Фрагменты днк или рнк и их модифицированные формы (C12N15/11)

Отслеживание патентов класса C12N15/11
C12N     Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N63; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q) (11911)
C12N15        Получение мутаций или генная инженерия; днк или рнк, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N1,C12N5,C12N7; новые виды растений A01H; разведение растений из тканевых культур A01H4; новые виды животных A01K67; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K48 пептиды вообще C07K) (3433)
C12N15/11                     Фрагменты днк или рнк; их модифицированные формы (днк или рнк, не используемые в рекомбинантном методе C07H21)(374)

Молекула одноцепочечной нуклеиновой кислоты для контроля экспрессии генов // 2628311
Настоящее изобретение относится к биохимии, в частности к одноцепочечной молекуле нуклеиновой кислоты, которая подавляет экспрессию целевого гена.

Способ и конструкт для синтетического двунаправленного растительного промотора scbv // 2627595
Изобретение относится к области биохимии, в частности к синтетическому конструкту двухцепочечной нуклеиновой кислоты для экспрессии множества гетерологичных генов в растительной клетке, характеризующемуся двунаправленным промотором, состоящему из первой цепи, содержащей элемент минимального корового промотора, и второй цепи, содержащей промотор бациллярного вируса сахарного тростника, а также к способу получения трансгенной растительной клетки или ткани, которые экспрессируют множество гетерологичных генов с его использованием.

Мутантные полимеразы вируса гепатита в // 2625021
Настоящее изобретение относится к биохимии, в частности к мутантному полипептиду полимеразы ВГВ, содержащему мутантный домен полимеразы ВГВ с внутренней делецией, которая подавляет функциональную активность полимеразы, и мутантный домен РНКазы Н с внутренней делецией и мутациями, которые подавляют функциональную активность РНКазы Н.

Лечение заболеваний, связанных с геном сиалидазы 4 (neu4), путем ингибирования природного антисмыслового транскрипта гена neu4 // 2624048
Группа изобретений относится к области биотехнологии. Представлены способы повышения экспрессии гена сиалидазы 4 (NEU4) с использованием олигонуклеотида, который специфически связывается с природным антисмысловым полинуклеотидом для гена NEU4.

Опосредуемое рнк-интерференцией ингибирование экспрессии генов вируса гепатита b (hbv) с применением малой интерферирующей нуклеиновой кислоты (минк) // 2624045
Изобретение относится к области биохимии. Предложена молекула двухцепочечной малой интерферирующей нуклеиновой кислоты (миНК) для ингибирования экспрессии вируса гепатита В (HBV).

Способы и композиции для модулирования экспрессии аполипопротеина (а) // 2624028
Изобретение относится к области биотехнологии, конкретно к соединению для снижения экспрессии mRNA аполипопротеина (а) и белка apo(a) у животного, и может быть использовано в медицине.

Конструкции слияния и их применение для получения антител с повышенными аффинностью связывания fc-рецептора и эффекторной функцией // 2623167
Изобретение относится к области биохимии, в частности к выделенной нуклеиновой кислоте, кодирующей полипептид слияния, обладающий активностью бета-1,4-N-ацетилглюкозаминилтрансферазы III (GnTIII) или бета-1,4-галактозилтрансферазы (GalT).

Композиция системы доставки на основе конъюгата для доставки полинуклеотида рнк-интерференции в клетку печени и способ ее получения // 2623160
Изобретение относится к области биотехнологии, конкретно к композиции для направленной доставки представляющего интерес полинуклеотида РНК-интерференции в гепатоциты in vivo, и может быть использовано в медицине.
Способ оценки состояния пародонта человека на устойчивость к развитию хронического генерализованного пародонтита на основании количественного определения бактерии-пародонтопротектора streptococcus sanguinis методом пцр-рв // 2621858
Изобретение относится к биотехнологии и стоматологии и клинико-лабораторной диагностике. Описан способ оценки состояния пародонта человека на предмет устойчивости к развитию хронического генерализованного пародонтита, вызываемого Treponema denticola и/или Tannerella forsythensis.

Лечение заболеваний, связанных с фратаксином (fxn), путем ингибирования природного антисмыслового транскрипта fxn // 2620980
Изобретение относится к биохимии. Описаны олигонуклеотиды, модулирующие экспрессию фратаксина (FXN), в частности, посредством нацеленного взаимодействия с природными антисмысловыми полинуклеотидами фратаксина (FXN).

Лечение hbv инфекции // 2620966
Изобретения касаются средства для направленной на ДНК РНК-интерференции (ddRNAi) (варианты) для ингибирования экспрессии РНК-зависимой ДНК полимеразы вируса гепатита В (HBV), кассеты экспрессии для экспрессии средства для ddRNAi, вектора экспрессии для ddRNAi, фармацевтической композиции, содержащей средство для ddRNAi и их применение для лечения инфекции, вызванной гепатитом B, у индивидов.

Детекция нуклеиновокислотной последовательности-мишени в анализе с отсутствием гибридизации, зависящим от расщепления и удлинения зондирующего и метящего олигонуклеотида (рто) // 2620958
Изобретение относится к биохимии. Описаны способы детекции нуклеиновокислотной последовательности-мишени в анализе с PCE-NH (отсутствием гибридизации, зависящим от расщепления и удлинения зондирующего и метящего олигонуклеотида (РТО)).

Детекция нуклеотидной вариации в нуклеиновокислотной последовательности-мишени в анализе с расщеплением и удлинением зондирующего и метящего олигонуклеотида (рто) // 2620955
Настоящее изобретение относится к области биотехнологии, конкретно к способу для детекции нуклеотидных вариаций посредством анализа с расщеплением и удлинением зондирующего и метящего олигонуклеотида (анализа РТОСЕ), и может быть использовано в медицине.
Вещество и способ модуляции пролиферации и дифференцировки регуляторных, стволовых и других соматических клеток // 2620069
Изобретение относится к области фундаментальной биологии, практической регенеративной медицины, ветеринарии, клеточной биологии и может быть использовано для лечения и профилактики заболеваний, расстройств или состояний, связанных с нарушением процессов пролиферации и дифференцировки клеток разных органов и тканей, для активации регенерационного потенциала органов и тканей человека и животных при возрастных изменениях и после экстремальных воздействий, а также для медико-биологических исследований.
Способ получения in vitro популяций активированных антигенспецифических противоопухолевых цитотоксических т-лимфоцитов, специфичных к эпитопам опухоль-ассоциированного антигена // 2619186
Изобретение относится к области биотехнологии, конкретно к иммунологии, и может быть использовано для получения противоопухолевых ЦТЛ.

Лечение заболеваний, связанных с разобщающим белком 2 (ucp2), путем ингибирования природного антисмыслового транскрипта к ucp2 // 2619185
Изобретение относится к биохимии. Описаны олигонуклеотиды длиной от 15 до 30 нуклеотидов, которые специфически гибридизуются с природной антисмысловой последовательностью IRS2 и имеют последовательность, по меньшей мере на 80% идентичную последовательности, обратно комплементарной участку последовательности SEQ ID NO: 3, или имеют последовательность, по меньшей мере на 80% идентичную участку последовательности SEQ ID NO: 1, причем указанные олигонуклеотиды необязательно содержат одну или более модификаций, выбранных из следующих: по меньшей мере один модифицированный фрагмент сахара, по меньшей мере одна модифицированная межнуклеозидная связь, по меньшей мере один модифицированный нуклеотид и их комбинации; и их применение для лечения заболеваний и расстройств, связанных с экспрессией UCP2.

Антисмысловые нуклеиновые кислоты // 2619184
Изобретение относится к биохимии. Описан антисмысловой олигомер, который вызывает пропуск 50-го экзона в гене дистрофина человека, состоящий из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, состоящих из 106-го - 126-го, 107-го - 127-го, 108-го - 127-го, 108-го - 128-го или 109-го - 129-го нуклеотидов, считая от 5'-конца 50-го экзона гена дистрофина человека.
Способ оценки защитной эффективности работы неспецифического иммунитета на поверхности пародонта на основе полимеразной цепной реакции в реальном времени // 2619174
Настоящее изобретение относится к медицине. Предложен способ диагностики локального иммунного статуса пародонта.
Способ оценки состояния пародонта человека на устойчивость к развитию хронического генерализованного пародонтита на основании количественного определения бактерии-пародонтопротектора veillonella parvula методом пцр в реальном времени // 2619172
Изобретение относится к клинико-лабораторной диагностики. В частности, к определению степени устойчивости пародонта к инфекции патогенными бактериями Porphyromonas gingivalis, Prevotella intermedia и Tannerella forsythensis за счет наличия бактерии-пародонтопротектора Veillonella parvula.

Способ направленного истощения олигонуклеотидных библиотек для снижения неспецифической адсорбции при твердофазной селекции аптамеров на основе нуклеиновых кислот // 2618872
Изобретение относится к области биотехнологии и касается способа направленного истощения олигонуклеотидных библиотек в отношении водорастворимых белковых мишеней глутатион-S-трансферазы и стрептавидина.

Лечение связанных с геном-супрессором опухолей заболеваний посредством ингибирования природного транскрипта в антисмысловой ориентации относительно этого гена // 2618688
Изобретение относится к биохимии. Заявлен способ повышения экспрессии полинуклеотида PTEN в клетках или тканях пациента in vivo или in vitro, включающий контактирование указанных клеток или тканей с по меньшей мере одним антисмысловым олигонуклеотидом длиной от 10-30 нуклеотида, мишенью которого является природный антисмысловой полинуклеотид PTEN, выбранный из SEQ ID NOs: 14 и 15; посредством чего осуществляется повышение экспрессии полинуклеотида PTEN в клетках или тканях пациента in vivo.

Способ экспресс-анализа генетического полиморфизма для выявления генетической предрасположенности к раку молочной железы // 2617936
Изобретение относится к молекулярной биологии, микробиологии и медицине. Предложен способ экспресс-анализа генетического полиморфизма для выявления генетической предрасположенности к раку молочной железы (РМЖ).

Лечение заболеваний, связанных с субстратом рецептора инсулина 2 (irs2), путем ингибирования природного антисмыслового транскрипта к irs2 // 2616283
Изобретение относится к олигонуклеотиду длиной от 15 до 30 нуклеотидов, который специфически гибридизуется с природной антисмысловой последовательностью IRS2 и имеет последовательность, по меньшей мере на 80% идентичную последовательности, обратно комплементарной участку последовательности SEQ ID NO: 3, или имеет последовательность, по меньшей мере на 80% идентичную участку последовательности SEQ ID NO: 1, причем указанный олигонуклеотид необязательно содержит одну или более модификаций, выбранных из следующих: по меньшей мере один модифицированный фрагмент сахара, по меньшей мере одна модифицированная межнуклеозидная связь, по меньшей мере один модифицированный нуклеотид и их комбинации.

Способ лечения аллергической бронхиальной астмы, основанный на подавлении экспрессии генов цитокинов il-4 и il-13 с использованием молекул мирнк // 2615463
Изобретение относится к области биотехнологии, конкретно к подавлению экспрессии генов цитокинов миРНК, и может быть использовано в медицине.

Иммуностимулирующие олигодезоксинуклеотиды // 2615457
Настоящее изобретение относится к биотехнологии. Предложен иммуностимулирующий неметилированный CpG-олигодезоксинуклеотид, вектор экспрессии, его содержащий, вакцина для предотвращения или борьбы с инфекционным заболеванием у птиц, содержащая указанные олигодезоксинуклеотид и/или вектор экспрессии и иммунологическое количество антигенного компонента, выделенного из патогенного для птичьих вируса или микроорганизма, а также применение олигодезоксинуклеотида в качестве лекарственного средства и для предотвращения инфекции у птичьих.

Сильный растительный промотор pro-smamp2 из сорного растения stellaria media // 2615456
Изобретение относится к области биологии, в частности молекулярной биологии и генетической инженерии. В качестве настоящего изобретения предложен фрагмент ДНК, обеспечивающий высокий уровень экспрессии генов в растениях и представляющий собой промотор гена pro-SmAMP2, соединенный с его 5'-нетранслируемой областью, где указанный фрагмент ДНК имеет нуклеотидную последовательность SEC ID NO 5.

Лечение заболеваний, связанных с ядерным респираторным фактором 1(nrf1), путем ингибирования природного антисмыслового транскрипта к nrf1 // 2615450
Изобретение относится к биохимии. Описаны антисмысловые олигонуклеотиды, модулирующие экспрессию ядерного респираторного фактора 1 (NRF1), в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами ядерного респираторного фактора 1 (NRF1).

Двухцепочечная молекула рнк для обеспечения клетки активностью mir-34a // 2615117
Изобретение относится к области молекулярной биологии и медицины. Предложена двухцепочечная молекула РНК с тупыми концами длиной 23 пары оснований для обеспечения клетки активностью miR-34a.
Оптимизированный ген, кодирующий рекомбинантный белок ипфiii // 2614124
Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению интерферонов, и может быть использовано для получения рекомбинантного белка интерферона лямбда.

Способ выявления мутаций в сложных смесях днк // 2613489
Настоящее изобретение направлено на методы выявления в образце мутаций в ДНК, где мутантная ДНК присутствует на фоне избытка немутантной ДНК.
Способ определения нуклеотидных последовательностей экзонов генов brca1 и brca2 // 2612894
Изобретение относится к области молекулярной биологии и диагностической медицины. Описан способ определения последовательностей экзонов генов BRCA1 и BRCA2.

Лечение заболеваний, связанных с колониестимулирующим фактором 3 (csf3), путем ингибирования природного антисмыслового транскрипта k csf3 // 2612884
Изобретение относится к биохимии. Описаны модифицированные олигонуклеотиды длиной от 15 до 30 нуклеотидов, содержащие по меньшей мере одну модификацию, причем указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного фрагмента сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Способ детектирования и характеризации токсиногенного штамма clostridium difficile // 2612789
Изобретение относится к биотехнологии. Описан способ детектирования и характеризации токсиногенного штамма Clostridium difficile в пробе, в котором выполняют следующие стадии: a.

Связывающие sdf-1 нуклеиновые кислоты и их применение // 2612388
Изобретение относится к области биотехнологии, конкретно к клеточным технологиям, и может быть использовано в медицине для получения лекарственного средства для лечения рака.

Лечение заболеваний, связанных с геном развития поджелудочной железы, путем ингибирования природного антисмыслового транскрипта к гену развития поджелудочной железы // 2612161
Настоящее изобретение относится к антисмысловым олигонуклеотидам, модулирующим экспрессию гена развития поджелудочной железы, в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами гена развития поджелудочной железы.

Набор синтетических олигонуклеотидов для определения уровней экспрессии гена pdlim4 // 2612139
Изобретение относится к области генной инженерии, конкретно к наборам синтетических олигонуклеотидов, и может быть использовано для определения уровней экспрессии основных изоформ гена PDLIM4.

Лечение заболеваний, связанных с интерферон- связанным регулятором развития 1 (ifrd1), путем ингибирования природного антисмыслового транскрипта к ifrd1 // 2611195
Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Лечение заболеваний, связанных с рнказой н1, путем ингибирования природного антисмыслового транскрипта к рнказе н1 // 2611192
Изобретение относится к биохимии. Описаны олигонуклеотиды, повышающие экспрессию гена РНКазы H1 путем нацеленного контакта с природными антисмысловыми полинуклеотидами РНКазы H1.

Лечение заболеваний, связанных со связывающим половые гормоны глобулином (гспг), путем ингибирования природного антисмыслового транскрипта к гспг // 2611191
Изобретение относится к биохимии. Описаны антисмысловые олигонуклеотиды, модулирующие экспрессию связывающего половые гормоны глобулина (ГСПГ), в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами связывающего половые гормоны глобулина (ГСПГ).

Лечение заболеваний, связанных с геном dlg, путем ингибирования природного антисмыслового транскрипта гена dlg // 2611190
Изобретение относится к биохимии. Описан олигонуклеотид длиной приблизительно от 15 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Лечение заболеваний, связанных с интерферон-регуляторным фактором 8 (irf8), путем ингибирования природного антисмыслового транскрипта к irf8 // 2611187
Настоящее изобретение относится к антисмысловым олигонуклеотидам, модулирующим экспрессию и/или функцию интерферон-регуляторного фактора 8 (IRF8), в частности, путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами интерферон-регуляторного фактора 8 (IRF8).

Лечение заболеваний, связанных с опухолевым белком 63 (р63), путем ингибирования природного антисмыслового транскрипта к р63 // 2611186
Изобретение относится к биохимии. Описаны олигонуклеотиды длиной от 15 до 30 нуклеотидов, содержащие по меньшей мере одну модификацию, причем указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного фрагмента сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Иммуностимулирующие олигонуклеотиды // 2610690
Изобретение относится к области биохимии, в частности к иммуногенной композиции, содержащей антиген и иммуностимулирующий олигонуклеотид, состоящий из нуклеотидной последовательности 5'TCGTCGTTTTTCGGTGCTTTT3', дополнительно содержащей фармацевтически приемлемый носитель.

Лечение заболеваний, связанных с фактором роста фибробластов 21 (fgf21), путем ингибирования природного антисмыслового транскрипта к fgf21 // 2610661
Изобретение относится к биохимии. Описаны олигонуклеотиды, повышающие экспрессию гена фактора роста фибробластов 21 (FGF21), путем нацеленного взаимодействия с природными антисмысловыми полинуклеотидами фактора роста фибробластов 21 (FGF21).
Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых днк-зондов для идентификации рнк энтеровирусов, ротовирусов, вирусов гепатита а и е, аденовирусов, норовирусов и астровирусов из водной среды методом мультиплексной пцр // 2610434
Изобретение относится к наборам олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации генетического материала методом мультиплексной ПЦР.

Лечение заболеваний, связанных с фактором роста гепатоцитов (фрг), посредством ингибирования природного антисмыслового транскрипта к фрг // 2609631
Изобретение относится к биохимии. Описаны олигонуклеотиды, модулирующие экспрессию фактора роста гепатоцитов (ФРГ), в частности, посредством нацеленного взаимодействия с природными антисмысловыми полинуклеотидами фактора роста гепатоцитов (ФРГ).

Подавление экспрессии гена c-kit в клетках нейробластом и лентивирусные конструкции, направляющие синтез shphk, специфичных в отношении данного гена // 2609107
Изобретение относится к области молекулярной биологии. Предложены рекомбинантная генетическая конструкция, клонированная в лентивирусный или ретровирусный вектор по сайтам рестрикции XpaI и XhoI и направленная на подавление экспрессии онкогена C-KIT в клетках нейробластом, и применение указанной конструкции для регуляции активности гена C-KIT и его белкового продукта.

Лечение заболеваний, связанных с пирролин-5 карбоксилатредуктазой 1(pycr1), путем ингибирования природного антисмыслового транскрипта к pycr1 // 2608496
Изобретение относится к биохимии. Описан способ повышения экспрессии полинуклеотида пирролин-5-карбоксилатредуктазы 1(PYCR1) в клетках или тканях пациента in vivo или in vitro, включающий: приведение указанных клеток или тканей в контакт с олигонуклеотидом, в частности с олигонуклеотидом малой интерферирующей РНК (миРНК), составляющим в длину от 20 до 30 нуклеотидов, который специфически гибридизуется с и нацелен на участок природного антисмыслового PYCR1.

Лечение заболеваний, связанных с nanog, путем ингибирования природного антисмыслового транскрипта nanog // 2608493
Изобретение относится к биохимии. Описаны способы повышения экспрессии полинуклеотида NANOG с помощью олигонуклеотидов длиной от 19 до 30 нуклеотидов.

Варианты альбумина // 2607374
Настоящее изобретение относится к области биотехнологии, конкретно к получению вариантов альбумина, у которых изменен период полужизни в плазме по сравнению с исходным альбумином, и может быть использовано в медицине.