Синтетические олигонуклеотидные праймеры и способ выявления рнк вируса респираторно-синцитиальной инфекции крупного рогатого скота с помощью синтетических олигонуклеотидных праймеров в полимеразной цепной реакции (пцр)


 


Владельцы патента RU 2405039:

Государственное научное учреждение Институт экспериментальной ветеринарии Сибири и Дальнего Востока Сибирского отделения Россельхозакадемии (ГНУ ИЭВСиДВ СО Россельхозакадемии) (RU)

Изобретение относится к биотехнологии, а именно к способу выявления РНК вируса респираторно-синцитиальной инфекции крупного рогатого скота, и может быть использовано в ветеринарии. Выявляют РНК вирус респираторно-синцитиальной инфекции крупного рогатого скота с помощью синтетических олигонуклеотидных праймеров, комплементарных высококонсервативной области генома вируса респираторно-синцитиальной инфекции крупного рогатого скота района гена гликопротеина F в полимеразной цепной реакции. Предложенный способ включает выделение РНК, проведение обратной транскрипции, амплификацию комплементарной ДНК (кДНК) вируса на синтетических олигонуклеотидных праймерах, перенос продукта амплификации на гель и оценку проведения реакции. ПНР проводится за 1 раунд. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 381 н.п. Изобретение позволяет проводить выявление РНК штаммов и изолятов вируса респираторно-синцитиальной инфекции крупного рогатого скота в пробах биоматериала различного происождения на ранних стадиях культивирования вируса, а также снизить себестоимость диагностики в 4,5 раза. 2 н.п. ф-лы, 3 табл.

 

Изобретение относится к биотехнологии, а именно к генетической инженерии, и может быть использовано в ветеринарной вирусологии для диагностики инфекционных заболеваний сельскохозяйственных животных, в частности респираторно-синцитиальной инфекции крупного рогатого скота.

Согласно современной классификации возбудитель болезни относится к роду Pneumovirus семейства Paramyxoviridae.

К вирусу восприимчив крупный рогатый скот всех пород. Чаще болеют телята от одного до шести месяцев.

До настоящего времени основным способом диагностики респираторно-синцитиальной инфекции крупного рогатого скота в России является выделение вируса из проб биологического материала в культуре клеток с последующей идентификацией вируса в реакции нейтрализации. Выделение вируса РСИ затруднено ввиду его чрезвычайной лабильности и возможно только на ранней стадии инфекции; вероятность выделения снижается с появлением признаков заболевания. Лучшие результаты получают, проводя заражение культур клеток как можно скорее после взятия материала, избегая его замораживания (Сюрин В.Н., Самуйленко А.Я., Соловьев Б.В., Фомина Н.В. Вирусные болезни животных. - М.: ВНИТИБП. - 1998. - 928 с.).

К недостаткам метода выделения вируса относятся необходимость культивирования с использованием первично-трипсинизированных или перевиваемых культур клеток животных, сыворотки крупного рогатого скота, пробирок и других реагентов и оборудования, что обусловливает его длительность, трудоемкость и низкую эффективность.

Наиболее приемлемым с точки зрения описанных недостатков и принятым за прототип является способ выявления РНК вируса респираторно-синцитиальной инфекции крупного рогатого скота (РСИ КРС), основанный на полимеразной цепной реакции (ПЦР), включающий выделение РНК вируса из вируссодержащей суспензии, синтез олигонуклеотидных праймеров на ген гликопротеина G, амплификацию РНК вируса в гнездовой ПНР, специфическую идентификацию продуктов ПНР с помощью электрофореза в 2,5% агарозном геле (Vilcek S., Elvander М., Ballagi-Pordany A., Belak S. Development of nested PCR Assays for Detection of Bovine Respiratory Syncytial Virus in Clinical Samples // Journal of Clinical Microbiology. - Vol.32, N 9. - P.2225-2231).

Наружные праймеры для первого раунда амплификации:

В 5А - 5' CCACCCTAGCCATGATAACCTTGAC 3'

В 6А - 5' AAGAGAGGATGC(T/C)TTGCTGTGG 3'.

Внутренние праймеры для второго раунда амплификации:

В 7А - 5' CATCAATCCAAAGCACCACACTGTC 3',

В 8 - 5' GCTAGTTCTGTGGTGGATTGTTGTC 3'.

К недостаткам данного способа можно отнести то, что он проводится методом гнездовой ПЦР, требующей синтез двух пар праймеров (внутренних и наружных) и соответственно проведения реакции в два раунда.

Задача изобретения - расширение арсенала олигонуклеотидных праймеров и способов выявления вируса респираторно-синцитиальной инфекции крупного рогатого скота.

Поставленная задача решается тем, что в известном способе синтезируются синтетические олигонуклеотидные праймеры для выявления РНК вируса респираторно-синцитиальной инфекции крупного рогатого скота, отличающиеся тем, что праймеры имеют нуклеотидные последовательности:

F1 - 5' TACCACACCCCTCAGTACAT 3',

F2 - 5' ATTGTGTCACAGAACACTCC 3'

Задача решается также тем, что в способе выявления РНК вируса респираторно-синцитиальной инфекции крупного рогатого скота, включающем проведение ПЦР с олигонуклеотидными праймерами, согласно изобретению праймеры имеют нуклеотидные последовательности F1 - 5' TACCACACCCCTCAGTACAT 3', F2 - 5' ATTGTGTCACAGAACACTCC 3' и синтезированы на высококонсервативный ген гликопротеина F, а ПЦР проводят в 1 раунд, при этом в случае положительной реакции синтезируется фрагмент, соответствующий размеру 381 п.н.

Изобретение иллюстрируется следующими примерами.

Пример 1. Получение синтетических олигонуклеотидных праймеров.

Поиск новых синтетических олигонуклеотидных праймеров осуществляют на основе полного генома штамма вируса респираторно-синцитиальной инфекции крупного рогатого скота (РСИ КРС) «А51908», представленного в базе данных GenBank (http://www.ncbi.nlm.nih.gov/GenBank/GenBankSearch.html), при помощи пакета программного обеспечения «Lasergen». Полученные последовательности нескольких пар праймеров дополнительно тестируют на специфичность с помощью моделирования ПЦР в программе "Vector NTI Suite" с последовательностями генома вируса парагриппа-3 крупного рогатого скота.

Окончательный выбор праймеров основывается на следующих критериях: высокий индекс сходства фрагмента и РНК различных штаммов вируса РСИ КРС, высокая температура отжига (GC- метод), большая длина консенсусов.

Химический синтез праймеров осуществляют амидофосфитным методом на автоматическом синтезаторе ASM-102U. Концентрацию синтетических олигонуклеотидных праймеров в маточном растворе определяют спектрометрическим методом.

Таким образом, были выбраны синтетические олигонуклеотидные праймеры, комплементарные высококонсервативной области генома вируса РСИ КРС района гена гликопротеина F.:

F1 - 5' TACCACACCCCTCAGTACAT 3',

F2 - 5' ATTGTGTCACAGAACACTCC 3', специфичные вирусу РСИ КРС.

Пример 2. Способ выявления РНК вируса респираторно-синцитиальной инфекции крупного рогатого скота с помощью синтетических олигонуклеотидных праймеров в полимеразной цепной реакции (ПНР).

Способ осуществляется в несколько этапов.

Этап 1. Выделение РНК вируса РСИ КРС.

Выделение РНК вируса осуществляют стандартным способом с использованием коммерческого набора «Рибо - сорб» производства ФГУН «Центральный НИИ эпидемиологии» Роспотребнадзора.

Этап 2. Проведение реакции обратной транскрипции для получения кДНК.

Осуществляют стандартным способом с использованием коммерческого набора «Реверта-L» производства того же института.

В пробирку, содержащую 9,5 мкл реакционной смеси: буфер для ОТ (50 mM Tris-HCl [рН 8.3], 3 мМ MgCl2, 75 mM KCl, 10 мМ DTT), 0,1 мМ dNTP, 0,1 мкг праймера для ОТ) и 0,5 мкл ревертазы из набора «Реверта-L», добавляют 10 мкл РНК-пробы, осторожно перемешивают и помещают в термостат 37°С на 30 минут. Затем добавляют 20 мкл ДНК-буфера, тщательно перемешивают и используют для постановки ПЦР.

Этап 3. Амплификация участка к-ДНК вируса РСИ КРС, кодирующего ген гликопротеина F.

Полимеразная цепная реакция. Состав реакционной смеси: ПНР-буфер (60 mM Tris-HCl [рН 8.5], 1,5 мМ MgCl2, 25 mM KCl, 10 мМ 2-меркаптэтанола, 0,1% Тритон Х-100), 0,2 мМ dNTP, no 0,1 мкг каждого праймера, 1.25 U Taq-ДНК-полимеразы, 5 мкл кДНК.

Температурный режим проведения ПЦР. Программа амплификации состоит из следующих температурных режимов: 95°С - 30 с - 1 цикл; 95°С - 30 с, 60°С - 30 с, 72°С - 45 с - 35 циклов; 72°С - 2 мин.

Этап 4. Определение размера продуктов диагностической ПЦР.

Продукты ПЦР анализируют методом электрофореза в 2%-м агарозном геле в стандартном трис-боратном буфере (рН 8,0) по стандартной методике.

Результаты электрофореза учитывают, просматривая гель в ультрафиолетовом свете с длиной волны 254 нм на приборе «Трансиллюминатор».

Маркер молекулярного веса 100 bp. Результат ПЦР считают положительным, если продукт ПЦР соответствует размеру фрагмента в 381 нуклеотидную пару.

Таким образом, указанный способ позволяет выявлять РНК вируса РСИ КРС в исследуемом материале.

Пример 3. Определение чувствительности ПЦР.

Для определения чувствительности реакции контрольный штамм вируса РСИ КРС «РСВ №3» титруют методом 10-кратных разведении до разведения 10-7 ТЦД50/мл, каждое разведение подвергают исследованию в ПЦР. Чувствительность разработанной ПЦР составляет 10 ТЦД50/мл.

Пример 4. Определение специфичности ПЦР.

Результаты опытов по определению специфичности реакции представлены в таблице 1.

Таблица 1
Вирус (штамм, изолят) Результаты ПЦР
Вирус РСИ КРС (штамм «РСВ №З») +
Вирус РСИ КРС (изолят «Мир») +
Вирус РСИ КРС (изолят «Ишим») +
Вирус РСИ КРС (изолят «К-18») +
Вирус РСИ КРС (изолят «К-38») +
Вирус РСИ КРС (изолят «Вак») +
Вирус ПГ-3 КРС (штамм «ПТК») -
Вирус ВД-БС КРС (штамм «ВК-1») -
Вирус классической чумы свиней (вакцинный штамм) -
Герпесвирус КРС 1-го типа (штамм «Оренбург») -
Аденовирус КРС 1 типа (BV-10) -
Риновирус КРС 1-го типа (SD-1) -
Культура клеток Vero -
Примечание: «+» - положительный результат; «-» - отрицательный результат

Таким образом, предлагаемый способ обладает высокой специфичностью при выявлении РНК штаммов и изолятов вируса РСИ КРС.

Пример 5. Выявление РНК вируса РСИ КРС в пробах биологического материала, полученного от больных и инфицированных животных.

Для исследования на РСИ КРС используют пробы носовых и глазных выделений, смывы со слизистой носа, соскобы со слизистой трахеи, трахеальную и бронхиальную слизь, пробы легких и бронхов.

Отбор проб биоматериала производят согласно методике (Сюрин В.Н., Самуйленко А.Я., Соловьев Б.В., Фомина Н.В. Вирусные болезни животных. - М.: ВНИТИБП. - 1998. - 928 с.).

Жидкости и пробы слизистых выделений отбирают в объеме не менее 1 мл, из легочной ткани вырезают кусочки размером 1×1×1 см3.

Культуральную жидкость, пробы штаммов и изолятов вируса РСИ КРС, пробы носовых и глазных выделений, трахеальной и бронхиальной слизи используют для выделения РНК без предварительной подготовки.

Пробы органов и тканей размером 1×1×1 см3 перед исследованием растирают в отдельных фарфоровых ступках со стерильным песком пестиком, добавляют 5-10 мл стерильного физиологического раствора и тщательно перемешивают. Смесь переносят в пластиковые пробирки емкостью 1,5 мл, центрифугируют на центрифуге при 10×103 об/мин в течение 5 минут. Для выделения РНК используют 100 мкл осветленной надосадочной жидкости, полученной после центрифугирования.

Густые пробы носовых выделений и слизи разводят стерильным физиологическим раствором (примерно 1:5), тщательно перемешивают, центрифугируют при 10×103 об/мин в течение 5 минут и 100 мкл осветленной надосадочной жидкости используют для выделения РНК. Дальнейшая процедура согласно примеру 1.

Таким образом, предлагаемый способ позволяет эффективно выявлять РНК вируса РСИ КРС в пробах различного биоматериала от больных и инфицированных животных, культуральных жидкостях, пробах штаммов и изолятов вируса РСИ КРС.

Пример 6. Сравнение эффективности гнездовой ПЦР с использованием праймеров В 5А - В 8А на ген гликопротеина G (Vilcek S., Elvander М., Ballagi-Pordany A., Belak S. Development of nested PCR Assays for Detection of Bovine Respiratory Syncytial Virus in Clinical Samples // Journal of Clinical Microbiology.- Vol.32, N 9. - P. 2225-2231) и ПЦР в один раунд с использованием праймеров F1 - F2 на ген гликопротеина F для выявления РНК вируса РСИ КРС.

Результаты опытов по сравнению эффективности ПЦР для выявления РНК вируса РСИ КРС с праймерами В5А - В8А (прототип) и F1-F2 представлены в таблице 2.

Таблица 2
Вирус (штамм, изолят) Гнездовая ПЦР с праймерами В5А-В8А на ген гликопротеина G, продолжительность 4 часа ПЦР в один раунд с праймерами F1-F2 на ген гликопротеина F, продолжительность 1,5 часа
1 2 3
Вирус РСИ КРС (штамм «РСВ №З») + +
Вирус РСИ КРС (изолят «Мир») + +
Вирус РСИ КРС (изолят «Ишим») + +
Вирус ПГ-3 КРС (штамм «ПТК») + -
Вирус ВД-БС КРС (штамм «ВК-1») + -
Вирус классической чумы свиней (вакцинный штамм) - -
Герпесвирус КРС 1-го типа (штамм «Оренбург») - -
Аденовирус КРС 1 типа (BV-10) - -
Риновирус КРС 1-го типа (SD-1) - -
Культура клеток Vero - -
Примечание: «+» - положительный результат;
«-» - отрицательный результат

Таким образом, предлагаемый способ более эффективен для выявления РНК вируса РСИ КРС, так как обладает высокой специфичностью, в то время как способ, принятый за прототип, дает ложноположительные результаты с РНК вирусов парагриппа-3 и вирусной диареи-болезни слизистых КРС

Преимущества разработанного метода перед стандартной методикой выделения вируса в культуре клеток представлены в таблице 3.

Таблица 3
Показатели Выделение вируса в культуре клеток Метод ПЦР
Длительность без учета выращивания культуры клеток для реакции (дни) от 7 до 30 суток 2 суток
Время исследования одной пробы биоматериала от 7 до 30 суток 2 суток
Себестоимость исследования одной пробы (руб.) 360 рублей 80 рублей
Трудозатраты (чел) 2 1
Необходимость подтверждения выявления вируса в реакции нейтрализации + -
Поддержание и хранение культур клеток в азоте + -

Таким образом, предлагаемый способ позволяет проводить эффективное выявление РНК штаммов и изолятов вируса РСИ КРС, а также РНК вируса в пробах биоматериала различного происхождения от больных и инфицированных животных и инфицированных культурах клеток на ранних стадиях культивирования вируса до наступления видимого цитопатогенного действия, а также сократить сроки проведения исследований до двух суток, снизить себестоимость диагностики в 4,5 раза, трудозатраты в 2 раза и исключить необходимость получения, поддержания и хранения культур клеток в лаборатории.

1. Синтетические олигонуклеотидные праймеры для выявления РНК вируса респираторно-синцитиальной инфекции крупного рогатого скота, отличающиеся тем, что праймеры имеют нуклеотидные последовательности
F1 - 5' TACCACACCCCTCAGTACAT 3';
F2 - 5' ATTGTGTCACAGAACACTCC 3'.

2. Способ выявления РНК вируса респираторно-синцитиальной инфекции крупного рогатого скота, включающий проведение ПЦР с олигонуклеотидными праймерами, отличающийся тем, что праймеры имеют нуклеотидные последовательности F1 - 5' TACCACACCCCTCAGTACAT 3', F2 - 5' ATTGTGTCACAGAACACTCC 3' и синтезированы на высококонсервативный ген гликопротеина F, а ПЦР проводят в 1 раунд, при этом в случае положительной реакции синтезируется фрагмент, соответствующий размеру 381 п.н.



 

Похожие патенты:

Изобретение относится к биотехнологии и касается получения быстрорастущего штамма вируса гепатита А (ВГА). .
Изобретение относится к области биотехнологии, в частности к способу получения вирионного антигена вируса клещевого энцефалита (КЭ) из антигенсодержащего материала, включающего, главным образом, антигенные частицы вируса КЭ мельче полноразмерных вирионов КЭ.
Изобретение относится к биотехнологии и может быть использовано для прогнозирования возможности эпидемий. .

Изобретение относится к медицинской вирусологии и микробиологии и касается штамма вируса гриппа птиц A/common gull/Chany/2006 H5N1 субтипа для приготовления антигенсодержащего диагностического или вакцинного препарата, депонированного в Коллекции культур микроорганизмов Федерального государственного учреждения науки «Государственный научный центр вирусологии и биотехнологии «Вектор» Роспотребнадзора под регистрационным номером V-368.

Изобретение относится к области химии и медицины и касается новых соединений, являющихся производными N-замещенного 1,4-диазабицикло[2.2.2.]октана. .
Изобретение относится к области биотехнологии, в частности к штаммам вируса трансмиссивного гастроэнтерита свиней. .

Изобретение относится к области биотехнологии, генной инженерии, вирусологии и медицины. .

Изобретение относится к области ветеринарной вирусологии и биотехнологии. .

Изобретение относится к области биотехнологии, в частности к выделению физиологически активных соединений, и может быть использовано в медицине. .

Изобретение относится к области молекулярной биологии, а именно к способу выделения и очистки дезоксирибонуклеиновых кислот (ДНК) из образцов тканей растений, а также продуктов переработки растительного и животного происхождения.

Изобретение относится к способам праймер-зависимого размножения нуклеиновых кислот в иммобилизованных средах, в частности, к способам обнаружения продуктов такого размножения.

Изобретение относится к области биотехнологии, конкретно к множественной RT-PCR с удлинением цепи путем перекрывания. .

Изобретение относится к сельскому хозяйству, а именно к способу экстракции рибонуклеиновой кислоты (РНК) из растительных образцов различного происхождения. .

Изобретение относится к биотехнологии. .
Изобретение относится к области клинической биохимии и касается способа выделения внеклеточных ДНК (внДНК) из крови. .

Изобретение относится к области медицины, в частности к медицинской диагностике, конкретно к способу и набору для обнаружения ДНК возбудителя холеры в материале от больных людей и из объектов окружающей среды, и может быть использовано в научно-исследовательских учреждениях, региональных, областных службах санэпиднадзора.
Изобретение относится к биотехнологии, а именно к способу получения плазмидной ДНК из бактериальных клеток
Наверх