Рекомбинантная плазмидная днк pfastbac-b17r, содержащая фрагмент генома вируса оспы коров, кодирующий альфа/бета-интерферонсвязывающий белок и штамм бакуловируса bvb17rg, продуцирующий растворимый альфа/бета-интерферонсвязывающий белок вируса оспы коров



Рекомбинантная плазмидная днк pfastbac-b17r, содержащая фрагмент генома вируса оспы коров, кодирующий альфа/бета-интерферонсвязывающий белок и штамм бакуловируса bvb17rg, продуцирующий растворимый альфа/бета-интерферонсвязывающий белок вируса оспы коров
Рекомбинантная плазмидная днк pfastbac-b17r, содержащая фрагмент генома вируса оспы коров, кодирующий альфа/бета-интерферонсвязывающий белок и штамм бакуловируса bvb17rg, продуцирующий растворимый альфа/бета-интерферонсвязывающий белок вируса оспы коров
Рекомбинантная плазмидная днк pfastbac-b17r, содержащая фрагмент генома вируса оспы коров, кодирующий альфа/бета-интерферонсвязывающий белок и штамм бакуловируса bvb17rg, продуцирующий растворимый альфа/бета-интерферонсвязывающий белок вируса оспы коров
Рекомбинантная плазмидная днк pfastbac-b17r, содержащая фрагмент генома вируса оспы коров, кодирующий альфа/бета-интерферонсвязывающий белок и штамм бакуловируса bvb17rg, продуцирующий растворимый альфа/бета-интерферонсвязывающий белок вируса оспы коров
Рекомбинантная плазмидная днк pfastbac-b17r, содержащая фрагмент генома вируса оспы коров, кодирующий альфа/бета-интерферонсвязывающий белок и штамм бакуловируса bvb17rg, продуцирующий растворимый альфа/бета-интерферонсвязывающий белок вируса оспы коров
Рекомбинантная плазмидная днк pfastbac-b17r, содержащая фрагмент генома вируса оспы коров, кодирующий альфа/бета-интерферонсвязывающий белок и штамм бакуловируса bvb17rg, продуцирующий растворимый альфа/бета-интерферонсвязывающий белок вируса оспы коров
Рекомбинантная плазмидная днк pfastbac-b17r, содержащая фрагмент генома вируса оспы коров, кодирующий альфа/бета-интерферонсвязывающий белок и штамм бакуловируса bvb17rg, продуцирующий растворимый альфа/бета-интерферонсвязывающий белок вируса оспы коров
Рекомбинантная плазмидная днк pfastbac-b17r, содержащая фрагмент генома вируса оспы коров, кодирующий альфа/бета-интерферонсвязывающий белок и штамм бакуловируса bvb17rg, продуцирующий растворимый альфа/бета-интерферонсвязывающий белок вируса оспы коров

 


Владельцы патента RU 2405824:

Федеральное государственное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФГУН ГНЦ ВБ "Вектор" Роспотребнадзора) (RU)

Изобретение относится к биотехнологии, для изготовления лекарственных препаратов для иммунокоррекции или использования как компонент тест-системы для определения интерферонового статуса человека в норме и патологии. Технический результат достигается созданием рекомбинантной плазмидной ДНК pFastBac-B17R, несущей фрагмент генома вируса оспы коров. Штамм рекомбинантного бакуловируса BvB17RG получен с помощью рекомбинантной плазмидной ДНК pFastBac-B17R и депонирован в коллекции культур микроорганизмов ФГУН ГНЦ ВБ «Вектор» Роспотребнадзора под номером V-388, является продуцентом растворимого белка-аналога клеточного рецептора интерферонов I-го типа вируса оспы коров. Техническим результатом изобретения является расширение спектра препаратов нового поколения. 2 н.п.ф-лы, 5 ил.

 

Изобретение относится к субстанции, способной модулировать экзогенный синтез α/β-интерферона с целью создания лекарственных препаратов для иммунокоррекции или используемой как компонент тест-системы для определения интерферонового статуса человека в норме и патологии, в биологических образцах (кровь, ткани), и может быть использована в медицине и биотехнологии, в частности в генетической инженерии.

Интерфероны I-го типа (α- и β-IFN) вырабатываются клетками теплокровных в ответ на вирусную инфекцию [1] и индуцируют экспрессию ряда генов, продукты которых обладают антивирусной активностью [2, 3]. В ряде случаев показана перспективность терапевтического использования интерферона-альфа [4-6].

Однако повышение уровня IFNα наблюдается при ряде аутоиммунных заболеваний [7], на начальных этапах развития СПИДа [8]; при различных заболеваниях ЦНС и рассеянном склерозе усиливается продукция IFNβ [9, 10].

Поэтому поиск субстанций, способных модулировать эффекты IFNα и IFNβ, представляет интерес для создания новых лекарственных препаратов для иммунокоррекции. Кандидатом на роль таких препаратов может быть α/βIFN- связывающий белок ортопоксвирусов. Этот белок также может быть использован как компонент тест-систем для определения содержания интерферонов в биологических образцах [11].

Известны аналоги, представленные в работах [12-14], описывающие белки, выделенные из биологических жидкостей человека, обладающие способностью связывать интерфероны I-го типа (IFN_I).

Наиболее близким аналогом (прототипом) заявляемого технического решения является интерферон-связывающий белок - продукт экспрессии гена B18R рекомбинантного штамма вируса осповакцины (BOB) Western Reserve [15].

Однако вирус осповакцины (ВОВ) непатогенен для человека, т.е. имеет недостаточно широкий круг хозяев. Известно, что ФНО- и комплемент-связывающие белки ортопоксвирусов, несмотря на высокую степень гомологии ортологичных генов, отличаются на биохимическом уровне, и большая биологическая активность соответствует белку более патогенного для человека вируса [16, 17].

Техническим результатом изобретения является расширение спектра препаратов (рекомбинантных α/β-интерферонсвязывающих белков) нового поколения, способных модулировать экзогенный синтез α/β-интерферона с целью создания лекарственных препаратов для иммунокоррекции, или используемых как компонент тест-систем для определения интерферонового статуса человека в норме и патологии.

Поставленная задача решается путем создания рекомбинантного бакуловируса - продуцента растворимого аналога клеточного рецептора интерферонов I-типа (IFN_I-BP) BOK. Первым этапом в создании штамма-продуцента является конструирование рекомбинантной плазмидной ДНК pFastBac-B17R, содержащей фрагмент генома BOK, кодирующей аминокислотную последовательность аналога клеточного рецептора интерферонов I-го типа. Целевая плазмида pFastBac-B17R имеет размер 5913 п.о. и молекулярную массу 3,85 Мда и состоит из:

- фрагмента генома BOK штамма GRI-90 длиной 1161 п.о., кодирующего белок-аналог клеточного рецептора интерферонов I-го типа;

- векторной плазмиды pFastBac [19], длиной 4752 п.о., обеспечивающей сайт-специфическую транспозицию целевого фрагмента ДНК в геном бакуловируса.

Рекомбинантный бакуловирус, полученный в результате сайт-специфической транспозиции целевого фрагмента ДНК из донорной плазмиды pFastBac1-B17R в бакуловирусный вектор (бакмиду), находящийся в E.coli [19], после заражения им клеток насекомых Spodoptera frugiperda линии Sf21 продуцирует растворимый белок ВОК штамма GRI-90 (ИНФ_I-ВР) - аналог рецептора интерферонов I-го типа.

Заявляемый рекомбинантный штамм ВОК имеет более широкий круг хозяев среди животных и при контакте с больным животным может вызывать заболевание человека, а рекомбинантный штамм ВОВ-прототип непатогенен для человека. Как указывалось выше, известно, что ФНО- и комплемент-связывающие белки ортопоксвирусов отличаются на биохимическом уровне, и большая биологическая активность соответствует белку более патогенного для человека вируса [16, 17].

В качестве фрагмента генома ВОК используют фрагмент ДНК длиной 1161 п.о., полученный с помощью полимеразной цепной реакции. Матрицей для амплификации служит ДНК ВОК штамма GRI-90. Праймеры для амплификации гена-аналога рецептора ИНФ-гамма ВОК имеют следующую структуру:

1. 5' CGGGATCCTAGTGCCGTATAATGACGATGA 3'

2. 5' CCCAAGCTTGTATATAAAAATGCATTGTGTA 3'

В структуру праймера 1 и 2 заложены сайты узнавания эндонуклеаз рестрикции BamHI и HindIIII, соответственно. В качестве плазмидного вектора, обеспечивающего сайт-специфическую транспозицию целевого фрагмента ДНК в бакмиду pMON14272 [18], используют плазмиду pFastBac [18], содержащую бакуловирусный специфический промотор pPolh для экспрессии белков в клетках насекомых, мини-Tn7-транспазон, ген устойчивости к гентамицину Gmr, полилинкер для клонирования целевых генов и сигнал для полиаденилирования вируса SV-40. Бакмида pMON14272 содержит низкокопийный мини-F репликон, ген устойчивости к канамицину и фрагмент ДНК, кодирующий α-пептид гена β-галактозидазы E.coli, и обеспечивает α-комплементацию при размножении в штамме E.coli DH10Bac™ в присутствии хромогенного субстрата X-gal и индуктора IPTG.

Выбранная бакуловирусная система экспрессии обеспечивает высокий уровень синтеза целевого продукта и его правильную посттрансляционную модификацию по сравнению с другими системами экспрессии.

Сущность изобретения заключается в том, что из генома ВОК штамма GRI-90 методом ПЦР выделяется ген B17R, затем он клонируется в донорной плазмиде pFastBac и путем сайт-специфической транспозиции конструируется рекомбинантная бакмида, которая используется для трансфекции клеток насекомых, в результате чего генерируется рекомбинантный вирус BvB17RG, экспрессирующий указанный ген. Нуклеотидная последовательность встроенного фрагмента и кодируемая им аминокислотная последовательность приведены на фиг.1.

Штамм характеризуется следующими признаками:

Морфологические признаки. Штамм обладает свойствами типичного представителя бакуловирусов, но в отличие от векторного вируса имеет фенотип Lac-.

Физиолого-биохимические характеристики и культуральные свойства штамма. ДНК рекомбинантного бакуловируса имеет длину около 140000 п.о. Наличие в его геноме целевой вставки длиной 1161 п.о подтверждено с помощью метода ПЦР. При размножении рекомбинантного бакуловируса на культуре клеток насекомых Spodoptera frugiperda линии Sf21 его титр не отличается от титра, получаемого при размножении вируса, не содержащего в своем геноме чужеродных фрагментов ДНК.

Основным отличием штамма является его способность синтезировать при инфицировании культуры клеток насекомых линии Sf21 белок IFN_I-BP/BOK, связывающий рекомбинантный интерферон α2В (IFNa2B). Уровень синтеза целевого белка составляет 2,5 мг/л культуральной жидкости инфицированных клеток Sf21.

Полученный штамм рекомбинантного бакуловируса BV-B17R депонирован в коллекции микроорганизмов ФГУН «Государственный научный центр вирусологии и биотехнологии «Вектор» Роспотребнадзора за номером V-388.

Изобретение иллюстрируется следующими фигурами графических изображений:

Фиг.1. Нуклеотидная последовательность гена B17R ВОК (штамм GRI-90) [20] и аминокислотная последовательность рекомбинантного белка - аналога клеточного рецептора интерферонов I-го типа [GenBank, CAD90743]. Выделены жирным курсивом и подчеркнуты последовательности ДНК, комплементарные специфическим праймерам, использовавшихся для проведения ПЦР. Уникальные сайты эндонуклеазы рестрикции EcoRI выделены серым цветом.

Фиг.2. Представлена физическая карта плазмиды pFastBac-B17R. За первый нуклеотид плазмиды принимается первый нуклеотид межцистронной области фага fl; Tn7L, Тn7R-сайты встраивания транспазона Tn7; SV40polyA- сайт полиаденилирования вируса SV40; B17R - ген IFN_I-связывающего белка ВОК штамма GRI-90; pPolh- промотор полиэдрина; Ori-сайт инициации репликации; Арr, Gmr- маркеры устойчивости к антибиотикам.

Фиг.3. Приведен электрофоретический анализ в 1% агарозе ПЦР-фрагментов, содержащих ген B17R, амплифицированных с помощью специфических праймеров с ДНК ВОК (GRI-90) (дорожка 1) и с бакмиды bMON14272-B17R (дорожка 2) и BamH/HindIII-гидролизатов рекомбинантных ДНК pFastBac и pFastBac-B17R (дорожки 3 и 4, соответственно). Дорожка М - ДНК-маркеры (100b.p.+1.5 Kb+3 Kb, НПО «Сибэнзим», Россия).

Фиг.4. Представлен электрофоретический анализ в 10% ПААГ рекомбинантного белка IFNJ_BP/BOK, выделенного методом аффинной хроматографии из клеток насекомых линии Sf-21 (дорожка 1); дорожка 2 - М - маркеры молекулярных масс белков (103.7 кДа, 81.1 кДа, 47.7 кДа, 35.8 кДа, 27.1 кДа и 19.3 кДа, Prestained SDS-PAGE Standarts, «BioRad», США).

Фиг.5. Представлен график α2В-интерферон- и дельтаферон-связывающие активности лизатов клеток Sf-21, инфицированных рекомбинантным бакуловирусом BvB17RG (-о- и -, соответственно) и α2В-интерферон-связывающая активность лизатов клеток Sf-21.

Для лучшего понимания сущности изобретения ниже приведены примеры его осуществления.

Пример 1. Способ амплификации фрагмента ДНК, содержащего ген B17R BOK.

Реакцию амплификации проводят в пробирках Eppendorf под слоем минерального масла в объеме 50 мкл. Реакционная смесь содержит 10 мМ Tris-HCl рН 8.8, 50 мМ KCl, 2.5 мМ MgCl2, 0.1% Tween 20, 0.2 мМ dATP, 0.2 мМ dCTP, 0.2 мМ dGTP, 0.2 мМ dTTP, олигонуклеотидные праймеры в количестве 40 пмол каждого, 2 ед.а. Tth-полимеразы, 2-10 нг ДНК-матрицы. Амплификацию ведут в течение 20 циклов по схеме:

Номер цикла Температура (°C) Время (мин)
1 93 2 мин
53 1 мин
72 1 мин
2-19 93 1 мин
53 1 мин
72 1 мин
20 93 1 мин
53 1 мин
72 10 мин

Далее в реакционную смесь добавляют хлороформ, отбирают водную фазу и переносят в чистую пробирку. Наличие амплифицированного продукта проверяют с помощью электрофореза в 1% агарозном геле (фиг.3, дорожка 1).

Пример 2. Конструирование рекомбинантной плазмидной ДНК pFastBac-B17R.

5-10 мкг плазмиды pFastBac [18] и 1-5 мкг амплифицированного продукта, соответствующего гену B17R BOK, гидролизуют эндонуклеазами рестрикции BamHI и HindIII в стандартных условиях. Полученные фрагменты выделяют электрофорезом в 1% агарозном геле с последующей элюцией. 0,2 мкг вектора и 0,6 мкг фрагмента лигируют в стандартных условиях и полученной лигазной смесью трансформируют компетентные клетки E.coli штамма XL-blue. Клеточные Apr-клоны выращивают при 37°С в LB-бульоне, содержащем 100 мкг/мл ампициллина, до стационарной фазы. Рекомбинантную плазмидную ДНК выделяют по стандартной методике и анализируют с помощью эндонуклеаз рестрикции BamHI и HindIII. Из клонов, содержащих встроенный фрагмент, выделяют плазмидную ДНК, структуру которой в районе встройки подтверждают определением нулеотидной последовательности методом терминации синтезируемой цепи на автоматическом секвенаторе АВМ PRISM™ 310 (Perkin Elmer, Германия) (фиг.1).

Полученную таким образом целевую плазмиду, физическая карта которой представлена на фиг.2, обозначают pFastBac-B17R.

Пример 3. Получение бакмиды pMON14272-B17R.

К 100 мкл компетентных клеткок E.coli штамма DH10Bac™ добавляют 1 нг плазмиды pFastBac-B17R. Полученную смесь инкубируют во льду в течение 30 мин, затем при 42° в течение 45 сек с последующим охлаждением во льду в течение 2 мин. Реакционную смесь разводят 1:10 LB-бульоном и подращивают на качалке при интенсивной аэрации при 37° в течение 4-х часов. Далее клетки высевают на селективные чашки Петри с LB-агаром, содержащим 100 мкг/мл X-gal, 40 мкг/мл IPTG, 50 мкг/мл канамицина, 7 мкг/мл гентамицина, 10 мкг/мл тетрациклина, в термостате при 37°С и инкубирют в течение суток. Клоны с фенотипом Lac- засевают в пробирки с 5 мл LB-бульоном, содержащим 50 мкг/мл канамицина, 7 мкг/мл гентамицина, 10 мкг/мл тетрациклина и выращивают при интенсивной аэрации при 37° до стационарной фазы. Культуру переносят в 1,5 мл пробирки Eppendorf, осаждают клетки центрифугированием в течение 40 секунд при 14000g, удаляют среду. Процедуру добавления культуры, осаждения и удаления среды повторяют еще два раза. Осадок ресуспендируют в 0.3 мл раствора 1 (10 мМ ЭДТА, 15 мМ Tris-HCl pH 8.0, 100 мкг/мл РНКазы), добавляют 0.3 мл раствора 2 (0.2 М NaOH, 1% SDS) и инкубируют при комнатной температуре 5 минут. К смеси медленно добавляют 0.3 мл раствора 3 (3 М KAc pH 5.2). Инкубируют во льду 10 минут. Центрифугируют при 14000 об/мин в течение 10 минут. Супернатант переносят в чистую пробирку, добавляют 0.8 мл изопропанола, перемешивают и охлаждают при -20°С 5 минут, затем осаждают при 14000 об/мин 15 минут. Осадок промывают два раза этанолом, высушивают, растворяют в 40 мкл буфера ТЕ. Наличие в геноме бакмиды интегрированного фрагмента ДНК подтверждают с помощью ПЦР (Фиг.3, дорожка 2). Полученную бакмидную ДНК pMON14272-B17R используют для трансфекции клеток насекомых линии Sf21.

Пример 4. Трансфекция клеток насекомых Sf21 рекомбинантной бакмидной ДНК pMON14272-B17R и получение рекомбинантного вируса BvB17RG.

Клетки Sf21 засевают в лунки 6-луночного планшета из расчета, чтобы на следующий день был монослой (2×106 клеток/лунку), в 2 мл среды Грейса, содержащей 10% эмбриональной сыворотки коров (ЭСК) (ООО «БиолоТ», Россия). На следующий день готовят два раствора: 10 мкл вирусной ДНК + 100 мкл среды Грейса и 6 мкл реактива CellFECTIN (« LifeTechnologies», США) + 100 мкл среды Грейса. Растворы смешивают, инкубируют при комнатной температуре 25 минут. В это время промывают монослой клеток два раза средой Грейса. К клеткам добавляют по 0,8 мл/лунку среды Грейса и 200 мкл приготовленного раствора. Инкубируют клетки при 28°С в течение 5 ч. После этого отбирают среду и добавляют к клеткам по 2 мл среды Грейса с 10% ЭСК. Клетки инкубируют при 28°С в течение 2-5 суток. Далее клетки ресуспендируют (интенсивным пипетированием), центрифугируют 5 мин при 5000 об/мин и осветленный супернатант расфасовывают в стерильные пробирки. Титр вируса определяют следующим образом. К монослою клеток Sf21 добавляют 200 мкл разведения вируса и проводят адсорбцию в течение 60 минут при комнатной температуре. Далее готовят 2% легкоплавкую агарозу (Sigma, США) и смешивают ее в расплавленном виде со средой Грейса (10% ЭСК) в соотношении 1:1. Полученную среду охлаждают в термостате до 37°С и добавляют по 2 мл на лунку, а после застывания добавляют по 2 мл на лунку среды Грейса с 10% ЭСК. Инкубируют в термостате при 28°С 5 суток. Далее добавляют по 2 мл на лунку краситель нейтральный красный (0,6% водный раствор), разведенный в среде Грейса с 10% ЭСК, в соотношении 1:20. Инкубируют при 28°С в течение суток. Титр определяют путем подсчета окрашенных бляшек. Последний составляет 107 БОЕ/мл. Суспензию рекомбинантного вируса титруют и хранят при -20°С.

Пример 5. Заражение клеток насекомых Sf21 рекомбинантным вирусом.

200 мкл размороженного вирусного материала с титром 107 наносят на монослой клеток насекомых Sf21 в матрасе для культивирования объемом 250 мл. Инкубируют 30 мин при комнатной температуре. После инкубации добавляют 25 мл среды Грейса с 10% ЭСК. Инкубируют при 28°С в течение 2-3 суток. Далее клетки ресуспендируют интенсивным пипетированием и центрифугируют. Осветленный супернатант используют для выделения продукта экспрессии гена B17R BOK в клетках насекомых методом аффинной хроматографии.

Пример 6. Выделение методом аффинной хроматографии белка IFN_I-BP/BOK - продукта экспрессии гена B17R ВОК в клетках насекомых.

Для приготовления аффинного носителя 1 г CNBr-активированной сефарозы 4В ("Sigma", США) промывают на стеклянном фильтре 3 мМ HCl и ресуспендируют в 3,5 мл 50 мM натрий-бикарбонатного буфера (рН 8.0), содержащего рекомбинантный α2В-интерферон (ФГУН ГНЦ ВБ «Вектор», Россия, [20]). Иммобилизацию интерферона проводят 18 часов при температуре 5°С при мягком перемешивании. Полученной суспензией заполняет колонку размером 0,5×4 см, промывают ее 10-ю мл 0,2 М глицин-HCl (рН 2,5) и уравновешивают 10 мМ трис-HCl (рН 8,0). 200 мл осветленного супернатанта клеток линии Sf21, инфицированных рекомбинантным бакуловирусом, наносят на подготовленную колонку с α2В-интерферон-сефарозой. Колонку промывают 30 мл буфера (10 мМ трис-HCl, рН 6,0). Рекомбинантный белок IFN_I-BP/BOK элюируют с колонки буфером, содержащим 0,2 М глицин-HCl (рН 2,5). Все операции выполняют при температуре 8°С и скорости элюции 4 мл/час. Объем фракций при элюировании составляет 2,5 мл. Детекцию целевого продукта проводят спектрофотометрически на спектрофотометре «Perlin-Elmer 550» (Германия), а затем электрофоретическим анализом фракций по методу Лэмли [21] (Фиг.4). Выход целевого продукта IFN_I-BP/BOK составляет 2,5 мг из 200 мл осветленного лизата. Полученный рекомбинантный белок используют для получения поликлональных антител.

Пример 7. Получение поликлональных антител к рекомбинантному белку IFN_I-ВР/ВОК.

Для получения поликлональных антител проводят 3-кратную иммунизацию беспородных кроликов массой 2-3 кг инъекциями подкожно в области спины полученным рекомбинантным белком. При первом введении антиген эмульгируют в полном адъюванте Фрейнда («Sigma», США), при последующих иммунизациях с интервалами в 7 дней вводят антиген в физиологическом растворе. Через неделю после последней инъекции у животных отбирают кровь из краевой вены уха и отделяют сыворотку. Иммуноглобулины из сыворотки кролика 3-кратно высаливают сульфатом аммония при конечном насыщении 33%.

Пример 8. Определение интерферон-связывающей активности продукта экспрессии гена B17R методом твердофазного иммуноферментного анализа.

В лунки 96-луночного полистирольного планшета вносят для адсорбции по 100 мкл раствора α2В-интерферона или аналога гамма-интерферона - дельтаферона [22] (оба цитокина - производства ФГУН ГНЦ ВБ «Вектор», Россия) в 50 мМ бикарбонате натрия (концентрация интерферонов 2 мкг/мл) и инкубируют 18-20 часов при температуре 8°С. Затем лунки планшета промывают буфером В (10 мМ калий-фосфат, рН 7,4, содержащий 0,8% NaCl и 0,05% твин-20). После удаления содержимого планшета для подавления неспецифичного связывания в лунки вносят 0,1% БСА («Sigma», США) в буфере В и инкубируют при комнатной температуре 2 часа, удаляя затем раствор из лунок аспирацией. В лунки планшета вносят по 100 мкл различных разведении осветленных супернатантов неинфицированных и инфицированных рекомбинантным бакуловирусом BV-B17R клеток Sf21. Для приготовления разведении используют 0,1% БСА в буфере В. Планшет инкубируют в 18 ч при 8°С. После трехкратной промывки буфером B в лунки планшета вносят по 100 мкл поликлональной антисыворотки к рекомбинантному белку IFN_I-BP/BOK, разбавленной 0,1% БСА в буфере в соотношении 1:10000. Планшет инкубируют в 18 ч при 8°С. После трехкратной промывки буфером B в каждую лунку вносят по 100 мкл рабочего раствора коньюгата белка А с пероксидазой хрена («Sigma», США), инкубируют 2 часа при комнатной температуре. По окончании инкубации лунки планшета трижды промывают буфером В, затем в каждую лунку вносят по 100 мкл свежеприготовленного 0,04% раствора о-фенилендиамина («Sigma», США) в 25 мМ цитратно-фосфатном буфере (рН 4,5), содержащем 0.012% перекиси водорода. Планшет инкубируют 30 мин при комнатной температуре в защищенном от света месте. Реакцию останавливают добавлением 100 мкл/лунка 1 М HCl. Результаты иммуноферментного анализа регистрируют, измеряя оптическую плотность при длине волны 495 нм на приборе Microplate Reader ELX808 («BIO-TEK INSTRUMENTS, INC», США) (Фиг.5).

Таким образом, получен рекомбинантный бакуловирус BvB17RG, обеспечивающий экспрессию гена B17R вируса оспы коров штамма GRI-90 - аналога гена клеточного рецептора интерферонов I-го типа в клетках насекомых линии Sf21. Полученный штамм может быть использован для получения рекомбинантного белка IFN_I-BP/BOK, который, в свою очередь, может быть использован для разработки лекарственных препаратов, способных модулировать экзогенный синтез интерферона, либо новой отечественной тест-системы для определения интерферонового статуса человека в норме и патологии.

1. Рекомбинантная плазмидная ДНК pFastBac-В17R, предназначенная для транспозиции в бакуловирус и несущая фрагмент генома вируса оспы коров, кодирующий растворимый белок-аналог клеточного рецептора интерферонов 1-го типа, молекулярной массой 3,85 Мд и размером 5745 п.н., содержащая
ПСР-фрагмент генома вируса оспы коров штамма GRI-90, содержащий ген В 17R, полученный с использованием праймеров
1) 5' CGGGATCCTAGTGCCGTATAATGACGATGA 3',
2) 5' CCCAAGCTTGTATATAAAAATGCATTGTGTA 3',
кодирующий белок-аналог клеточного рецептора интерферонов 1-го типа, фланкированный сайтами узнавания эндонуклеаз рестрикции BamHI и HindIII, размером 1073 п.н.;
BamHI- HindII- фрагмент векторной плазмиды pFastBac, размером 4672 п.н., включающий бакуловирусный промотор pPolh, мини-Тn7-транспазон и сигнал для полиаденилирования вируса SV-40, обеспечивающий сайт-специфическую транспозицию ДНК гена В17R в геном бакуловируса;
генетические маркеры:
ген bla (β-лактамазы), определяющий устойчивость к ампициллину, и ген Gmr, определяющий устойчивость к гентомицину, при трансформации E.coli;
уникальные сайты рестрикции:
BamHI (4032);
HindIII(5105);
EcoRI(4133;4550).

2. Штамм рекомбинантного бакуловируса BvB17RG, полученный с помощью рекомбинантной плазмидной ДНК pFastBac-B17R по п.1, депонированный в коллекции культур микроорганизмов ФГУН ГНЦ ВБ «Вектор» Роспотребнадзора под номером V-388, - продуцент растворимого белка-аналога клеточного рецептора интерферонов 1-го типа вируса оспы коров.



 

Похожие патенты:

Изобретение относится к области биотехнологии, генной инженерии, вирусологии и медицины. .

Изобретение относится к области биотехнологии. .

Изобретение относится к области генетической инженерии и вирусологии. .

Изобретение относится к области вирусологии и медицины. .

Изобретение относится к области генной инженерии и вирусологии. .

Изобретение относится к иммунологии и биотехнологии. .

Изобретение относится к иммунологии и биотехнологии. .

Изобретение относится к биотехнологии и представляет собой мутантный фотопротеин для определения внутриклеточного кальция одновременно в разных органеллах клетки, обладающий светоизлучающей функцией и характеризующийся аминокислотной последовательностью кальций-регулируемого фотопротеина дикого типа, в которой природные остатки фенилаланина, относящиеся к консервативным областям названной последовательности и соответствующие остатку 119 фотопротеина обелина Obelia longissima, а также остатку 88 обелина Obelia longissima заменены другими остатками, отличными от фенилаланина, замены которых приводят к тому, что чувствительность кальций-регулируемого фотопротеина к ионам кальция уменьшается по сравнению с фотопротеином дикого типа и изменяется длина волны испускаемого света по сравнению с фотопротеином дикого типа.

Изобретение относится к анти-М-СSF-специфическим антителам, полученным на основе RX1 или происходящим от RX1, и которые более чем на 75% конкурируют с моноклональными антителами RX1, МС1 и/или МС3 за связывание с M-CSF (макрофагальному колониестимулирующему фактору).

Изобретение относится к протеиновым аналогам интерферона- , в которых аспарагин в положении 25, в соответствии с нумерацией аминокислот в нативном интерфероне- , деамидирован, и цистеин в положении 17, в соответствии с нумерацией аминокислот в нативном интерфероне- , делетирован или замещен нейтральной аминокислотой, которые проявляют повышенные уровни биологической активности нативного интерферона- человека и не требуют НА для стабилизации протеина.
Наверх