Модифицированные днк аптамеры, ингибирующие активность тромбина



Модифицированные днк аптамеры, ингибирующие активность тромбина
Модифицированные днк аптамеры, ингибирующие активность тромбина
Модифицированные днк аптамеры, ингибирующие активность тромбина
Модифицированные днк аптамеры, ингибирующие активность тромбина
Модифицированные днк аптамеры, ингибирующие активность тромбина
Модифицированные днк аптамеры, ингибирующие активность тромбина

 

C12N15/115 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2410432:

Государственное учреждение Научно-исследовательский институт физико-химической биологии имени А.Н. Белозерского Московского государственного университета имени М.В. Ломоносова (RU)
Федеральное государственное учреждение "Российский кардиологический научно-производственный комплекс Федерального агентства по высокотехнологичной медицинской помощи" (RU)

Изобретение относится к области биотехнологии и медицины, а именно к прямым ингибиторам тромбина. Предложен модифицированный аптамерный олигодезоксирибонуклеотид общей формулы

d R-GTGACGTANGGTTGGTGTGGTTGGGGCGTCAC-R,

где d - дезоксирибоза (олигонуклеотид содержит дезоксирибозу во всех позициях), R - химические заместители, В качестве заместителей используют аминогексанол (NH2 группа), который этерифицирует фосфатную группу на 5′ или 3′ конце и PEG, который присоединяют по 5′ и/или 3′ концу. При этом как минимум один из присоединенных по 5′ или 3′ концу заместителей представляет собой полиэтиленгликоль (PEG). Предложенный модифицированный ДНК аптамер ингибируют активность тромбина в плазме крови человека, удлиняя тромбиновое время, протромбиновое время и АЧТВ, и ингибируют стимулируемую тромбином агрегацию тромбоцитов. При внутривенном введении экспериментальным животным он циркулирует в кровотоке дольше, чем базовый аптамер RE31. Данный ДНК-аптамер способен служить основой для лекарственных антитромботических препаратов. 6 ил.

 

Изобретение относится к области биотехнологии и медицины, а именно к модифицированным ДНК аптамерам, представляющим собой олигодезоксирибонуклеотиды (базовые аптамеры), конъюгированные с химическими заместителями, и обладающие антикоагулянтными свойствами, и более конкретно к прямым ингибиторам тромбина, которые могут служить основой для лекарственных антитромботических препаратов.

Для лечения и профилактики тромбозов, применяются препараты, которые либо растворяют уже образовавшийся тромб, либо препятствуют процессу тромбообразования (Машковский М.Д. Лекарственные средства, М., Медицина, 2000, т.2, стр.73-76; Энциклопедия лекарств, изд. 8, М., РЛС, 2001, стр.1503, Справочник ВИДАЛЬ, М., АстраФармСервис, 2001, стр.725).

По механизму действия все известные препараты разбиты на три группы.

- Тромболитики, действие которых направлено на активацию фибринолитической системы крови и растворение тромба (стрептокиназа, урокиназа, тканевой активатор плазминогена).

- Антиагреганты, действие которых направлено на ингибирование агрегации тромбоцитов (аспирин, антагонисты P2Y12 рецепторов АДФ клопидогрель и др.), антагонисты гликопротеинов IIb-IIIa).

- Антикоагулянты - препараты, действующие на свертывающую систему крови и ингибирующие образование фибрина (гепарин и его производные, непрямые антикоагулянты, прямые ингибиторы тромбина).

То, что препараты действуют на разные системы тромбообразования, дает возможность их комбинированного применения, что повышает эффективность и специфичность терапии.

Тромбин играет ключевую роль в процессах внутрисосудистого тромбообразования. Эта протеиназа участвует как в реакциях коагуляции крови, так и в активации тромбоцитов. Наиболее известная реакция тромбина - это отщепление фибринопептидов А и В с образованием мономеров дезААВВ-фибрина, которые затем агрегируют, сшиваются и переходят в нерастворимое состояние. В процессе свертывания крови тромбин не только вызывает образование фибрина из фибриногена, но и активирует многие факторы коагуляционного каскада. Другая важная функция тромбина - индукция активации и агрегации тромбоцитов, реакции запускающей образование тромбов в сосудах артериального русла. Эта функция осуществляется путем взаимодействия тромбина со специфическими PAR рецепторами (protease activated receptors, рецепторы, активируемые протеазами). Тромбин отщепляет N-концевой пептид рецептора, а появляющийся новый N-концевой фрагмент взаимодействует со специальным внеклеточным участком рецептора, что и приводит к инициации активирующего сигнала. В реакциях гидролиза высокомолекулярных субстратов принимают участие, как минимум, два участка молекулы тромбина - активный центр фермента и область специфичного «узнавания» субстрата, связывание с которой ориентирует субстрат относительно активного центра. Высокоаффинное и специфичное связывание двух упомянутых выше субстратов тромбина - фибриногена и PAR рецептора осуществляется через участок, получивший название экзосайт I. Учитывая ключевую роль тромбина в основных тромботических реакциях - образовании фибрина и активации тромбоцитов, очевидно, что ингибирование активности тромбина представляет собой один из наиболее перспективных и эффективных путей профилактики и терапии тромбозов. [Lane D.A., Philippou H., Huntington J.A. Blood 2005, v.106, pp.2605-2612].

Традиционным антикоагулянтным препаратом, ингибирующим реакции тромбина является гепарин и его производные. Гепарин подавляет активность тромбина не напрямую - механизм его действия основан на активации антитромбина III, главного эндогенного ингибитора тромбина. Кроме того, гепарин способен связывать не только антитромбин, но и многие другие белки плазмы крови и клеток сосудистого русла. Последние обстоятельства определяют негативные побочные эффекты применения гепарина, например тромбоцитопению. Недостатков гепарина лишены прямые ингибиторы тромбина, такие как полипептид гирудин и его производные (бивалирудин) и некоторые низкомолекулярные синтетические ингибиторы (аргатробан, дабигатран), которые подавляют активность тромбина, действуя непосредственно на сам фермент. Гирудин и его производные взаимодействуют как с активным центром, так и с участком связывания субстратов (экзосайт 1), а низкомолекулярные ингибиторы - только с активным центром. Также, в отличие от гепарина, эти соединения не взаимодействуют с другими (кроме тромбина) плазменными и клеточными белками, и не вызывают развития такого нежелательного побочного эффекта, как тромбоцитопения. (Di Nisio M., Middeldorp S., Buller H.R. New Eng. J. Med. 2005, v.353, pp.1028-1040].

Известны пептиды Gly-Pro, Trp-Pro, Pro-Gly, Gly-Pro-Gly-Gly и Pro-Gly-Pro, обладающие антикоагулянтной и фибринолитической активностью (В.Е.Пасторова, Л.Я.Ляпина, Т.Ю.Смолина, И.П.Ашмарин. Антикоагулянтные и фибринолитические эффекты некоторых пролинсодержащих пептидов. Известия АН. Серия биологическая. 1998. №3, с.390-394).

Однако все эти пептиды не обладают антитромбоцитарной и антитромботической активностью.

Известны пептиды Pro-Gly и Pro-Gly-Pro, обладающие антитромбоцитарной активностью (В.Е.Пасторова, Л.Я.Ляпина, И.П.Ашмарин, Р.У.Островская, Т.А.Гудашева, Э.В.Луговской. Фибриндеполимеризационная активность и антитромбоцитарный эффект циклического и линейных коротких пролинсодержащих пептидов. Известия АН. Серия биологическая, 2001, №5, с.593-596).

Однако данные известные пептиды обладают слабым антикоагулянтным действием.

В качестве прямых ингибиторов тромбина могут быть использованы и аптамеры - ДНК или РНК олигонуклеотиды, способные к высокоспецифичному связыванию и ингибированию активности молекул-мишеней.

Подобно антителам молекулы ДНК способны допускать различные трехмерные структуры в зависимости от их последовательности. Некоторые из них могут иметь значение для связывания с мишенью. Такими мишенями могут служить как небольшие лиганды, так и крупные белковые комплексы. Аптамеры отбираются с помощью метода SELEX по связыванию с выбранной мишенью. (Systematic evolution of ligands by exponential enrichment) (Систематическое развитие лигандов посредством экспоненциального обогащения) для отбора и идентификации молекул одноцепочечных молекул ДНК или РНК, называемых аптамерами.

При необходимости проводится направленный дизайн и/или модификация отобранного аптамера. По своему сродству по отношению к молекуле мишени аптамеры сравнимы с антителами. Однако в отличие от антител, и других соединений, имеющих пептидную структуру (например, гирудин и его производные), олигонуклеотидные аптамеры являются неиммуногенными соединениями.

Технология аптамеров объединяет генерирование огромного структурного разнообразия в случайных пулах олигонуклеотидов с мощностью полимеразной цепной реакции (ПЦР) для амплификации отобранных последовательностей. Эта технология включает в себя скрининг большого пула со случайными последовательностями олигонуклеотидов и основана на том факте, что они допускают большое количество третичных структур, некоторые из которых могут обладать желаемой связывающей или каталитической активностью против молекул - мишеней. Хотя ингибирование не является необходимым для этого отбора, во многих случаях эти лиганды непосредственно ингибируют биологические функции белков-мишеней. В этих случаях ингибиторные функции этих лигандов предположительно обусловлены перекрыванием их сайтов с функциональным районом белков.

В последние годы аптамеры рассматривают как потенциальные фармакологические субстанции, которые могут быть использованы для разработки лекарственных препаратов. [Кульбачинский А.В. Успехи биол. химии. 2006. Т.246. С.193-224; Lee J.F., Stovall G.M., Ellington A.D. Curr. Opin. Chem. Biol. 2006, v.10, pp.282-289]. Одно из направлений, связанное с возможностью фармакологического использования аптамеров - это создание на их основе антитромботического препарата - прямого ингибитора тромбина [Спиридонова В.А., Рог Е.В., Дугина Т.Н. Струкова СМ., Копылов A.M. Биоорг. Химия. 2003. Т.29, №5. С.495-498]

Для тромбина получены аптамерные ДНК, свойства которых описаны, например, в ряде публикаций, приведенных ниже:

Bock L.C., Griffin L.C., Latham J.A., Vermaas E.H., Toole J.J. Nature 1992. v.355. p.564-566]

Macaya R.F., Gao H., Joesten M.E., Yang M., Patel R., Bertelsen A.H., Cook A.F. Biochemistry, 1995, v.34, p.4478-92.

Tasset D.M., Kubik M.F., Steiner W.J. Mol.Biol, 1997, v.272, p.688-698.

Kubik M.F., Stephens A.W., Schneider D., Marlar R.A., Tasset D. Nucleic Acid Res. 1994, v.22, p.2619-2626.

Ikebukuro К., Okumura Y., Sumikura K., Karube I., Nucleic Acid Res. 2003, RS 3, p.205-206.

Ikebukuro K, Okumura Y, Sumikura K, Karube I, Nucleic Acid Res. 2005, v.33, N12, e108.

Ikebukuro K., Yoshida W., NomaT., Sode K. Biotechnol Lett. 2006, v. 28, p.1933-1937.

Pagano В., Martino L., Randazzo A., Giancola С.Biophys. J. 2008 v.94, p.562-569.

Griffin L.C., Tidmarsh G.F., Bock L.C., Toole J.J., Leung L.L.K. Blood 1993, v.12, p.3271-3276.

Li W-X., Kaplan A.V., Grant G.W., Toole J.J., Leung L.L. Blood 1994, v.3, p.677-682.

Reyderman L., Stavchansky S. Pharmaceutical research 1998, v.15, p.904-910.

Shaw J.P., Fishback J.A., Cundy K.C., Lee W.A. Pharmaceutical research 1995, v.12, p.1937-1942.

Lee W.A., Fishback J.A., Shaw J.P., Bock L.C., Griffin L.C., Cundy K.C. Pharmaceutical research 1995, v.12, p.1943-1947.

Добровольский А.Б., Титаева Е.В., Хаспекова С.Г., Спиридонова В.А., Копылов A.M., Мазуров А.В. Бюлл. Эксп. Биол. Мед. 2009. Т.147, №7. С.41-45.

В частности, в RU 2360000, 27.06.2009 описаны новые катепсин G-ингибирующие аптамеры, которые являются одно- или двухцепочечными линейными ДНК-последовательностями или полинуклеотидными последовательностями, характеризующимися тем, что они имеют длину цепи по меньшей мере 60 нуклеотидов, предпочтительно 70 нуклеотидов и по существу не подвергаются межмолекулярному и/или внутримолекулярному спариванию.

Эти ДНК-последовательности могут иметь длину цепи 70-120 нуклеотидов, предпочтительно 70-110 нуклеотидов, даже более предпочтительно 80-100 нуклеотидов. Хотя последовательности могут быть одно- или двухцепочечными, предпочтительными являются одноцепочечные последовательности. Последовательности характеризуются также предпочтительно тем, что они имеют молярное содержание гуанина приблизительно 25-50%, предпочтительно 35-45% и/или имеют молярное отношение AG/TC приблизительно 1,0-2,0, предпочтительно 1,2-1,8 (для целей данного изобретения AG обозначает общее число нуклеотидов А и G этой последовательности, тогда как ТС обозначает общее число нуклеотидов Т и С этой последовательности).

Предпочтительными вариантами являются:

олигомеры (GT)n или (АС)n, в которых n находится в диапазоне 35-60, предпочтительно 40-50;

гомополимеры (Т)n, или (G)n, или (А)n, или (С)n, или (инозин)n, в которых n находится в диапазоне 70-120, предпочтительно 80-100.

Эти аптамеры селективно и эффективно ингибируют катепсин G, и, следовательно, они могут быть использованы в приготовлении лекарственного средства для лечения и профилактики воспалительных заболеваний, прокоагулянтных состояний, генетических заболеваний, дегенеративных заболеваний, повреждений ДНК, неоплазии и/или кожных заболеваний.

Ранее авторами заявленного изобретения был разработан оригинальный 31-звенный ДНК аптамер, получивший кодовое название RE31 и имеющий последовательность GTGACGTAGGTTGGTGTGGTTGGGGCGTCAC. Этот аптамер не уступает по своей способности ингибировать активность тромбина, также 31-звенному аптамеру 31ТВА (ТВА - thrombin binding aptamer) с последовательностью CACTGGTAGGTTGGTGTGGTTGGGGCCAGTG, одному из наиболее высокоэффективных из ранее описанных антитромбиновых аптамеров. [Спиридонова В.А., Головин А.В., Копылов A.M., Добровольский А.Б., Мазуров А.В. Заявка на патент РФ №2008149583 от 17 декабря 2008 г.].

Однако известно, что немодифицированные аптамеры, и, в том числе ДНК аптамеры против тромбина, характеризуются очень коротким (не более нескольких минут) временем жизни в кровотоке [Griffin L.C., Tidmarsh G.F., Bock L.C., Toole J.J., Leung L.L.K. Blood 1993, v.12, p.3271-3276]. Это свойство может препятствовать созданию на их основе эффективных лекарственных препаратов. В связи с этим для удлинения времени жизни in vivo базовые олигонуклеотидные последовательности могут подвергаться химическим модификациям. Эти модификации, во-первых, защищают аптамеры от действия нуклеаз, а, во-вторых, замедляют их выведение через почки. Известны модифицированные аптамеры с потенциальными антитромботическими свойствами, направленные против фактора Виллебранда [Gilbert J.C., De Feo-Fraulini Т., Hutabarat R.M., Horvath C.J., Merlino P.C., Marsh H.N. et al. Circulation 2007, v. 116, pp.2678-2686] и фактора IX [Dyke C.K., Steinhubl S.R., Kleiman N.S., Cannon R.O., Aberle L.G., Lin M., et al. Circulation 2006, v.114, pp.2490-2497].

Технической задачей настоящего изобретения является модификация антитромбинового ДНК аптамера RE31 с целью удлинения времени его жизни в кровотоке без существенного снижения способности ингибировать реакции тромбина.

Поставленная техническая задача достигнута модифицированным аптамерным олигонуклеотидом, представляющим собой олигодезоксирибонуклеотид ДНК-аптамер, характеризующийся нуклеотидной последовательностью

GTGACGTAGGTTGGTGTGGTTGGGGCGTCAC и конъюгированный по 5′ или 3′ концу с NH2 группой этерификацией аминогексанолом фосфатной группы на 5′ или 3′ конце и/или с полиэтиленгликолем PEG, присоединенным по 5′ и/или 3′ концу, при этом как минимум один из присоединенных по 5′ и 3′ концу заместителей представляет собой полиэтиленгликоль (PEG), и отвечающий общей формуле

d R-GTGACGTANGGTTGGTGTGGTTGGGGCGTCAC-R,

где d - дезоксирибоза, при этом олигонуклеотид содержит дезоксирибозу во всех позициях, R - химические заместители - NH2 группа и/или полиэтиленгликоль (PEG).

Итак, задача достигается присоединением по 5′ и 3′ концам базового олигонуклеотидного аптамера RE31 с последовательностью GTGACGTANGGTTGGTGTGGTTGGGGCGTCAC аминогексанола (NH2 группы) или полиэтиленгликоля (PEG).

Таким образом, общая формула модифицированных ДНК аптамеров по изобретению может быть представлена как:

где d - дезоксирибоза (олигонуклеотид содержит дезоксирибозу во всех позициях), R - химичекие заместители. В качестве заместителей (модифицирующих агентов) R используют аминогексанол, который этерифицирует фосфатную группу на 5′ или 3′ конце и PEG, при этом как минимум один из присоединенных по 5′ и 3′ концу заместителей представляет собой полиэтиленгликоль (PEG).

На основании формулы (1) было создано 3 модифицированных аптамера с кодовыми названиями NH2-RE-PEG, PEG-RE-NH2 и PEG-RE-PEG. В аптамере NH2-RE-PEG произведено введение NH2 группы по 5′ и PEG по 3′ концам олигонуклеотида, в аптамере PEG-RE-NH2 - введение PEG по 5′ и NH2 по 3′ концам олигонуклеотида, и в аптамере PEG-RE-PEG - введение PEG по обоим концам олигонуклеотида.

Все 3 аптамера по изобретению:

- ингибируют активность тромбина в плазме крови человека, удлиняя АЧТВ, протромбиновое и тромбиновое время, в концентрациях, сравнимых с базовым аптамером RE31;

- ингибируют стимулируемую тромбином агрегацию тромбоцитов, опосредуемую связыванием тромбина с PAR рецепторами тромбоцитов в концентрациях сравнимых с базовым аптамером RE31;

- при внутривенном введении экспериментальным животным циркулируют в кровотоке дольше, чем базовый аптамер RE31.

Получают модифицированные ДНК-аптамеры по изобретению следующим образом.

Базовую олигонуклеотидную последовательность аптамера RE31 синтезируют на автоматическом синтезаторе Applied BioSystems 380b с использованием стандартных производных (синтонов) нуклеотидов, как подробно описано в приложении А к научно-техническому отчету по этапу 1.

После окончания синтеза основной олигонуклеотидной последовательности на 5′-конец вводится нужная модификация. Сначала вводят гликольную группировку, которая фосфорилирована по концевой гидроксильной группе. На 5′-концевой остаток фосфора присоединяют аминогексанол, так что концевой становится алифатическая аминогруппа.

Введение аминогруппы на 3′-конец проводят по аналогичной схеме - после снятия олигонуклеотида с полимерного носителя фосфитного эфира окисляют до фосфатного производного и присоединяют к нему гексанол, который образует эфир с пятивалентным концевым фосфорным остатком, а аминогруппа остается экспонированной в раствор. Масштаб синтеза составлял 0,1-0,2 мкмоля/г.

При введении полиэтиленгликоля нуклеотид, закрепленный на стекле, этерифицируют полиэтиленгликолем (PEG), затем фосфорилируют для дальнейших работ. При введении полиэтиленгликоля на 3′- конец используют спейсеры - небольшие по длине олигонуклеотидные последовательности, которые позволяют придать гибкость полимерной цепочке и дают возможность далее присоединять протяженные гликольные звенья нужной длины.

Отщепление олигодезоксирибонуклеотида с полимерного носителя и снятие защитных групп проводят слудующим образом. Полимер из колонки помещают в пробирку на 1,5 мл, заливают 0,5 мл конц. NH3 и инкубируют при комнатной температуре 1,5-2,0 часа. Осадок собирали центрифугированием, промывали 0,3 мл конц. NH3, супернатанты объединяли и выдерживали при 55° 10-12 часов. После охлаждения раствора аммиак упаривают и остаток растворяют в 1 мл дистиллированной воды.

Анализ реакционной смеси проводят на хроматографе Tracor, колонка 4×250 мм с обращенно-фазовым сорбентом Диасорб С16Т с размером пор 7 мкм. Колонку предварительно уравновешивают буфером: 48 мМ фосфат калия (рН=7,0), 2 мМ дигидрофосфат тетрабутиламмония, 5% ацетонитрил, при 45° и скорости потока 1 мл/мин. Измерения проводят при 260 нм, вещество вводят шприцем в объеме 2,5 мкл. На хроматограмме реакционной смеси, кроме целевого олигонуклеотида, как правило, видны более короткие продукты. Их образование связано с невозможностью полного проведения конденсации, со 100% выходом. Препаративное разделение реакционной смеси проводят обращенно-фазовой хроматографией. Носитель тот же, который используется в первом случае. Как правило, объем реакционной смеси составляет 0,5-1,0 мл. Вещество элюируется в следующем диапазоне (50-80%) буфера 48 мМ фосфат калия (рН=7,0), 2 мМ дигидрофосфат тетрабутиламмония, 40% ацетонитрил. Собранное вещество многократно упаривают при добавлении 1 мл 50% раствора метанола в воде для удаления следов аммония. Удаление 5′-О-диметокситритильной защиты проводят в 1,5 мл 80% уксусной кислоты, 30 мин при комнатной температуре. Для удаления уксусной кислоты раствор многократно упаривают на роторном испарителе, добавляя каждый раз 1,5 мл 50% раствора метанола в воде. Полученный продукт растворяют в 1 мл воды. Для определения количества полученного олигонуклеотида по окончании разделения проводили обработку хроматограмм, интегрируя площадь пиков и рассчитывали концентрацию целевого продукта по формуле S×4×10-6.

Нижеследующие примеры иллюстрируют свойства модифицированных ДНК-аптамеров, как прямых ингибиторов тромбина с удлиненным временем жизни в кровотоке, и их применение (использование), но не ограничивают их.

Пример 1. Ингибирование модифицированными аптамерами коагуляционных реакций тромбина. Сравнение с базовым, немодифицированным аптамером RE31.

Анализ влияния модифицированных аптамеров (NH2-RE-PEG, PEG-RE-NH2 и PEG-RE-PEG) на свертывание крови включал исследование 3-х показателей: тромбинового времени, протромбинового времени и активированного частичного тромбопластинового времени (АЧТВ). Исследования проводили в сравнении с базовым аптамером RE31.

В тесте «тромбиновое время» определяли действие аптамеров на образование фибрина, катализируемое экзогенным тромбином. В кювету коагулометра вносили 0,1 мл раствора аптамеров в 25 мМ HEPES буфере (рН 7,4), содержащем 150 мМ NaCl и 5 мМ KCl и 0.1 мл цитратной плазмы человека. После инкубирования в течение 2 мин при 37°С реакцию стартовали добавлением 0,1 мл раствора тромбина человека с концентрацией 6 ед/мл (удельная активность 4400 ед/мл). Регистрировали время образования сгустка.

Из фиг.1 видно, что все три модифицированных аптамера в концентрациях до 0,38 мкМ существенно (более чем в 8-10 раз) удлиняют время образования фибрина после добавления экзогенного тромбина к человеческой плазме. По способности ингибировать действие экзогенного тромбина они уступают базовому аптамеру RE31, в среднем приблизительно в 1,5 раза в соответствии с концентрациями, при которых достигаются одинаковые эффекты на время свертывания плазмы.

На фиг.1 показано влияние модифицированных аптамеров и базового аптамера RE31 на тромбиновое время. Представлены результаты одного из 3 воспроизводимых экспериментов

В двух следующих сериях экспериментов изучали влияние аптамеров на образование фибринового сгустка, катализируемое эндогенным тромбином при активации свертывания по «внешнему» (протромбиновое время) и «внутреннему» пути (АЧТВ). Влияние аптамеров на протромбиновое время исследовали следующим образом. В кювету коагулометра вносили 20 мкл раствора аптамера в 25 мМ HEPES буфере (рН 7,4), содержащем 150 мМ NaCl и 5 мМ KCl, затем 100 мкл нормальной цитратной плазмы человека. После инкубации в течение 2 мин при 37° реакцию стартовали добавлением 100 мкл Са-тромбопластина ("STA Neoplastin Plus" производства "Diagnostica Stago"). Влияние аптамеров на АЧТВ исследовали следующим образом. В кювету коагулометра вносили 20 мкл раствора аптамера в 25 мМ HEPES буфере (рН 7,4), содержащем 150 мМ NaCl и 5 мМ КС1, затем 100 мкл нормальной цитратной плазмы человека. Инкубировали в течение 2 мин при 37°, добавляли 100 мкл реактива "STA АРТТ" и через 3 мин реакцию стартовали добавлением 100 мкл 25 мМ CaCl2. В обоих тестах регистрировали время образования сгустка.

На фиг.2 показано влияние модифицированных аптамеров и базового аптамера RE31 на протромбиновое время.

На фиг.3 показано влияние модифицированных аптамеров и базового аптамера RE31 на АЧТВ. Представлены результаты одного из 3 воспроизводимых экспериментов.

Из фиг.2 и 3 видно, что в обоих случаях все три модифицированных аптамера в концентрациях до 3 мкМ существенно удлиняли времена свертывания крови - протромбиновое время не менее чем в 5 раз, а АЧТВ приблизительно в 3-4 раза. Концентрации модифицированных аптамеров, при которых достигались эффекты, сходные с базовым аптамером RE31, были выше в обоих тестах - в тесте протромбиновое время не более чем в 2 раза, а тесте АЧТВ в 1,5-4 раза для разных аптамеров.

Можно отметить, что во всех 3 коагуляционных тестах наибольшую ингибирующую активность среди модифицированных аптамеров проявлял аптамер NH2-RE-PEG. Для этого аптамера различия в одинаково эффективных концентрациях по сравнению с базовым аптамером RE31 не превышали 50%.

Пример 2. Ингибирование модифицированными аптамерами тромбин-индуцированной агрегации тромбоцитов. Сравнение с базовым, немодифицированным аптамером RE31.

Влияние модифицированных аптамеров (NH2-RE-PEG, PEG-RE-NH2 и PEG-RE-PEG) на тромбин-индуцированную агрегацию тромбоцитов, исследовали в сравнении с базовым аптамером RE31.

Отмытые тромбоциты получали из крови здоровых доноров в соответствии с ранее описанным методом [Mazurov A.V., D.V.Vinogradov, N.V.Kabaeva, G.N. Antonova, Yu.A.Romanov, T.N.Vlasik, et al. Thromb. Haemost, 1991, v.66, pp.494-499]. Отмытые тромбоциты суспендировали в растворе Тироде/Hepes (137 мМ NaCl, 2,7 мМ KCl, 0,36 мМ NaH2PO4, 0,1% декстрозы, 1 мМ MgCl2, 0,35% БСА, 5 мМ Hepes, рН 7,35) в концентрации 3×108 на 1 мл. После ресуспендирования к отмытым тромбоцитам добавляли CaCl2 в конечной концентрации 1 мМ. Агрегацию тромбоцитов изучали в агрегометре БИОЛА. В кювету агрегометра добавляли по 300 мкл суспензии отмытых тромбоцитов и регистрировали агрегацию по изменению светопропускания суспензии (Т, %) при 37° и перемешивании со скоростью 800 об/мин. Для стимуляции агрегации использовали тромбин человека в конечной концентрации 0,25 ед/мл (удельная активность 4400 ед/мг). Аптамеры добавляли в агрегационную кювету не менее чем за 2 мин до добавления тромбина, а тромбин (0,1 ед/мл) через 30 с после начала регистрации светопропускания.

На фиг.4 и 5 представлены кривые тромбин-индуцированной агрегации тромбоцитов в отсутствие и присутствии исследованных аптамеров. Видно, что в концентрации 0,01 мкМ все три модифицированных аптамера в той или иной степени подавляли тромбин-индуцированную агрегацию. При этом максимальный эффект достигался в присутствии NH2-RE-PEG, который ингибировал агреагцию практически также, как и исходный немодифициованный аптамер RE31. (фиг.4). При увеличении концентрации модифицированных аптамеров до 0,02-0,025 мкМ все они полностью подавляли тромбин-индуцированную агрегацию. На фиг.5 в качестве примера представлены кривые агрегации при добавлении различных концентраций наименее эффективного аптамера PEG-RE-PEG.

На фиг.4 и 5 показано влияние модифицированных аптамеров и базового аптамера RE31 на тромбин-индуцированную агрегацию тромбоцитов. Фиг.4. К тромбоцитам не добавляли аптамеров (кривая 0) или добавляли аптамеры RE31 (кривая 1), NH2-RE-PEG (кривая 2), PEG-RE-NH2 (кривая 3), PEG-RE-PEG (кривая 4) в концентрации 0,01 мкМ. Фиг.5. К тромбоцитам не добавляли аптамеров (кривая 0) или добавляли аптамер PEG-RE-PEG в концентрациях 0,025, 0,02, 0,015 и 0,01 мкМ (кривые 1-4 соответственно). На обоих чертежах представлены результаты одного из 3 воспроизводимых экспериментов.

Несмотря на существенный (иногда в несколько раз) разброс абсолютных значений концентраций аптамеров, при которых наблюдалось полное ингибирование агрегации в различных экспериментах, соотношение между эффектами изучаемых аптамеров сохранялось неизменным. По своей ингибирующей активности NH2-RE-PEG незначительно уступал базовому аптамеру RE31, но несколько превосходил 2 других модифицированных аптамера - PEG-RE-NH2 и PEG-RE-PEG (см. фиг.4).

Пример 3. Выведение модифицированных аптамеров из кровотока крысы. Сравнение с базовым, немодифицированным аптамером RE31.

Определяли скорость выведения модифицированных аптамеров (NH2-RE-PEG, PEG-RE-NH2 и PEG-RE-PEG) из кровотока крысы после их внутривенного введения в сравнении с базовым аптамером RE31. Присутствие аптамеров в кровотоке регистрировали по их способности ингибировать действие тромбина на свертывание крови в тесте тромбиновое время.

Крысам линии Wistar (вес от 350 до 500 г) через установленный в предсердие катетер внутривенно вводили аптамеры в дозе 60 мкг на 100 г веса. Кровь отбирали до и затем через 5, 15, 30 и 60 мин после введения аптамеров. В качестве антикоагулянта использовали 0,11 М цитрат натрия в соотношении кровь:антикоагулянт 1:9. Объем крови в каждой пробе - 1 мл. Кровь центрифугировали при 10000 g в течение 5 мин и затем отбирали плазму. Плазму крысы смешивали со стандартной плазмой человека в соотношении 1:3 и измеряли тромбиновое время, стимулируя свертывание раствором тромбина человека с активностью 3 ед/мл. (Разведение крысиной плазмы проводили с целью стандартизации условий измерения). За 100% принимали время образования сгустка в пробах, отобранных до введения аптамеров.

На фиг.6 показано выведение аптамеров из кровотока крысы. Крысам вводили указанные аптамеры и отбирали кровь до и через указанные промежутки времени после введения аптамеров. Плазму крысы смешивали со стандартной плазмой человека в соотношении 1:3 и определяли в полученной смеси тромбиновое время. Представлены средние значения из 3 экспериментов.

Как видно из фиг.6 эффекты немодифицированного базового аптамера RE31 на тромбиновое время удается регистрировать лишь через 5 минут после введения в кровоток крысе, а через 15 мин тромбиновое время уже не отличалось от контрольного (до введения аптамера). При введении всех модифицированных аптамеров удлинение тромбинового времени через 5 минут было более выражено, чем при введении аптамера RE31 - в 2-2,5 раза по сравнению с 60-70% соответственно. В отличие от RE31 все модифицированные аптамеры сохраняли свое действие через 15 мин и 30 мин после введения (удлинение тромбинового времени на 40-60% и 15-40% соответственно) и лишь через 60 мин показатели сравнивались с контрольным уровнем. Наиболее выраженные эффекты через 15 и 30 минут были зарегистрированы для аптамера NH2-RE-PEG.

Необходимо отметить, что более длительное действия модифицированных аптамеров на тромбиновое время отмечалось, несмотря на то, что в условиях in vitro степень ингибирования ими активности тромбина была несколько ниже по сравнению с базовым аптамером RE31 (см. пример 1). Полученные результаты указывают на то, что проведенные модификации позволили существенно - не менее чем в 3-5 раз (для разных вариантов модификации) увеличить время жизни аптамеров в кровотоке in vivo.

Модифицированный аптамерный олигонуклеотид, обладающий способностью ингибировать реакции тромбина с увеличенным временем жизни в кровотоке, представляющий собой олигодезоксирибонуклеотид ДНК - аптамер, характеризующийся нуклеотидной последовательностью
GTGACGTAGGTTGGTGTGGTTGGGGCGTCAC
и конъюгированный по 5′ или 3′ концу с NH2 группой этерификацией аминогексанолом фосфатной группы на 5′ или 3′ конце и/или с полиэтиленгликолем (PEG), присоединенным по 5′ и/или 3′ концу, при этом как минимум один из присоединенных по 5′ или 3′ концу заместителей представляет собой полиэтиленгликоль (PEG), и отвечающий общей формуле
d R-GTGACGTANGGTTGGTGTGGTTGGGGCGTCAC-R,
где d - дезоксирибоза, при этом олигонуклеотид содержит дезоксирибозу во всех позициях, R - химические заместители - NH2 группа и/или полиэтиленгликоль (PEG).



 

Похожие патенты:

Изобретение относится к области генной инженерии, конкретно к носителям для доставки лекарственного средства, и может быть использовано в медицине. .

Изобретение относится к области биотехнологии и может быть использовано для получения фактора VII свертывания крови человека. .

Изобретение относится к области молекулярной биологии и может быть использовано в медицине. .

Изобретение относится к области биотехнологии и биохимии и может быть использовано в медицине. .

Изобретение относится к биотехнологии и может быть использовано в селекции организмов, например растений. .

Изобретение относится к новым ДНК-соединениям и клинирующим векторам рекомбинантной ДНК, кодирующим новые зимогенные формы человеческого белка С. .

Изобретение относится к биотехнологии и относится к рекомбинантной плазмиде pP10PLC-Bc для экспрессии в дрожжах Pichia pastoris гена фосфолипазы. .

Изобретение относится к области биотехнологии, в частности к способу получения иммуногенного рекомбинантного экстраклеточного фрагмента коннексина-43. .

Изобретение относится к биотехнологии и генетической инженерии и представляет собой рекомбинантную термостабильную ДНК-лигазу Thermococcus sp 1519, проявляющую лигазную активность в присутствии ионов магния, в широком диапазоне значений рН (7,0-10,7) и концентраций натрия хлорида (25-150 мМ).

Изобретение относится к области биотехнологии, конкретно, к получению рекомбинантного мутантного TRAIL человека и может быть использовано для исследования TRAIL опосредованных механизмов апоптоза, а также в качестве терапевтического средства для лечения DR5-зависимых опухолей.

Изобретение относится к биотехнологии и решает задачу поиска новых лекарственных средств, направленных против боли. .

Изобретение относится к биотехнологии и представляет собой способ продукции пуриновых нуклеозидов с использованием бактерии, принадлежащей к роду Bacillus, содержащей фрагмент ДНК, кодирующий мутантную бактериальную фосфорибозилпирофосфатсинтетазу, в которой L-аминокислотный остаток, соответствующий положению 120, 135 или 194 в последовательности фосфорибозилпирофосфатсинтетазы дикого типа из Bacillus subtilis замещен остатком другой L-аминокислоты, и чувствительность указанного фермента к ингибированию пуриновыми нуклеотидами по типу обратной связи снижена.

Изобретение относится к медицине, в частности к иммунологии и эндокринологии, и касается лечения гипофункции щитовидной железы после операции по поводу узловых образований щитовидной железы.
Наверх