Способ прогнозирования риска развития желудочковой экстрасистолии у школьников перед занятиями спортом

Изобретение относится к области медицины, а именно к детской кардиологии, и касается способа прогнозирования риска развития желудочковой экстрасистолии у школьников перед занятиями спортом. Сущность способа: у школьников за 1 месяц до начала занятий спортом проводят исследование сыворотки крови и определяют в ней концентрации иммунохимических показателей: фактора некроза опухоли-α, интерлейкина-10 и аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05. Прогнозируют высокий риск развития желудочковой экстрасистолии при концентрации фактора некроза опухоли-α от 11,5 до 13,5 пг/мл, при концентрации интерлейкина-10 от 18,4 до 20,2 пг/мл и при концентрации аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05 от 9,8 до 12,3 усл. ед. Прогнозируют низкий риск развития желудочковой экстрасистолии при концентрации фактора некроза опухоли-α от 7,7 до 10,1 пг/мл, при концентрации интерлейкина-10 от 13,5 до 16,3 пг/мл и при концентрации аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05 от 6,7 до 8,7 усл. ед. Предлагаемое изобретение направлено на повышение точности прогнозирования риска развития желудочковой экстрасистолии у детей перед занятиями спортом. 1 табл., 4 пр.


Изобретение относится к области медицины, а именно к детской кардиологии и может быть использовано для прогнозирования риска возникновения желудочковой экстрасистолии у школьников перед занятиями спортом.

Прогнозирование риска развития нарушений ритма сердца является актуальной проблемой медицины в связи со сложностью ранней диагностики и значительным негативным влиянием на качество жизни пациентов.

С внедрением норм ГТО и президентских программ развития детского спорта, возрастает его значение в достижении высоких спортивных результатов, основой которых служит состояние процессов адаптации к физическим нагрузкам. Длительные и интенсивные тренировки у детей могут негативно сказываться на работе сердечно-сосудистой системы и проявляться в виде снижения толерантности к физическим нагрузкам, что характеризуется изменением иммунологических параметров.

Из практики медицины известен способ прогнозирования нарушений адаптации у детей в раннем неонатальном периоде (Синчихин С.П. с соавт. Патент на изобретение №2247990, опубликован 10.03.2005, Бюл. изобретений №7).

В представленной работе с целью прогнозирования адаптации у новорожденных детей используются определения уровней фактора некроза опухоли - альфа и субкласса иммуноглобулина G2, и при значении фактора некроза опухоли-α - 22,5-52,0 пг/мл, иммуноглобулина G2 - 1,49-2,03 мг/мл прогнозируют выраженные нарушения адаптации; при значении фактора некроза опухоли-α - 16,0-20,5 пг/мл, иммуноглобулина G2 - 2,30-2,70 мг/мл прогнозируют умеренные нарушения адаптации, а при значении фактора некроза опухоли-α - 14,3-15,9 пг/мл, иммуноглобулина G2 - 2,86-3,18 мг/мл прогнозируют благоприятное течение адаптации. Недостатками данного способа являются:

- уровень фактора некроза опухоли-α отражает активность только провоспалительных процессов, в тоже время, состоянию противовоспалительных процессов не уделяется должного внимания;

- изменение уровней иммуноглобулина G2 зависит от антигеннной стимуляции и отражает иммунные нарушения в организме, но не может быть использовано для характеристики состояния миокарда и выявления дисфункции проводящей системы сердца;

- состояние уровней фактора некроза опухоли-α и иммуноглобулина G2 определяется у детей периода новорожденное.

Таким образом, одновременное определение уровней фактора некроза опухоли-α и субкласса иммуноглобулина G2 не позволяет прогнозировать риск развития желудочковых экстрасистолии у детей перед началом занятий спортом.

Кроме того, существует количественный метод использования полимеразной цепной реакции для выявления экспрессии генов интерлейкина-4 в периферической крови при физиологическом состоянии у взрослых (Реферат CN 1629316 (А) - 20050622 (Fluorogenic quantitative PCR method for detecting interleukin 4 gene expression in peripheralblood under physiological state, inventor(s): Chen Peijie; Dong Qianggang; Wang ru [cn] Applicant(s): shanghai physical education in (Shanghai Physical education institute)).

Авторами предлагается количественный способ определения иммунохимического маркера - цитокина-4 в периферической крови, а также метод может применяться для специфического выявления экспрессии гена цитокина – интерлейкина-4 для определения ранней стадии усталости и предотвращения снижения иммунологической реактивности, вызванного избыточной физической нагрузкой.

Недостатками данного способа являются:

- для прогнозирования риска развития желудочковой экстрасистолии у детей, длительно занимающихся спортом недостаточно использовать один показатель;

-концентрация интерлейкина-4 отражает активность противовоспалительных процессов в организме, в тоже время состояние провоспалительных процессов остается не оцененным;

- повышение концентрации интерлейкина-4 не отражает состояние сердечной мышцы, поэтому использование его для прогнозирования желудочковой экстрасистолии у детей не целесообразно.

Предлагаемое изобретение направлено на повышение точности прогнозирования риска возникновения желудочковой экстрасистолии у школьников перед началом занятий спортом.

Указанный технический результат достигается тем, что определяют в сыворотке крови у школьников за 1 месяц перед занятиями спортом концентрации фактора некроза опухоли-α, интерлейкина-10 и аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05, при этом прогнозируют высокий риск развития желудочковой экстрасистолии при концентрации фактора некроза опухоли-α от 11,5 до 13,5 пг/мл, при концентрации интерлейкина-10 от 18,4 до 20,2 пг/мл и при концентрации аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05 от 9,8 до 12,3 усл. ед. и прогнозируют низкий риск развития желудочковой экстрасистолии при концентрации фактора некроза опухоли-α от 7,7 до 10,1 пг/мл, при концентрации интерлейкина-10 от 13,5 до 16,3 пг/мл и при концентрации аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05 от 6,7 до 8,7 усл .ед.

Существующие клинико-лабораторные методы исследования не позволяют объективно прогнозировать риск развития желудочковой экстрасистолии у этой категории пациентов.

Вследствие этого важно комплексное использование определения концентраций иммунохимических показателей, включая про- и противовоспалительные цитокины, а также аутоантитела класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05, которые не нашли достаточного применения при прогнозировании риска развития желудочковой экстрасистолии у детей перед началом занятий спортом.

Преимуществом предлагаемого нами способа является использование для прогнозирования риска возникновения желудочковой экстрасистолии у школьников за 1 месяц до начала занятий спортом концентрации фактора некроза опухоли-α, интерлейкина-10 и аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05.

Это позволяет не только прогнозировать риск развития у них в дальнейшем желудочковой экстрасистолии, но и более дифференцированно подходить к вопросам подготовки детей к занятиям спортом, а также разрабатывать для них индивидуальные программы физических тренировок.

Занятия спортом являются мощным стрессом для всего организма и иммунной системы в частности. Дисбаланс в иммунной системе ребенка, имеющийся до этого, может значительно усугубиться.

Известно, что фактор некроза опухоли - альфа (ФНО-α) относится к провоспалительным цитокинам. Он резко увеличивает образование макрофагами и нейтрофилами перекиси водорода, активирует катаболические процессы, оказывает отрицательное инотропное действие на миокард, а также приводит к его метаболическому истощению. Он модулирует активность других цитокинов, способствуя развитию воспаления. Известно, что высокий уровень ФНО-α ассоциируется с дисфункцией синусового узла.

Интерлейкин-10 (IL-10) относится к противовоспалительным цитокинам. Он обладает негативной регуляторной активностью в отношении воспалительных процессов. Продукция его выполняет сугубо ингибиторные функции, то есть он способен затормаживать синтез всех воспалительных цитокинов. IL-10 может угнетать клеточный иммунный ответ, в тоже время стимулируя пролиферацию В-лимфоцитов и гуморальный иммунный ответ.

Таким образом, дисбаланс уровней про- и противовоспалительных цитокинов во многом определяет развитие воспалительной реакции.

Известно, что при инфекционно-токсической кардиопатии выявлен рост продукции антител к проводящей системе и кардиомиоцитам. Изменение уровней антикардиальных антител может отмечаться как при воспалительных, так и при невоспалительных заболеваниях миокарда, причем они могут выступать как в роли свидетелей патологического процесса, так и являться агрессорами. Повышение уровней аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05(АТ COS-05) сопровождает развитие стресс-индуцированного ремоделирования миокарда у молодых спортсменов.

Длительные и интенсивные тренировки у юных спортсменов сопровождаются изменениями метаболизма кардиомиоцитов и даже приводить его ремоделированию.

Определение концентрации ФНО-α, IL-10 и AT COS-05 у школьников перед занятиями спортом позволит объективно оценивать состояние миокарда и прогнозировать риск развития желудочковой экстрасистолии.

Предложенный способ был успешно апробирован в течение 2015-2017 гг.в ГБУЗ АО «Областной физкультурный диспансер» на 153 детях, которые проходили обследование перед занятиями спортом на базе этого лечебного учреждения.

Полученные данные обработаны методом вариационной статистики и представлены в таблице 1.

Ниже приведены результаты апробации.

Пример №1.

Ребенок Н., мальчик, 11 лет. Жалоб на момент осмотра не предъявляет. Физические нагрузки переносит хорошо. Состояние удовлетворительное. Рост 138 см, вес - 31 кг. Кожные покровы бледно-розовые. Подкожно-жировой развит умеренно, распределен равномерно. Костно-мышечная система развита удовлетворительно, сила мышц достаточная. Дыхание в легких везикулярное, частота дыхательных движений 20 в минуту.

Верхушечный толчок пальпируется в 5 межреберье слева. Границы сердца: правая - посредине между правой парастернальной и правой стернальной линиями, верхняя расположена на уровне третьего ребра, левая - на 0,5 см кнаружи от левой срединно-ключичной линии. Частота сердечных сокращений 85 ударов в минуту. Тоны сердца ясные, громкие, ритмичные. АД=105/70 мм рт. ст. Печень пальпируется по краю реберной дуги.

На ЭКГ - дыхательная аритмия, нормальное положение электрической оси. Неполная блокада правой ножки пучка Гиса.

На основании клинических данных и полученных результатов инструментального исследования сложно оценить риск развития желудочковой экстрасистолии.

Для более точной оценки риска развития желудочковой экстрасистолии ребенку дополнительно проводилось иммунохимическое исследование сыворотки крови методом иммуноферментного анализа с целью определения концентрации определялись концентрации цитокинов: фактора некроза опухоли α, интерлейкина-10, а также концентрация антикардиальных антител-COS-05. Порядок проведения иммуноферментного анализа выполнялся согласно прилагаемым инструкциям. В результате выявлено, что концентрация ФНО-α у мальчика составляет 7,7 пг/мл, IL- 10- 13,5 пг/мл, a AT COS-05 - 6,7 усл. ед.

Полученные данные сравнили со значениями, которые приводятся в таблице №1.

Таким образом, проведенный анализ концентрации показал, что результаты исследования попадают в диапазон, позволяющий прогнозировать у этого ребенка низкий риск развития желудочковой экстрасистолии.

Пример №2.

Ребенок О. девочка, 9 лет. Жалоб нет. Физические нагрузки переносит хорошо. Состояние удовлетворительное. Рост 130 см, вес - 28 кг. Кожные покровы бледно-розовые. Дыхание везикулярное, частота дыхательных движений 22 в минуту.

Верхушечный толчок не изменен. Границы сердца: правая - посредине между правой парастернальной и правой стернальной линиями, верхняя расположена на уровне 3-его ребра, левая - на 0,5 см кнаружи от левой срединно-ключичной линии. Частота сердечных сокращений 87 ударов в минуту. Тоны сердца громкие, ритмичные. АД=100/65 мм рт.ст. Печень - по краю реберной дуги.

На ЭКГ - синусовый ритм, нормальное положение электрической оси сердца.

Ребенку проводилось определение концентрации ФНО-α, IL-10, AT COS-05 в сыворотке крови по методике, описанной в примере 1.

Установлено, что уровень ФНО-α составил 10,1 пг/мл, IL-10 - 16,3 пг/мл, AT COS-05 - 8,7 усл. ед. Подобные значения, как видно из таблицы №1, позволяют прогнозировать низкий риск развития желудочковой экстрасистолии у данного ребенка.

Пример №3.

Ребенок В. девочка, 8 лет. Жалоб нет. Физические нагрузки переносит хорошо. Состояние удовлетворительное. Рост 125 см, вес - 25 кг. Кожные покровы цвета загара. Дыхание везикулярное, частота дыхательных движений 20 в минуту.

Верхушечный толчок не изменен. Границы сердца: правая - посредине между правой парастернальной и правой стернальной линиями, верхняя расположена на уровне 3-его ребра, левая - на 0,5 см кнаружи от левой срединно-ключичной линии. Частота сердечных сокращений 86 ударов в минуту. Тоны сердца громкие, ритмичные. АД=100/70 мм рт.ст. Печень - по краю реберной дуги.

На ЭКГ - синусовый ритм, нормальное положение электрической оси сердца.

На ЭХО-КГ: эктопически расположенная хорда левого желудочка.

На основании клинических данных и полученных результатов инструментального исследования сложно оценить риск развития желудочковой экстрасистолии.

Поэтому ребенку проведено определение концентрации ФНО-α, IL-10, AT COS-05 и было установлено, что концентрация ФНО-α составила 11,5 пг/мл, IL-10 - 18,4 пг/мл, AT COS-05 - 9,8 усл. ед. Подобные значения, как видно из таблицы №1, позволяют прогнозировать высокий риск развития желудочковой экстрасистолии.

Данный пример показывает преимущество предлагаемого способа прогноза, которое выражается в том, что он позволяет прогнозировать наличие у ребенка высокого риска возникновения желудочковой экстрасистолии, при полном отсутствии клинико-инструментальных ее проявлений.

Пример №4.

Ребенок Ш., мальчик, 12 лет. Жалоб на момент осмотра не предъявляет. Физические нагрузки переносит хорошо. Состояние удовлетворительное. Рост 149 см, вес - 40 кг. Кожные покровы обычной окраски. Дыхание в легких везикулярное, перкуторно над легкими ясный легочный звук, частота дыхательных движений 18 в минуту.

Визуально область сердца не изменена. Верхушечный толчок пальпируется в 5 межреберье слева. Границы сердца: правая - посредине между правой парастернальной и правой стернальной линиями, верхняя расположена на уровне третьего ребра, левая - на 0,5 см кнаружи от левой срединно-ключичной линии. Частота сердечных сокращений 79 ударов в минуту. Тоны сердца ясные, громкие, дыхательная аритмия. АД=110/70 мм рт.ст. Печень пальпируется по краю реберной дуги.

На ЭКГ - дыхательная аритмия, нормальное положение электрической оси.

Ребенку проводилось определение концентраций ФНО-α, IL-10, AT COS-05 в сыворотке крови.

Установлено, что концентрация ФНО-α составила 13,5 пг/мл, IL-10- 20,2 пг/мл, AT COS-05 - 12,3 усл. ед. Подобные значения иммунологических показателей, как видно из таблицы №1, позволяют прогнозировать высокий риск развития желудочковой экстрасистолии у данного ребенка.

Представленные клинические примеры наглядно демонстрируют практическую реализацию предлагаемого способа прогнозирования желудочковой экстрасистолии у детей перед занятиями спортом. Указанный технический результат достигается за счет совокупности всех составляющих предлагаемого способа, их последовательности и режимов его реализации.

Положительный эффект предлагаемого способа достигается повышением точности прогнозирования риска развития желудочковой экстрасистолии у школьников перед занятиями спортом с помощью оценки состояния иммунологических показателей. Прогнозирование риска возникновения желудочковой экстрасистолии, является основанием для определения конкретного объема физической нагрузки и разработки индивидуальных программ физических тренировок у детей, планирующих заниматься спортом.

Это позволит с высокой точностью прогнозировать риск развития желудочковой экстрасистолии у юных спортсменов, поскольку точность способа составляет 95%.

Этот способ одновременно технически прост, надежен и доступен для широкого практического применения, поскольку не требует использования дорогостоящих реактивов и оборудования.


ФНО-α - фактор некроза опухоли-α;

IL-10 - интерлейкин-10;

AT COS-05 - антикардиальные антитела;

n - число наблюдений;

* - М±m, где М - это среднеарифметическая величина, a m - это стандартная ошибка среднеарифметической величины;

** - разброс значений показателей (минимальное и максимальное значения);

р - критерий достоверности значений при сравнении показателей у детей с высоким и низким риском развития желудочковой экстрасистолии.

Способ прогнозирования риска развития желудочковой экстрасистолии у школьников перед занятиями спортом, включающий определение в сыворотке крови у школьников за 1 месяц до начала занятий спортом концентрации фактора некроза опухоли-α, интерлейкина-10 и аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05; при этом прогнозируют высокий риск развития желудочковой экстрасистолии при концентрации фактора некроза опухоли-α от 11,5 до 13,5 пг/мл, при концентрации интерлейкина-10 от 18,4 до 20,2 пг/мл и при концентрации аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05 от 9,8 до 12,3 усл. ед. и прогнозируют низкий риск развития желудочковой экстрасистолии при концентрации фактора некроза опухоли-α от 7,7 до 10,1 пг/мл, при концентрации интерлейкина-10 от 13,5 до 16,3 пг/мл и при концентрации аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05 от 6,7 до 8,7 усл. ед.


Похожие патенты:

Изобретение относится к области медицины, а именно к детской кардиологии, и касается способа прогнозирования риска развития желудочковой экстрасистолии у детей, занимающихся спортом 2-3 года.

Изобретение относится к области медицины, а именно к детской кардиологии. Изобретение представляет собой способ прогнозирования риска развития приобретенной кардиомиопатии перед занятиями спортом, включающий определение в сыворотке крови у детей за 1 месяц до начала занятий спортом концентрации тропонина-Т, N-концевого натрийуретического пептида, интерлейкина-4 (ИЛ-4) и интерлейкина-6 (ИЛ-6), при этом прогнозируют высокий риск развития приобретенной кардиомиопатии при концентрации тропонина-Т от 0,37 до 0,48 нг/мл, при концентрации N-концевого натрийуретического пептида от 66,2 до 77,1 пг/мл, при концентрации ИЛ-4 от 2,6 до 3,1 пг/мл и при концентрации ИЛ-6 от 7,3 до 9,7 пг/мл и прогнозируют низкий риск развития вторичной кардиомиопатии при концентрации тропонина-Т от 0,21 до 0,36 нг/мл, при концентрации N-концевого натрийуретического пептида от 35,3 до 43,5 пг/мл, при концентрации ИЛ-4 от 3,4 до 4,58 пг/мл и при концентрации ИЛ-6 от 5,6 до 6,9 пг/мл.

Группа изобретений относится к области устройств и способов для тестирования биологических жидкостей. Интегрированное тестирующее устройство содержит тестовый компонент, резервуар для тестовой жидкости, регулировочный сосуд и пусковое устройство для подачи жидкости, приведение в действие которого приводит к выпуску тестовой жидкости из резервуара в регулировочный сосуд.

Изобретение относится к области медицины, а именно к детской кардиологии. Изобретение представляет собой способ прогнозирования риска развития приобретенной кардиомиопатии у спортсменов, включающий определение у детей, занимающихся спортом в течение 2-3 лет, в сыворотке крови концентрации тропонина-Т, N-концевого натрийуретического пептида, интерлейкина-4 (ИЛ-4) и интерлейкина-6 (ИЛ-6), при этом прогнозируют высокий риск развития приобретенной кардиомиопатии при концентрации тропонина-Т от 0,76 до 0,91 нг/мл, при концентрации N-концевого натрийуретического пептида от 78,2 до 92,5 пг/мл, при концентрации ИЛ-4 от 1,8 до 2,5 пг/мл и при концентрации ИЛ-6 от 8,3 до 10,1 пг/мл; прогнозируют низкий риск развития приобретенной кардиомиопатии при концентрации тропонина-Т от 0,48 до 0,72 нг/мл, при концентрации N-концевого натрийуретического пептида от 44,3 до 71,5 пг/мл, при концентрации ИЛ-4 от 3,2 до 4,0 пг/мл и при концентрации ИЛ-6 от 7,1 до 8,1 пг/мл.

Настоящее изобретение относится к области биотехнологии, конкретно к полипептидному биомаркеру эффективности применения ингибитора FGFR при лечении рака мочевого пузыря и рака легких, что может быть использовано в медицине.

Настоящее изобретение относится к области биотехнологии, конкретно к полипептидному биомаркеру эффективности применения ингибитора FGFR при лечении рака мочевого пузыря и рака легких, что может быть использовано в медицине.

Изобретение относится к области медицины, в частности к дерматологии. Предложен способ выявления мутаций 2282del4, R501X и R2447X в гене филаггрина (FLG) при вульгарном ихтиозе и атопическом дерматите.

Изобретение относится к медицине, а именно к клинической лабораторной диагностике в акушерстве, и может быть использовано для дифференциальной диагностики анемии хронических заболеваний и железодефицитной анемии у беременных с нарушениями углеводного обмена с целью выбора оптимальной тактики лечения анемии.

Изобретение касается способа оценки способности высвобождения эндосомой тестовой молекулы, причем упомянутая тестовая молекула представляет собой клостридиальный нейротоксин или перенаправленную не цитотоксическую протеазу и обладает способностью к протеолитическому расщеплению и инактивированию белка SNARE, где способ включает: i) приведение эукариотной клетки в контакт с тестовой молекулой, которая должна быть оценена на способность высвобождения эндосомой, причем упомянутая эукариотная клетка содержит клеточную мембрану, включающую в себя центр связывания, присутствующий на внешней поверхности клеточной мембраны упомянутой клетки; ii) инкубирование тестовой молекулы с упомянутой эукариотной клеткой, что, таким образом, допускает: a) связывание тестовой молекулы и образование связанного комплекса с центром связывания, присутствующим на эукариотной клетке, что позволяет, таким образом, упомянутому связанному комплексу попадать в эукариотную клетку за счет эндоцитоза; b) формирование одной или более эндосом в упомянутой клетке, причем одна или более эндосом содержит тестовую молекулу; и c) введение упомянутой тестовой молекулы в цитозоли эукариотной клетки сквозь эндосомальную мембрану одной или более эндосом; iii) удаление избыточной тестовой молекулы, которая не связана с центрами связывания, присутствующими на эукариотных клетках; iv) детектирование количества тестовых молекул, присутствующих в одной или более эндосом, или выявление количества тестовых молекул, присутствующих в цитозоли упомянутой эукариотной клетки; v) сопоставление количества тестовых молекул, выявленных на этапе iv), с контрольным значением, причем упомянутое контрольное значение отображает количество тестовых молекул, присутствующих в одной или более эндосомах, или количество тестовых молекул, присутствующих в цитозоли, перед выполнением этапа iv); vi) расчет параметра высвобождения эндосомы для тестовой молекулы путем определения относительного изменения количества тестовых молекул, которые присутствуют в одной или более эндосом, или путем определения относительного изменения количества тестовых молекул, присутствующих в цитозоли упомянутой эукариотной клетки; причем этап (iv) содержит детектирование тестовой молекулы с использованием флуоресцентной метки.
Изобретение относится к медицине, в частности к хирургии, и может быть использовано в качестве способа дифференциальной диагностики деструктивного панкреатита. Способ включает исследование крови больного, в крови определяют содержание полиненасыщенной жирной кислоты - γ-линоленовой кислоты.

Изобретение относится к области медицины. Предложен способ определения маркеров наличия опухолевых Т-лимфобластов. Осуществляют выделение фракции РВМС из образца пунктата костного мозга пациента с острым лейкозом, выделение геномной ДНК, мультиплексную полимеразную цепную реакцию с использованием выделенной геномной ДНК в качестве матрицы и олигонуклеотидных праймеров для локусов TRB, электрофорез, определение количества V(D)J-перестроек, связанных с опухолевыми клонами, секвенирование элюированных продуктов мультиплексной ПЦР для определения последовательностей V(D)J-перестроек генов TRB, содержащихся в мажорных продуктах мультиплексной ПЦР. Установленные последовательности V(D)J-перестроек генов TRB являются идентифицированными маркерами наличия опухолевых Т-лимфобластов. Изобретение обеспечивает определение типа преобладающих V(D)J-перестроек генов Т клеточных рецепторов и их количество в диагностическом образце индивидуальной геномной ДНК. 1 ил., 1 пр.

Изобретение относится к биотехнологии. Изобретение представляет собой способ определения в гене галактозо-1-фосфатуридилтрансферазы человека мутации Q188R, rs35742686. Способ может быть использован при скрининге носительства моногенных заболеваний. Способ включает снятие кривых плавления с флуоресцентно-меченными аллель-специфичными олигонуклеотидными пробами. Используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченные аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченный гасителем флуоресценции, следующего нуклеотидного состава:GALT-s GGTCAGGAGGGAGTTGACTTGGGALT-as CCACAGTGCTGGCTCAGACTCAGCGALT-p1 CCACTGCCAGGTAAGG-FAMGALT-p2 CACTGCCGGGTAAGG-VICGALT-р3 BHQ1- GTGTCAGGGGCTCCAGTGG-P,где FAM означает флуоресцентный краситель FAM, VIC означает флуоресцентный краситель VIC, BHQ1 означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции. Относят образец к гомозиготе или гетерозиготе по данному аллелю по анализу форм кривых плавления ДНК, а именно по максимуму первой производной графиков флуоресценции. Предложенное изобретение позволяет более доступно проводить определение в гене галактозо-1-фосфатуридилтрансферазы человека мутации Q188R, rs35742686. 1 ил., 1 табл., 1 пр.

Изобретение относится к области медицины, а именно к детской кардиологии, и касается способа прогнозирования риска развития желудочковой экстрасистолии у школьников перед занятиями спортом. Сущность способа: у школьников за 1 месяц до начала занятий спортом проводят исследование сыворотки крови и определяют в ней концентрации иммунохимических показателей: фактора некроза опухоли-α, интерлейкина-10 и аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05. Прогнозируют высокий риск развития желудочковой экстрасистолии при концентрации фактора некроза опухоли-α от 11,5 до 13,5 пгмл, при концентрации интерлейкина-10 от 18,4 до 20,2 пгмл и при концентрации аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05 от 9,8 до 12,3 усл. ед. Прогнозируют низкий риск развития желудочковой экстрасистолии при концентрации фактора некроза опухоли-α от 7,7 до 10,1 пгмл, при концентрации интерлейкина-10 от 13,5 до 16,3 пгмл и при концентрации аутоантител класса иммуноглобулина G к растворимому антигену кардиомиоцитов -COS-05 от 6,7 до 8,7 усл. ед. Предлагаемое изобретение направлено на повышение точности прогнозирования риска развития желудочковой экстрасистолии у детей перед занятиями спортом. 1 табл., 4 пр.
