в организме хозяина, вирус может внедрять в свой геном ген поверхностного белка HA и/или NA из другого вируса, что, тем самым, приводит к образованию нового подтипа вируса гриппа и избеганию действия иммунной системы.

HA является поверхностным гликопротеином вируса, который обычно содержит приблизительно 560 аминокислот и представляет 25% от общего количества вирусного белка. Он отвечает за прикрепление вирусной частицы к клетке-хозяину и ее проникновение в таковую на ранних стадиях инфекции. Расщепление вирусного предшественника HA0 на субфрагменты HA1 и HA2 является необходимым этапом для того, чтобы вирус инфицировал клетку. Таким образом, расщепление требуется для того, чтобы превратить новые вирусные частицы в клетке-хозяине в вирионы, способные инфицировать новые клетки. Известно, что расщепление происходит во время транспортировки интегрального мембранного белка HA0 из эндоплазматического ретикулума инфицированной клетки к плазматической мембране. В ходе транспортировки гемагглютинин подвергается ряду ко- и посттрансляционных модификаций, включая протеолитическое расщепление предшественника HA на амино-концевой фрагмент HA1 и карбокси-концевой HA2. Одна из основных трудностей при выращивании штаммов гриппа в первичной культуре ткани или в устойчивых клеточных линиях проистекает из потребности в активации протеолитического расщепления гемагглютинина вируса гриппа в клетке-хозяине.

Хотя известно, что нерасщепленный HA может опосредовать прикрепление вируса к его рецепторам на поверхности клетки, содержащим нейраминовую кислоту, он не способен к участию в следующем этапе инфекционного цикла, которым является слияние. Сообщалось, что для гидрофобного амино-конца HA2, образуемого при расщеплении, необходимо, чтобы он был выставлен на поверхности, так чтобы он мог встраиваться в целевые клетки, тем самым образуя мостик между мембранами вируса и целевой клетки. Следом за этим процессом происходит слияние двух мембран и проникновение вируса в целевую клетку.

Протеолитическая активация HA включает расщепление по аргининовому остатку с помощью трипсиноподобной эндопротеазы, которая часто является внутриклеточным кальций-зависимым ферментом, оптимальное значение рН для которого является нейтральным. Так как активирующие протеазы являются клеточными ферментами, то, будет ли расщепляться HA, определяется типом инфицированных клеток. HA вирусов гриппа млекопитающих и непатогенных вирусов птичьего гриппа являются восприимчивыми к протеолитическому расщеплению только в ограниченном количестве типов клеток. С другой стороны, HA патогенных вирусов птиц подтипов Н5 и Н7 расщепляются протеазами, присутствующими в широком круге различных клеток-хозяев. Таким образом, существуют различия в круге хозяев, происходящие из различий в способности гемагглютинина к расщеплению, которые коррелируют с патогенными свойствами вируса.

Нейраминидаза (NA) является вторым мембранным гликопротеином вирусов гриппа. Было показано, что присутствие NA вируса является важным для формирования многостороннего защитного иммунного ответа в отношении инфицирующего вируса. У большинства вирусов гриппа A NA имеет длину 413 аминокислот и кодируется геном, содержащим 1413 нуклеотидов. Девять различных подтипов NA были идентифицированы в вирусах гриппа (N1, N2, N3, N4, N5, N6, N7, N8 и N9), все из которых были обнаружены у диких птиц. NA участвует в разрушении клеточного рецептора к HA вируса за счет отщепления концевых остатков нейраминовой кислоты (также называемой сиаловой кислотой) от углеводных фрагментов, расположенных на поверхности инфицированных клеток. NA также отщепляет остатки сиаловой кислоты от вирусных белков, предупреждая агрегацию вирусов. Гипотетически предполагается, что при помощи этого механизма NA облегчает высвобождение вирусного потомства, предупреждая накопление вновь образованных вирусных частиц вдоль клеточной мембраны, а также содействуя транспортировке вируса через слизь, присутствующую на поверхности слизистой оболочки. NA является важной антигенной детерминантой, которая подвергается антигенной вариации.

Вирус гриппа, в дополнение к поверхностным белкам HA и NA, содержит шесть дополнительных внутренних генов, которые отвечают за синтез восьми различных белков, в том числе гены белков полимеразного комплекса PB1, PB2 и PA, матриксных белков M1 и M2, нуклеопротеина (NP) и неструктурных белков NS1 и NS2 (Horimoto et al., Clin Microbiol Rev. 14(1):129-149, 2001).

Для упаковки в вирионы потомства вирусная РНК транспортируется из ядра в виде рибонуклеопротеинового (RNP) комплекса, образованного тремя белками, представляющими собой полимеразы вируса гриппа, нуклеопротеином (NP) и вирусной РНК, в ассоциации с матриксным белком 1 (M1) вируса гриппа и белком ядерного экспорта (Marsh et al., J Virol, 82:2295-2304, 2008). Считается, что белок М1, который располагается в оболочке, задействован в сборке и отпочковании. Ограниченное число белков M2 интегрировано в вирионы (Zebedee, J. Virol. 62:2762-2772, 1988). Они образуют тетрамеры, обладающие активностью ионных каналов для H+, и при активации под действием низкого pH в эндосомах подкисляют внутреннее пространство вириона, облегчая сбрасывание его оболочки (Pinto et al., Cell 69:517-528, 1992). Амантадин является противогриппозным лекарственным средством, которое предупреждает вирусную инфекцию путем нарушения активность ионных каналов, образуемых белками М2, тем самым ингибируя сбрасывание оболочки вируса.

NS1, неструктурный белок, имеет несколько функций, включая регуляцию сплайсинга и ядерного экспорта клеточных мРНК, а также стимуляцию трансляции. По-видимому, основной функцией NS1 является противодействие активности интерферона хозяина, поскольку вирус с нокаутом гена NS1 был жизнеспособным, хотя характеризовался менее эффективным ростом, чем родительский вирус, в клетках без недостаточности интерферона (Garcia-Sastre, Virology 252:324-330, 1998).

NS2 выявляли в вирусных частицах (Richardson et al., Arch. Virol. 116:69-80, 1991; Yasuda et al., Virology 196:249-255, 1993). По оценкам, среднее количество белков NS2 в вирусной частице составляет 130-200 молекул. Анализ связывания in vitro показывает наличие прямого белок-белкового контакта между M1 и NS2. Комплексы NS2-M1 также выявляли с помощью иммунопреципитации в лизатах клеток, инфицированных вирусом. Считается, что белок NS2 играет роль в экспорте RNP из ядра посредством взаимодействия с белком М1 (Ward et al., Arch. Virol. 140:2067-2073, 1995).

VI. VLP, сходные с частицами вируса гриппа, и их введение

В данном документе обеспечиваются VLP, сходные с частицами вируса гриппа, содержащие оптимизированный HA (такой как HA, имеющий аминокислотную последовательность, приведенную как любая из SEQ ID NO: 1-11). VLP, сходные с частицами вируса гриппа, как правило, образованы белками HA, NA и М1. Получение VLP, сходных с частицами вируса гриппа, описано в данной области техники и находится в пределах квалификации среднего специалиста в данной области. Например, VLP, сходные с частицами вируса гриппа, можно получить путем трансфекции клеток-хозяев с помощью плазмид, которые кодируют белки HA, NA и М1. После инкубирования трансфицированных клеток в течение соответствующего периода времени, необходимого для обеспечения экспрессии белка (как, например, в течение приблизительно 72 часов), VLP можно выделять из надосадочной жидкости культуры клеток. В примере 2 ниже приводится иллюстративный протокол очистки VLP, сходных с частицами вируса гриппа, от надосадочной жидкости культуры клеток. В этом примере VLP выделяют путем низкоскоростного центрифугирования (для удаления клеточного дебриса), вакуум-фильтрации и ультрацентрифугирования в 20% глицерине.

VLP, сходные с частицами вируса гриппа, раскрываемые в данном документе, можно применять в качестве вакцин против гриппа для вызова защитного иммунного ответа в отношении вирусов гриппа H1N1.

VLP, сходные с частицами вируса гриппа, или их композиции можно вводить субъекту любым из путей, обычно применяемых для введения рекомбинантных вирусов субъекту. Способы введения включают, но без ограничений, внутрикожный, внутримышечный, внутрибрюшинный, парентеральный, внутривенный, подкожный, вагинальный, ректальный, интраназальный, ингаляционный или пероральный. Парентеральное введение, такое как, подкожное, внутривенное или внутримышечное введение, как правило, производится путем инъекции. Инъекционные лекарственные средства можно получить в традиционных формах, в виде жидких растворов либо суспензий, в твердых формах, пригодных для получения раствора или суспензии в жидкости перед инъекцией, или в виде эмульсий. Инъекционные растворы и суспензии можно получить из стерильных порошков, гранул и таблеток ранее описанного типа. Введение может быть системным или локальным.
VLP, сходные с частицами вируса гриппа, или их композиции вводят любым подходящим способом, как, например, с фармацевтически приемлемыми носителями. Фармацевтически приемлемые носители частично определяются конкретной вводимой композицией, а также конкретным способом, применяемым для введения композиции. Соответственно, в настоящем раскрытии представлено большое разнообразие подходящих составов на основе фармацевтических композиций.
Препараты для парентерального введения включают стерильные водные или неводные растворы, суспензии и эмульсии. Примерами неводных растворителей являются пропиленгликоль, полиэтиленгликоль, растительные масла, такие как оливковое масло, и инъецируемые органические сложные эфиры, такие как этилолеат. Водные носители включают воду, спиртовые/водные растворы, эмульсии или суспензии, в том числе солевые и буферные среды. Среды для парентерального применения включают раствор хлорида натрия, декстрозу в растворе Рингера, декстрозу и хлорид натрия, лактатный раствор Рингера или нелетучие масла. Среды для внутривенного применения включают жидкие и питательные наполнители, электролитные наполнители (как, например, на основе декстрозы в растворе Рингера) и т.п. Также могут присутствовать консерванты и другие добавки, такие как, например, противомикробные средства, антиоксиданты, хелатообразователи и инертные газы и т.п.
Некоторые из композиций, вероятно, можно вводить в виде фармацевтически приемлемой соли присоединения кислоты или основания, образованной в результате реакции с неорганическими кислотами, такими как соляная кислота, бромистоводородная кислота, перхлорная кислота, азотная кислота, тиоциановая кислота, серная кислота и фосфорная кислота, и органическими кислотами, такими как муравьиная кислота, уксусная кислота, пропионовая кислота, гликолевая кислота, молочная кислота, пировиноградная кислота, щавелевая кислота, малоновая кислота, янтарная кислота, малеиновая кислота и фумаровая кислота, или в результате реакции с неорганическим основанием, таким как гидроксид натрия, гидроксид аммония, гидроксид калия, и органическими основаниями, такими как моно-, ди-, триалкиламины, и ариламины, и замещенные этаноламины.
Введение может осуществляться с применением однократных или многократных доз. Доза, вводимая субъекту применительно к настоящему раскрытию, должна быть достаточной для индуцирования благоприятного терапевтического эффекта у субъекта, продолжающегося в течение длительного времени, или для подавления или предупреждения инфекции, вызываемой вирусом гриппа H1N1. Требуемая доза будет варьировать для различных субъектов в зависимости от вида, возраста, веса и общего состояния субъекта, тяжести инфекции, лечение которой осуществляется, конкретной применяемой композиции и способа ее введения. Соответствующая доза может быть определена средним специалистом в данной области при помощи только стандартных экспериментов.
В данном документе обеспечиваются фармацевтические композиции, содержащие терапевтически эффективное количество VLP, сходных с частицами вируса гриппа, в отдельности или в комбинации с фармацевтически приемлемым носителем. Фармацевтически приемлемые носители включают, но без ограничений, солевой раствор, забуференный солевой раствор, декстрозу, воду, глицерин, этанол и их комбинации. Носитель и композиция могут быть стерильными, а состав соответствует режиму введения. Композиция может также содержать небольшие количества смачивающих или эмульгирующих средств или буферных средств, поддерживающих pH. Композиция может представлять собой жидкий раствор, суспензию, эмульсию, таблетку, гранулу, капсулу, состав с замедленным высвобождением или порошок. Композицию можно составить в виде суппозитория с традиционными связующими и носителями, такими как триглицериды. Составы для перорального применения могут включать стандартные носители, такие как маннит, лактоза, крахмал, стеарат магния, сахарин натрия, целлюлоза и карбонат магния фармацевтической степени чистоты. Можно применять любые обычные фармацевтические носители, такие как стерильный солевой раствор или кунжутное масло. Среда может также содержать традиционные фармацевтические вспомогательные средства, такие как, например, фармацевтически приемлемые соли для корректировки осмотического давления, буферы, консерванты и т.п. Другие среды, которые можно применять с композициями и способами, обеспечиваемыми в данном документе, представляют собой физиологический раствор и кунжутное масло.

VLP, сходные с частицами вируса гриппа, описываемые в данном документе, можно вводить в отдельности или в комбинации с другими терапевтическими средствами для усиления антигенных свойств. Например, VLP, сходные с частицами вируса гриппа, можно вводить с адъювантом, таким как неполный адъювант Фрейнда или полный адъювант Фрейнда.

Необязательно, один или несколько цитокинов, таких как IL-2, IL-6, IL-12, RANTES, GM-CSF, TNF-α или IFN-γ, один или несколько факторов роста, таких как GM-CSF или G-CSF; одну или несколько молекул, таких как OX-40L или 41 BBL, или комбинации этих молекул можно применять в качестве биологических адъювантов (см., например, Salgaller et al., 1998, J. Surg. Oncol. 68(2):122-38; Lotze et al., 2000, Cancer J. Sci. Am. 6(Suppl 1):S61-6; Cao et al., 1998, Stem Cells 16(Suppl 1):251-60; Kuiper et al., 2000, Adv. Exp. Med. Biol. 465:381-90). Эти молекулы можно вводить системно (или локально) хозяину.

Известен ряд средств, индуцирующих клеточный ответ как in vitro, так и in vivo. Липиды были идентифицированы в качестве средств, способных содействовать in vivo праймированию CTL против различных антигенов. Например, как описано в патенте США №5662907, остатки пальмитиновой кислоты могут прикрепляться к альфа- и эпсилон-аминогруппам лизинового остатка, а затем связываться (например, посредством одного или нескольких связывающих остатков, таких как глицин, глицин-глицин, серин, серин-серин или т.п.) с иммуногенным пептидом. Липидизированный пептид можно затем инъецировать напрямую в мицеллярной форме, включенным в липосому или эмульгированным в адъюванте. В качестве другого примера, для праймирования опухолеспецифического CTL можно применять липопротеины E.coli, такие как трипальмитоил-S-глицерилцистеинилсерилсерин, в случаях, когда они ковалентно присоединены к соответствующему пептиду (см. Deres et al., Nature 342:561, 1989). Дополнительно, поскольку индуцирование выработки нейтрализующих антител также может быть достигнуто с помощью праймирования той же молекулой, конъюгированной с пептидом, у которого обнаруживается соответствующий эпитоп, две композиции можно объединить, чтобы вызвать как гуморальный, так и клеточный ответы в тех случаях, когда это считается желательным.

Хотя в данном документе в качестве примера приводится введение VLP, содержащих оптимизированный белок HA, специалист в данной области поймет, что для того, чтобы вызвать иммунный ответ у субъекта, также можно вводить оптимизированный белок HA вируса гриппа сам по себе (в отсутствие вирусной частицы) или в форме белка слияния.

Следующие примеры приведены для иллюстрации конкретных отдельных признаков и/или вариантов осуществления. Эти примеры не должны рассматриваться как ограничивающие раскрытие конкретными описываемыми признаками или вариантами осуществления.

ПРИМЕРЫ

Пример 1. Образование последовательностей COBRA вируса гриппа H1N1

Аминокислотные последовательности HA вируса гриппа A H1N1 загружали из базы данных ресурсов по вирусу гриппа NCBI. Белки HA H1N1 из 1134 изолятов, выделенных с 1918 по 2011 гг., применяли для образования консенсусных последовательностей. Одиннадцать различных консенсусных последовательностей (SEQ ID NO: 1-11) были образованы с применением следующих способов.

1. COBRA, способ 1 (1918-2005)

Последовательности (456) упорядочивали по дате выделения, и образовывали восемь первичных консенсусных последовательностей с применением изолятов, выделенных с 1918 по 1934 гг. (8), с 1935 по 1947 гг. (13), с 1948 по 1957 гг. (12), с 1977 по 1983 гг. (68), с 1984 по 1986 гг. (9), с 1987 по 1991 гг. (12), с 1992 по 1999 гг. (59) и с 2000 по 2005 гг. (263). Четыре вторичные консенсусные последовательности образовывали с помощью группировки первичных консенсусных последовательностей по дате, как показано на фигуре 1. Конечную консенсусную последовательность (консенсусную последовательность третьего уровня; SEQ ID NO: 1) образовывали с помощью выравнивания четырех вторичных консенсусных последовательностей.

2. COBRA, способ 2 (1918-2005)

Как и в способе 1, последовательности (456) упорядочивали по дате выделения с образованием восьми первичных консенсусных последовательностей. Конечную консенсусную последовательность (SEQ ID NO: 2) образовывали с помощью выравнивания восьми первичных консенсусных последовательностей, как изображено на фигуре 2.

3. COBRA, способ 3 (1918-2005)

Консенсусную последовательность (SEQ ID NO: 3) образовывали с помощью выравнивания 456 изолятов вируса H1N1, выделенных с 1918 по 2005 гг.

4. COBRA, способ 4 (1918-2005)

Последовательности (456) упорядочивали по дате выделения, и образовывали десять первичных консенсусных последовательностей с применением изолятов, выделенных с 1918 по 1933 гг. (6), с 1934 по 1946 гг. (15), с 1947 по 1956 гг. (12), с 1957 по 1977 гг. (8), с 1978 по 1980 гг. (17), с 1981 по 1985 гг. (49), с 1986 по 1990 гг. (14), с 1991 по 1995 гг. (27), с 1996 по 1998 гг. (27) и с 1999 по 2005 гг. (281), как показано на фигуре 3. Конечную консенсусную последовательность (SEQ ID NO: 4) образовывали с помощью выравнивания десяти первичных консенсусных последовательностей.

5. COBRA, способ 5 (1918-2011)

Последовательности (1134) упорядочивали по дате выделения, и образовывали 12 первичных консенсусных последовательностей с применением изолятов, выделенных в 1918 г. (1), 1976 г. (4), с 2009 по 2011 гг. (123), с 1933 по 1934 гг. (8), с 1935 по 1947 гг. (13), с 1948 по 1957 гг. (12), с 1977 по 1983 гг. (68), с 1984 по 1986 гг. (9), с 1987 по 1991 гг. (12), с 1992 по 1999 гг. (27), с 2000 по 2005 гг. (59) и с 2006 по 2008 гг. (798). Четыре вторичные консенсусные последовательности образовывали с помощью группировки первичных консенсусных последовательностей в соответствии с последовательностями вируса свиного гриппа или по дате, как показано на фигуре 4. Конечную консенсусную последовательность (консенсусную последовательность третьего уровня; SEQ ID NO: 5) образовывали с помощью выравнивания четырех вторичных консенсусных последовательностей.

6. COBRA, способ 6

Последовательности (1134) упорядочивали по дате выделения, и образовывали 13 первичных консенсусных последовательностей с применением изолятов, выделенных в 1918 г. (1), с 1933 по 1934 гг. (8), с 1935 по 1947 гг. (13), с 1948 по 1957 гг. (12), в 1976 г. (4), с 1977 по 1983 гг. (68), с 1984 по 1986 гг. (9), с 1987 по 1991 гг. (12), с 1992 по 1999 гг. (27), с 2000 по 2005 гг. (59), в 2006 г. (76), с 2007 по 2008 гг. (722) и с 2009 по 2011 гг. (123), как показано на фигуре 5. Конечную консенсусную последовательность (SEQ ID NO: 6) образовывали с помощью выравнивания 13 первичных консенсусных последовательностей.

7. COBRA, способ 5 с дегликозилированием

Данную последовательность (SEQ ID NO: 7) образовывали с помощью изменения консенсусной последовательности согласно способу 5 (SEQ ID NO: 5) с удалением предсказанных сайтов гликозилирования.

8. COBRA 1918-1957

Данную последовательность (SEQ ID NO: 8) образовывали с помощью выравнивания последовательностей изолятов H1N1, выделенных с 1918 по 1957 гг.

9. COBRA 1977-2005

Данную последовательность (SEQ ID NO: 9) образовывали с помощью выравнивания последовательностей изолятов H1N1, выделенных с 1977 по 2005 гг.

10. COBRA вируса свиного гриппа человека

Данную последовательность (SEQ ID NO: 10) образовывали с помощью выравнивания изолятов вируса свиного гриппа человека H1N1. Данную последовательность выравнивали с применением консенсусных последовательностей, образованных на основании строения изолятов, выделенных в 1918 г., 1976 г. и с 2009 по 2011 гг.

11. COBRA вируса свиного гриппа

Данную последовательность (SEQ ID NO: 11) образовывали с помощью выравнивания изолятов вируса свиного гриппа H1N1. Данную последовательность выравнивали с применением последовательностей изолятов вируса свиного гриппа, выделенных с 1930 по 2010 гг.

Аминокислотную последовательность COBRA, образованную в соответствии со способом 1, подвергали обратной трансляции и оптимизации для экспрессии в клетках млекопитающих, включая оптимизацию частоты использования кодонов и РНК (GeneArt; Регенсбург, Германия). Оптимизированная последовательность нуклеиновой кислоты приведена в данном документе как SEQ ID NO: 13. Остальные последовательности COBRA также будут подвергнуты обратной трансляции и оптимизации для экспрессии в клетках млекопитающих. Оптимизированные последовательности нуклеиновых кислот будут вставлять в вектор экспрессии pTR600 (публикация заявки на патент США №2002/0106798; Ross et al., Nat Immunol. 1(2):102-103, 2000; Green et al., Vaccine 20:242-248, 2001).

Пример 2. Получение VLP, сходных с частицами вируса гриппа, и иммунизация с их помощью

Следующие способы можно применять для получения и определения характеристик VLP, сходных с частицами вируса гриппа, содержащих оптимизированный HA. Иллюстративные способы иммунизации мышей, хорьков и макаков также описаны ниже (см. также Giles and Ross, Vaccine 29(16):3043-3054, 2011).

Получение вакцины

Клетки 293T подвергают транзиентной трансфекции с помощью плазмид, экспрессирующих M1, NA и оптимизированный HA, и инкубируют в течение 72 часов при 37°C. Последовательности, кодирующие M1, NA и HA, могут быть подвергнуты оптимизации кодонов для экспрессии в клетках млекопитающих. Надосадочную жидкость собирают, а клеточный дебрис удаляют путем низкоскоростного центрифугирования с последующей вакуум-фильтрацией через стерильный фильтр на 0,22 мкм. VLP очищают при помощи ультрацентрифугирования (100000 x g в 20% глицерине, вес/объем) в течение 4 часов при 4°C. Сгусток затем ресуспендируют в PBS, pH 7,2, и хранят в виде аликвот для однократного применения при -80°C до применения. Общую концентрацию белка определяют с помощью набора реагентов для анализа белков Micro BCATM (Pierce Biotechnology, Рокфорд, Иллинойс, США).

Определение дозы

Удельное содержание HA можно определить при помощи вестерн-блоттинга и денситометрического анализа. Очищенный рекомбинантный COBRA HA и очищенные VLP получают при стандартном общем количестве белка, и подвергают электрофорезу в 10% геле для SDS-PAGE, и переносят на PVDF-мембрану. Блот зондируют при помощи мышиной поликлональной антисыворотки, полученной от мышей, инфицированных вирусом гриппа, и комплексы HA-антитело выявляют при помощи антител козы к IgG мыши, конъюгированных с пероксидазой хрена (HRP) (Southern Biotech; Бирмингем, Алабама, США). HRP выявляют с помощью хемилюминесцентного субстрата (Pierce Biotechnology; Рокфорд, Иллинойс, США), и проводят экспозицию на рентгеновскую пленку (ThermoFisher; Питтсбург, Пенсильвания, США). Оптическую плотность полос определяют при помощи программного обеспечения ImageJ (NIH). Значения оптической плотности полос рекомбинантного HA применяют для расчета стандартной кривой, а значения оптической плотности очищенных VLP интерполируют с применением результатов, полученных для рекомбинантного HA.

Исследования на мышах

Мышей BALB/c (Mus musculus, самки, возраст 6-8 недель) можно приобрести у Harlan Sprague Dawley (Индианаполис, Индиана, США). Мышей содержат в микроизоляторных блоках, им обеспечивается свободный доступ к пище и воде, и уход за ними осуществляется в соответствии с директивами USDA в отношении лабораторных животных. Мышей вакцинируют с помощью одной из трех доз очищенных VLP с COBRA HA (1,5 мкг, 0,3 мкг или 0,06 мкг), исходя из содержания HA, определенного в денситометрическом анализе, посредством внутримышечной инъекции на неделе 0, а затем им вводят такую же дозу посредством бустер-инъекции на неделе 3. Вакцины в каждой дозе составляют с адъювантом квасцами (Imject Alum, Pierce Biotechnology; Рокфорд, Иллинойс, США), CpG-олигонуклеотидами или только со средой. Через 14-21 день после каждой вакцинации у мышей под анестезией из ретроорбитального сплетения забирают кровь и переносят ее в микроцентрифужную пробирку. Пробирки центрифугируют, и сыворотку отбирают и замораживают при -80±5°C. Сывороточный титр антител, ингибирующих гемагглютинацию (HAI), для каждой группы вакцинации определяют на неделе 5 при помощи типичных реассортантных вирусов или VLP с COBRA HA.
Через три недели после заключительной вакцинации производят интраназальное контрольное заражение мышей высокопатогенным вирусом H1N1 в объеме 50 мкл. После инфицирования проводят ежедневное отслеживание мышей в отношении снижения массы тела, наличия признаков заболевания и наступления смерти в течение 14 дней после инфицирования. Индивидуальные значения массы тела, баллы по шкале оценки заболевания (Toapanta and Ross, Respiratory Research 10(1):112, 2009) и случаи смерти регистрируют для каждой группы ежедневно после прививки.

Исследования на хорьках

Домашних хорьков (Mustela putorius furo, самки, возраст 6-12 месяцев), не подвергавшихся ранее заражению вирусом гриппа и с удаленными пахучими железами, можно приобрести у Marshall Farms (Сейр, Пенсильвания, США). Хорьков содержат парами в клетках из нержавеющей стали (Shor-line, Канзас-Сити, Канзас, США), в которых имеется подстилка для лабораторных животных Sani-chips (P.J. Murphy Forest Products, Монтвилл, Нью-Джерси, США). Хорьки получают корм для хорьков Teklad Global (Harlan Teklad, Мэдисон, Висконсин, США) и свежую воду ad libitum. VLP с COBRA HA разводят в PBS, pH 7,2, до достижения конечной концентрации. Хорьков вакцинируют с помощью одной из двух доз очищенных VLP с COBRA (15 мкг, 3 мкг), исходя из содержания HA, определенного в денситометрическом анализе, посредством внутримышечной инъекции в четырехглавую мышцу в объеме 0,25 мл на неделе 0, а затем им вводят такую же дозу посредством бустер-инъекции на неделе 3. Вакцины хранят при -80°С до применения и составляют с адъювантом квасцами (Imject Alum; Pierce Biotechnology, Рокфорд, Иллинойс, США) непосредственно перед применением. Проводят еженедельное отслеживание животных в отношении нежелательных явлений, включая снижение массы тела, повышение температуры, снижение активности, выделения из носа, чихание и диарея, во время действия режима вакцинации. До вакцинации животные подвергаются анализу на HAI для подтверждения того, что они являются серонегативными в отношении циркулирующих в крови вирусов гриппа A и гриппа B. Через 14-21 день после каждой вакцинации у хорьков под анестезией из передней полой вены забирают кровь и переносят ее в микроцентрифужную пробирку. Пробирки центрифугируют, и сыворотку отбирают и замораживают при -80±5°С. Сывороточный титр HAI-антител для каждой группы вакцинации определяют на неделе 5 при помощи типичных реассортантных вирусов или VLP с COBRA HA.

Через три недели после заключительной вакцинации производят интраназальное контрольное заражение хорьков высокопатогенным вирусом H1N1 в объеме 1 мл. После инфицирования проводят ежедневное отслеживание хорьков в отношении снижения массы тела, наличия признаков заболевания и наступления смерти в течение 14 дней после инфицирования. Индивидуальные значения массы тела, баллы по шкале оценки заболевания и случаи смерти регистрируют для каждой группы ежедневно после прививки. Промывания полости носа выполняют путем закапывания 3 мл PBS в ноздри хорьков под анестезией ежедневно в течение 7 дней после прививки. Смывы собирают и хранят при -80ºС до применения.

Иммунизации приматов

Макаков-крабоедов (Macaca fascicularis, самцы, возраст 3-5 лет) можно приобрести у Harlan Sprague Dawley (Индианаполис, Индиана, США). Макаков вакцинируют с помощью очищенных VLP с COBRA HA (15 мкг), исходя из содержания HA, определенного в денситометрическом анализе, посредством внутримышечной инъекции на неделе 0, а затем им вводят такую же дозу посредством бустер-инъекции на неделях 3 и 6. Вакцины составляют с адъювантом квасцами (Imject Alum; Pierce Biotechnology, Рокфорд, Иллинойс, США) непосредственно перед применением. Через двадцать один день после каждой вакцинации у макаков под анестезией из бедренной вены забирают кровь и переносят в пробирку для отделения сыворотки. В пробирках обеспечивают возможность активации свертывания, после чего проводят центрифугирование, а сыворотку отбирают и замораживают при -80±5°С. Конечную точку титрования IgG и сывороточный титр HAI-антител для каждой группы вакцинации определяют на неделе 5 при помощи типичных реассортантных вирусов или VLP с COBRA HA.

Через три недели после заключительной вакцинации производят контрольное заражение макаков посредством интраназальной, интратрахеальной или глазничной прививки с помощью высокопатогенного вируса H1N1 в объеме 1 мл. После инфицирования проводят ежедневное отслеживание макаков в отношении снижения массы тела, наличия признаков заболевания и наступления смерти в течение 5 дней после инфицирования. Индивидуальные значения массы тела, баллы по шкале оценки заболевания и случаи смерти регистрируют для каждой группы ежедневно после прививки.

Пример 3. Анализ COBRA HA H1N1 согласно способу 1

В данном примере описывается обнаруженный факт, заключающийся в том, что прививка мышей с помощью VLP, сходных с частицами вируса гриппа H1N1, с COBRA индуцирует значительное повышение сывороточных титров HAI-антител и дополнительно демонстрирует, что трансляция COBRA HA H1N1 in vitro приводит к экспрессии белка, имеющего ожидаемый молекулярный вес.

Сывороточные титры HAI-антител

Чтобы оценить, может ли вирус гриппа, содержащий COBRA HA H1N1 согласно способу 1, вызывать ответ с формированием антител у инфицированных животных, VLP, содержащие COBRA HA H1N1 согласно способу 1 (SEQ ID NO: 1), образовывали, как описано в примере 2. Мышам инокулировали VLP, и сыворотку собирали на неделях 3, 5, 8 и 12 после инфицирования для определения сывороточных титров HAI-антител. Антисыворотку тестировали в отношении сезонного вируса гриппа H1N1 A/Новая Каледония/20/1999. Как показано на фигуре 6, титры HAI выявляли, начиная с 5 недель после инфицирования, и они повышались на неделях 8 и 12.

Экспрессия COBRA HA in vitro

Как описано в примере 2, аминокислотную последовательность COBRA HA согласно способу 1 подвергали обратной трансляции и оптимизации для экспрессии в клетках млекопитающих. Оптимизированную последовательность нуклеиновой кислоты (SEQ ID NO: 13), кодирующую COBRA HA, вставляли в вектор экспрессии pTR600. Для того чтобы оценить, экспрессируется ли COBRA HA H1N1 должным образом in vitro, клетки трансфицировали с помощью вектора экспрессии pTR600, кодирующего COBRA HA H1N1. Лизаты культур клеток анализировали с помощью SDS-PAGE с последующим вестерн-блоттингом для выявления HA вируса гриппа. Как показано на фигуре 7, COBRA HA мигрирует соответственно его ожидаемому молекулярному весу, что подтверждает экспрессию синтетического белка in vitro.
Ввиду многих возможных вариантов осуществления, к которым могут быть применены принципы раскрытого изобретения, следует признать, что проиллюстрированные варианты осуществления являются только предпочтительными примерами настоящего изобретения и не должны рассматриваться как ограничивающие объем настоящего изобретения. Напротив, объем настоящего изобретения определяется следующей формулой изобретения. Поэтому в качестве настоящего изобретения заявляется все, что находится в пределах объема и сущности данной формулы изобретения.

1. Рекомбинантный полипептид гемагглютинин (НА) вируса гриппа для вызова иммунного ответа в отношении вируса гриппа, содержащий аминокислотную последовательность, по меньшей мере на 99% идентичную остаткам 2-566 SEQ ID NO: 1, содержащую остатки 2-566 SEQ ID NO: 2, по меньшей мере на 99% идентичную остаткам 2-566 SEQ ID NO: 3, по меньшей мере на 99% идентичную остаткам 2-566 SEQ ID NO: 4, по меньшей мере на 98% идентичную остаткам 2-566 SEQ ID NO: 5, по меньшей мере на 99% идентичную остаткам 2-566 SEQ ID NO: 6, по меньшей мере на 97% идентичную остаткам 2-566 SEQ ID NO: 7, по меньшей мере на 99% идентичную остаткам 2-566 SEQ ID NO: 8, содержащую остатки 2-566 SEQ ID NO: 9, по меньшей мере на 99% идентичную остаткам 2-566 SEQ ID NO: 10 или по меньшей мере на 99% идентичную остаткам 2-566 SEQ ID NO: 11.

2. Полипептид НА вируса гриппа по п. 1, содержащий аминокислотную последовательность, по меньшей мере на 99% идентичную SEQ ID NO: 1, содержащую остатки 2-566 SEQ ID NO: 2, по меньшей мере на 99% идентичную SEQ ID NO: 3, по меньшей мере на 99% идентичную SEQ ID NO: 4, по меньшей мере на 98% идентичную SEQ ID NO: 5, по меньшей мере на 99% идентичную SEQ ID NO: 6, по меньшей мере на 97% идентичную SEQ ID NO: 7, по меньшей мере на 99% идентичную SEQ ID NO: 8, содержащую SEQ ID NO: 9, по меньшей мере на 99% идентичную SEQ ID NO: 10 или по меньшей мере на 99% идентичную SEQ ID NO: 11.

3. Полипептид НА вируса гриппа по п. 1 или 2, где аминокислотная последовательность полипептида содержит:

(i) не более 5 аминокислотных замен по сравнению с SEQ ID NO: 1;

(ii) не более 3 аминокислотных замен по сравнению с SEQ ID NO: 2;

(iii) не более 6 аминокислотных замен по сравнению с SEQ ID NO: 3;

(iv) не более 8 аминокислотных замен по сравнению с SEQ ID NO: 4;

(v) не более 10 аминокислотных замен по сравнению с SEQ ID NO: 5;

(vi) не более 8 аминокислотных замен по сравнению с SEQ ID NO: 6;

(vii) не более 10 аминокислотных замен по сравнению с SEQ ID NO: 7;

(viii) не более 10 аминокислотных замен по сравнению с SEQ ID NO: 8;

(ix) не более 8 аминокислотных замен по сравнению с SEQ ID NO: 10 или

(x) не более 5 аминокислотных замен по сравнению с SEQ ID NO: 11.

4. Полипептид НА вируса гриппа по п. 1, содержащий аминокислотную последовательность из остатков 2-566 SEQ ID NO: 1, остатков 2-566 SEQ ID NO: 2, остатков 2-566 SEQ ID NO: 3, остатков 2-566 SEQ ID NO: 4, остатков 2-566 SEQ ID NO: 5, остатков 2-566 SEQ ID NO: 6, остатков 2-566 SEQ ID NO: 7, остатков 2-566 SEQ ID NO: 8, остатков 2-566 SEQ ID NO: 9, остатков 2-566 SEQ ID NO: 10 или остатков 2-566 SEQ ID NO: 11.

5. Полипептид НА вируса гриппа по п. 1, состоящий из аминокислотной последовательности из остатков 2-566 SEQ ID NO: 1, остатков 2-566 SEQ ID NO: 2, остатков 2-566 SEQ ID NO: 3, остатков 2-566 SEQ ID NO: 4, остатков 2-566 SEQ ID NO: 5, остатков 2-566 SEQ ID NO: 6, остатков 2-566 SEQ ID NO: 7, остатков 2-566 SEQ ID NO: 8, остатков 2-566 SEQ ID NO: 9, остатков 2-566 SEQ ID NO: 10 или остатков 2-566 SEQ ID NO: 11.

6. Полипептид НА вируса гриппа по п. 2, содержащий аминокислотную последовательность SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 или SEQ ID NO: 11.

7. Полипептид НА вируса гриппа по п. 2, состоящий из аминокислотной последовательности SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 или SEQ ID NO: 11.

8. Выделенная молекула нуклеиновой кислоты, кодирующая полипептид НА вируса гриппа по п. 1.

9. Выделенная молекула нуклеиновой кислоты по п. 8, где молекула нуклеиновой кислоты подвергнута оптимизации кодонов для экспрессии в клетках млекопитающих.

10. Вектор, кодирующий рекомбинантные полипептиды НА по пункту 1, содержащий молекулу нуклеиновой кислоты по п. 8.

11. Вектор по п. 10, дополнительно содержащий промотор, функционально связанный с последовательностью нуклеиновой кислоты, кодирующей полипептид НА вируса гриппа.

12. Выделенная клетка для выработки и экспрессии вирусоподобных частиц (VLP) гриппа, содержащая вектор по п. 10.

13. Вирусоподобная частица (VLP) для вызова иммунного ответа в отношении вируса гриппа, сходная с частицей вируса гриппа, содержащая полипептид НА вируса гриппа по п. 1.

14. VLP, сходная с частицей вируса гриппа, по п. 13, дополнительно содержащая белок нейраминидазу (NA) вируса гриппа, матриксный белок (M1) вируса гриппа или оба таковых.

15. VLP для вызова иммунного ответа в отношении вируса гриппа, сходная с частицей вируса гриппа, содержащая полипептид НА вируса гриппа по п. 1, получаемая путем трансфекции клетки-хозяина с помощью вектора, кодирующего полипептид НА, вектора, кодирующего белок NA вируса гриппа, и вектора, кодирующего белок M1 вируса гриппа, в условиях, достаточных для обеспечения экспрессии белков НА, M1 и NA.

16. Слитый белок для вызова иммунного ответа в отношении вируса гриппа, содержащий полипептид НА вируса гриппа по п. 1.

17. Композиция для вызова иммунного ответа в отношении вируса гриппа, содержащая полипептид НА вируса гриппа по п. 1, слитый белок по п. 16, или VLP по п. 13, или VLP по п. 15, и фармацевтически приемлемый носитель.

18. Способ вызова иммунного ответа в отношении вируса гриппа у субъекта, включающий введение полипептида НА вируса гриппа по п. 1, или слитого белка по п. 16, или VLP по п. 13, или VLP по п. 15, или композиции по п. 17 в эффективном количестве.

19. Способ иммунизации субъекта против вируса гриппа, включающий введение субъекту композиции, содержащей VLP по п. 13 или VLP по п. 15, и фармацевтически приемлемого носителя в эффективном количестве.

20. Способ по п. 19, где композиция дополнительно содержит адъювант.

21. Способ по п. 19 или 20, где композицию вводят внутримышечно.

22. Способ по п. 19, где композиция содержит от около 1 до около 25 мкг VLP.

23. Способ по п. 22, где композиция содержит около 15 мкг VLP.



 

Похожие патенты:

Изобретение относится к медицине и касается способа прогнозирования возникновения рецидива вульвы I и II стадии. Предложенный способ заключается в определении в ткани опухоли ДНК вируса папилломы человека методом полимеразной цепной реакции.

Изобретение относится к вирусологии. Предложен аттенуированный штамм «СКА-2015 ВНИИВВиМ» вируса африканской чумы свиней VIII-го серотипа.

Настоящее изобретение относится к биотехнологии. Предложен способ получения вируса гриппа с моногликозилированным гемагглютинин-антигеном (НА-антиген).

Изобретение относится к области медицинской биотехнологии. Предложены способы определения биологической активности монокомпонентов в ассоциированных комбинированных ди- и тривакцинах, содержащих вакцинные штаммы вируса кори (Л-16), эпидемического паротита (Л-3) и/или краснухи (Орлов).
Настоящее изобретение относится к способу захвата представляющих интерес вирусоподобных частиц из смеси, включающей разрушенные клетки растений. Способ включает использование расширяющегося слоя адсорбента, содержащего материал смолы, уравновешивание материала смолы при рН 6,0-8,0 и внесение смеси на расширяющийся слой адсорбента для связывания вирусоподобных частиц.

Изобретение относится к области ветеринарной вирусологии и биотехнологии и касается штамма вируса нодулярного дерматита крупного рогатого скота (ВНД КРС). Описанный штамм выделен от коров, больных нодулярным дерматитом, и депонирован в Коллекции штаммов микроорганизмов ФГБУ «ВНИИЗЖ» под регистрационным номером - ВНД КРС/Дагестан/2015 (диагностический).

Изобретение относится к области биотехнологии и касается штамма вируса гриппа. Представленный штамм вируса гриппа птиц A/Common Muskrat/Chany Lake/226/05 H2N2-субтипа, депонированный в Коллекции микроорганизмов Федерального бюджетного учреждения науки «Государственный научный центр вирусологии и биотехнологии «Вектор» под регистрационным номером V-623.

Изобретение относится к области биотехнологии и касается штамма вируса гриппа. Предложен реассортантный вакцинный штамм А/17/серебристая чайка/Сарма/06/887 (H6N1).

Изобретение относится к медицинской вирусологии и касается штамма вируса гриппа. Предложен вакцинный штамм А/17/Гонконг/2014/8296 (H3N2) - реассортант, полученный путем скрещивания «дикого» вируса А/Гонконг/4801/2014 (H3N2) с холодоадаптированным температурочувствительным вирусом А/Ленинград/134/17/57 (H2N2) - донором аттенуации, безвредным для людей.

Изобретение относится к вирусологии. Предложен вакцинный штамм В/60/Пхукет/2013/26 - реассортант, полученный методом генетической реассортации эпидемического вируса В/Пхукет/3073/2013 с холодоадаптированным температурочувствительным вирусом В/СССР/60/69 - донором аттенуации, безвредным для людей.

Настоящее изобретение относится к области биотехнологии и иммунологии. Предложены выделенные полинуклеотиды, кодирующие вариабельные области легкой и тяжелой цепи антитела против человеческого EGFR; анти-EGFR антитело и фрагмент антитела; а также вектор, клетка-хозяин и способ получения анти-EGFR антитела или его фрагмента.

Изобретение относится к области биотехнологии и иммунологии. Описано блокирующее AGR2 моноклональное антитело и, в частности, гуманизированное моноклональное антитело для блокирования AGR2.

Изобретение относится к области биотехнологии и иммунологии. Предложено гуманизированное антитело и его антиген-связывающий фрагмент, специфически связывающиеся с рецептором фолиевой кислоты 1 (FOLR1) человека и охарактеризованные аминокислотными последовательностями участков, определяющих комплементарность с антигеном (CDR).

Описаны белок, который связывается с геном фактора IX (FIX), полинуклеотид, кодирующий такой белок, выделенная клетка-хозяин, экспрессирующая белок, и способ экспрессии белка.

Изобретение относится к области биохимии, в частности к трансгенному растению, которое имеет устойчивость к насекомым Helicoverpa zea, включающему ДНК, кодирующую Vip3Ab1, и ДНК, кодирующую Cry1Ab, его семени и клетке, а также к способу задержки или предотвращения развития устойчивости у насекомых Helicoverpa zea к белкам Cry1Ab и Vip3Ab1 с его использованием.

Изобретение относится к области иммунологии. Предложены способ получения антигенсвязывающего белка и клетка-хозяин для его получения.

Изобретение относится к клеточной технологии. Описаны способы получения полиплоидных мегакариоцитов и тромбоцитов, включающие принудительную экспрессию гена BCL-XL в мегакариоцитах, не прошедших полиплоидизацию, при этом указанные мегакариоциты получены посредством принудительной экспрессии онкогена семейства MYC и гена ВМИ в указанных клетках на любой стадии дифференцировки из гемопоэтических клеток-предшественников, полученных не из ЭС клеток, в мегакариоциты перед полиплоидизацией и культивированием и пролиферацией полученных клеток, и культивирование указанных клеток.

Данное изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, которые специфично связывают дельта-подобный лиганд 4 (DLL4) человека, охарактеризованные последовательностями определяющих комплементарность участков (CDR).

Изобретение относится к области биотехнологии, вирусологии и иммунологии. Описаны новые аденовирусные штаммы с улучшенной серопревалентностью.

Изобретение относится к области биотехнологии и может быть использовано для получения вариантов плазминогена и плазмина. Получают вариант плазминогена, содержащий сайт активации и каталитический домен, в котором каталитический домен содержит замену валина на изолейцин в положении 1 каталитического домена плазмина человека или в положении, соответствующем таковому в каталитическом домене плазмина, отличном от плазмина человека, где указанный каталитический домен плазмина человека начинается с аминокислоты валин в положении 1, которая является той же аминокислотой валин, которая находится в положении 562 Glu-плазминогена человека с SEQ ID NO: 1.

Изобретение относится к биохимии. Описаны модифицированные олигонуклеотиды длиной от 15 до 30 нуклеотидов, содержащие по меньшей мере одну модификацию, причем указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного фрагмента сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.
Наверх