Полипептиды, обладающие противомикробным действием, и кодирующие их полинуклеотиды

Для получения устойчивого к микробам растения клетки растения трансформируют вектором, содержащим полинуклеотидную конструкцию, кодирующую полипептид дефензина, имеющий аминокислотную последовательность С-х (3)-С-х (7, 9)-С-С, С-С-(8)-С-х-С и С-х-С-х (8, 11)-С. Полипептид может быть также использован в качестве лекарственного или ветеринарного средства, а также в корме для животных. 14 н. и 9 з.п. ф-лы, 4 табл.

 

ОБЛАСТЬ ТЕХНИКИ

Настоящее изобретение относится к выделенным полипептидам, обладающим противомикробным действием и выделенным полинуклеотидам, кодирующим эти полипептиды. Изобретение также относится к конструкциям нуклеиновых кислот, векторам и клеткам-хозяевам, содержащим полинуклеотиды, а также к способам получения и применения полипептидов.

ПРЕДПОСЫЛКИ СОЗДАНИЯ ИЗОБРЕТЕНИЯ

Задачей настоящего изобретения является разработка полипептидов, обладающих противомикробным действием, и кодирующих их полинуклеотидов.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к полипептидам, обладающим противомикробным действием, которые содержат аминокислотную последовательность, представленную: С-х(3)-С-х(7,9)-С-С; С-С-х(8)-С-х-С; или С-х-С-х(8,11)-С.

В варианте осуществления изобретения полипептиды являются дефензинами.

В еще одном варианте осуществления изобретения полипептиды выбраны из группы, состоящей из:

(а) полипептида, имеющего аминокислотную последовательность, которая имеет по крайней мере 60% идентичности с:

аминокислотами с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислотами с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислотами с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислотами с 1 по 45 из SEQ ID NO:22;

аминокислотами с 1 по 49 из SEQ ID NO:24;

аминокислотами с 1 по 44 из SEQ ID NO:26; или

аминокислотами с 1 по 59 из SEQ ID NO:28.

(b) полипептида, который кодируется нуклеотидной последовательностью, которая гибридизуется при по крайней мере средних условиях с (i)

нуклеотидами от 151 до 297 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

нуклеотидами от 118 до 255 из SEQ ID NO:11, SEQ ID NO:13;

нуклеотидами от 112 до 255 из SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

нуклеотидами от 118 до 252 из SEQ ID NO:21;

нуклеотидами от 151 до 297 из SEQ ID NO:23;

нуклеотидами от 121 до 252 из SEQ ID NO:25; или

нуклеотидами от 145 до 321 из SEQ ID NO:27; или (ii) комплементарной цепью (i); и

(с) варианта, содержащего консервативную замену, делецию и/или вставку одной или более аминокислот из:

аминокислот с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислот с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислот с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислот с 1 по 45 из SEQ ID NO:22;

аминокислот с 1 по 49 из SEQ ID NO:24;

аминокислот с 1 по 44 из SEQ ID NO:26; или

аминокислот с 1 по 59 из SEQ ID NO:28.

Настоящее изобретение также относится к выделенным полинуклеотидам, кодирующим полипептиды, обладающие противомикробным действием, выбранным из группы, состоящей из:

(а) полинуклеотида, кодирующего полипептид, имеющий аминокислотную последовательность, которая имеет по крайней мере 60% идентичности с:

аминокислотами с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислотами с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислотами с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислотами с 1 по 45 из SEQ ID NO:22;

аминокислотами с 1 по 49 из SEQ ID NO:24;

аминокислотами с 1 по 44 из SEQ ID NO:26; или

аминокислотами с 1 по 59 из SEQ ID NO:28.

(b) полинуклеотида, имеющего по крайней мере 60% идентичности с нуклеотидами от 151 до 297 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

нуклеотидами от 118 до 255 из SEQ ID NO: 11, SEQ ID NO:13;

нуклеотидами от 112 до 255 из SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

нуклеотидами от 118 до 252 из SEQ ID NO:21;

нуклеотидами от 151 до 297 из SEQ ID NO:23;

нуклеотидами от 121 до 252 из SEQ ID NO:25; или

нуклеотидами от 145 до 321 из SEQ ID NO:27; и

(с) полинуклеотида, который гибридизуется при по крайней мере среднежестких условиях с (i):

нуклеотидами от 151 до 297 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

нуклеотидами от 118 до 255 из SEQ ID NO:11, SEQ ID NO:13;

нуклеотидами от 112 до 255 из SEQ ID NO:15; SEQ ID NO:17; SEQ ID NO:19;

нуклеотидами от 118 до 252 из SEQ ID NO:21;

нуклеотидами от 151 до 297 из SEQ ID NO:23;

нуклеотидами от 121 до 252 из SEQ ID NO:25; или

нуклеотидами от 145 до 321 из SEQ ID NO:27; или (ii) комплементарной цепью (i).

Настоящее изобретение также относится к конструкциям нуклеиновых кислот, векторам для рекомбинантной экспрессии и рекомбинантным клеткам-хозяевам, содержащим полинуклеотиды.

Настоящее изобретение также относится к способам получения таких полипептидов, обладающих противомикробным действием, содержащим (а) культивирование рекомбинантных клеток-хозяев, содержащих конструкцию нуклеиновой кислоты, содержащую полинуклеотид, кодирующий полипептид, при условиях, способствующих получению полипептида; (b) выделение полипептида.

Настоящее изобретение также относится к способам применения полипептидов и полинуклеотидов по изобретению.

ОПРЕДЕЛЕНИЯ

Противомикробное действие: Термин «противомикробное действие» определен здесь как действие, способное лизировать клетки или ингибировать рост клеток микробов. Применительно к настоящему изобретению термин «противомикробный» означает, что присутствует бактерицидный, и/или бактериостатический, и/или фунгицидный, и/или фунгистатический эффект, и/или вирулицидный эффект, где термин «бактерицидный» следует понимать, как способный лизировать бактериальные клетки. Термин «бактериостатический» следует понимать, как способный ингибировать рост бактерий, т.е. ингибировать рост бактериальных клеток. Термин «фунгицидный» следует понимать, как способный лизировать клетки грибов. Термин «фунгистатический» следует понимать, как способный ингибировать рост грибов, т.е. ингибировать рост клеток грибов. Термин «вирулицидный» следует понимать, как способный инактивировать вирус. Термин «микробные клетки» означает бактериальные или грибные клетки (включая дрожжи).

Применительно к настоящему изобретению термин «ингибирование роста микробных клеток» означает, что клетки находятся в стационарной фазе, т.е. они не способны к размножению.

Для целей настоящего изобретения противомикробное действие может быть определено по методу, описанному Lehrer et al., Journal of Immunological Methods, Vol. 137 (2) p. 167-174 (1991). В качестве альтернативы противомикробное действие может быть определено согласно руководству NCCLS (Национального Комитета по Клиническим и Лабораторным Стандартам) от CLSI (Института Клинических и Лабораторных Стандартов; ранее известного как Национальный Комитет по Клиническим и Лабораторным Стандартам).

Полипептиды, обладающие противомикробным действием, могут быть способны уменьшать количество живых клеток Escherichia coli (DSM 1576) до 1/100 после 8 часов (предпочтительно, после 4 часов, более предпочтительно, после 2 часов, наиболее предпочтительно, после 1 часа, и, в особенности, после 30 минут) инкубации при 20°С в 25% (по весу) водном растворе; предпочтительно, в 10% (по весу) водном растворе; более предпочтительно, в 5% (по весу) водном растворе; еще более предпочтительно, в 1% (по весу) водном растворе; наиболее предпочтительно, в 0,5% (по весу) водном растворе; и, в особенности, в 0,1% (по весу) водном растворе полипептида, обладающего противомикробным действием.

Полипептиды, обладающие противомикробным действием, могут также быть способными ингибировать разрастание Escherichia coli (DSM 1576) в течение 24 часов при 25°С в субстрате для роста микроорганизмов при добавлении в концентрации 1000 ppm (миллионных долей); предпочтительно, при добавлении в концентрации 500 ppm (миллионных долей); более предпочтительно, при добавлении в концентрации 250 ppm; еще более предпочтительно, при добавлении в концентрации 100 ppm; наиболее предпочтительно, при добавлении в концентрации 50 ppm; и, в особенности, при добавлении в концентрации 25 ppm.

Полипептиды, обладающие противомикробным действием, могут являться способными уменьшать число живых клеток Bacillus subtilis (ATCC 6633) до 1/100 после 8 часов (предпочтительно, после 4 часов, более предпочтительно, после 2 часов, наиболее предпочтительно, после 1 часа, и, в особенности, после 30 минут) инкубации при 20°С в 25% (по весу) водном растворе; предпочтительно, в 10% (по весу) водном растворе; более предпочтительно, в 5% (по весу) водном растворе; еще более предпочтительно, в 1% (по весу) водном растворе; наиболее предпочтительно, в 0,5% (по весу) водном растворе; и, в особенности, в 0,1% (по весу) водном растворе полипептида, обладающего противомикробным действием.

Полипептиды, обладающие противомикробным действием, могут также быть способными ингибировать разрастание Bacillus subtilis (ATCC 6633) в течение 24 часов при 25°С в субстрате для роста микроорганизмов при добавлении в концентрации 1000 ppm (миллионных долей); предпочтительно, при добавлении в концентрации 500 ppm; более предпочтительно, при добавлении в концентрации 250 ppm; еще более предпочтительно, при добавлении в концентрации 100 ppm; наиболее предпочтительно, при добавлении в концентрации 50 ppm; и, в особенности, при добавлении в концентрации 25 ppm.

Полипептиды согласно настоящему изобретению обладают по крайней мере 20%, предпочтительно по крайней мере 40%, более предпочтительно, по крайней мере 50%, более предпочтительно, по крайней мере 60%, более предпочтительно, по крайней мере 70%, более предпочтительно, по крайней мере 80%, еще более предпочтительно, по крайней мере 90%, наиболее предпочтительно, по крайней мере 95% и, еще наиболее предпочтительно по крайней мере 100% от противомикробной активности полипептида, состоящего из аминокислотной последовательности, представленной

аминокислотами с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислотами с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислотами с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислотами с 1 по 45 из SEQ ID NO:22;

аминокислотами с 1 по 49 из SEQ ID NO:24;

аминокислотами с 1 по 44 из SEQ ID NO:26; или

аминокислотами с 1 по 59 из SEQ ID NO:28.

Дефензин: Термин «дефензин», используемый здесь, относится к полипептидам, признанными специалистами, как принадлежащими к классу дефензинов противомикробных пептидов. Чтобы определить, является ли полипептид дефензином по изобретению, аминокислотная последовательность, предпочтительно, сравнивается с профайлами скрытой модели маркова (НММ профайлами) базы данных. PFAM посредством применения свободно доступного пакета программ НММЕR (см. Пример 6).

Семейства дефензинов PFAM включают Дефензин_1 или «Дефензин млекопитающих» (номер доступа PF00323), Дефензин_2 или «Дефензин членистоногих» (номер доступа PF01097), Дефензин_бета или «Бета дефензин» (номер доступа PF00711). Дефензин_пропеп или «Дефензиновый пропептид» (номер доступа PF00879) и Гамма-тионин или «Гамма-тиониновое семейство» (номер доступа PF00304).

Дефензины могут принадлежать к классу альфа-дефензинов, классу бета-дефензинов, классу тета-дефензинов, классам дефензинов насекомых или членистоногих или классу растительных дефензинов.

В варианте осуществления изобретения аминокислотная последовательность дефензина по изобретению содержит 4, 5, 6, 7, 8, 9 или 10 остатков цистеина, предпочтительно, 6, 7, 8, 9 или 10 остатков цистеина, более предпочтительно, 6, 8 или 10 остатков цистеина, и, наиболее предпочтительно, 6 или 8 остатков цистеина.

Дефензины могут также являться синтетическими дефензинами, совмещая характерные свойства любого класса дефензинов.

Примеры дефензинов включают, но не ограничены этим, α-Дефензин HNP-1 (пептид нейтрофилов человека), HNP-2 и HNP-3; β-Дефензин-12, Дрозомицин, Хелиомицин, γ1-пуротионин, Дефензин А насекомых и дефензины, раскрытые в РСТ заявках WO 99/53053, WO 02/06324, WO 02/085934, WO 03/044049, PCT/DK2005/000725 и PCT/DK2005/000735.

Выделенный полипептид: Термин «выделенный полипептид», используемый здесь, относится к полипептиду, который обладает по крайней мере 20% чистотой, предпочтительно, по крайней мере 40% чистотой, более предпочтительно, по крайней мере 60% чистотой, еще более предпочтительно, по крайней мере 80% чистотой, наиболее предпочтительно, по крайней мере 90% чистотой и, еще наиболее предпочтительно, по крайней мере 95% чистотой, определенной посредством ДСН-ПААГ.

Практически чистый полипептид: Термин «практически чистый полипептид» означает здесь полипептидный препарат, который содержит самое большее 10%, предпочтительно, самое большее 8%, более предпочтительно, самое большее 6%, более предпочтительно, самое большее 5%, более предпочтительно, самое большее 4%, самое большее 3%, еще более предпочтительно, самое большее 2%, наиболее предпочтительно, самое большее 1% и, еще более предпочтительно, самое большее, 0,5% по весу другого полипептидного материала, с которым он связан неочищенным. Таким образом, предпочтительным является, что практически чистый полипептид имеет по крайней мере 92% чистоты, предпочтительно, по крайней мере 94% чистоты, более предпочтительно, по крайней мере 95% чистоты, более предпочтительно, по крайней мере 96% чистоты, более предпочтительно, по крайней мере 97% чистоты, более предпочтительно, по крайней мере 98% чистоты, еще более предпочтительно, по крайней мере 99% чистоты, наиболее предпочтительно, по крайней мере 99,5% чистоты и, еще более предпочтительно, по крайней мере 100% чистоты по весу от общего полипептидного материала, присутствующего в препарате.

Полипептиды согласно настоящему изобретению находятся, предпочтительно, в практически чистом виде. В частности, предпочтительно, чтобы полипептиды находились в преимущественно чистом виде, т.е., чтобы полипептидный препарат являлся преимущественно свободным от другого полипептидного материала, с которым он связан неочищенным. Это можно достичь, например, посредством получения полипептида широко известными рекомбинантными способами или классическими способами очистки.

Здесь, термин, «практически чистый полипептид» является синонимом терминам «выделенный полипептид» иди «полипептид в выделенном виде».

Идентичность: Родство между двумя аминокислотными последовательностями или между двумя нуклеотидными последовательностями описывается параметром «идентичность».

Для целей настоящего изобретения степень идентичности между двумя аминокислотными последовательностями определяется посредством использования программы FASTA, включенной в версию 2,0х пакета программ FASTA (см. W. R. Pearson and D. J. Lipman (1988), "Improved Tools for Biological Sequence Analysis", PNAS 85:2444-2448; и W. R. Pearson (1990) "Rapid and Sensitive Sequence Comparison with FASTP and FASTA", Methods in Enzymology 183:63-98). Используемой матрицей весов была BLOSUM50, штраф на пропуск был -12 и штраф на продолжение разрыва был -2.

Степень идентичности между двумя нуклеотидными последовательностями определяли, используя тот же алгоритм и пакет программ, описанный выше. Используемой матрицей весов была матрица сходства, штраф на пропуск был -16 и штраф на продолжение разрыва был -4.

В качестве альтернативы, выравнивание двух аминокислотных последовательностей определяли посредством использования программы Needle из пакета EМBOSS (http://emboss.org) version 2.8.0. Программа Needle выполняет общий алгоритм выравнивания, описанный в Needleman, S. B. and Wunsch, C. D. (1970) J. MoI. Biol. 48, 443-453. Используемой матрицей подстановки является BLOSUM62, штраф на первую аминокислоту разрыва равен 10 и штраф на продолжение разрыва равен 0,5.

Степень идентичности между аминокислотной последовательностью настоящего изобретения («последовательностью изобретения»; например, аминокислотами от 1 до 49 из SEQ ID NO:2) и отличающейся аминокислотной последовательностью («чужеродной последовательностью») подсчитывается как число точных совпадений в перекрытии выравнивания двух последовательностей, разделенное на длину «последовательности изобретения» или длину «чужеродной последовательности», любую самую короткую. Результат представлен в процентах идентичности.

Полное совпадение случается, когда «последовательность изобретения» или «чужеродная последовательность» имеют идентичные аминокислотные остатки в одинаковых положениях перекрывания. Длина последовательности является числом аминокислотных остатков в последовательности (например, длина аминокислот с 1 по 49 из SEQ ID NO:2 равна 49).

Полипептидный фрагмент: Термин «полипептидный фрагмент» определен здесь как полипептид, имеющий одну или более аминокислот, удаленных с амино и/или карбокси конца SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28, или последовательностей, гомологичных им, где фрагмент обладает противомикробным действием.

Субпоследовательность: Термин «субпоследовательность» определен здесь как нуклеотидная последовательность, имеющая один или более нуклеотидов, удаленных с 5' и/или 3' конца SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27 или последовательностей, гомологичных им, где субпоследовательность кодирует полипептидный фрагмент, обладающий противомикробным действием.

Аллельный вариант: Термин «аллельный вариант» обозначает здесь любую из двух или более альтернативных форм гена, занимающих одинаковый хромосомный локус. Аллельное разнообразие возникает в природе через мутации и может приводить к полиморфизму внутри популяций. Мутации генов могут быть молчащими (нет замен в кодируемом полипептиде) или могут кодировать полипептиды, имеющие измененные аминокислотные последовательности. Аллельный вариант полипептида является полипептидом, кодируемым аллельным вариантом гена.

Практически чистый полинуклеотид: Термин «практически чистый полинуклеотид», используемый здесь, относится к препарату полинуклеотида, свободному от других внешних или нежелательных нуклеотидов и в виде, подходящем для использования в системах получения созданных методами генетической инженерии белков. Поэтому, практически чистый нуклеотид содержит, самое большее 10%, предпочтительно, самое большее, 8%, более предпочтительно, самое большее 6%, более предпочтительно, самое большее 5%, более предпочтительно, самое большее 4%, более предпочтительно, самое большее 3%, еще более предпочтительно, самое большее 2%, наиболее предпочтительно, самое большее 1% и, еще более предпочтительно, самое большее, 0,5% по весу другого полинуклеотидного материала, с которым он связан неочищенным. Практически чистый полинуклеотид может, однако, включать естественные 5' и 3' нетранслируемые области, такие как промоторы и терминаторы. Предпочтительным является, что практически чистый полинуклеотид имеет по крайней мере 90% чистоты, предпочтительно, по крайней мере 92% чистоты, более предпочтительно, по крайней мере 94% чистоты, более предпочтительно, по крайней мере 95% чистоты, более предпочтительно, по крайней мере 96% чистоты, более предпочтительно, по крайней мере 97% чистоты, еще более предпочтительно, по крайней мере 98% чистоты, наиболее предпочтительно по крайней мере 99% чистоты и, еще наиболее предпочтительно, по крайней мере 99,5% чистоты по весу. Полинуклеотиды согласно настоящему изобретению находятся предпочтительно в практически чистом виде. В частности, предпочтительно, чтобы полинуклеотиды, раскрытые здесь, находились в «преимущественно чистом виде», т.е. чтобы полинуклеотидный препарат являлся преимущественно свободным от другого полинуклеотидного материала, с которым он связан неочищенным. Здесь термин «практически чистый полинуклеотид» является синонимом терминам «выделенный полинуклеотид» или «полинуклеотид в выделенном виде». Полинуклеотиды могут быть геномного, кДНК, РНК, полусинтетического, синтетического происхождения или любой их комбинацией.

кДНК: Термин «кДНК» определен здесь как молекула ДНК, которая может быть получена путем обратной транскрипции из зрелой сплайсированной мРНК молекулы, полученной из эукариотической клетки. В кДНК отсутствуют интронные последовательности, которые обычно присутствуют в соответствующей геномной ДНК. Начальный первичный РНК-транскрипт является предшественником мРНК, который процессируется посредством серии этапов перед появлением в качестве зрелой сплайсированной мРНК. Эти этапы включают удаление интронных последовательностей посредством процесса, называемого сплайсингом. кДНК, производное от мРНК, не имеет, таким образом, никаких интронных последовательностей.

Конструкция нуклеиновой кислоты: Термин «конструкция нуклеиновой кислоты», используемый здесь, относится к молекуле нуклеиновой кислоты, одно- или двух-цепочечной, которая выделена из встречающегося в природе гена, или которая является модифицированной для содержания сегментов нуклеиновых кислот так, что иным образом не существовала бы в природе. Термин конструкция нуклеиновой кислоты является синонимом термину «экспрессионная кассета», когда конструкция нуклеиновой кислоты содержит контролирующие последовательности, требующиеся для экспрессии кодирующей последовательности согласно настоящему изобретению.

Контролирующая последовательность: Термин «контролирующая последовательность» определен здесь как включающий все компоненты, которые являются необходимыми или преимущественными для экспрессии полинуклеотида, кодирующего полипептид согласно настоящему изобретению. Каждая управляющая последовательность может быть своей или чужеродной для нуклеотидной последовательности, кодирующей полипептид. Такие контролирующие последовательности включают, но не ограничены этим, лидер, последовательность полиаденилирования, последовательность пропептида, промотор, сигнальную пептидную последовательность и терминатор транскрипции. Самое меньшее управляющие последовательности включают промотор и транскрипционные и трансляционные стоп-сигналы. Контролирующие последовательности могут быть предоставлены с линкерами для цели введения особых сайтов рестрикции, облегчающих лигирование управляющих последовательностей с кодирующей областью нуклеотидной последовательности, кодирующей полипептид.

Функционально присоединенный: Термин «функционально присоединенный» означает здесь конфигурацию, в которой управляющая последовательность помещена в соответствующее положение, относительно кодирующей последовательности полипептидной последовательности так, что управляющая последовательность управляет экспрессией кодирующей последовательности полипептида.

Кодирующая последовательность: При использовании здесь термин «кодирующая последовательность» означает нуклеотидную последовательность, которая прямо определяет аминокислотную последовательность ее белкового продукта. Границы кодирующей последовательности обычно определены открытой рамкой считывания, которая обычно начинается с ATG старт-кодона или альтернативных старт-кодонов, таких как GTG или TTG. Кодирующая последовательность может быть ДНК, кДНК или рекомбинантной нуклеотидной последовательностью.

Экспрессия: Термин «экспрессия» включает любой этап, вовлеченный в получение полипептида, включая, но не ограничиваясь этим, транскрипцию, пост-транскрипционные модификации, трансляцию, пост-трансляционные модификации и секрецию.

Экспрессионный вектор: Термин «экспрессионный вектор» определен здесь как линейная или кольцевая молекула ДНК, которая содержит полинуклеотид, кодирующий полипептид изобретения, и который функционально присоединен к дополнительным нуклеотидам, которые обеспечивают его экспрессию.

Клетка-хозяин: Термин «клетка-хозяин», используемый здесь, включает любой тип клеток, который является восприимчивым к трансформации, трансфекции, трансдукции и им подобным конструкцией нуклеиновой кислоты, содержащей полинуклеотид настоящего изобретения.

Модификация: Термин «модификация» означает здесь любую химическую модификацию полипептида, состоящего из

аминокислот с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислот с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислот с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислот с 1 по 45 из SEQ ID NO:22;

аминокислот с 1 по 49 из SEQ ID NO:24;

аминокислот с 1 по 44 из SEQ ID NO:26; или

аминокислот с 1 по 59 из SEQ ID NO:28; а также генетические манипуляции с ДНК, кодирующей этот полипептид. Модификация(и) может(гут) быть заменой(ами), делецией(ями) и/или вставкой(ами) аминокислот(ы), а также заменой(ами) в боковой(ых) цепи(ях) аминокислот; или использованием неприродных аминокислот с похожими характеристиками в аминокислотной последовательности. В частности, модификация(ии) может(гут) быть образованием амидной связи, таким как образование амидной связи на С-конце.

Искусственный вариант: При использовании здесь термин «искусственный вариант» означает полипептид, обладающий противомикробным действием, полученный с помощью организма, экспрессирующего модифицированную нуклеотидную последовательность из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27. Модифицированную нуклеотидную последовательность получают посредством вмешательства человека посредством модификации нуклеотидной последовательности, раскрытой в SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

ПОЛИПЕПТИДЫ, ОБЛАДАЮЩИЕ ПРОТИВОМИКРОБНЫМ ДЕЙСТВИЕМ

В первом аспекте, изобретение относится к полипептидам, обладающим противомикробным действием, которые содержат аминокислотную последовательность, представленную: С-х(3)-С-х(7,9)-С-С; С-С-х(8)-С-х-С; или С-х-С-х(8,11)-С.

В варианте осуществления изобретения полипептиды содержат аминокислотную последовательность, представленную:

C-x(3)-C-x(7,9)-C-C и C-C-x(8)-C-x-C; или

C-C-x(8)-C-x-C и C-x-C-x(8,11)-C; или

C-x(3)-C-x(7,9)-C-C и C-x-C-x(8,11)-C; или

C-x(3)-C-x(7,9)-C-C и C-C-x(8)-C-x-C и C-x-C-x(8,11 )-C.

Консенсусы C-x(3)-C-x(7,9)-C-C; C-C-x(8)-C-x-C и C-x-C-x(8,11)-C следует интерпретировать, используя PROSITE (www.expasy.org/prosite/) формат определения консенсусов:

- для аминокислот использован стандартный однобуквенный код IUPAC;

- символ «х» использован для положения, где разрешена любая аминокислота;

- каждый элемент в образце отделен от соседнего посредством «-»; и

- повтор элемента в консенсусе указан посредством следующих за элементом численной величины или численного диапазона в скобках. Например: х(3) соответствует х-х-х, х(2,4) соответствует х-х или х-х-х или х-х-х-х.

Для большей информации по применению принципа PROSITE, обращайтесь Sigrist et al. PROSITE: a documented database using patterns and profiles as motif descriptors. Brief Bioinform. 3:265-274 (2002).

Во втором аспекте, который может быть вариантом осуществления первого аспекта, изобретение относится к полипептидам, содержащим аминокислотную последовательность, которая имеет степень идентичности с аминокислотами с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислотами с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислотами с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислотами с 1 по 45 из SEQ ID NO:22;

аминокислотами с 1 по 49 из SEQ ID NO:24;

аминокислотами с 1 по 44 из SEQ ID NO:26; или

аминокислотами с 1 по 59 из SEQ ID NO:28 (т.е. зрелыми полипептидами) по крайней мере 60%, предпочтительно, по крайней мере 65%, более предпочтительно, по крайней мере 70%, более предпочтительно, по крайней мере 75%, более предпочтительно, по крайней мере 80%, более предпочтительно по крайней мере 85%, еще более предпочтительно, по крайней мере 90%, наиболее предпочтительно, по крайней мере 95% и, еще наиболее предпочтительно, по крайней мере 97%, которые обладают противомикробным действием (ниже «гомологичные полипептиды»). В предпочтительном аспекте гомологичные полипептиды имеют аминокислотную последовательность, которая отличается десятью аминокислотами, предпочтительно, пятью аминокислотами, более предпочтительно, четырьмя аминокислотами, еще более предпочтительно, тремя аминокислотами, наиболее предпочтительно, двумя аминокислотами и, еще более предпочтительно, одной аминокислотой от аминокислот с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислот с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислот с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислот с 1 по 45 из SEQ ID NO:22;

аминокислот с 1 по 49 из SEQ ID NO:24;

аминокислот с 1 по 44 из SEQ ID NO:26; или

аминокислот с 1 по 59 из SEQ ID NO:28.

Полипептид настоящего изобретения предпочтительно содержит аминокислотную последовательность из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28, или аллельный их вариант; или их фрагмент, который обладает противомикробным действием. В предпочтительном аспекте полипептид содержит аминокислотную последовательность из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28. В другом предпочтительном аспекте полипептид содержит аминокислоты с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислоты с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислоты с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислоты с 1 по 45 из SEQ ID NO:22;

аминокислоты с 1 по 49 из SEQ ID NO:24;

аминокислоты с 1 по 44 из SEQ ID NO:26; или

аминокислоты с 1 по 59 из SEQ ID NO:28, или их аллельный вариант; или их фрагмент, который обладает противомикробным действием. В еще одном предпочтительном аспекте полипептид содержит аминокислоты с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислоты с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислоты с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислоты с 1 по 45 из SEQ ID NO:22;

аминокислоты с 1 по 49 из SEQ ID NO:24;

аминокислоты с 1 по 44 из SEQ ID NO:26; или

аминокислоты с 1 по 59 из SEQ ID NO:28.

В еще одном предпочтительном аспекте полипептид состоит из аминокислотной последовательности из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28, или их аллельного варианта; или их фрагмента, который обладает противомикробным действием. В еще одном предпочтительном аспекте полипептид состоит из аминокислотной последовательности из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28. В еще одном предпочтительном аспекте полипептид состоит из аминокислот с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислот с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислот с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислот с 1 по 45 из SEQ ID NO:22;

аминокислот с 1 по 49 из SEQ ID NO:24;

аминокислот с 1 по 44 из SEQ ID NO:26; или

аминокислот с 1 по 59 из SEQ ID NO:28 или их аллельного варианта; или их фрагмента, который обладает противомикробным действием. В еще одном предпочтительном аспекте полипептид состоит из аминокислот с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислот с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислот с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислот с 1 по 45 из SEQ ID NO:22;

аминокислот с 1 по 49 из SEQ ID NO:24;

аминокислот с 1 по 44 из SEQ ID NO:26; или

аминокислот с 1 по 59 из SEQ ID NO:28.

Во втором аспекте настоящее изобретение относится к выделенным полипептидам, обладающим противомикробным действием, которые кодируются полинуклеотидами, гибридизующимися при очень мягких условиях, предпочтительно, мягких условиях, более предпочтительно, средних условиях, более предпочтительно, средне-жестких условиях, еще более предпочтительно, жестких условиях и, наиболее предпочтительно, очень жестких условиях с (i) нуклеотидами от 151 до 297 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

нуклеотидами от 118 до 255 из SEQ ID NO:11, SEQ ID NO:13;

нуклеотидами от 112 до 255 из SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

нуклеотидами от 118 до 252 из SEQ ID NO:21;

нуклеотидами от 151 до 297 из SEQ ID NO:23;

нуклеотидами от 121 до 252 из SEQ ID NO:25; или

нуклеотидами от 145 до 321 из SEQ ID NO:27;

(ii) последовательностью кДНК, содержащейся в нуклеотидах от 1 до 297 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

нуклеотидах от 1 до 255 из SEQ ID NO:11, SEQ ID NO:13;

нуклеотидах от 1 до 255 из SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

нуклеотидах от 1 до 252 из SEQ ID NO:21;

нуклеотидах от 1 до 297 из SEQ ID NO:23;

нуклеотидах от 1 до 252 из SEQ ID NO:25; или

нуклеотидах от 1 до 321 из SEQ ID NO:27;

(iii) субпоследовательностью из (i) или (ii), или (iv) комплементарной цепью (i), (ii) или (iii) (J. Sambrook, E.F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York). Субпоследовательность из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27 содержит по крайней мере 100 сопряженных нуклеотидов, или, предпочтительно, 200 сопряженных нуклеотидов. Кроме того, субпоследовательность может кодировать полипептидный фрагмент, который обладает противомикробным действием.

Нуклеотидные последовательности из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27 или их субпоследовательности, а также аминокислотные последовательности из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28, или их фрагменты могут быть использованы для создания зонда нуклеиновой кислоты для обнаружения и клонирования ДНК, кодирующей полипептиды, обладающие противомикробным действием, из штаммов различных родов или видов по способам, хорошо известным в данной области. В частности, такие пробы могут быть использованы для гибридизации с геномной или кДНК интересующего рода или вида, следуя стандартной методике Саузерн блоттинга, для обнаружения или выделения соответствующего гена в ней. Такие зонды могут быть значительно короче, чем полная последовательность, но должны иметь по крайней мере 14, предпочтительно, по крайней мере 25, более предпочтительно по крайней мере 35 и, наиболее предпочтительно по крайней мере 75 нуклеотидов в длину. Однако предпочтительным является, чтобы зонд нуклеиновой кислоты имел по крайней мере 100 нуклеотидов в длину. Например, зонд нуклеиновой кислоты может иметь по крайней мере 200 нуклеотидов, предпочтительно по крайней мере 250 нуклеотидов. Могут быть использованы как ДНК, так и РНК зонды. Зонды обычно метят для детекции соответствующего гена (например, 32Р, 3Н, 35S, биотином или авидином). Такие зонды являются охваченными настоящим изобретением.

Библиотеки геномной ДНК или кДНК, приготовленные из таких организмов, могут, таким образом, быть скринированы на ДНК, которая гибридизуется с пробами, описанными выше, и которая кодирует полипептид, обладающий противомикробным действием. Геномная или другая ДНК из таких других организмов могут быть разделены электрофорезом в агарозном или полиакриламидном геле, или другими методами разделения. ДНК из библиотек или выделенная ДНК могут быть перенесены и иммобилизованы на нитроцеллюлозе или другом подходящем материале-носителе. Для обнаружения клона или ДНК, которые гомологичны с SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27, или их субпоследовательностью материал-носитель используется в Саузерн-блоте.

Для целей настоящего изобретения гибридизация показывает, что нуклеотидная последовательность гибридизуется с меченным зондом нуклеиновой кислоты, соответствующей нуклеотидной последовательности, показанной в SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27, ее комплементарной последовательности, или ее субпоследовательности при очень мягких до очень жестких условиях гибридизации. Молекулы, с которыми гибридизуется зонд нуклеиновой кислоты, могут быть обнаружены, используя рентгеновскую пленку.

В предпочтительном аспекте зонд нуклеиновой кислоты является полинуклеотидной последовательностью, которая кодирует полипептиды из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28, или их субпоследовательности. В другом предпочтительном аспекте зонд нуклеиновой кислоты является SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27. В другом предпочтительном аспекте зонд нуклеиновой кислоты является областью, кодирующей зрелый полипептид, из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27.

Для длинных зондов длиной по крайней мере 100 нуклеотидов определены условия гибридизации от очень мягких до очень жестких как предгибридизация и гибридизация при 42°С в 5X SSPE, 0,3% SDS, 200 мкг/мл разрушенной и денатурированной ДНК из спермы лосося, и в или 25% формамиде для очень мягких или мягких условий, или 35% формамиде для средних или среднежестких условий, или 50% формамиде для жестких или очень жестких условий, следуя стандартной методике Саузерн блоттинга, оптимально, в течение от 12 до 24 часов.

Для длинных зондов длиной по крайней мере 100 нуклеотидов материал-носитель в конце промывают три раза, каждый по 15 минут, используя 2Х SSC, 0,2% SDS, предпочтительно, по крайней мере при 45°С (очень мягкая отмывка), более предпочтительно, по крайней мере при 50°С (мягкая отмывка), более предпочтительно, по крайней мере при 55°С (средняя отмывка), более предпочтительно, по крайней мере при 60°С (среднежесткая отмывка), еще более предпочтительно, по крайней мере при 65°С (жесткая отмывка) и, наиболее предпочтительно, по крайней мере при 70°С (очень жесткая отмывка).

Для коротких зондов, которые имеют, примерно, от 15 нуклеотидов до, примерно, 70 нуклеотидов в длину, жесткость условий определена как предгибридазация, гибридизация и отмывка после гибридизации при, примерно, 5°С до, примерно, 10°С ниже расчетной Тm (температуры плавления), используя расчет по Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) в 0,9 M NaCI, 0,09 M Tris-HCI pH 7,6, 6 мM EDTA, 0,5% NP-40, 1X растворе Денхарта, 1 мМ пирофосфата натрия, 1 мМ фосфата натрия одноосновного, 0,1 мМ АТР и 0,2 мг РНК из дрожжей на мл, следуя стандартной методике Саузерн блоттинга.

Для коротких зондов, которые имеют, примерно, от 15 нуклеотидов до, примерно, 70 нуклеотидов в длину, материал-носитель промывают однократно в 6Х SSC плюс 0,1% SDS в течение 15 минут и дважды по 15 минут каждый, используя 6Х SSC при 5°С до 10°С ниже расчетной Тm.

В третьем аспекте настоящее изобретение относится к искусственным вариантам, содержащим консервативную замену, делецию и/или вставку одной или нескольких аминокислот в SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28, или в их зрелых полипептидах. Предпочтительно, чтобы аминокислотные замены являлись незначительными, то есть консервативными аминокислотными заменами или вставками, которые не влияют существенно на сворачивание и/или активность белка; небольшими делециями, обычно от одной до, примерно, 30 аминокислот; небольшими удлинениями амино- или карбокси-концов, такими как метиониновое основание; небольшим линкерным пептидом до, примерно, 20-25 оснований; или небольшим удлинением, которое облегчает очистку посредством изменения общего заряда или другой функции, такой как полигистидиновый участок, антигенный эпитоп или связывающий домен.

Примеры консервативных замен находятся в пределах группы основных аминокислот (аргинин, лизин и гистидин), кислых аминокислот (глутаминовая кислота и аспарагиновая кислота), полярных аминокислот (глутамин и аспарагин), гидрофобных аминокислот (лейцин, изолейцин и валин), ароматических аминокислот (фенилаланин, триптофан и тирозин) и малых аминокислот (глицин, аланин, серин, треонин и метионин). Аминокислотные замены, которые, обычно, не меняют конкретную активность, являются известными в данной области и описаны, например H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. Наиболее распространенными заменами являются Ala/Ser, Val/lle, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lle, Leu/Val, Ala/Glu и Asp/Gly.

В дополнение к 20 стандартным аминокислотам, нестандартные аминокислоты (такие как 4-гидрокси-пролин, 6-N-метил-лизин, 2-амноизобутировая кислота, изовалин и альфа-метил-серин) могут являться заменой для аминокислотных остатков полипептида дикого типа. Ограниченное число не консервативных аминокислот, аминокислот, которые не кодируются генетическим кодом, и неприродных аминокислот могут использоваться вместо аминокислотных остатков. «Неприродные аминокислоты» были модифицированы после синтеза белка и/или имеют химическую структуру в своих боковых цепях, отличную от нее в обычных аминокислотах. Неприродные аминокислоты могут быть химически синтезированными и, предпочтительно, доступными в продаже, и включают пипеколиновую кислоту, тиазолидинкарбоновую кислоту, дегидропролин, 3- и 4-метилпролин и 3,3-диметилпролин.

В качестве альтернативы аминокислотные замены представляют вещества с измененными физико-химическими свойствами. Например, аминокислотные замены могут улучшить термическую стабильность полипептида, изменить субстратную специфичность, поменять оптимум рН и подобное им.

Незаменимые аминокислоты в родительском полипептиде могут быть идентифицированы по методикам, известным в науке, таким как сайт-направленный мутагенез или аланин-сканирующий мутагенез (Cunningham and Wells, 1989, Science 244: 1081-1085). В последней методике одиночные аланиновые мутации вставляются в каждый остаток в молекуле и получающиеся мутантные молекулы тестируются на биологическую активность (т.е., противомикробное действие), чтобы обнаружить аминокислотные остатки, которые являются критическими для активности молекулы. См. также Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. Активный участок фермента или другое биологическое взаимодействие может также быть определен посредством физического анализа структуры, которая определяется такими методиками, как ядерный магнитный резонанс, кристаллография, электронная дифракция или фотоаффинное мечение в сочетании с мутацией аминокислот возможного участка контакта. См., например, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. MoI. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309:59-64. Заключение об идентификации незаменимых аминокислот может также быть сделано из анализа тождественности с полипептидами, которые связаны с полипептидами по изобретению.

Одиночные или множественные аминокислотные замены могут быть сделаны и протестированы с использованием известных способов мутагеназа, рекомбинации и/или перестановки с последующей процедурой соответствующего скрининга, такого как те, что раскрыты в Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; или WO 95/22625. Другие способы, которые могут быть использованы, включают ошибочно-направленную ошибкам ПЦР, фаговый дисплей (e.g., Lowman et al., 1991, Biochem. 30:10832-10837; патент США № 5223409; WO 92/06204) и область-направленный мутагенез (Derbyshire et al., 1986, Gene 46:145; Ner et al., 1988, DNA 7:127).

Способы мутагенеза/перетасовки могут быть совмещены со способами высокопроизводительного автоматизированного скрининга для обнаружения активности клонированных мутантных полипептидов, экспрессированных в клетках-хозяевах. Мутированные молекулы ДНК, которые кодируют активные полипептиды, могут быть выделены из клеток-хозяев и быстро секвенированы, используя стандартные способы в данной области. Эти способы позволяют быстро определить важность индивидуальных аминокислотных остатков в интересующем полипептиде и могут быть применены к полипептидам с неизвестной структурой.

Общее число аминокислотных замен, делеций и/или вставок

в аминокислотах с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислотах с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислотах с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислотах с 1 по 45 из SEQ ID NO:22;

аминокислотах с 1 по 49 из SEQ ID NO:24;

аминокислотах с 1 по 44 из SEQ ID NO:26; или

аминокислотах с 1 по 59 из SEQ ID NO:28 равно 10, предпочтительно, 9, более предпочтительно, 8, более предпочтительно, 7, более предпочтительно, самое большее, 6, более предпочтительно, самое большее, 5, более предпочтительно, 4, еще более предпочтительно, 3, наиболее предпочтительно, 2 и, еще наиболее предпочтительно, 1.

В предпочтительном варианте осуществления изобретения полипептиды по изобретению являются полипептидами дефензинов.

N-концевое продолжение

N-концевое продолжение полипептидов по изобретению может соответственно составлять от 1 до 50 аминокислот, предпочтительно, от 2 до 20 аминокислот, особенно, от 3 до 15 аминокислот. В одном варианте осуществления изобретения N-концевое пептидное продолжение не содержит Arg (R). В другом варианте осуществления изобретения N-концевое продолжение содержит kex2 или kex2-подобные сайты расщепления, определенные далее ниже. В предпочтительном варианте осуществления изобретения N-концевое продолжение является пептидом, содержащим по крайней мере два Glu (Е) и/или Asp (D) аминокислотные остатки, такое как N-концевое продолжение, содержащее одну из следующих последовательностей: ЕАЕ, ЕЕ, DE и DD.

Сайты kex2

Сайты kex2 (см., например, Methods in Enzymology VoI 185, ed. D. Goeddel, Academic Press Inc. (1990), San Diego, CA, "Gene Expression Technology") и kex2-подобные сайты являются двухосновными сайтами узнавания (т.е., сайтами расщепления), найденными между кодирующей пропептид областью и областью зрелого пептида в некоторых белках.

В некоторых случаях было показано, что вставка kex2 или kex2-подобного сайта улучшает правильный процессинг эндопептидазой в сайте ращепления пропептида, приводя к увеличению уровня секреции белка.

В контексте изобретения вставка kex2 или kex2-подобных сайтов приводит к возможности получить расщепление в определенном положении в N-концевом продолжении, приводя к удлиненному противомикробному пептиду по сравнению со зрелым полипептидом, показанном в аминокислотах с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислотах с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислотах с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислотах с 1 по 45 из SEQ ID NO:22;

аминокислотах с 1 по 49 из SEQ ID NO:24;

аминокислотах с 1 по 44 из SEQ ID NO:26; или

аминокислотах с 1 по 59 из SEQ ID NO:28.

Слитые полипептиды

Полипептиды согласно настоящему изобретению также включают слитые полипептиды или расщепляемые слитые полипептиды, в которых другой полипептид является соединенным с N-концом или С-концом полипептида изобретения или его фрагментом. Слитый полипептид получают посредством слияния нуклеотидной последовательности (или ее части), кодирующей другой полипептид, с нуклеотидной последовательностью (или ее частью) настоящего изобретения. Методики для получения слитых полипептидов известны в науке и включают лигирование кодирующих последовательностей, кодирующих полипептиды, таким образом, что они находятся в рамке и, что экспрессия слитого полипептида находится под контролем тех же промотора(ов) и терминатора.

Источники полипептидов, обладающих противомикробным действием

Полипептиды согласно настоящему изобретению могут быть получены из микроорганизмов любого рода. Для целей настоящего изобретения, термин «получен из», используемый здесь, в связи с данным источником должен означать, что полипептид, кодируемый нуклеотидной последовательностью, продуцирован этим источником или штаммом, в который была встроена нуклеотидная последовательность из источника. В предпочтительном аспекте, полипептид, полученный из данного источника, секретируется вне клетки.

Полипептид согласно настоящему изобретению может быть бактериальным полипептидом. Например, полипептид может быть из грамположительных бактерий, таким как полипептид из Bacillus, например, полипептидом из Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis или Bacillus thuringiensis; или полипептид из Streptomyces, например, полипептид из Streptomyces lividans или Streptomyces murinus; или полипептид из грамотрицательных бактерий, например, полипептид из E. coli или Pseudomonas sp..

Полипептид согласно настоящему изобретению может быть также грибковым полипептидом и, более предпочтительно, дрожжевым полипептидом, таким как полипептид из Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces или Yarrowia; или, более предпочтительно, полипептидом из филаментных грибов, такой как полипептид из Acremonium, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium или Trichoderma.

В предпочтительном аспекте полипептид является полипептидом из Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis или Saccharomyces oviformis, обладающим противомикробным действием.

В другом предпочтительном аспекте полипептид является полипептидом из Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei или Trichoderma viride.

В другом предпочтительном аспекте полипептид является полипептидом из Arenicola marina, например, полипептидом из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28.

Будет понятно, что для вышеупомянутых видов изобретение охватывает как совершенные, так и несовершенные стадии и другие таксономические эквиваленты, например, анаморфы, независимо от названия вида, под которым они известны. Специалисты легко распознают тождественность соответствующих эквивалентов.

Штаммы этих видов легко общедоступны в ряде коллекций культур, таких как American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS) и Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).

Кроме того, такие полипептиды могут быть обнаружены и получены из других источников, включая микроорганизмы, выделенные из природы (например, почвы, компоста, воды и т.п.), используя вышеупомянутые пробы. Методики для выделения микроорганизмов из естественных мест обитания хорошо известны в науке. Полинуклеотид может затем быть получен посредством простого скрининга геномной или кДНК библиотеки другого микроорганизма. Как только полинуклеотидная последовательность, кодирующая полипептид, обнаружена зондом (ами), полинуклеотид можно выделить или клонировать, используя методики, которые хорошо известны специалисту в данной области (см., например, Sambrook et al., 1989, supra).

Полипептиды согласно настоящему изобретению также включают слитые полипептиды или расщепляемые полипептидные фьюжны, в которых другой полипептид слит с N-концом или С-концом полипептида или его фрагмента. Слитый полипептид получают путем слияния нуклеотидной последовательности (или ее части), кодирующей другой полипептид с нуклеотидной последовательностью (или ее фрагментом) согласно настоящему изобретению. Методики для получения полипептидных фьюжнов являются известными в науке и включают лигирование кодирующих последовательностей, кодирующих полипептиды таким образом, чтобы они находились в рамке и чтобы экспрессия слитого полипептида находилась под контролем тех же промотора(ов) и терминатора.

Полинуклеотиды

Настоящее изобретение также относится к выделенным полинуклеотидам, имеющим нуклеотидную последовательность, которая кодирует полипептид согласно настоящему изобретению. В предпочтительном аспекте нуклеотидная последовательность установлена в SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27. В другом предпочтительном аспекте нуклеотидная последовательность является областью, кодирующей зрелый полипептид из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27. Настоящее изобретение также охватывает нуклеотидные последовательности, которые кодируют полипептид, имеющий аминокислотную последовательность из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28, или их зрелых пептидов, которые отличаются от SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27 благодаря вырожденности генетического кода. Настоящее изобретение также относится к субпоследовательностям из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27, которые кодируют фрагменты из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28, обладающие противомикробным действием.

Настоящее изобретение также относится к мутантным полинуклеотидам, содержащим по крайней мере одну мутацию в последовательности, кодирующей зрелый полипептид, из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27, в которых мутантная нуклеотидная последовательность кодирует полипептид, состоящий из

аминокислот с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислот с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислот с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислот с 1 по 45 из SEQ ID NO:22;

аминокислот с 1 по 49 из SEQ ID NO:24;

аминокислот с 1 по 44 из SEQ ID NO:26; или

аминокислот с 1 по 59 из SEQ ID NO:28.

Методики, используемые для выделения или клонирования полинуклеотида, кодирующего полипептид, известны в уровне техники и включают выделение из геномной ДНК, получение из кДНК или их комбинацию. Клонирование полинуклеотидов согласно настоящему изобретению из такой геномной ДНК может быть выполнено, например, посредством использования полимеразной цепной реакции (ПЦР) или скрининга антителами экспрессионных библиотек для обнаружения ДНК фрагментов с общими структурными свойствами. См., например, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Другие методики амплификации нуклеиновых кислот, такие как лигазная цепная реакция (ЛЦР), лигированная активированная транскрипция (ЛАТ) и основанная на нуклеотидной последовательности амплификация (ОНПА), могут быть использованы. Полинуклеотиды могут быть клонированы из штамма Aspergillus, или другого, или родственного организма и, следовательно, например, могут являться аллельным или видовым вариантом кодирующей полипептид области нуклеотидной последовательности.

Настоящее изобретение также относится к полинуклеотидам, имеющим нуклеотидные последовательности, которые имеют степень идентичности последовательности, кодирующей зрелый полипептид, из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27 (т.е. нуклеотидам от 151 до 297 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9; нуклеотидам от 118 до 255 из SEQ ID NO:11, SEQ ID NO:13; нуклеотидам от 112 до 255 из SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19; нуклеотидам от 118 до 252 из SEQ ID NO:21; нуклеотидам от 151 до 297 из SEQ ID NO:23; нуклеотидам от 121 до 252 из SEQ ID NO:25; или нуклеотидам от 145 до 321 из SEQ ID NO:27) по крайней мере 60%, предпочтительно, по крайней мере 65%, более предпочтительно, по крайней мере 70%, более предпочтительно, по крайней мере 75%, более предпочтительно, по крайней мере 80%, более предпочтительно, по крайней мере 85%, более предпочтительно, по крайней мере 90%, еще более предпочтительно, по крайней мере 95% и, наиболее предпочтительно, по крайней мере 97% идентичности, которые кодируют активный полипептид.

Модификация нуклеотидной последовательности, кодирующей полипептид согласно настоящему изобретению, может быть необходима для синтеза полипептидов, существенно похожих на полипептид. Термин «существенно похожий» на полипептиды относится к не встречающимся в природе формам полипептида. Эти полипептиды могут отличаться некоторым сконструированным образом от полипептида, выделенного из его естественного источника, например, искусственные варианты, которые отличаются в определенной активности, термостабильности, оптимуму рН или им подобному. Вариантная последовательность может быть сконструирована на основе нуклеиновой последовательности, представленной как кодирующая полипептид область из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27, например, ее субпоследовательность и/или посредством введения нуклеотидных замен, которые не являются источником другой аминокислотной последовательности полипептида, кодируемого нуклеотидной последовательностью, но которые соответствуют триплетам организма-хозяина, предназначенными для производства фермента, или посредством встраивания нуклеотидных замен, которые могут являться источником отличной аминокислотной последовательности. Для общего описания нуклеотидных замен, см., например, Ford et al., 1991, Protein Expression and Purification 2: 95-107.

Специалистам будет очевидным, что такие замены могут быть сделаны вне областей, критичных для функционирования молекулы, и все равно дать в результате активный полипептид. Аминокислотные остатки, необходимые для активности полипептида, кодируемого посредством выделенного полинуклеотида по изобретению и, таким образом, предпочтительно, не объекты для замены, могут быть идентифицированы по методикам, известным в науке, таким как сайт-направленный мутагенез или аланин-сканирующий мутагенез (см., например, Cunningham and Wells, 1989, Science 244: 1081-1085). В последней методике мутации вводят в каждый положительно заряженный остаток в молекуле и получившиеся мутантные молекулы тестируют на противомикробное действие для обнаружения аминокислотных остатков, которые критичны для активности молекулы. Участки взаимодействия субстрат-фермент могут также быть определены посредством анализа трехмерной структуры, которая определена посредством таких методик, как ядерный магнитный резонанс, кристаллография или фотоаффинное мечение (см., например, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

Настоящее изобретение также относится к выделенным полинуклеотидам, кодирующим полипептид согласно настоящему изобретению, которые гибридизируются при мягких условиях, предпочтительно, средних условиях, более предпочтительно, средне-жестких условиях, еще более предпочтительно, жестких условиях и, наиболее предпочтительно, очень жестких условиях с (i) нуклеотидами от 151 до 297 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

нуклеотидами от 118 до 255 из SEQ ID NO:11, SEQ ID NO:13;

нуклеотидами от 112 до 255 из SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

нуклеотидами от 118 до 252 из SEQ ID NO:21;

нуклеотидами от 151 до 297 из SEQ ID NO:23;

нуклеотидами от 121 до 252 из SEQ ID NO:25; или

нуклеотидами от 145 до 321 из SEQ ID NO:27;

(ii) последовательностью кДНК, содержащейся в нуклеотидах от 1 до 297 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

нуклеотидах от 1 до 255 из SEQ ID NO:11, SEQ ID NO:13;

нуклеотидах от 1 до 255 из SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

нуклеотидах от 1 до 252 из SEQ ID NO:21;

нуклеотидах от 1 до 297 из SEQ ID NO:23;

нуклеотидах от 1 до 252 из SEQ ID NO:25; или

нуклеотидах от 1 до 321 из SEQ ID NO:27; или

(iii) комплементарной цепью (i) или (ii); или их аллельными вариантами или субпоследовательностями (Sambrook et al., 1989, supra), которые определены здесь.

Настоящее изобретение также относится к выделенным полинуклеотидам, полученным посредством (а) гибридизации популяции ДНК при мягких, средних, средне-жестких, жестких или очень жестких условиях с (i) нуклеотидами от 151 до 297 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

нуклеотидами от 118 до 255 из SEQ ID NO:11, SEQ ID NO:13;

нуклеотидами от 112 до 255 из SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

нуклеотидами от 118 до 252 из SEQ ID NO:21;

нуклеотидами от 151 до 297 из SEQ ID NO:23;

нуклеотидами от 121 до 252 из SEQ ID NO:25; или

нуклеотидами от 145 до 321 из SEQ ID NO:27;

(ii) последовательностью кДНК, содержащейся в нуклеотидах от 1 до 297 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9;

нуклеотидах от 1 до 255 из SEQ ID NO:11, SEQ ID NO:13;

нуклеотидах от 1 до 255 из SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19;

нуклеотидах от 1 до 252 из SEQ ID NO:21;

нуклеотидах от 1 до 297 из SEQ ID NO:23;

нуклеотидах от 1 до 252 из SEQ ID NO:25; или

нуклеотидах от 1 до 321 из SEQ ID NO:27; или

(iii) комплементарной цепью (i) или (ii); и (b) выделения гибридизирующегося полинуклеотида, который кодирует полипептид, обладающий противомикробным действием.

Конструкции нуклеиновых кислот

Настоящее изобретение также относится к конструкциям нуклеиновых кислот, содержащим выделенный полинуклеотид согласно настоящему изобретению, функционально прикрепленный к одной или более управляющим последовательностям, которые направляют экспрессию кодирующей последовательности в подходящей клетке-хозяине при условиях, совместимых с управляющими последовательностями.

С выделенным полинуклеотидом, кодирующим полипептид согласно настоящему изобретению, можно проводить манипуляции различными путями, чтобы обеспечить экспрессию полипептида. Манипуляции с последовательностью полинуклеотида до его встраивания в вектор могут быть желательны или необходимы в зависимости от экспрессирующего вектора. Методики для модификации полинуклеотидных последовательностей, использующие способы рекомбинантных ДНК, широко известны в науке.

Управляющая последовательность может являться соответствующей промоторной последовательностью, нуклеотидной последовательностью, которая распознается клеткой-хозяином, для экспрессии полинуклеотида, кодирующего полипептид настоящего изобретения. Промоторная последовательность содержит последовательности управления транскрипции, которые опосредуют экспрессию полипептида. Промотор может являться любой нуклеотидной последовательностью, которая показывает транскрипционную активность в выбранной клетке-хозяине, включая мутантные, сокращенные или гибридные промоторы, и может быть получена из генов, кодирующих внеклеточные или внутриклеточные полипептиды, или гомологичные, или гетерологичные для клетки-хозяина.

Примерами подходящих промоторов для направления транскрипции конструкций нуклеиновых кислот согласно настоящему изобретению, особенно в бактериальной клетке-хозяине, являются промоторы, полученные из lac оперона E. coli, гена агаразы (dagA) из Streptomyces coelicolor, гена левансахаразы (sacB) из Bacillus subtilis, гена альфа-амилазы (amyL) из Bacillus licheniformis, гена мальтогенной амилазы (amyM) из Bacillus stearothermophilus (amyM), гена альфа-амилазы (amyQ) из Bacillus amyloliquefaciens, гена пенициллиназы (penP) из Bacillus licheniformis, генов xylA и xylB из Bacillus subtilis, и прокариотического гена бета-лактамазы (Villa-Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75: 3727-3731), а также tac промотор (DeBoer et al., 1983, Proceedings of the National Academy of Sciences USA 80: 21-25). Дополнительно промоторы описаны в "Useful proteins from recombinant bacteria" в Scientific American, 1980, 242: 74-94; и в Sambrook et al., 1989, supra.

Примерами подходящих промоторов для направления транскрипции конструкций нуклеиновых кислот согласно настоящему изобретению в клетках-хозяевах из филаментных грибов являются промоторы, полученные из генов ТАКА амилазы из Aspergillus oryzae, аспартатной протеазы из Rhizomucor miehei, нейтральной альфа-амилазы из Aspergillus niger, кислото-устойчивой альфа-амилазы из Aspergillus niger, глюкоамилазы (glaA) из Aspergillus niger или Aspergillus awamori, липазы из Rhizomucor miehei, щелочной протеазы из Aspergillus oryzae, триозо-фосфат-изомеразы из Aspergillus oryzae, ацетамидазы из Aspergillus nidulans, амилоглюкозидазы из Fusarium venenatum (WO 00/56900), Daria из Fusarium venenatum (WO 00/56900), Quinn из Fusarium venenatum (WO 00/56900), трипсин-подобной протеазы из Fusarium oxysporum (WO 96/00787), бета-глюкозидазы из Trichoderma reesei, целлобиогидролазы I из Trichoderma reesei, эндоглюканазы I из Trichoderma reesei, эндоглюканазы II из Trichoderma reesei, эндоглюканазы III из Trichoderma reesei, эндоглюканазы IV из Trichoderma reesei, эндоглюканазы V из Trichoderma reesei, ксиланазы I из Trichoderma reesei, ксиланазы II из Trichoderma reesei, бета-ксилозидазы из Trichoderma reesei, а также NA2-tpi промотор (гибрид промоторов из генов нейтральной альфа-амилазы из Aspergillus niger и триозо-фосфат-изомеразы из Aspergillus oryzae); и мутантные, укороченные или гибридные промоторы этого.

В хозяевах-дрожжах используемые промоторы получены из генов энолазы (ENO-1) из Saccharomyces cerevisiae, галактокиназы (GAL1) из Saccharomyces cerevisiae, алкогольдегидрогеназы/глицеральдегид-3-фосфат дегидрогеназы (ADH1, ADH2/GAP) из Saccharomyces cerevisiae, триозо-фосфат-изомеразы (TPI) из Saccharomyces cerevisiae, металлотионина (CUP1) из Saccharomyces cerevisiae и 3-фосфоглицерат киназы из Saccharomyces cerevisiae. Другие проходящие промоторы для дрожжевых клеток-хозяев описаны Romanos et al., 1992, Yeast 8: 423-488.

Контролирующая последовательность может также являться подходящей последовательностью терминатора транскрипции, последовательностью, распознаваемой клеткой-хозяином для остановки транскрипции. Терминаторная последовательность является функционально присоединенной к 3'-концу нуклеотидной последовательности, кодирующей полипептид. Любой терминатор, который является функциональным в выбранной клетке-хозяине, может быть использован в настоящем изобретении.

Предпочтительными терминаторами для клеток-хозяев из филаментных грибов являются полученные из генов ТАКА амилазы из Aspergillus oryzae, глюкоамилазы из Aspergillus niger, антранилат-синтетазы из Aspergillus nidulans, альфа-глюкозидазы из Aspergillus niger и трипсин-подобной протеазы из Fusarium oxysporum.

Предпочтительные терминаторы для дрожжевых клеток-хозяев получены из генов энолазы из Saccharomyces cerevisiae, цитохрома С (CYC1) из Saccharomyces cerevisiae, и глицеральдегид-3-фосфат дегидрогеназы из Saccharomyces cerevisiae. Другие применимые терминаторы для дрожжевых клеток-хозяев описаны Romanos et al., 1992, supra.

Контролирующая последовательность может также являться лидерной последовательностью, нетранслируемой областью мРНК, которая является важной для трансляции клеткой-хозяином. Лидерная последовательность является функционально присоединенной к 5'-концу нуклеотидной последовательности, кодирующей полипептид. Любая лидерная последовательность, которая является функциональной в выбранной клетке-хозяине, может быть использована в настоящем изобретении.

Предпочтительными лидерами для клеток-хозяев из филаментных грибов являются полученные из генов ТАКА амилазы из Aspergillus oryzae и триозо-фосфат-изомеразы из Aspergillus nidulans.

Подходящими лидерами для дрожжевых клеток-хозяев являются полученные из генов энолазы из Saccharomyces cerevisiae, 3-фосфоглицерат киназы из Saccharomyces cerevisiae, альфа-фактора из Saccharomyces cerevisiae и алкогольдегидрогеназы/глицеральдегид-3-фосфат дегидрогеназы (ADH2/GAP) из Saccharomyces cerevisiae.

Контролирующая последовательность может также быть последовательностью полиаденилирования, последовательностью, функционально связанной с 3'-концом нуклеотидной последовательности, и которая при транскрипции узнается клеткой-хозяином как сигнал для добавления остатков полиаденозина к транскрибированной РНК. Любая последовательность полиаденилирования, которая является функциональной в выбранной клетке-хозяине, может быть использована в настоящем изобретении.

Предпочтительными последовательностями полиаденилирования для клеток-хозяев из филаментных грибов являются полученные из генов ТАКА амилазы из Aspergillus oryzae, глюкоамилазы из Aspergillus niger, антранилат-синтетазы из Aspergillus nidulans, трипсин-подобной протеазы из Fusarium oxysporum и альфа-глюкозидазы из Aspergillus niger.

Подходящие последовательности полиаденилирования для дрожжевых клеток-хозяев описаны Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.

Контролирующая последовательность может также являться кодирующей сигнальный пептид областью, которая кодирует аминокислотную последовательность, связанную с аминоконцом полипептида, и направляет кодируемый полипептид по клеточному секреторному пути. 5'-конец кодирующей последовательности нуклеотидной последовательности может изначально содержать кодирующую сигнальный пептид область, естественным образом связанную в рамке считывания трансляции с сегментом кодирующей области, которая кодирует секретируемый полипептид. В качестве альтернативы, 5'-конец кодирующей последовательности может содержать кодирующую сигнальный пептид область, которая является чужеродной для кодирующей области. Чужеродная кодирующая сигнальный пептид область может требоваться, когда кодирующая последовательность не содержит по своей природе кодирующую сигнальный пептид область. В качестве альтернативы чужеродная кодирующая сигнальный пептид область может просто заменить природную кодирующую сигнальный пептид область для усиления секреции полипептида. Однако любая кодирующая сигнальный пептид область, которая направляет экспрессируемый полипептид по секреторному пути выбранной клетки-хозяина, может быть использована в настоящем изобретении.

Действующими кодирующими сигнальные пептиды областями для бактериальных клеток-хозяев являются кодирующие сигнальные пептиды области, полученные из генов мальтогенной амилазы из Bacillus NCIB 11837, альфа-амилазы из Bacillus stearothermophilus, субтилизина из Bacillus licheniformis, бета-лактамазы из Bacillus licheniformis, нейтральных протеаз (nprT, nprS, nprM) из Bacillus stearothermophilus, и prsA из Bacillus subtilis. Дополнительные сигнальные пептиды описаны Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.

Действующими кодирующими сигнальные пептиды областями для клеток-хозяев из филаментных грибов являются кодирующие сигнальные пептиды области, полученные из генов ТАКА амилазы из Aspergillus oryzae, нейтральной амилазы из Aspergillus niger, глюкоамилазы из Aspergillus niger, аспартатной протеазы из Rhizomucor miehei, целлюлазы из Humicola insolens и липазы из Humicola lanuginose.

В предпочтительном аспекте кодирующей сигнальный пептид областью являются нуклеотиды с 1 по 57 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 или SEQ ID NO:9, которые кодируют аминокислоты от -50 до -32 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10; нуклеотиды с 1 по 63 из SEQ ID NO:11 или SEQ ID NO:13, которые кодируют аминокислоты от -39 до -19 из SEQ ID NO:12 или SEQ ID NO:14; нуклеотиды с 1 по 63 из SEQ ID NO:15, SEQ ID NO:17 или SEQ ID NO:19, которые кодируют аминокислоты от -37 до -17 из SEQ ID NO: 16, SEQ ID NO: 18 или SEQ ID NO:20; нуклеотиды с 1 по 63 из SEQ ID NO:21, которые кодируют аминокислоты от -39 до -19 из SEQ ID NO:22; нуклеотиды с 1 по 57 из SEQ ID NO:23, которые кодируют аминокислоты от -50 до -32 из SEQ ID NO:24; нуклеотиды с 1 по 63 из SEQ ID NO:25, которые кодируют аминокислоты от -40 до -20 из SEQ ID NO:26; или нуклеотиды с 1 по 66 из SEQ ID NO:27, которые кодируют аминокислоты от -48 до -27 из SEQ ID NO:28.

Пригодные сигнальные пептиды для дрожжевых клеток-хозяев получены из генов альфа-фактора из Saccharomyces cerevisiae и инвертазы из Saccharomyces cerevisiae. Другие применимые области, кодирующие сигнальные пептиды, описаны Romanos et al., 1992, supra.

Контролирующая последовательность может также являться кодирующей пропептид областью, которая кодирует аминокислотную последовательность, расположенную на аминоконце полипептида. Получающийся полипептид называется проферментом или прополипептидом (или зимогеном в некоторых случаях). Прополипептид является обычно неактивным и может быть превращен в зрелый активный полипептид посредством каталитического или автокаталитического расщепления пропептида из прополипептида. Кодирующая пропептид область может быть получена из генов щелочной протеазы (aprE) из Bacillus subtilis, нейтральной протеазы (nprT) из Bacillus subtilis, альфа-фактора из Saccharomyces cerevisiae, аспартатной протеазы из Rhizomucor miehei и лакказы из Myceliophthora thermophila (WO 95/33836).

В предпочтительном аспекте кодирующей пропептид областью являются нуклеотиды с 58 по 150 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 или SEQ ID NO:9, которые кодируют аминокислоты от -31 до -1 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10; нуклеотиды с 64 по 117 из SEQ ID NO:11 или SEQ ID NO:13, которые кодируют аминокислоты от -18 до -1 из SEQ ID NO:12 или SEQ ID NO:14; нуклеотиды с 64 по 111 из SEQ ID NO:15, SEQ ID NO:17 или SEQ ID NO:19, которые кодируют аминокислоты от -16 до -1 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20; нуклеотиды с 64 по 117 из SEQ ID NO:21, которые кодируют аминокислоты от -18 до -1 из SEQ ID NO:22; нуклеотиды с 58 по 150 из SEQ ID NO:23, которые кодируют аминокислоты от -31 до -1 из SEQ ID NO:24; нуклеотиды с 64 по 120 из SEQ ID NO:25, которые кодируют аминокислоты от -19 до -1 из SEQ ID NO:26; или нуклеотиды с 67 по 144 из SEQ ID NO:27, которые кодируют аминокислоты от -26 до -1 из SEQ ID NO:28.

Там, где области и сигнального пептида и пропептида присутствуют на аминоконце полипептида, область пропептида располагается перед аминоконцом полипептида, и область сигнального пептида располагается перед аминоконцом области пропептида.

Также может быть желательно добавить регуляторные последовательности, которые позволяют регулировать экспрессию полипептида относительно роста клетки-хозяина. Примерами регуляторных систем являются те, что вызывают включение и выключение экспрессии гена в ответ на химические или физические стимулы, включая присутствие регуляторного соединения. Регуляторные системы в прокариотических системах включают операторные системы lac, tac и trp. В дрожжах могут быть использованы система ADH2 или система GAL1. В филаментных грибах в качестве регуляторных последовательностей могут быть использованы промотор ТАКА альфа-амилазы, промотор глюкоамилазы из Aspergillus niger и промотор глюкоамилазы из Aspergillus oryzae. Другими примерами регуляторных последовательностей являются те, которые позволяют амплификацию гена. В эукариотических системах они включают ген дегидрофолатредуктары, который амплифицируется в присутствии метотрексата, и гены металлотионеинов, которые амплифицируются с тяжелыми металлами. В этих случаях кодирующая полипептид нуклеотидная последовательность была бы функционально прикреплена к регуляторной последовательности.

Векторы экспрессии

Настоящее изобретение также относится к рекомбинантным экспрессионным векторам, содержащим полинуклеотид согласно настоящему изобретению, промотор и стоп-сигналы транскрипции и трансляции. Различные последовательности нуклеиновых кислот и контролирующие последовательности, описанные выше, могут быть соединены вместе с получением рекомбинантного экспрессионного вектора, который может включать один или больше удобных рестрикционных сайтов, чтобы позволить вставку или замену нуклеотидной последовательности, кодирующей полипептид, по таким сайтам. В качестве альтернативы нуклеотидная последовательность согласно настоящему изобретению может быть экспрессирована посредством встраивания нуклеотидной последовательности или конструкции нуклеиновой кислоты, содержащей последовательность, в соответствующий вектор для экспрессии. При создании экспрессионного вектора кодирующая последовательность расположена в векторе таким образом, что кодирующая последовательность является функционально присоединенной к соответствующим контролирующим последовательностям для экспрессии.

Рекомбинантным экспрессионным вектором может быть любой вектор (например, плазмида или вирус), который может быть удобно подвергнут методикам рекомбинантных ДНК и может осуществлять экспрессию нуклеотидной последовательности. Выбор вектора будет обычно зависеть от совместимости вектора с клеткой-хозяином, в которую вводится вектор. Векторы могут быть линейными или закрытыми кольцевыми плазмидами.

Вектор может являться автономно реплицирующимся вектором, т.е. вектором, который существует в качестве внехромосомной единицы, репликация которой является независимой от хромосомной репликации, например, плазмидой, внехромосомным элементом, минихромосомой или искусственной хромосомой. Вектор может содержать любые механизмы для обеспечения саморепликации. В качестве альтернативы вектор может быть тем, который при введении в клетку-хозяина интегрируется в геном и реплицируется вместе с хромосомой(ами), в которую он интегрировался. Кроме того, могут быть использованы одиночный вектор или плазмида или два или больше векторов или плазмид, которые совместно содержат полную ДНК для встраивания в геном клетки-хозяина, или транспозон.

Векторы согласно настоящему изобретению предпочтительно содержат один или больше маркеров селекции, которые позволяют легкую селекцию трансформированных клеток. Маркер селекции является геном, продукт которого предоставляет биоцид или вирусную резистентность, резистентность к тяжелым металлам, свойства прототрофа ауксотрофам и им подобное.

Примерами бактериальных маркеров селекции являются dal гены из Bacillus subtilis или Bacillus licheniformis, или маркеры, которые наделяют устойчивостью к антибиотикам, такой как устойчивость к ампициллину, канамицину, хлорамфениколу или тетрациклину. Подходящими маркерами для дрожжевых клеток-хозяев являются ADE2, HIS3, LEU2, LYS2, MET3, TRP1 и URA3. Маркеры селекции для использования в клетках-хозяевах филаментных грибов включают, но не ограничены этим, amdS (ацетамидазу), argB (орнитин карбамоил трансферазу), bar (фосфинотрицин ацетилтрансферазу), hph (гигромицин фосфотрансферазу), niaD (нитрат редуктазу), pyrG (оротидин-5'-фосфат декарбоксилазу), sC (сульфат аденилтрансферазу) и trpC (антранилат синтазу), а также их эквиваленты. Предпочтительными для использования в клетках Aspergillus являются amdS и pyrG гены из Aspergillus nidulans или Aspergillus oryzae и bar ген из Streptomyces hygroscopicus.

Векторы согласно настоящему изобретению предпочтительно содержат элемент(ы), который позволяет встраивание вектора в геном клетки-хозяина или автономную репликацию вектора в клетке, независимо от генома.

Для встраивания в геном клетки-хозяина вектор может основываться на последовательности полинуклеотида, кодирующего полипептид, или любом другом элементе вектора для интеграции в геном посредством гомологичной или негомологичной рекомбинации. В качестве альтернативы вектор может содержать дополнительные нуклеотидные последовательности для направления интеграции посредством гомологичной рекомбинации в геноме клетки-хозяина в точное положение(я) на хромосоме(ах). Для увеличения вероятности интеграции в точное местоположение элементы интеграции должны, предпочтительно, содержать достаточное количество нуклеиновых кислот, такое как от 100 до 10000 пар оснований, предпочтительно, от 400 до 10000 пар оснований и, наиболее предпочтительно, от 800 до 10000 пар оснований, которые имеют высокую степень идентичности с соответствующей последовательностью-мишенью для усиления вероятности гомологичной рекомбинации. Интеграционным элементом может являться любая последовательность, которая гомологична последовательности мишени в геноме клетки-хозяина. Кроме того, интеграционные элементы могут быть некодирующими или кодирующими нуклеотидными последовательностями. С другой стороны вектор может быть встроен в геном клетки-хозяина посредством негомологичной рекомбинации.

Для автономной репликации вектор может далее содержать точку начала репликации, дающую возможность вектору реплицироваться автономно в рассматриваемой клетке-хозяине. Точкой начала репликации может быть любой плазмидный репликатор, опосредующий автономную репликацию, который функционирует в клетке. Термин «точка начала репликации» или «плазмидный репликатор» определен здесь как нуклеотидная последовательность, дающая возможность плазмиде или вектору реплицироваться in vivo.

Примерами бактериальных точек начала репликации являются точки начала репликации плазмид pBR322, pUC19, pACYC177 и pACYC184, разрешающие репликацию в E. coli, и pUB110, pE194, pTA1060 и pAMβ1, разрешающие репликацию в Bacillus.

Примерами точек начала репликации для использования в дрожжевых клетках-хозяевах являются 2-микронные точки начала репликации, ARS1, ARS4, комбинация из ARS1 и CEN3 и комбинация из ARS4 и CEN6.

Примерами точек начала репликации для использования в клетках-хозяевах из филаментных грибов являются AMA1 и ANS1 (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic Acids Research 15: 9163- 9175; WO 00/24883). Выделение гена AMA1 и конструирование плазмид или векторов, содержащих ген, может быть выполнено по способам, раскрытым в WO 00/24883.

Более чем одна копия полинуклеотида согласно настоящему изобретению может быть вставлена в клетку-хозяина для увеличения продукции продукта гена. Увеличение числа копий полинуклеотида может быть получено путем встраивания по крайней мере одной дополнительной копии последовательности в геном клетки-хозяина или посредством включения амплифицируемого гена маркера селекции с полинуклеотидом, где клетки, содержащие амплифицированные копии гена маркера селекции, и, следовательно, дополнительные копии полинуклеотида, могут быть отобраны посредством культивирования клеток в присутствии соответствующего агента селекции.

Методики, используемые для лигирования элементов, описанных выше, для конструирования рекомбинантных экспрессионных векторов настоящего изобретения хорошо известны специалисту (см., например, Sambrook et al., 1989, supra).

Клетки-хозяева

Настоящее изобретение также относится к рекомбинантным клеткам-хозяевам, содержащим полинуклеотид согласно настоящему изобретению, которые преимущественно применяются в рекомбинантном получении полипептидов. Вектор, содержащий полинуклеотид согласно настоящему изобретению, введен в клетку-хозяина таким образом, что вектор поддерживается как хромосомная вставка или как самореплицирующийся внехромосомный вектор, описанный ранее. Термин «клетка-хозяин» охватывает любое потомство родительской клетки, которое не является идентичным родительской клетке из-за мутаций, которые случаются во время репликации. Выбор клетки-хозяина будет в большей степени зависеть от гена, кодирующего полипептид, и его источника.

Клетка-хозяин может являться одноклеточным микроорганизмом, например, прокариотом, или не одноклеточным микроорганизмом, например, эукариотом.

Подходящими одноклеточными микроорганизмами являются бактериальные клетки, такие как грамположительные бактерии, включающие, но не ограниченные этим, клетки Bacillus, например, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis и Bacillus thuringiensis; или клетки Streptomyces, например, Streptomyces lividans и Streptomyces murinus, или грам-отрицательные бактерии, такие как E. coli и Pseudomonas sp. В предпочтительном аспекте бактериальная клетка-хозяин является клеткой Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus или Bacillus subtilis. В другом предпочтительном аспекте клетки Bacillus являются клетками алкалофильных Bacillus.

Введение вектора в бактериальную клетку-хозяина может, например, быть осуществлено посредством трансформации протопластов (см., например, Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), используя компетентные клетки (см., например, Young and Spizizin, 1961, Journal of Bacteriology 81: 823-829 или Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), электропорацией (см., например, Shigekawa and Dower, 1988, Biotechniques 6: 742-751) или коньюгацией (см., например, Koehler and Thone, 1987, Journal of Bacteriology 169: 5771-5278).

Клетка-хозяин может также являться эукариотической, такой как клетки млекопитающих, насекомых, растений или грибов.

В предпочтительном аспекте клетка-хозяин является клеткой грибов. «Грибы», используемые здесь, включают типы Аскомицеты, Базидиомицеты, Хитридиомицеты и Зигомицеты (определенные Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK), а также Оомицеты (приведенные в Hawksworth et al., 1995, supra, page 171) и все образующие митоспоры грибы (Hawksworth et al., 1995, supra).

В более предпочтительном аспекте грибная клетка-хозяин является дрожжевой клеткой. «Дрожжи», используемые здесь, включают аскоспорогенные дрожжи (порядок Эндомицетовые), базидиоспорогенные дрожжи и дрожжи, принадлежащие к несовершенным грибам (Бластомицеты). Так как классификация грибов может измениться в будущем, для целей настоящего изобретения дрожжи будут определены как описано в Biology and Activities of Yeast (Skinner, F.A., Passmore, S.M., and Davenport, R.R., eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

В еще более предпочтительном аспекте дрожжевая клетка-хозяин является клеткой Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces или Yarrowia.

В наиболее предпочтительном аспекте дрожжевая клетка-хозяин является клеткой Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis или Saccharomyces oviformis. В другом наиболее предпочтительном аспекте дрожжевая клетка-хозяин является клеткой Kluyveromyces lactis. В другом наиболее предпочтительном аспекте, дрожжевая клетка-хозяин является клеткой Yarrowia lipolytica.

В другом более предпочтительном аспекте грибная клетка-хозяин является клеткой нитчатых грибов.

«Нитчатые грибы» включают все нитчатые формы подразделения Эумицеты и Оомицеты (определенные Hawksworth et al., 1995, supra). Нитчатые грибы обычно отличаются стенкой мицелия, состоящей из хитина, целлюлозы, глюкана, хитозана, маннана и других сложных полисахаридов. Вегетативный рост является удлинением гифа, и углеродный катаболизм является облигатно аэробным. В отличие от этого вегетативный рост дрожжей, таких как Saccharomyces cerevisiae, происходит путем почкования одноклеточного таллома, и катаболизм углерода может быть ферментативным.

В еще более предпочтительном аспекте клетка-хозяин из нитчатых грибов является клеткой Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes или Trichoderma.

В наиболее предпочтительном аспекте клетка-хозяин из нитчатых грибов является клеткой Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger или Aspergillus oryzae. В другом наиболее предпочтительном аспекте клетка-хозяин из нитчатых грибов является клеткой Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides или Fusarium venenatum. В другом наиболее предпочтительном аспекте клетка-хозяин из нитчатых грибов является клеткой штаммов Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa или Ceriporiopsis subvermispora, Coprinus cinereus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei или Trichoderma viride.

Клетки грибов могут быть трансформированы посредством процесса, включающего образование протопласта, трансформацию протопласта и регенерацию клеточной стенки способом, общеизвестным per se. Подходящие методики для трансформации клеток-хозяев из Aspergillus и Trichoderma описаны в EP 238 023 и Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Подходящие методики для трансформации вида Fusarium описаны Malardier et al., 1989, Gene 78: 147-156 и WO 96/00787. Дрожжи можно трансформировать, используя методики, описанные Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153: 163; и Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920.

Способы получения

Настоящее изобретение также относится к способам получения полипептида согласно настоящему изобретению, включающим (а) культивирование клетки, которая в виде дикого типа способна продуцировать полипептид при условиях, способствующих продуцированию полипептида; и (b) выделение полипептида. Предпочтительно клетки относятся к роду Arenicola и, еще более предпочтительно, представляют собой Arenicola marina.

Настоящее изобретение также относится к способам получения полипептида согласно настоящему изобретению, включающим (а) культивирование клетки при условиях, способствующих продуцированию полипептида; и (b) выделение полипептида.

Настоящее изобретение также относится к способам получения полипептида согласно настоящему изобретению, включающим (а) культивирование клетки при условиях, способствующих продуцированию полипептида, где клетка-хозяин содержит мутантную нуклеотидную последовательность, имеющую по крайней мере одну мутацию в кодирующей зрелый полипептид области из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27, где мутантная нуклеотидная последовательность кодирует полипептид, который состоит из аминокислот с 1 по 49 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10;

аминокислот с 1 по 46 из SEQ ID NO:12 или SEQ ID NO:14;

аминокислот с 1 по 48 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20;

аминокислот с 1 по 45 из SEQ ID NO:22;

аминокислот с 1 по 49 из SEQ ID NO:24;

аминокислот с 1 по 44 из SEQ ID NO:26; или

аминокислот с 1 по 59 из SEQ ID NO:28, и (b) выделение полипептида.

В способах получения согласно настоящему изобретению клетки культивируют в питательной среде, подходящей для получения полипептида, используя способы, хорошо известные в данной области. Например, клетки можно культивировать в колбах при встряхивании и ферментацией в малом масштабе или в большом масштабе (включая непрерывную, периодическую, подпитываемую или твердофазную ферментации) в лабораторном или промышленном ферментерах, выполняемую в подходящей среде и при условиях, позволяющих экспрессировать и/или выделять полипептид. Культивирование происходит в подходящей питательной среде, содержащей источники углерода и азота и неорганические соли, используя методики, известные в данной области. Подходящая среда доступна от частных поставщиков и может быть приготовлена по опубликованным композициям (например, в каталогах Американской Коллекции Типовых Культур). Если полипептид секретируется в питательную среду, полипептид может быть прямо выделен из среды. Если полипептид не секретируется, он может быть выделен из клеточных лизатов.

Полипептиды можно детектировать, используя способы, известные в данной области, которые являются избирательными для полипептидов. Эти способы детекции могут включать применение специфичных антител. Например, метод обнаружения противомикробного действия может быть использован, чтобы определить активность полипептида, описанного здесь.

Получающийся полипептид можно выделять, используя способы, известные в данной области. Например, полипептид может быть выделен из питательной среды посредством общеизвестных методик, включая, но не ограничиваясь этим, центрифугирование, фильтрацию, экстракцию, конвекционную сушку, испарение или осаждение.

Полипептиды согласно настоящему изобретению можно очистить, используя множество методик, известных в данной области, включая, но не ограничиваясь этим, хроматографию (например, ион-обменную, аффинную, гидрофобную, хроматофокусирование и гель-фильтрацию), электрофоретические методики (например, препаративное изоэлектрофокусирование), дифференциальную растворимость (например, осаждение сульфатом аммония), ДСН-ПААГ или экстракцию (см., например, Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Растения

Настоящее изобретение также относится к трансгенному растению, части растения или растительной клетке, которые трансформированы нуклеотидной последовательностью, кодирующей полипептид, обладающий противомикробным действием, настоящего изобретения для того, чтобы экспрессировать и получать полипептид в выделяемых количествах. Полипептид может быть выделен из растения или части растения. В качестве альтернативы растение или часть растения, содержащие рекомбинантный полипептид, могут быть использованы как таковые для улучшения качества пищи или корма, например, улучшения питательной ценности, вкусовой привлекательности и реологических свойств, или чтобы разрушить анти-питательный фактор.

Трансгенное растение может являться двудольным (двудольное растение) или однодольным (однодольное растение). Примерами однодольных растений являются травы, такие как мятлик, кормовая трава, такая как овсяница, плевел, травы умеренного климата, такие как полевица, и злаки, например, пшеница, овес, рожь, ячмень, рис, сорго и маис (кукуруза).

Примерами двудольных растений являются табак, бобовые, такие как люпин, картофель, сахарная свекла, горох, фасоль и соя и крестоцветные растения (семейство Капустные), такие как цветная капуста, рапс и близкородственный модельный организм Arabidopsis thaliana.

Примерами частей растения являются стебель, каллус, листья, корень, фрукты, семена и клубни, а также индивидуальные ткани, составляющие эти части, например, эпидермис, мезофилл, паренхима, сосудистые ткани, меристема. Отдельные компартменты растительной клетки, такие как хлоропласты, апопласты, митохондрии, вакуоли, пероксисомы и цитоплазма, также считаются частью растения. Кроме того, любая растительная клетка, из какого-либо источника ткани, считается частью растения. Аналогичным образом, части растений, как конкретные ткани и клетки, выделенные для облегчения использования изобретения, также считаются частями растения, например, зародыши, эндосперм, алейрон и семенные оболочки.

Также включенным в объем настоящего изобретения является потомство таких растений, части растений и растительные клетки.

Трансгенное растение или растительная клетка, экспрессирующие полипептид согласно настоящему изобретению могут быть интерпретированы в соответствии со способами, известными в данной области. Кратко, растение или растительная клетка интерпретируются как включение одного или больше экспрессионных конструкций, кодирующих полипептид настоящего изобретения, в геном растения-хозяина и размножение получающегося модифицированного растения или растительной клетки в трансгенное растение или растительную клетку.

Экспрессионной конструкцией обычно является конструкция нуклеиновой кислоты, которая содержит полинуклеотид, кодирующий полипептид настоящего изобретения, функционально присоединенный к соответствующим регуляторным последовательностям, требуемым для экспрессии нуклеотидной последовательности в выбранном растении или части растения. Кроме того, экспрессионная конструкция может содержать маркер селекции, пригодный для идентификации клеток-хозяев, в которые была встроена экспрессионная конструкция, и ДНК последовательности, необходимые для введения конструкции в рассматриваемое растение (последнее зависит от метода введения ДНК, который будет использоваться).

Выбор регуляторных последовательностей, таких как промоторная и терминаторная последовательности и, необязательно, сигнальная или транзитная последовательности определяется, например, на основе когда, где и как желательно экспрессировать полипептид. Например, экспрессия гена, кодирующего полипептид настоящего изобретения, может быть конститутивной или индуцированной или может быть связанной с развитием, специфичной к стадии (развития) или ткани, и продукт гена может быть нацелен на определенную ткань или часть растения, такую как листья или семена. Регуляторными последовательностями являются, например, описанные Tague et al., 1988, Plant Physiology 86: 506.

Для конститутивной экспрессии могут быть использованы промотор 35S-CaMV, промотор убиквитина 1 из маиса и промотор актина 1 из риса (Franck et al., 1980, Cell 21: 285-294, Christensen et al., 1992, Plant Mo. Biol. 18: 675-689; Zhang et al., 1991, Plant Cell 3: 1155-1165). Промоторами, специфичными к органам, могут являться, например, промотор из запасающих тканей, таких как семена, клубни картофеля и фрукты (Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303) или из тканей метаболитических стоков, таких как меристемы (Ito et al., 1994, Plant MoI. Biol. 24: 863-878), промотор, специфичный для семян, такой как глютелиновый, проламиновый, глобулиновый или альбуминовый промоторы из риса (Wu et al., 1998, Plant and Cell Physiology 39: 885-889), промотор из Vicia faba легумина B4 и промотор гена неизвестного белка из семени из Vicia faba (Conrad et al., 1998, Journal of Plant Physiology 152: 708-711), промотор составляющего белка растительного масла (Chen et al., 1998, Plant and Cell Physiology 39: 935-941), промотор запасного белка napA из Brassica napus или любой другой известный в данной области промотор, специфичный для семян, например, как описанный в WO 91/14772. Кроме того, промотор может являться промотором, специфичным для листьев, таким как rbcs промотор из риса или томата (Kyozuka et al., 1993, Plant Physiology 102: 991-1000), промотор гена адениновой метилтрансферазы из вируса хлореллы (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), или промотор гена aldP из риса (Kagaya et al., 1995, Molecular and General Genetics 248: 668-674), или индуцируемый ранением промотор, такой как pin2 из картофеля (Xu et al., 1993, Plant Molecular Biology 22: 573-588). Аналогичным образом, промотор может являться индуцируемым при небиологических воздействиях, таких как температура, сухость или изменения в минерализации, или индуцируемым посредством эндогенно применяемых веществ, которые активируют промотор, например, этанола, оэстрогенов, растительных гормонов, таких как этилен, абсцизовая кислота и гибберелиновая кислота, и тяжелых металлов.

Промоторный энхансерный элемент может также быть использован для достижения более высокой экспрессии полипептида настоящего изобретения в растении. Например, промоторный энхансерный элемент может являться интроном, помещенным между промотором и нуклеотидной последовательностью, кодирующей полипептид настоящего изобретения. Например, Xu et al., 1993, supra, раскрывают применение первого интрона в гене актина 1 риса для усиления экспрессии.

Ген маркера селекции и любые другие части экспрессионной конструкции могут быть выбраны из тех, что доступны в данной области.

Конструкция нуклеиновой кислоты включена в геном растения по общеизвестным методикам, известным в данной области, включая Agrobacterium-опосредованную трансформацию, вирус-опосредованную трансформацию, микроинъекцию, бомбардировку частицами, биолистическую трансформацию и электропорацию (Gasser et al., 1990, Science 244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).

На сегодняшний день Agrobacterium tumefaciens-опосредованный перенос генов является основным способом получения трансгенных двудольных растений (для обзора, см. Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38) и также может быть использован для трансформации однодольных растений, хотя для этих растений часто используются другие способы трансформации. На сегодняшний день основным способом получения трансгенных однодольных растений является бомбардировка частицами (микроскопическими золотыми или вольфрамовыми частицами, покрытыми трансформирующей ДНК) эмбрионального каллуса или развивающихся зародышей (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994, Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992, Bio/Technology 10: 667-674). Альтернативный способ трансформации однодольных растений основан на трансформации протопластов, описанной Omirulleh et al., 1993, Plant Molecular Biology 21: 415-428.

После трансформации включивших экспрессионную конструкцию трансформантов отбирают и регенерируют в целые растения по способам, широко известным в данной области. Часто методика трансформации разработана для селективного удаления генов селекции или в ходе регенерации, или в следующих поколениях посредством использования, например, совместной трансформации двумя отдельными Т-ДНК конструкциями или сайт-специфическим вырезанием гена селекции посредством определенной рекомбиназы.

Настоящее изобретение также относится к способам получения полипептида согласно настоящему изобретению, включающим: (а) культивирование трансгенного растения или растительной клетки, содержащих полинуклеотид, кодирующий полипептид, обладающий противомикробным действием, согласно настоящему изобретению при условиях, способствующих получению полипептида; и (b) выделение полипептида.

Композиции

Настоящее изобретение также относится к композициям, таким как фармацевтические композиции, содержащие полипептид настоящего изобретения. Предпочтительно, композиции являются обогащенными таким полипептидом. Термин «обогащенный» указывает, что противомикробная активность композиции увеличена, например, с фактором обогащения 1.1.

Композиции могут дополнительно содержать другой фармацевтически активный агент, такой как дополнительный биоцид, такой как другой противомикробный полипептид, проявляющий противомикробное действие, определенное выше. Биоцидом может быть антибиотик, известный в данной области. Классы антибиотиков включают пенициллины, например, пенициллин G, пенициллин V, метициллин, оксациллин, карбенициллин, нафциллин, ампициллин и т.п.; пенициллины в сочетании с ингибиторами бета-лактамазы; цефалоспорины, например, цефаклор, цефазолин, цефуроксим, моксалактам и т.п.; карбапенемы; монобактамы; аминогликозиды; тетрациклины; макролиды; линкомицины; полимиксины; сульфонамиды; кинолоны; хлорамфеникал; метронидазол; спектиномицин; триметоприм; ванкомицин; и т.п. Биоцид может также являться противогрибковым агентом, включая полиены, например, амфотерицин В, нистатин; 5-флукозин; и азолы, например, миконазол, кетоконазол, итраконазол и флуконазол.

В варианте осуществления изобретения биоцидом является химический агент, не являющийся ферментом. В другом варианте осуществления изобретения биоцидом является не полипептидный химический агент.

Композиции могут содержать подходящий материал-носитель. Композиции могут также содержать подходящее средство доставки, способное доставлять противомикробные полипептиды изобретения в желаемое место, где композиции применяются в качестве лекарственного средства.

Полипептидные композиции могут быть приготовлены по способам, известным в данной области, и могут быть в виде жидкой или сухой композиции. Например, полипептидная композиция может быть в виде гранул или микрогранул. Полипептид для включения в композицию может быть стабилизирован по способам, известным в данной области.

Ниже приведены Примеры предпочтительного использования полипептидных композиций по изобретению. Дозы полипептидной композиции по изобретению и другие условия, при которых композиция используется, могут быть определены на основе способов, известных в данной области.

Способы и применение

Настоящее изобретение также направлено на способы применения полипептидов, обладающих противомикробным действием. Противомикробные полипептиды обычно применимы в любом месте, подвергающемся загрязнению бактериями, грибами, дрожжами или водорослями. Обычно местами являются водные системы, такие как охлаждающие водные системы, прачечные стоки, масляные системы, такие как смазочно-охлаждающие жидкости, смазки, нефтяные месторождения и им подобные, где микроорганизмы должны быть убиты или где их рост должен быть под контролем. Однако настоящее изобретение может также применяться во всех приложениях, для которых применимы известные противомикробные составы, такие как защита дерева, латекс, адгезив, клей, бумага, картон, текстиль, кожа, пластмасса, герметик и корм.

Другие применения включают сохранность пищевых продуктов, напитков, косметики, такой как лосьоны, кремы, гели, мази, мыла, шампуни, кондиционеры, антипреспиранты, деодоранты, средства для полоскания рта, продукты для контактных линз, ферментативные фармацевтические композиции или пищевые ингредиенты.

Поэтому противомикробные полипептиды по изобретению могут быть применимы в качестве дезинфектанта, например, в лечении инфекции в глазах и во рту, кожных инфекций; в антипреспирантах или деодорантах; для очистки и дезинфекции контактных линз и зубов (уход за полостью рта).

В общем подразумевается, что противомикробные полипептиды согласно настоящему изобретению применимы для очистки, дезинфекции или ингибирования роста микроорганизмов на любой поверхности. Примерами поверхностей, для которых контакт с противомикробными полипептидами изобретения может является выгодным, являются поверхности технологического оборудования, используемого, например, в молочной промышленности, на химических или фармацевтических заводах, в системах обеззараживания воды, на нефтеперерабатывающих заводах, на целлюлозоперерабатывающих заводах, на водоочистительных станциях и градирнях. Противомикробные полипептиды по изобретению следует использовать в количестве, которое является эффективным для очистки, дезинфекции или ингибирования роста микроорганизмов на рассматриваемой поверхности.

Противомикробные полипептиды по изобретению могут дополнительно использоваться для очистки поверхностей и кухонных принадлежностей в пищевой промышленности и в любом месте, в котором пища готовится или подается, таком как госпитали, роддома и рестораны.

Они также могут быть использованы в качестве консерванта или дезинфектанта в водоосновных красках.

Изобретение также относится к применению противомикробного полипептида или композиции по изобретению в качестве лекарственного средства. Далее, противомикробные полипептид или композиция по изобретению могут также быть использованы для производства лекарственных средств для контроля и борьбы с микроорганизмами, такими как грибы и бактерии, предпочтительно, грамположительные бактерии.

Композиция и противомикробный полипептид по изобретению могут быть использованы в качестве ветеринарного или медицинского терапевтического, или профилактического агента. Поэтому композиция и противомикробный полипептид по изобретению могут быть использованы в получении ветеринарных или медицинских терапевтических, или профилактических агентов для лечения микробных инфекций, таких как бактериальные или грибковые инфекции, предпочтительно инфекции, вызываемые грамположительными бактериями. В частности, микробные инфекции могут быть ассоциированы с легочными болезнями, включая, но не ограничиваясь этим, туберкулез, пневмонию и кистозный фиброз; и болезнями, передаваемыми половым путем, включая, но не ограничиваясь этим, гонорею и хламидиоз.

Композиции по изобретению содержат эффективное количество противомикробного полипептида по изобретению.

Термин «эффективное количество» при использовании здесь означает количество противомикробных полипептидов по изобретению, которое является достаточным для ингибирования роста рассматриваемого микроорганизма.

Изобретение также относится к ранозаживляющим композициям или продукции, таким как повязки, медицинским устройствам, таким как, например, катетеры и далее к продукции против перхоти, такой как шампуни.

Составы противомикробных полипептидов по изобретению вводятся лицу, страдающему от или предрасположенному к микробной инфекции. Введение может быть местным, локализованным или системным в зависимости от конкретного микроорганизма, предпочтительно, оно будет локализованным. Обычно доза противомикробных полипептидов изобретения будет достаточной, чтобы уменьшить популяцию микроорганизмов по крайней мере на 50%, обычно по крайней мере на 1 порядок и, может быть, на 2 или более порядков. Соединения согласно настоящему изобретению вводят в дозировке, которая уменьшает популяцию микроорганизмов, в то же время минимизируя любые побочные эффекты. Предусматривается, что состав будет получен и использован под руководством терапевта для применения in vivo. Противомикробные полипептиды по изобретению особенно применимы для уничтожения грамотрицательных бактерий, включая Pseudomonas aeruginosa и Chlamydia trachomatis; и грамположительных бактерий, включая стрептококки, такие как Streptococcus pneumonia, S. uberis, S. hyointestinalis, S. pyogenes и S. agalactiae; и стафилококки, такие как Staphylococcus aureus, S. epidermidis, S. simulans, S. xylosus и S. carnosus.

Составы противомикробных полипептидов по изобретению могут быть введены лицу, страдающему от или предрасположенному к микробной легочной инфекции, такой как пневмония; или к микробной раневой инфекции, такой как бактериальная раневая инфекция.

Составы противомикробных полипептидов по изобретению могут быть введены лицу, страдающему от или предрасположенному к инфекции кожи, такой как акне, атопический дерматит или себорейный дерматит; предпочтительно, инфекция кожи является бактериальной инфекцией кожи, например, вызванной Staphylococcus epidermidis, Staphylococcus aureus, Propionibacterium acnes, Pityrosporum ovale или Malassezia furfur.

Противомикробные полипептиды по изобретению также применимы для in vitro фармацевтических составов для уничтожения микробов, особенно где нежелательно вводить множество традиционных антибиотиков. Например, противомикробные полипептиды по изобретению могут быть добавлены к пищевым продуктам для животных и/или людей; или они могут быть включены как добавка для культур клеток in vitro, чтобы предотвратить разрастание микробов в клеточной культуре тканей.

Восприимчивость определенного микроба к лизису противомикробными полипептидами изобретения может быть определена посредством тестирования in vitro, подробно описанного в экспериментальном разделе. Обычно культуру микроорганизма соединяют с противомикробным полипептидом при различных концентрациях на период времени, достаточной для белка, чтобы подействовать, обычно между, примерно, одним часом и одним днем. Оставшихся в живых микробов потом подсчитывают и определяют уровень лизиза.

Микробы, представляющие интерес, включают, но не ограничиваются этим, грамположительные бактерии, например: Citrobacter sp.; Enterobacter sp.; Escherichia sp., например, E. coli; Klebsiella sp.; Morganella sp.; Proteus sp.; Providencia sp.; Salmonella sp., например, S. typhi, S. typhimurium; Serratia sp.; Shigella sp.; Pseudomonas sp., например, P. aeruginosa; Yersinia sp., например, Y. pestis, Y. pseudotuberculosis, Y. enterocolitica; Franciscella sp.; Pasturella sp.; Vibrio sp., например, V. cholerae, V. parahemolyticus; Campylobacter sp., например, C. jejuni; Haemophilus sp., например, H. influenzae, H. ducreyi; Bordetella sp., например, B. pertussis, B. bronchiseptica, B. parapertussis; Brucella sp., Neisseria sp., например, N. gonorrhoeae, N. meningitidis и т.п. Другие бактерии, представляющие интерес, включают Legionella sp., например, L pneumophila; Listeria sp., например, L. monocytogenes; Mycoplasma sp., например, M. hominis, M. pneumoniae; Mycobacterium sp., например, M. tuberculosis, M. leprae; Treponema sp., например, T. pallidum; Borrelia sp., например, B. burgdorferi; Leptospirae sp.; Rickettsia sp., например, R. rickettsii, R. typhi; Chlamydia sp., например, C. trachomatis, C. pneumoniae, C. psittaci; Helicobacter sp., например, H. pylori и т.п.

Небактериальные патогены, представляющие интерес, включают грибные и протозойные патогены, например, Plasmodia sp., например, P. falciparum, Trypanosoma sp., например, T. brucei; шистозомы; Entaemoeba sp., Cryptococcus sp., Candida sp., например, C. albicans и т.п.

Могут быть использованы различные методы введения. Полипептидная композиция может вводиться перорально, или может быть введен внутрисосудисто, подкожно, внутрибрюшинно, в виде аэрозоля, через глаз, внутрь мочевого пузыря, местно и т.п. Например, способы введения посредством ингаляции, являются широко известными в данной области. Доза терапевтической композиции будет широко варьировать в зависимости от конкретного вводимого противомикробного полипептида, природы заболевания, частоты введения, способа введения, выведения агента из пациента и тому подобного. Начальная доза может быть больше, с последующими более меньшими поддерживающими дозами. Доза может быть введена так нечасто, как еженедельно, или раз в две недели, или разделена на более мелкие дозы и введена один или несколько раз в день, два раза в неделю и т.п., чтобы поддерживать эффективный уровень дозировки. Во многих случаях пероральное введение будет требовать более высокой дозы, чем внутривенное введение. Амидные связи, а также амино- и карбоксиконцы могут быть модифицированы для более высокой стабильности при пероральном введении. Например, карбоксиконец может быть амидирован.

Составы

Соединения по изобретению могут быть включены во множество составов для терапевтического введения. Более конкретно, соединения по изобретению могут быть введены в составы посредством сочетания с соответствующими, фармацевтически приемлемыми носителями или разбавителями и могут быть введены в твердые, мягкие, жидкие или газообразные препараты, такие как таблетки, капсулы, порошки, гранулы, мази, кремы, пены, растворы, суппозитории, инъекции, ингаляторы, гели, микросферы, лосьоны и аэрозоли. Как таковое, введение соединений может быть достигнуто различными путями, включая пероральное, буккальное, ректальное, парентеральное, внутрибрюшинное, внутрикожное, трансдермальное, интрахеальное и т.п. введение. Противомикробные полипептиды по изобретению могут быть системными после введения или могут быть локализованными посредством применения импланта или другой рецептурной формы, которая действует, удерживая активную дозировку в месте имплантации.

В одном варианте осуществления изобретения состав для топического применения содержит хелатирующий агент, который уменьшает эффективную концентрацию бивалентных катионов, особенно кальция и магния. Например, агенты, такие как цитрат, EGTA или EDTA, могут быть включены, причем цитрат является предпочтительным. Концентрация цитрата составляет обычно от, примерно, 1 до 10 мМ.

Соединения согласно настоящему изобретению могут быть введены индивидуально, в комбинации друг с другом или они могут быть использованы в комбинации с другими известными соединениями (например, перфорином, противовоспалительными агентами, антибиотиками и т.п.). В фармацевтические дозировочные формы соединения могут быть введены в виде их фармацевтически приемлемых солей. Следующие способы и вспомогательные вещества являются только иллюстративными и не в коей мере не ограничивающими.

Для пероральных препаратов соединения могут быть использованы индивидуально или в сочетании с соответствующими добавками для изготовления таблеток, порошков, гранул или капсул, например, с общеизвестными добавками, такими как лактоза, маннит, кукурузный или картофельный крахмал; со связывающими веществами, такими как кристаллическая целлюлоза, производные целлюлозы, камедь, кукурузный крахмал или желатины; с разрыхлителями, такими как кукурузный крахмал, картофельный крахмал или натриевая карбоксиметилцеллюлоза; со смазками, такими как тальк или стеарат магния; и, если желательно, с разбавителями, буферными агентами, увлажняющими агентами, консервантами и ароматизаторами.

Соединения могут быть введены в препараты для инъекций путем растворения, суспендирования или эмульгирования их в водном или неводном растворителе, таком как растительное или другие похожие масла, синтетические глицериды насыщенных кислот, сложные эфиры высших алифатических кислот или пропилен гликоль; и, если желательно, с обычными добавками, такими как растворители, изотонические агенты, суспендирующие агенты, эмульгирующие агенты, стабилизаторы и консерванты.

Соединения могут быть использованы в виде аэрозольного состава для введения посредством ингаляции. Соединения настоящего изобретения могут быть введены в рецептуру в находящиеся по давлением приемлемые пропелленты, такие как дихлордифторметан, пропан, азот и подобные им.

Соединения могут быть использованы в качестве лосьонов, например, для предотвращения инфицирования ожогов, посредством введения в рецептуру с обычными добавками, такими как растворители, изотонические агенты, суспендирующие агенты, эмульгирующие агенты, стабилизаторы и консерванты.

Кроме того, соединения могут быть изготовлены в суппозиториях посредством смешивания с множеством оснований, таких как эмульгирующие основания или водоосновные основания. Соединения согласно настоящему изобретению могут вводиться ректально через суппозиторий. Суппозиторий может включать носители, такие как какао-масло, карбоваксы и полиэтиленгликоли, которые растворяются при температуре тела, оставаясь твердыми при комнатной температуре.

Могут быть использованы стандартные лекарственные формы для перорального или ректального введения, такие как сиропы, эликсиры и суспензии, где каждая единица дозы, например, чайная ложка, столовая ложка, таблетка или суппозиторий содержит предопределенное количество состава, содержащего одно или больше соединений согласно настоящему изобретению. Сходным образом, стандартные лекарственные формы для инъекций или внутривенного введения могут содержать соединение согласно настоящему изобретению в композиции в качестве раствора в стерильной воде, физиологическом растворе или другом фармацевтически приемлемом носителе.

Импланты для рецептурных форм длительного высвобождения являются хорошо известными в данной области. Импланты являются рецептурной формой, как микросферы, полоски и т.п. с биоразлагаемыми и небиоразлагаемыми полимерами. Например, полимеры молочной кислоты и/или гликолевой кислоты образуют эродируемый полимер, который хорошо переносится пациентом. Имплант, содержащий противомикробные полипептиды изобретения, помещается в непосредственной близости от места инфекции, так что местная концентрация активного агента является увеличенной по сравнению с остальным телом.

Термин «стандартная лекарственная форма», используемый здесь, относится к физически дискретным единицам, подходящим в качестве единичных дозировок для людей и животных, каждой единицей, содержащей предопределенное количество соединений настоящего изобретения, рассчитанных в количестве, достаточном для получения желаемого эффекта в сочетании с фармацевтически приемлемыми разбавителем, носителем или средством доставки. Технические характеристики для стандартных лекарственных форм согласно настоящему изобретению зависят от конкретного используемого соединения и достигаемого эффекта, и фармакодинамики, ассоциированной с соединением в организме пациента.

Фармацевтически приемлемые эксципиенты, такие как средства доставки, адьюванты, носители или разбавители, являются легко доступными всем. Более того, фармацевтически приемлемые вспомогательные вещества, такие как агенты для подведения рН и буферные агенты, агенты для подведения физиологической концентрации солей, стабилизаторы, увлажняющие агенты и им подобные, являются легко доступными всем.

Типичные дозировки для системного введения находятся в границах от 0,1 до 100 миллиграммов на кг массы тела пациента на введение. Обычная дозировка может быть одной таблеткой, принимаемой от двух до шести раз в день, или одной капсулой или таблеткой замедленного высвобождения, принимаемой раз в день и содержащей пропорционально более высокое содержание активного ингредиента. Эффект замедленного высвобождения может быть получен при помощи материалов капсулы, которые растворяются при различных значениях рН, при помощи капсул, которые высвобождают медленно под действием осмотического давления или посредством любых других известных средств контролируемого высвобождения.

Специалисту понятно, что уровни доз могут варьировать в зависимости от конкретного соединения, тяжести симптомов и восприимчивости пациента к побочным эффектами. Некоторые из конкретных соединений являются более сильными, чем другие. Предпочтительные дозы для данного соединения являются легко определимыми специалистом путем разнообразных способов. Предпочтительным способом является измерение физиологической активности данного соединения.

Использование липосом в качестве средства доставки является одним способом, представляющим интерес. Липосомы сливаются с клетками в целевом месте и доставляют содержимое липосомы внутрь клетки. Для слияния в течение достаточного времени поддерживают контакт липосом с клетками, используя различные средства для поддержания контакта, такие как выделение, связывающие агенты и им подобные. В одном аспекте изобретения липосомы разработаны в виде аэрозоля для введения через легкие. Липосомы могут быть приготовлены с очищенными белками или пептидами, которые опосредуют слияние мембран, такими как вирус Сендай или вирус гриппа и т.п. Липидами может являться любая пригодная комбинация известных образующих липосомы липидов, включая катионные или цвиттер-ионные липиды, такие как фосфатидилхолин. Остальные липиды будут обычно нейтральными или кислыми липидами, такими как холестерин, фосфатидилсерин, фосфатидилглицерин и им подобные.

Для получения липосом может быть использована методика, описанная Kato et al. (1991) J. Biol. Chem. 266:3361. Кратко, липиды и композиция просвета липосом, содержащий пептиды, смешивают в соответствующей водной среде, обычно физиологической среде, где общий сухой остаток будет находиться в пределах, примерно, 1-10 весовых процентов. После интенсивного встряхивания в течение коротких периодов времени от, примерно, 5-60 с. пробирку помещают в теплую водяную баню с температурой, примерно, 25-40°С и цикл повторяют, примерно, 5-10 раз. Композицию затем озвучивают в течение подходящего периода времени, обычно от, примерно, 1-10 с, и могут далее встряхивать на вортексе. Затем увеличивают объем добавлением водной среды, обычно увеличивая объем в, примерно, 1-2 раза, с последующими встряхиванием и охлаждением. Этот способ позволяет включать в просвет липосом молекулы с большим молекулярным весом.

Составы с другими активными агентами

Для использования в рассматриваемых способах противомикробные полипептиды по изобретению могут быть введены в состав с другими фармацевтически активными агентами, в частности, с другими противомикробными агентами. Другие агенты, представляющие интерес, включают широкий спектр антибиотиков, известных в данной области. Классы антибиотиков включают пенициллины, например, пенициллин G, пенициллин V, метициллин, оксациллин, карбенициллин, нафциллин, ампициллин и т.п.; пенициллины в сочетании с ингибиторами бета-лактамазы; цефалоспорины, например, цефаклор, цефазолин, цефуроксим, моксалактам и т.п.; карбапенемы; монобактамы; аминогликозиды; тетрациклины; макролиды; линкомицины; полимиксины; сульфонамиды; кинолоны; хлорамфеникал; метронидазол; спектиномицин; триметоприм; ванкомицин; и т.п.

Противогрибковые агенты также являются пригодными, включая полиены, например, амфотерицин В, нистатин; 5-флукозин; и азолы, например, миконазол, кетоконазол, итраконазол и флуконазол. Противотуберкулезные лекарства включают изониазид, этамбутол, стрептомицин и рифампин. Цитокины могут также быть включены в состав противомикробных полипептидов изобретения, например, интерферон гамма, фактор некроза опухолей альфа, интерлейкин 12 и т.п.

Синтез in vitro

Противомикробные полипептиды по изобретению могут быть получены посредством синтеза in vitro, используя стандартные методы, известные в науке. Доступными являются различные продажные аппараты для синтеза, например, автоматические синтезаторы фирм Applied Biosystems Inc., Beckman и т.п. При использовании синтезаторов встречающиеся в природе аминокислоты могут быть заменены на не встречающиеся в природе аминокислоты, особенно D-изомеры (или D-формы), например, D-аланин или D-изолейцин, диастереоизомеры, боковые цепи, имеющие отличную длину или другие функции и им подобные. Конкретная последовательность и способ получения будут определяться удобством, экономическими соображениями, требуемой чистотой и им подобными.

Химическое сшивание может быть обеспечено у пептидов или белков, содержащих удобные функциональные группы для связывания, такие как аминогруппы для образования амидов или замещенных аминов, например, восстановительным аминированием, тиольные группы для образования тиоэфиров или дисульфидных связей, карбоксильные группы для образования амидов и им подобные.

Если желательно, различные группы могут быть введены в пептид в ходе синтеза или в ходе экспрессии, которые позволяют сшивание с другими молекулами или с поверхностью. Так, цистеины могут быть использованы для создания тиоэфиров, гистидины для связывания с комплексами ионов металлов, карбоксильные группы для образования амидов или сложных эфиров, аминогруппы для образования амидов и им подобные.

Полипептиды могут быть выделены и очищены по общеизвестным способам рекомбинантного синтеза. Можно получить лизат экспрессирующих клеток-хозяев и очистить лизат с помощью ВЭЖХ, гель-фильтрации, электрофореза в геле, аффинной хроматографии или другой методики очистки. По большей части, используемые композиции будут содержать по крайней мере 20% по весу желаемого продукта, предпочтительно, по крайней мере примерно 75% по весу, более предпочтительно, по крайней мере примерно 95% по весу и для терапевтических целей обычно по крайней мере примерно 99,5% по весу по отношению к примесям, связанных со способом получения продукта и его очистки. Обычно процентные соотношения будут основаны на общем белке.

Корм для животных

Настоящее изобретение является также направленным на способы применения полипептидов, обладающих противомикробным действием, в корме для животных, а также на композиции корма и кормовые добавки, содержащие противомикробные полипептиды изобретения.

Термин животное включает всех животных, включая людей. Примерами животных являются не жвачные животные и жвачные животные, такие как коровы, овцы и лошади. В конкретном варианте осуществления изобретения животное является не жвачным животным. Не жвачные животные включают животных с однокамерным желудком, например свиней или хряков (включая, но не ограничиваясь этим, поросят, откормочных свиней и свиноматок); домашнюю птицу, такую как индейки и куры (включая, но не ограничиваясь этим, бройлерных кур, несушек); молодых телят; и рыбу (включая, но не ограничиваясь этим, лосося).

Термин корм или композиция корма означает любое соединение, получение, смесь или композиция, подходящая для или направленная на прием внутрь животным.

В применении по изобретению противомикробные полипептиды могут быть скормлены животному перед, после или одновременно с питанием. Последнее является предпочтительным.

В конкретном варианте осуществления изобретения противомикробный полипептид в виде, в котором он добавлен к корму, или при включении в кормовую добавку является строго определенным. Строго определенный означает, что препарат противомикробного полипептида является по крайней мере 50% чистоты, определенной посредством гель-фильтрационной хроматографии (см. Пример 12 из WO 01/58275). В других отдельных вариантах осуществления изобретения препарат противомикробного полипептида имеет 60, 70, 80, 85, 88, 90, 92, 94 или по крайней мере 95% чистоты, определенной посредством этого способа.

Строго определенный противомикробным препарат является выгодным. Например, намного легче дозировать правильно в корм противомикробный полипептид, который является практически свободным от мешающих или загрязняющих других противомикробных полипептидов. Термин дозировать правильно относится в частности к задаче получения согласованных и постоянных результатов и способности оптимизировать дозировку, исходя из желаемого эффекта.

Для применения в корме для животных, однако, противомикробный полипептид необязательно должен быть этой чистоты; он может включать, например, другие ферменты, в таком случае он может называться препаратом противомикробного полипептида.

Препарат противомикробного полипептида может быть (а) добавлен непосредственно в корм (или использован прямо в процессе обработки растительных белков) или (b) он может быть использован в получении одной или более промежуточных композиций, таких как кормовые добавки или предварительно приготовленные смеси, которые впоследствии добавляют в корм (или используют в процессе обработки). Степень чистоты, описанная выше, относится к первоначальному препарату противомикробного полипептида, используемому или по (а) или по (b).

Препараты противомикробных полипептидов с чистотой в данном порядке величин являются в частности получаемыми, используя рекомбинантные способы получения, тогда как их не так легко получить и они также подвержены намного более высоким вариациям от партии к партии, при получении противомикробного полипептида традиционными ферментационными способами.

Такой препарат противомикробного полипептида может быть, конечно, смешан с другими ферментами.

Термин растительные белки, используемый здесь, относится к любому соединению, композиции, препарату или смеси, которые включают по крайней мере один белок, полученный или происходящий из растения, включая модифицированные белки и производные белков. В конкретных вариантах осуществления изобретения содержание растительных белков составляет по крайней мере 10, 20, 30, 40, 50 или 60% (весовых).

Растительные белки могут быть получены из источников растительных белков, таких как бобовые и зерновые, например, материалов из растений семейств Fabaceae (Leguminosae), Cruciferaceae, Chenopodiaceae и Poaceae, таких как мука из соевых бобов, мука из люпина и мука из рапсовых семян.

В конкретном варианте осуществления изобретения источник растительного белка является материалом из одного или более растений из семейства Fabaceae, например, сои, люпина, гороха или фасоли.

В другом конкретном варианте осуществления изобретения источник растительного белка является материалом из одного или более растений из семейства Chenopodiaceae, например, свеклы, сахарной свеклы, шпината или лебеды кино.

Другими примерами источников растительного белка являются семена рапса и капуста.

Соя является предпочтительным источником растительного белка.

Другими примерами источников растительного белка являются зерновые, такие как ячмень, пшеница, рожь, овес, маис (кукуруза), рис и сорго.

Противомикробный полипептид может быть добавлен к корму в любой форме, будучи как относительно чистым противомикробным полипептидом или в примеси с другими компонентами, предназначенными для добавления в корм для животных, т.е. в виде добавок в корм для животных, таких как так называемые заранее приготовленные смеси для корма для животных.

В дальнейшем аспекте настоящее изобретение относится к композициям для применения в корме для животных, таких как корм для животных и добавки в корм для животных, например, заранее приготовленные смеси.

Кроме противомикробного полипептида изобретения добавки в корм для животных изобретения содержат по крайней мере один жирорастворимый витамин и/или по крайней мере один водорастворимый витамин, и/или по крайней мере один микроэлемент, и/или по крайней мере один макроэлемент.

Далее, необязательно, кормодобавочными ингредиентами являются красители, ароматические соединения, стабилизаторы и/или по крайней мере один фермент, выбранный из фитаз ЕС 3.1.3.8. или 3.1.3.26; ксиланаз ЕС 3.2.1.8.; галактаназ ЕС 3.2.1.89; и/или бета-глюканаз ЕС 3.2.1.4.

В конкретном варианте осуществления изобретения эти другие ферменты являются строго определенными (как определено выше для препаратов противомикробных полипептидов).

Примерами других противомикробных полипептидов (AMPs) являются САР18, Лейкоцин А, Тритрптицин, Протегрин-1, Танатин, Дефензин, Овиспирин, такой как Новиспирин (Robert Lehrer, 2000), и варианты или фрагменты этого, которые сохраняют противомикробную активность.

Примерами других противогрибковых полипептидов (AFPs) являются пептиды из Aspergillus giganteus и Aspergillus niger, а также варианты или фрагменты этого, которые сохраняют противогрибковую активность, описанные в WO 94/01459 и WO 02/090384.

Обычно жиро- и водорастворимые витамины, а также микроэлементы образуют часть, так называемую заранее приготовленную смесь, предназначенную для добавления в корм, тогда как макроэлементы обычно отдельно добавляют в корм. Любая из этих типов композиций при обогащении противомикробным полипептидом изобретения является добавкой в корм для животных изобретения.

В конкретном варианте осуществления добавка в корм для животных изобретения предназначена для включения (или предписана как должна быть включена) в питание животных или корм на уровне от 0,01 до 10%; более конкретно, от 0,05 до 5,0%; или от 0,2 до 1% (% означает значение в граммах добавки на 100 г корма). Это так, в частности, для заранее приготовленных смесей.

Нижеследующее является неисключительным списком примеров этих соединений:

Примерами жирорастворимых витаминов являются витамин А, витамин D3, витамин Е и витамин К, например витамин К3.

Примерами водорастворимых витаминов являются витамин В12, биотин и холин, витамин В1, витамин В2, витамин В6, ниацин, фолиевая кислота и пантотенат, например Са-D-пантотенат.

Примерами микроэлементов являются марганец, цинк, железо, медь, йод, селен и кобальт.

Примерами макроэлементов являются кальций, фосфор и натрий.

Потребность в этих соединениях (проиллюстрированная на домашней птице и поросятах/свиньях) приведена в Таблице А из WO 01/58275. Потребность означает, что эти соединения должны быть обеспечены в питании в указанных концентрациях.

В качестве альтернативы добавка в корм животных по изобретению содержит по крайней мере один из индивидуальных компонентов, определенных в Таблице А из WO 01/58275. По крайней мере один означает или один, или более одного, или два, или три, или четыре и т.д. до всех тринадцати или до всех пятнадцати индивидуальных компонентов. Более определенно, этот по крайней мере один индивидуальный компонент является включенным в добавку изобретения в таком количестве, чтобы обеспечить концентрацию в корме в пределах, указанных в колонке четыре, или колонке пять, или колонке шесть Таблицы А.

Настоящее изобретение также относится к композициям корма для животных. Композиции корма для животных или питание имеют относительно высокое содержание белка. Питание домашней птицы или свиней может отличаться как указано в Таблице В из WO 01/58275, колонки 2-3. Питание рыб может отличаться как указано в колонке 4 из этой Таблицы В. Кроме того, такое питание рыб обычно имеет общее содержание жиров 200-310 г/кг.

Композиция корма для животных по изобретению имеет содержание общего белка 50-800 г/кг и, кроме того, содержит по крайней мере один противомикробный полипептид, заявленный здесь.

Кроме того или в качестве альтернативы (к содержанию общего белка, указанному выше), композиция корма для животных изобретения имеет содержание метаболизируемой энергии 10-30 МДж/кг; и/или содержание кальция 0,1-200 г/кг; и/или содержание доступного фосфора 0,1-200 г/кг; и/или содержание метионина 0,1-100 г/кг; и/или содержание метионина плюс цистеин 0,1-150 г/кг; и/или содержание лизина 0,5-50 г/кг.

В конкретных вариантах осуществления изобретения содержание метаболизируемой энергии, общего белка, кальция, фосфора, метионина, метионина плюс цистеин и/или лизина находится в любом одном из рядов 2, 3, 4 или 5 в Таблице В из WO 01/58275 (Р. 2-5).

Общий белок подсчитывается как азот (N), умноженный на фактор 6,25, т.е. Общий белок (г/кг)=N (г/кг)х6,25. Содержание азота определяется при помощи метода Кьельдаля (А.О.А.С., 1984, Official Methods of Analysis 14th ed., Association of Official Analytical Chemists, Washington DC).

Метаболизируемая энергия может быть подсчитана на основе NRC издания Nutrient requirements in swine, ninth revised edition 1988, subcommittee on swine nutrition, committee on animal nutrition, board of agriculture, national research council. National Academy Press, Washington, D. C, p. 2-6 и European Table of Energy Values for Poultry Feed-stuffs, Spelderholt centre for poultry research and extension, 7361 DA Beekbergen, The Netherlands. Grafisch bedrijf Ponsen & looijen bv, Wageningen. ISBN 90-71463-12-5.

Содержание в рационе кальция, доступного фосфора и аминокислот в полноценном питании для животных подсчитывается на основе таблиц, таких как Veevoedertabel 1997, gegevens over chemische samenstelling, verteerbaarheid en voederwaarde van voedermiddelen, Central Veevoederbureau, Runderweg 6, 8219 pk Lelystad. ISBN 90-72839-13-7.

В конкретном варианте осуществления изобретения композиция корма для животных изобретения содержит по крайней мере один растительный белок или источник белка, определенный выше.

В еще далее частных вариантах осуществления изобретения композиция корма для животных изобретения содержит 0-80% маиса; и/или 0-80% сорго; и/или 0-70% пшеницы; и/или 0-70% ячменя; и/или 0-30% овса; и/или 0-40% соевой муки; и/или 0-10% рыбной муки; и/или 0-20% молочной сыворотки. Животные рационы могут, например, быть изготовлены как мешанка (не гранулированная) или гранулированный корм. Обычно перемолотые кормовые продукты смешивают и добавляют достаточное количество необходимых витаминов и минералов по техническим условиям для данного вида. Ферменты могут быть добавлены в качестве твердых или жидких ферментных композиций. Например, твердую ферментную композицию обычно добавляют перед или в течение этапа смешивания; а жидкую ферментную композицию обычно добавляют после этапа гранулирования. Фермент может также быть включенным в кормовую добавку или заранее приготовленную смесь.

Конечная концентрация фермента в питании находится в пределах от 0,01-200 мг белкового фермента на кг рациона, например, в пределах 5-30 мг белкового фермента на кг животного рациона.

Противомикробный полипептид может быть введен в одном или более из следующих количеств (диапазонов доз): 0,01-200; или 0,01-100; или 0,05-100; или 0,05-50; или 0,10-10 - все эти пределы, являющиеся в мг противомикробного полипептидного белка на килограмм корма (ррm).

Для определения мг противомикробного полипептида на кг корма противомикробный полипептид очищают из комовой композиции, и специфическую активность очищенного противомикробного полипептида определяют, используя подходящий метод анализа (см. на противомикробную активность, субстраты и методы анализа). Противомикробная активность кормовой композиции как таковой также определяется, используя тот же метод анализа, и на основе этих двух определений подсчитывается доза в мг противомикробного полипептидного белка на кг корма.

Те же принципы применяются для определения мг противомикробного полипептидного белка в кормовых добавках. Конечно, если доступен образец противомикробного полипептида, используемого для приготовления кормовой добавки или корма, специфическая активность определяется из этого образца (нет нужды очищать противомикробный полипептид из кормовых композиции или добавки).

Сигнальный пептид или пропептид

Настоящее изобретение также относится к конструкциям нуклеиновых кислот, содержащих ген, кодирующий белок, функционально присоединенный к одной или обеим из первой нуклеотидной последовательности, состоящей из нуклеотидов с 1 по 57 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 или SEQ ID NO:9, кодирующих сигнальный пептид, состоящий из аминокислот от -50 до -32 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10; нуклеотидов с 1 по 63 из SEQ ID NO:11 или SEQ ID NO:13, кодирующих сигнальный пептид, состоящий из аминокислот от -39 до -19 из SEQ ID NO:12 или SEQ ID NO:14; нуклеотидов с 1 по 63 из SEQ ID NO:15, SEQ ID NO:17 или SEQ ID NO: 19, кодирующих сигнальный пептид, состоящий из аминокислот от -37 до -17 из SEQ ID NO: 16, SEQ ID NO: 18 или SEQ ID NO:20; нуклеотидов с 1 по 63 из SEQ ID NO:21, кодирующих сигнальный пептид, состоящий из аминокислот от -39 до -19 из SEQ ID NO:22; нуклеотидов с 1 по 57 из SEQ ID NO:23, кодирующих сигнальный пептид, состоящий из аминокислот от -50 до -32 из SEQ ID NO:24; нуклеотидов с 1 по 63 из SEQ ID NO:25, кодирующих сигнальный пептид, состоящий из аминокислот от -40 до -20 из SEQ ID NO:26; или нуклеотидов с 1 по 66 из SEQ ID NO:27, кодирующих сигнальный пептид, состоящий из аминокислот от -48 до -27 из SEQ ID NO:28;

и второй нуклеотидной последовательности, состоящей из нуклеотидов с 58 по 150 из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 или SEQ ID NO:9, кодирующих пропептид, состоящий из аминокислот от -31 до -1 из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 или SEQ ID NO:10; нуклеотидов с 64 по 117 из SEQ ID NO:11 или SEQ ID NO:13, кодирующих пропептид, состоящий из аминокислот от -18 до -1 из SEQ ID NO:12 или SEQ ID NO:14; нуклеотидов с 64 по 111 из SEQ ID NO:15, SEQ ID NO:17 или SEQ ID NO:19, кодирующих пропептид, состоящий из аминокислот от -16 до -1 из SEQ ID NO:16, SEQ ID NO:18 или SEQ ID NO:20; нуклеотидов с 64 по 117 из SEQ ID NO:21, кодирующих пропептид, состоящий из аминокислот от -18 до -1 из SEQ ID NO:22; нуклеотидов с 58 по 150 из SEQ ID NO:23, кодирующих пропептид, состоящий из аминокислот от -31 до -1 из SEQ ID NO:24; нуклеотидов с 64 по 120 из SEQ ID NO:25, кодирующих пропептид, состоящий из аминокислот от -19 до -1 из SEQ ID NO:26; или нуклеотидов с 67 по 144 из SEQ ID NO:27, кодирующих пропептид, состоящий из аминокислот от -26 до -1 из SEQ ID NO:28; где ген является чужеродным по отношению к первой и второй нуклеотидным последовательностям.

Настоящее изобретение также относится к рекомбинантным экспрессионным векторам и рекомбинантным клеткам-хозяевам, содержащим такие конструкции нуклеиновых кислот.

Настоящее изобретение также относится к способам получения белка, содержащим (а) культивирование такой рекомбинантной клетки-хозяина при условиях, подходящих для получения белка; и (b) выделение белка.

Первая и вторая нуклеотидные последовательности могут быть функционально присоединены к чужеродным генам отдельно с другими управляющими последовательностями или в сочетании с другими управляющими последовательностями. Такие другие управляющие последовательности описаны supra. Как описано выше, где области как сигнального пептида, так и пропептида находятся на аминоконце белка, область пропептида располагается перед аминокислотным концом белка, а область сигнального пептида располагается перед аминокислотным концом области пропептида.

Белок может являться нативным или гетерологичным для клетки-хозяина. Термин «белок» здесь не предназначен, чтобы относиться к конкретной длине кодируемого продукта и, таким образом, охватывает пептиды, олигопептиды и белки. Термин «белок» также охватывает два или больше полипептидов, скомбинированных, чтобы образовать кодируемый продукт. Белки также включают гибридные полипептиды, которые содержат комбинацию частичной или полной полипептидных последовательностей, полученных из по крайней мере двух различных белков, где одна или более могут являться гетерологичными или нативными для клетки-хозяина. Белки далее включают естественно встречающиеся аллельные или искусственно созданные вариации вышеупомянутых белков и гибридных белков.

Предпочтительно, белок является гормоном или его вариантом, ферментом, рецептором или частью его, антителом или его частью, или репортером. В более предпочтительном аспекте, белок является оксидоредуктазой, трансферазой, гидролазой, лиазой, изомеразой или лигазой. В еще более предпочтительном аспекте, белок является аминопептидазой, амилазой, карбогидразой, карбоксипептидазой, каталазой, целлюлазой, хитиназой, кутиназой, циклодекстрин гликозилтрансферазой, дезоксирибонуклеазой, эстеразой, альфа-галактозидазой, бета-галактозидазой, глюкоамилазой, альфа-глюкозидазой, бета-глюкозидазой, инвертазой, лакказой, липазой, маннозидазой, мутаназой, оксидазой, пектинолитическим ферментом, пероксидазой, фитазой, полифенолоксидазой, протеолитическим ферментом, рибонуклеазой, трансглутаминазой или ксиланазой.

Ген может быть получен из любого прокариотического, эукариотического или другого источника.

Настоящее изобретение далее описано посредством следующих примеров, которые не должны быть истолкованы как лимитирующие объем изобретения.

ПРИМЕРЫ

Химикаты, используемые в качестве буферов и субстратов, являлись товарным продуктом по крайней мере реагентной чистоты (соответствует нашему ЧДА).

ПРИМЕР 1

Получение библиотеки кДНК из Arenicola marina

Библиотека кДНК была получена из кишечника A. marina. Была очищена обогащенная полиА мРНК, синтезирована кДНК и создана библиотека по стандартным методикам молекулярной биологии. Подробный протокол всего процесса можно найти в примерах международной патентной заявки WO 01/12794. Вектором, использованным для клонирования, являлся pMHАs7i. Плазмида pMHаs7i является производной pMhаs5 (см. WO 03/044049), в которой по SMART протоколу были созданы сайты клонирования SfiI, совместимые с адаптированной под SfiI кДНК. Кратко, EcoRI-NotI кДНК фрагмент адолазы человека из lambdaTripIX2 (Clontech) клонировали в сайты клонирования Eco-RI pMHas5. Получающаяся плазмида, pMHas7i содержит кДНК адолазы человека, фланкированную соответствующими сайтами SfiI, необходимыми для клонирования SMART адаптированных кДНК.

Получение pMHas7i для клонирования кДНК: Вектор обрабатывали эндонуклеазой рестрикции SfiI и очищали через гель от вставки адолазы посредством электрофореза в агарозном геле. Полосу, содержащую плазмиду, обработанную эндонуклеазой рестрикции, очищали посредством GFX обработки (компании GE Healthcare).

ПРИМЕР 2

Открытие пептидного семейства мариназинов посредством метода сигнального захвата из кДНК библиотеки из A. marina

Плазмидный пул кДНК получили из 20000 тотальных трансформантов исходного лигирования кДНК в pMHas5 вектор и провели метод сигнального захвата, как описано в WO 01/77315, получая в результате 381 контигов последовательностей.

Для всех 381 контигов был произведен индивидуальный поиск по базам данных и результаты проанализированы. Один контиг (ZY151351) обладал некоторой гомологией по аминокислотам с известными противомикробными полипептидами (сходные с дефензином полипептиды). Выведенный полипептид был назван Мариназин 1А (SEQ ID NO:6).

После повторного изучения 381 контигов посредством поиска гомологии с последовательностью полипептида Мариназин 1А были обнаружены несколько других «мариназинов» (SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28).

ПРИМЕР 3

Создание экспрессирующегося в Aspergillus вектора для мариназинов

кДНК, кодирующую предсказанный зрелый участок Мариназина 1 B (аминокислоты с 1 по 49 из SEQ ID NO:8), Мариназина 2A (аминокислоты с 1 по 46 из SEQ ID NO:12), Мариназина 3B (аминокислоты с 1 по 48 из SEQ ID NO:18), Мариназина 4 (аминокислоты с 1 по 45 из SEQ ID NO:22), Мариназина 5 (аминокислоты с 1 по 49 из SEQ ID NO:24), Мариназина 6 (аминокислоты с 1 по 44 из SEQ ID NO:26) и Мариназина 7 (аминокислоты с 1 по 59 из SEQ ID NO:28), амплифицировали из кДНК библиотеки из кишечника A. marina и соединяли с фрагментом кДНК, кодирующим пре-про область плектазина, следующим образом: 10 нг кДНК использовали в качестве матрицы в реакциях ПЦР, используя олигонуклеотиды, приведенные в Таблице 1.

Таблица 1
Мариназин1B-F 5' GGATGCGAACCAACTTCAGAAACGTAGCTGGCTATGTAACTGGTTGGGC 3'
Мариназин1B-R 5' CCCAAGCTTCACATGGTGTATGGTTGATCTCTCC 3'
Мариназин2А-F 5' GGATGCGAACCAACTTCAGAAACGTGGTTGGTGCTGGCAGTGGACATGT 3'
Мариназин2B-R 5' CCCAAGCTTGCCCTTCTAGCGTTCAGCTCTT 3'
Мариназин3B-F 5' GGATGCGAACCAACTTCAGAAACGTCATTGGTGTTTCGAGTGGTCATGT 3'
Мариназин3B-R 5' CCCAAGCTTTCAGTGGAGAACCGTTACAGCA 3'
Мариназин4-F 5' GGATGCGAACCAACTTCAGAAACGTATCCCCTGTTGGACTCCGACATGT 3'
Мариназин4-R 5' CCCAAGCTTAGCCCAGTATGCTCTGCACGT 3'
Мариназин5-F 5' GGATGCGAACCAACTTCAGAAACGTGGGGGCCGGCCCTGTCATAGGCAT 3'
Мариназин5-R 5' CCCAAGCTTAGTTGTTCGCTCCATTAGCACCT 3'
Мариназин6-F 5' ACCAACTTCAGAAACGTGGCAGGTCGTGTAATTTCTGGTT 3'
Мариназин6-R 5' CCCAAGCTTTGGGCGATTCTATCTGCCTCTTA 3'
Мариназин7-F 5' ACCAACTTCAGAAACGTGGTGGGATGTGTGGTGACGA 3'
Мариназин7-R 5' CCCAAGCTTGCACATCGTTTCCACCGCAA 3'

5 пмоль каждого праймера F (прямого) и R (обратного) (например, Мариназин1B-F и Мариназин1B-R) использовались в 25 мкл объема реакции с Expand High Fidelity PCR System (Roche). После денатурации при 94°С в течение 2 минут проводили 35 циклов ПЦР по следующей программе: 94°С в течение 15 с и 60°С в течение 60 с.

Пре-про область плектазина, включая интрон длиной 58 п.о. (смотри Примеры из WO 03/044049), была амплифицирована из плазмидной матрицы, используя олигонуклеотиды, приведенные в Таблице 2.

Таблица 2
PlecBHI-F 5' CGCGGATCCCACCATGCAATTTACCACCATCCTCTC 3'
Plec-Mar1B-R 5' GCCCAACCAGTTACATAGCCAGCTACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar2A-R 5' ACATGTCCACTGCCAGCACCAACCACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar3B-R 5'ACATGACCACTCGAAACACCAATGACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar4-R 5'TCCAACAGGGGATACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar5-R 5' ATGCCTATGACAGGGCCGGCCCCCACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar6-R 5' AAATTACACGACCTGCCACGTTTCTGAAGTTGGTTCGCATCC 3'
Plec-Mar7-R 5'CACACATCCCACCACGTTTCTGAAGTTGGTTCGCATCC 3'

5 пмоль каждого праймера F и R (например, PlecBHI-F и Мариназин1B-R) использовались в 25 мкл объема реакции с Expand High Fidelity PCR System (Roche). После денатурации при 94°С в течение 2 минут проводили 35 циклов ПЦР по следующей программе: 94°С в течение 15 с и 60°С в течение 60 с.

Реакции ПЦР разделяли в 2% агарозном геле. Полосы ожидаемого размера как для кДНК мариназина, так и для пре-про участка плектазина выделяли, используя набор для очистки ДНК GFX DNA purification kit (Amersham) по протоколу изготовителя. 1/50 очищенного материала использовали в качестве матрицы для ПЦР для соединения, используя прямой праймер из плектазина и обратный праймер из мариназина (например, для Мариназина 1В: Продукт Мариназина1В-F и Мариназина1В-R, совмещенный с продуктом PlecBHI-F и Plec-Mar1B-R, в качестве матрицы, используя PlecBHI-F и Мариназин1B-R в качестве праймеров). 5 пмоль каждого праймера F и R (например, Мариназин1В-F и Мариназин1В-R) использовали в 25 мкл объема реакции с Expand High Fidelity PCR System (Roche). После денатурации при 94°С в течение 2 минут проводили 25 циклов ПЦР по следующей программе: 94°С в течение 15 с и 60°С в течение 60 с. Реакции ПЦР разделяли в 2% агарозном геле. Полосы ожидаемого размера, кодирующие конструкции слитых плектазина/мариназина, выделяли, используя набор для очистки ДНК GFX DNA purification kit (Amersham) по протоколу изготовителя. Фрагменты расщепляли BamHI и HindIII, которые расщепляют выступающие концы, введенные с помощью ПЦР праймеров. Расщепленные фрагменты выделяли и клонировали в экспрессирующую плазмиду pDAu109 (см. Примеры из WO 2005/042735).

ПРИМЕР 4

Экспрессия мариназинов в Aspergillus

Плазмиды, экспрессирующие мариназины на базе pDAu109, трансформировали в штамм BECh2 Aspergillus orizae (см. WO 00/393229). От десяти до 20 трансформантов каждого штамма были повторно выделены дважды при селективных и неиндуцирующих условиях на плашках с минимальной средой Кова с сахарозой и ацетамидом. Для тестирования экспрессии мариназинов трансформантов растили в течение 3 дней при 26 градусах С в пробирках с 10 мл Dap2C-1 (см. «Среды» в Примерах из WO 2004/032648). Экспрессию проверяли с помощью Maldi-TOF и ДСН-ПААГ из культуральных супернатантов на 16% трициновых ДСН-гелях NuPage (Invitrogen), как рекомендовано изготовителем.

ПРИМЕР 5

Определение противомикробной активности методом радиальной диффузии

Супернатанты, описанные выше в Примере 4, анализировали посредством метода радиальной диффузии, следуя ранее опубликованному протоколу для определения противомикробной активности Lehrer et al., (1991) Ultra sensitive assays for endogenous antimicrobial polypeptides J Immunol Methods 137: 167-173). Целевые бактерии (106 колониеобразующих единиц (КОЕ)) добавили к 10 мл нижнего агарозного слоя (1% низкоплавкой электроосмотической агарозы, 0,03% триптиказо-соевой среды, 10 мM фосфата натрия, pH 7,4, 37 градусов Цельсия). Суспензия затвердевала на чашках Петри INTEGRID Petri Dish (Becton Dickinson Labware, NJ). Устройство Gel Puncher 3 мм использовали для проделавания отверстий в нижней агарозе (Amersham Pharmacia Biotech, Sweden). Образцы добавляли в отверстие и инкубировали при 37 градусах Цельсия, в течение 3 часов. Верхний слой заливали на поверхность и чашку инкубировали в течение ночи (среда LB, 7,5% агар). Противомикробное действие было видно, как зоны, свободные от бактерий, вокруг лунок. Живые клетки окрашивали 10 мл 0,2 мM MTT (3-(4,5-диметилтиазол-2-ил)-2,5-дифенилтетразолий бромид Тиазоловый синий). Все стандартные протоколы были описаны в другом месте (Sambrook, Fritsch, and Maniatis, 1989). Были сделаны электронные фотографии. Ингибирование бактериального роста видно как прозрачные зоны, которые измеряли с точностью до 0,1 нм и вычитали диаметр отверстия. Результаты показаны как зоны ингибирования исходных образцов (Таблица 3) и концентрированных образцов (Таблица 4) против ряда тестовых штаммов:

A: Staphylococcus simulans (ATCC11631)

B: Staphylococcus carnosus (ATCC51365)

C: Streptococcus hyointestinalis (ATCC49169)

D: Bacillus subtilis (ATCC23857)

E: Enterococcus saccharolyticus (ATCC43076)

F: Escherichia coli (ATCC10536)

G: Acinetobacter anitratus (ATCC17903)

H: Erwinia chrysanthemi (ATCC11663)

J: Pseudomonas boreopolis (ATCC15452)

Концентрирование образцов проводили осаждением 45 мл культурального супернатанта с 2,5 мл 100% ТХУ и ресуспендированием осажденного преципитата в 450 мкл буфера для ресуспендирования (100 мМ Tris, рН 8, 100 мМ NaCl).

Таблица 3
Результаты метода радиальной диффузии для исходных культуральных супернатантов рекомбинантных клонов A. oryzae, экспрессирующих мариназины. 10 единиц в методе радиальной диффузии соответствуют 1 мм диаметру прозрачной зоны вокруг 3 мм лунки для образца
Тестовый штамм
В С D Е
Мариназин 1В 21 10 10 9
Мариназин 2А 26 12 16 14
Мариназин 4 60 54 32 43
Мариназин 6 - 45 39 40
Контроль 0 0 0 0
Таблица 4
Результаты метода радиальной диффузии для осажденных ТХУ культуральных супернатантов из рекомбинантных A. oryzae клонов, экспрессирующих мариназины (концентрированные в 100 раз). 10 единиц в методе радиальной диффузии соответствуют 1 мм диаметру прозрачной зоны вокруг 3 мм лунки для образца.
Тестовый штамм
A B C D Е F G Н J
Мариназин 1В 22 25 22 28 30 25 26 25 28
Мариназин 2А 34 35 35 38 41 25 39 40 39
Мариназин 4 14 81 59 32 68 0 6 0 0
Мариназин 5 22 13 24 25 23 19 26 26 22
Контроль 0 0 0 0 0 0 0 0 0

ПРИМЕР 6

Применение НММ файлов из базы данных PFAM для идентификации дефензина

Анализ последовательностей, использующий профайлы скрытой модели маркова (НММ профайлы), может быть проведен или онлайн в Интернете или местно на компьютере, используя широко известный программный пакет НММЕR в свободном доступе. Текущей версией является НММЕR 2.3.2, датированная октябрем 2003.

НММ профайлы можно получить из широко известной базы данных PFAM. Текущей версией является PFAM 16.0, датированная ноябрем 2004. Как НММЕR, так и PFAM являются доступными для всех компьютерных платформ от, например, Университета Вашингтон в Сент-Луисе (США), Школа Медицины (http://pfam.wustl.edu и http://hmmer.wustl.edu).

Если запрошенная аминокислотная последовательность или ее фрагмент принадлежит к одному из следующих пяти семейств PFAM, то аминокислотная последовательность является дефензином по изобретению:

Дефензин_бета или «Бета Дефензин», номер доступа: PF00711;

Дефензин_пропеп или «Дефензин пропептид», номер доступа: PF00879;

Дефензин_1 или «Дефензин млекопитающих», номер доступа: PF00323;

Дефензин_2 или «Дефензин членистоногих», номер доступа: PF01097;

Гамма-тионин или «Семейство гамма-тионинов», номер доступа: PF00304.

Аминокислотная последовательность принадлежит к семейству PFAM по изобретению, если она образует Е-величину, которая больше, чем 0,1, и счет, который больше или равен нулю, когда база данных PFAM используется онлайн или когда hmmpfam программа (из HMMER программного пакета) используется местно.

Когда анализ последовательности проводится местно, используя программу hmmpfam, является необходимым получить (скачать) НММ профайлы из базы данных PFAM. Два профайла существуют для каждого семейства: «xxx_ls.hmm» для общих поисков и «xxx_fs.hmm» для локальных поисков («ххх» является названием семейства). Это составляет всего 10 профайлов для пяти семейств, упомянутых выше.

Эти десять профайлов могут использоваться индивидуально или объединенными (прибавленными) в одном профайле (используя текстовый редактор - профайлы являются ASCII файлами), который может быть назван, например defensin.hmm. Запрошенная аминокислотная последовательность может быть затем оценена, используя следующую командную строку:

hmmpfam -E 0.1 defensin.hmm sequence_file

- где «sequence_file» является файлом с запрашиваемой аминокислотной последовательностью в любом из форматов, распознаваемых программным пакетом HMMER.

Если счет является больше или равным нулю (0,0), и Е-величина является больше, чем 0,1, то запрашиваемая аминокислотная последовательность является дефензином по изобретению.

База данных PFAM далее описана в Bateman et al. (2004) "The Pfam Protein Families Database", Nucleic Acids Research, Vol. 32 (Database Issue) p. D138-D141.

1. Полипептид дефензина, обладающий противомикробной активностью, который содержит аминокислотную последовательность, представленную
С-х(3)-С-х(7,9)-С-С и С-С-х(8)-С-х-С и С-х-С-х(8,11)-С.

2. Полипептид по п.1, который является:
(а) полипептидом, содержащим аминокислотную последовательность, которая имеет по крайней мере 60% идентичности с:
аминокислотами с 1 по 49 из SEQ ID NO:2,
аминокислотами с 1 по 49 из SEQ ID NO:4,
аминокислотами с 1 по 49 из SEQ ID NO:6,
аминокислотами с 1 по 49 из SEQ ID NO:8,
аминокислотами с 1 по 49 из SEQ ID NO:10,
аминокислотами с 1 по 46 из SEQ ID NO:12,
аминокислотами с 1 по 46 из SEQ ID NO:14,
аминокислотами с 1 по 48 из SEQ ID NO:16,
аминокислотами с 1 по 48 из SEQ ID NO:18,
аминокислотами с 1 по 48 из SEQ ID NO:20,
аминокислотами с 1 по 45 из SEQ ID NO:22,
аминокислотами с 1 по 49 из SEQ ID NO:24,
аминокислотами с 1 по 44 из SEQ ID NO:26,
или аминокислотами с 1 по 59 из SEQ ID NO:28; или
(b) полипептидом, который кодируется нуклеотидной последовательностью, которая гибридизуется при по крайней мере средних условиях с (i):
нуклеотидами от 151 до 297 из SEQ ID NO:1,
нуклеотидами от 151 до 297 из SEQ ID NO:3,
нуклеотидами от 151 до 297 из SEQ ID NO:5,
нуклеотидами от 151 до 297 из SEQ ID NO:7,
нуклеотидами от 151 до 297 из SEQ ID NO:9,
нуклеотидами от 118 до 255 из SEQ ID NO:11,
нуклеотидами от 118 до 255 из SEQ ID NO:13,
нуклеотидами от 112 до 255 из SEQ ID NO:15,
нуклеотидами от 112 до 255 из SEQ ID NO:17,
нуклеотидами от 112 до 255 из SEQ ID NO:19,
нуклеотидами от 118 до 252 из SEQ ID NO:21,
нуклеотидами от 151 до 297 из SEQ ID NO:23,
нуклеотидами от 121 до 252 из SEQ ID NO:25 или
нуклеотидами от 145 до 321 из SEQ ID NO:27; или (ii) комплементарной цепью (i).

3. Полипептид по п.2, содержащий аминокислотную последовательность, которая имеет по крайней мере 70% идентичности с:
аминокислотами с 1 по 49 из SEQ ID NO:2,
аминокислотами с 1 по 49 из SEQ ID NO:4,
аминокислотами с 1 по 49 из SEQ ID NO:6,
аминокислотами с 1 по 49 из SEQ ID NO:8,
аминокислотами с 1 по 49 из SEQ ID NO:10,
аминокислотами с 1 по 46 из SEQ ID NO:12,
аминокислотами с 1 по 46 из SEQ ID NO:14,
аминокислотами с 1 по 48 из SEQ ID NO:16,
аминокислотами с 1 по 48 из SEQ ID NO:18,
аминокислотами с 1 по 48 из SEQ ID NO:20,
аминокислотами с 1 по 45 из SEQ ID NO:22,
аминокислотами с 1 по 49 из SEQ ID NO:24,
аминокислотами с 1 по 44 из SEQ ID NO:26 или
аминокислотами с 1 по 59 из SEQ ID NO:28.

4. Полипептид, содержащий аминокислотную последовательность, которая имеет по крайней мере 80% идентичности с:
аминокислотами с 1 по 49 из SEQ ID NO:2,
аминокислотами с 1 по 49 из SEQ ID NO:4,
аминокислотами с 1 по 49 из SEQ ID NO:6,
аминокислотами с 1 по 49 из SEQ ID NO:8,
аминокислотами с 1 по 49 из SEQ ID NO:10,
аминокислотами с 1 по 46 из SEQ ID NO:12,
аминокислотами с 1 по 46 из SEQ ID NO:14,
аминокислотами с 1 по 48 из SEQ ID NO:16,
аминокислотами с 1 по 48 из SEQ ID NO:18,
аминокислотами с 1 по 48 из SEQ ID NO:20,
аминокислотами с 1 по 45 из SEQ ID NO:22,
аминокислотами с 1 по 49 из SEQ ID NO:24,
аминокислотами с 1 по 44 из SEQ ID NO:26 или
аминокислотами с 1 по 59 из SEQ ID NO:28.

5. Полипептид по п.2, содержащий аминокислотную последовательность, которая имеет по крайней мере 90% идентичности с:
аминокислотами с 1 по 49 из SEQ ID NO:2,
аминокислотами с 1 по 49 из SEQ ID NO:4,
аминокислотами с 1 по 49 из SEQ ID NO:6,
аминокислотами с 1 по 49 из SEQ ID NO:8,
аминокислотами с 1 по 49 из SEQ ID NO:10,
аминокислотами с 1 по 46 из SEQ ID NO:12,
аминокислотами с 1 по 46 из SEQ ID NO:14,
аминокислотами с 1 по 48 из SEQ ID NO:16,
аминокислотами с 1 по 48 из SEQ ID NO:18,
аминокислотами с 1 по 48 из SEQ ID NO:20,
аминокислотами с 1 по 45 из SEQ ID NO:22,
аминокислотами с 1 по 49 из SEQ ID NO:24,
аминокислотами с 1 по 44 из SEQ ID NO:26 или
аминокислотами с 1 по 59 из SEQ ID NO:28.

6. Полипептид по п.2, который кодируется нуклеотидной последовательностью, которая гибридизуется при средне-жестких условиях с (i):
нуклеотидами от 151 до 297 из SEQ ID NO:1,
нуклеотидами от 151 до 297 из SEQ ID NO:3,
нуклеотидами от 151 до 297 из SEQ ID NO:5,
нуклеотидами от 151 до 297 из SEQ ID NO:7,
нуклеотидами от 151 до 297 из SEQ ID NO:9,
нуклеотидами от 118 до 255 из SEQ ID NO:11,
нуклеотидами от 118 до 255 из SEQ ID NO:13,
нуклеотидами от 112 до 255 из SEQ ID NO:15,
нуклеотидами от 112 до 255 из SEQ ID NO:17,
нуклеотидами от 112 до 255 из SEQ ID NO:19,
нуклеотидами от 118 до 252 из SEQ ID NO:21,
нуклеотидами от 151 до 297 из SEQ ID NO:23,
нуклеотидами от 121 до 252 из SEQ ID NO:25,
или нуклеотидами от 145 до 321 из SEQ ID NO:27 или
(ii) комплементарной цепью (i).

7. Полипептид по п.2, который кодируется нуклеотидной последовательностью, которая гибридизуется при жестких условиях с (i):
нуклеотидами от 151 до 297 из SEQ ID NO:1,
нуклеотидами от 151 до 297 из SEQ ID NO:3,
нуклеотидами от 151 до 297 из SEQ ID NO:5,
нуклеотидами от 151 до 297 из SEQ ID NO:7,
нуклеотидами от 151 до 297 из SEQ ID NO:9,
нуклеотидами от 118 до 255 из SEQ ID NO:11,
нуклеотидами от 118 до 255 из SEQ ID NO:13,
нуклеотидами от 112 до 255 из SEQ ID NO:15,
нуклеотидами от 112 до 255 из SEQ ID NO:17,
нуклеотидами от 112 до 255 из SEQ ID NO:19,
нуклеотидами от 118 до 252 из SEQ ID NO:21,
нуклеотидами от 151 до 297 из SEQ ID NO:23,
нуклеотидами от 121 до 252 из SEQ ID NO:25,
или нуклеотидами от 145 до 321 из SEQ ID NO:27 или
(ii) комплементарной цепью (i).

8. Полипептид по любому из пп.1-7, который состоит из SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 или SEQ ID NO:28.

9. Полипептид по п.2, который состоит из
аминокислот с 1 по 49 из SEQ ID NO:2,
аминокислот с 1 по 49 из SEQ ID NO:4,
аминокислот с 1 по 49 из SEQ ID NO:6,
аминокислот с 1 по 49 из SEQ ID NO:8,
аминокислот с 1 по 49 из SEQ ID NO:10,
аминокислот с 1 по 46 из SEQ ID NO:12,
аминокислот с 1 по 46 из SEQ ID NO:14,
аминокислот с 1 по 48 из SEQ ID NO:16,
аминокислот с 1 по 48 из SEQ ID NO:18,
аминокислот с 1 по 48 из SEQ ID NO:20,
аминокислот с 1 по 45 из SEQ ID NO:22,
аминокислот с 1 по 49 из SEQ ID NO:24,
аминокислот с 1 по 44 из SEQ ID NO:26 или
аминокислот с 1 по 59 из SEQ ID NO:28.

10. Полинуклеотид, содержащий нуклеотидную последовательность, которая кодирует полипептид по любому из пп.1-9.

11. Полинуклеотид по п.10, имеющий по крайней мере одну мутацию в кодирующей зрелый полипептид последовательности из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25 или SEQ ID NO:27, в котором мутантная нуклеотидная последовательность кодирует полипептид, состоящий из
аминокислот с 1 по 49 из SEQ ID NO:2,
аминокислот с 1 по 49 из SEQ ID NO:4,
аминокислот с 1 по 49 из SEQ ID NO:6,
аминокислот с 1 по 49 из SEQ ID NO:8,
аминокислот с 1 по 49 из SEQ ID NO:10,
аминокислот с 1 по 46 из SEQ ID NO:12,
аминокислот с 1 по 46 из SEQ ID NO:14,
аминокислот с 1 по 48 из SEQ ID NO:16,
аминокислот с 1 по 48 из SEQ ID NO:18,
аминокислот с 1 по 48 из SEQ ID NO:20,
аминокислот с 1 по 45 из SEQ ID NO:22,
аминокислот с 1 по 49 из SEQ ID NO:24,
аминокислот с 1 по 44 из SEQ ID NO:26 или
аминокислот с 1 по 59 из SEQ ID NO:28.

12. Конструкция нуклеиновой кислоты, содержащая полинуклеотид по п.10, функционально связанный с одной или более кодирующими последовательностями, которые направляют продукцию полипептида в экспрессионном хозяине.

13. Рекомбинантный экспрессионный вектор, содержащий конструкцию нуклеиновой кислоты по п.12.

14. Рекомбинантная клетка-хозяин, содержащая конструкцию нуклеиновой кислоты по п.12.

15. Способ получения полипептида по любому из пп.1-9, включающий (a) культивирование клетки, которая в виде дикого типа способна продуцировать полипептид при условиях, способствующих продуцированию полипептида; и (b) выделение полипептида.

16. Способ получения полипептида по любому из пп.1-9, включающий (а) культивирование клетки-хозяина, содержащей конструкцию нуклеиновой кислоты, содержащей нуклеотидную последовательность, кодирующую полипептид, в условиях, способствующих продуцированию полипептида; и (b) выделение полипептида.

17. Выделенный полинуклеотид, полученный посредством (а) гибридизации популяции ДНК при средних условиях, предпочтительно среднежестких или жестких условиях с (i)
нуклеотидами от 151 до 297 из SEQ ID NO:1,
нуклеотидами от 151 до 297 из SEQ ID NO:3,
нуклеотидами от 151 до 297 из SEQ ID NO:5,
нуклеотидами от 151 до 297 из SEQ ID NO:7,
нуклеотидами от 151 до 297 из SEQ ID NO:9,
нуклеотидами от 118 до 255 из SEQ ID NO:11,
нуклеотидами от 118 до 255 из SEQ ID NO:13,
нуклеотидами от 112 до 255 из SEQ ID NO:15,
нуклеотидами от 112 до 255 из SEQ ID NO:17,
нуклеотидами от 112 до 255 из SEQ ID NO:19,
нуклеотидами от 118 до 252 из SEQ ID NO:21,
нуклеотидами от 151 до 297 из SEQ ID NO:23,
нуклеотидами от 121 до 252 из SEQ ID NO:25 или
нуклеотидами от 145 до 321 из SEQ ID NO:27; или (ii) комплементарной цепью (i); и (b) выделение гибридизующегося полинуклеотида, который кодирует полипептид, обладающий противомикробным действием.

18. Способ получения полипептида по любому из пп.1-9, включающий (а) культивирование трансгенного растения или клетки растения, содержащей полинуклеотид, кодирующий полипептид, обладающий противомикробным действием, согласно настоящему изобретению, в условиях, способствующих продуцированию полипептида; и (b) выделение полипептида.

19. Трансгенное растение, часть растения или клетка растения, которые были трансформированы полинуклеотидом, кодирующим полипептид по любому из пп.1-9.

20. Способ лизиса или ингибирования роста микробных клеток, включающий контакт микробных клеток с противомикробным полипептидом, определенным в любом из пп.1-9.

21. Противомикробный полипептид, определенный в любом из пп.1-9, для применения в качестве лекарственного средства или противомикробного ветеринарного или медицинского терапевтического или профилактического агента.

22. Применение противомикробного полипептида, определенного в любом из пп.1-9, в получении ветеринарного или медицинского терапевтического или профилактического агента для лечения микробной инфекции или для профилактического применения.

23. Применение по меньшей мере одного противомикробного полипептида, определенного в любом из пп.1-9, в корме для животных.



 

Похожие патенты:

Изобретение относится к иммунологии и биотехнологии. .

Изобретение относится к биотехнологии и представляет собой мутантный фотопротеин для определения внутриклеточного кальция одновременно в разных органеллах клетки, обладающий светоизлучающей функцией и характеризующийся аминокислотной последовательностью кальций-регулируемого фотопротеина дикого типа, в которой природные остатки фенилаланина, относящиеся к консервативным областям названной последовательности и соответствующие остатку 119 фотопротеина обелина Obelia longissima, а также остатку 88 обелина Obelia longissima заменены другими остатками, отличными от фенилаланина, замены которых приводят к тому, что чувствительность кальций-регулируемого фотопротеина к ионам кальция уменьшается по сравнению с фотопротеином дикого типа и изменяется длина волны испускаемого света по сравнению с фотопротеином дикого типа.

Изобретение относится к анти-М-СSF-специфическим антителам, полученным на основе RX1 или происходящим от RX1, и которые более чем на 75% конкурируют с моноклональными антителами RX1, МС1 и/или МС3 за связывание с M-CSF (макрофагальному колониестимулирующему фактору).

Изобретение относится к биотехнологии и представляет собой клетку мицелиального гриба, принадлежащего к роду Penicillium, трансформированную плазмидой. .

Изобретение относится к области биотехнологии, конкретно к прямым ингибиторам тромбина, и может быть использовано в медицине. .

Изобретение относится к области биотехнологии, в частности, к олигонуклеотиду с двойной специфичностью, способу его получения и способам, в которых он используется.

Изобретение относится к области биотехнологии. .

Изобретение относится к биотехнологии и представляет собой клетку мицелиального гриба, принадлежащего к роду Penicillium, трансформированную плазмидой. .

Изобретение относится к биотехнологии и представляет собой молекулу ДНК, кодирующую фермент, обладающий активностью глюкоамилазы, обладающую по меньшей мере 80% идентичности последовательности с глюкоамилазой из Trichoderma, обладающей последовательностью SEQ ID NO: 4.
Изобретение относится к области молекулярной и клеточной биологии и медицины. .

Изобретение относится к области биотехнологии, в частности к генетической инженерии высших растений, и касается способа получения трансгенных растений, устойчивых к вирусной инфекции.

Изобретение относится к области молекулярной биологии и биотехнологии. .

Изобретение относится к олигонуклеотидным зондам и их композициям, которые могут использоваться для анализа репрезентативной выборки генома. .

Изобретение относится к биотехнологии. .

Полипептиды, обладающие противомикробным действием, и кодирующие их полинуклеотиды

Наверх