Вариантные фитазные ферменты



Вариантные фитазные ферменты
Вариантные фитазные ферменты
Вариантные фитазные ферменты
Вариантные фитазные ферменты
Вариантные фитазные ферменты
Вариантные фитазные ферменты

 


Владельцы патента RU 2421520:

ДАНИСКО А/С (DK)

Настоящее изобретение относится к фитазе, полученной из бактерии Buttiauxella sp., и ее модифицированным формам. Данные ферменты обладают улучшенными характеристиками по сравнению с ферментом дикого типа, выбранными из высокой термической стабильности, активности в широком диапазоне рН, высокой специфической активности, широкой субстратной специфичности и протеолитической стабильности. Кроме того, предлагаются нуклеиновые кислоты, кодирующие данные ферменты, вектор, содержащий данные нуклеиновые кислоты, клетка-хозяин, несущая вектор, и способ получения предложенных фитазных ферментов из клеток-хозяев. Настоящее изобретение также относится к пищевому продукту или корму для животных и к способу получения пищевого продукта или корма для животных, который включает в себя добавление фитазного фермента по настоящему изобретению к одному или нескольким ингредиентам приготовляемого продукта или корма. Использование фитазных ферментов по настоящему изобретению в качестве добавок к кормам для животных позволяет улучшить доступность органического фосфора и снизить загрязнение фосфатом окружающей среды. 11 н. и 17 з.п. ф-лы, 3 ил., 2 табл.

 

Настоящее изобретение относится к фитазам, нуклеотидным последовательностям для них, способам продуцирования фитаз и их применению.

Область техники, к которой относится изобретение

Настоящее изобретение относится к области ферментов в качестве добавок к кормам. Более конкретно, настоящее изобретение относится к фитазам, которые могут быть использованы для усиления усвоения фосфата в продуктах питания и кормах для животных.

Предшествущий уровень техники и известный уровень техники

Фитат представляет собой основную форму запасания фосфора в зерновых злаках и бобовых растениях. Однако моногастрические животные (животные с однокамерным желудком), такие как свинья, домашняя птица и рыба, не способны метаболизировать или абсорбировать фитат (или фитиновую кислоту) и поэтому он экскретируется, приводя к загрязнению фосфором в областях интенсивного животноводства. Кроме того, фитиновая кислота также действует как антидиетологический агент у моногастрических животных посредством хелатирования металлических агентов, таких как кальций, медь и цинк.

Для того чтобы обеспечить достаточно фосфатов для роста и здорового состояния этих животных, неорганический фосфат добавляют в их рационы. Такое добавление может быть дорогостоящим и дополнительно усиливает проблемы загрязнения.

В результате действия фитазы фитат обычно гидролизуется, производя низшие инозитфосфаты и неорганический фосфат. Фитазы используют в качестве добавок к кормам для животных, где они улучшают доступность органического фосфора у животных и снижают загрязнение фосфатом окружающей среды (Wodzinski RJ, Ullah AH. Adv Appl Microbiol. 42, 263-302 (1996)).

Ряд фитаз грибного (Wyss M. с сотр. Appl. Environ. Microbiol. 65 (2), 367-373 (1999); Berka R.M. с сотр. Appl. Environ. Microbiol. 64 (11), 4423-4427 (1998); Lassen S. с сотр. Appl. Environ. Microbiol. 67 (10), 4701-4707 (2001)) и бактериального происхождения (Greiner R. с сотр. Arch. Biochem. Biophys. 303 (1), 107-113 (1993); Kerovuo с сотр. Appl. Environ. Microbiol. 64 (6), 2079-2085 (1998); Kim H.W. с сотр. Biotechnol. Lett. 25, 1231-1234 (2003); Greiner R. с сотр. Arch. Biochem. Biophys. 341 (2), 201-206 (1997); Yoon S.J. с сотр. Enzyme and microbial technol. 18, 449-454 (1996); Zinin N.V. с сотр. FEMS Microbiol. Lett. 236, 283-290 (2004))) были описаны в литературе.

Однако в настоящее время ни одна из этих фитаз не проявляет свойства, необходимые для эффективного применения в качестве добавки к корму для животных. В частности, грибные фитазы проявляют тенденцию к протеолитической нестабильности (Igbasan F.A. с сотр. Arch. Anim. Nutr. 53,353-373 (2000)) и поэтому чувствительны к расщеплению, в то время как большинство бактериальных фитаз имеет узкую субстратную специфичность для одного фитата и слабо расщепляет инозитфосфаты промежуточных стадий фосфорилирования (Greiner R. с сотр., Arch. Biochem. Biophys. 303 (1), 107-113 (1993); Kerovuo J с сотр. Biochem. J. 352, 623-628 (2000)).

Следовательно, существует необходимость улучшения фитаз.

Сущность изобретения

В широком аспекте настоящее изобретение относится к фитазам, полученным из бактерии и ее модифицированным формам. В частности, изобретение относится к фитазам, полученным из бактерии Buttiauxella sp. и ее вариантным/модифицированным формам, выбранным и/или сконструированным для улучшения характеристик по сравнению с ферментом дикого типа (исходным).

Настоящее изобретение является выгодным, так как оно предоставляет новые фитазы, которые обладают свойствами, делающими их практически полезными и эффективыми в качестве кормовых ферментов. В частности, изобретение относится к выделенным и/или очищенным новым фитазным полипептидам, как описано в данном описании, или к их функциональному фрагменту, или вариантам, или их модифицированным формам. Изобретение также предоставляет последовательность нуклеиновой кислоты, кодирующую указанную фитазу.

Чтобы быть эффективной в качестве ферментной добавки к продукту питания или корму для животных, в фитазе должен быть скомбинирован ряд различных свойств. Для того чтобы быть в состоянии расщепить фитиновую кислоту в кислой окружающей среде желудка животных, она должна быть активной при низком pH, предпочтительно в сверхшироком диапазоне значений pH. Кроме того, она должна иметь высокую специфическую активность и предпочтительно высокую термостабильность, чтобы обеспечить возможность белку выдержать высокие температуры, обычно применяемые для приготовления кормов, таких как кормовые гранулы.

Также важно, что фермент обладает широкой субстратной специфичностью, позволяющей ему гидролизовать не только фитат, но также промежуточные продукты расщепления фитата, такие как инозитпентафосфаты, -тетрафосфаты и

-трифосфаты. Исследования расщепления фитата у свиней показывают, что эти инозитолигофосфаты в противном случае остаются главным образом нерастворимыми в тонкой и толстой кишке и, таким образом, недоступны для щелочных фосфатаз, продуцируемых животным и микрофлорой кишечника (Schlemmer U. с сотр. Arch. Anim. Nutr. 55, 255-280 (2001)). Были идентифицированы вариации профилей субстратной специфичности различных ферментов. Например, инозиттрифосфаты, генерируемые фитазой B. subtilis, в основном, устойчивы к дальнейшему гидролизу посредством этого фермента [Kerovuo J. с сотр. Biochem J. 352, 623-628 (2000)].

В другом аспекте изобретения предоставляется плазмида или векторная система, или трансформированный или трансгенный организм, включающий новую фитазу, как описано в данном описании, или ее модифицированную форму.

В другом аспекте настоящее изобретение относится к трансгенным организмам, модифицированным для экспрессии новой фитазы, как описано в данном описании, или ее модифицированной формы и поэтому способным продуцировать фитазу. Настоящее изобретение дополнительно предоставляет средства и способы биотехнологического продуцирования фитаз и их применения в качестве комовых добавок.

Аспекты настоящего изобретения представлены в формуле изобретения и в нижеследующем комментарии.

Для облегчения ориентирования эти и другие аспекты по настоящему изобретению теперь обсуждаются в разделах с соответствующими заголовками. Однако идеи каждого раздела не обязательно ограничены каждым отдельным разделом.

Как использовано в отношении настоящего изобретения, термины «продуцировать или получать», «продуцирующий», «продуцированный или полученный», «способный продуцировать», «продуцирование или получение» являются синонимичными по отношению к терминам «готовить», «приготовление», «приготовленный», «подготовка», «генерированный», «генерирование» и «способный приготавливать».

Как использовано в отношении настоящего изобретения, термины «экспрессия», «экспрессировать», «экспрессированный» и «способный экспрессироваться» являются синонимичными по отношению к терминам «транскрипция», «транскрибировать» и «способный транскрибироваться».

Как использовано в отношении настоящего изобретения, термины «трансформация» и «трансфекция» относятся к способу введения последовательностей нуклеиновой кислоты в хозяев, клетки-хозяева, ткани или органы.

Другие аспекты, имеющие отношение к нуклеотидным последовательностям, которые могут быть использованы в настоящем изобретении, включают: конструкцию, включающую последовательности по настоящему изобретению; вектор, включающий последовательности для применения в настоящем изобретении; плазмиду, включающую последовательности для применения в настоящем изобретении; трансформированную клетку, включающую последовательности для применения в настоящем изобретении; трансформированную ткань, включающую последовательности для применения в настоящем изобретении; трансформированный орган, включающий последовательности для применения в настоящем изобретении; трансформированного хозяина, включающего последовательности для применения в настоящем изобретении; трансформированный организм, включающий последовательности для применения в настоящем изобретении. Настоящее изобретение также осуществляет способы экспрессии нуклеотидной последовательности для применения в настоящем изобретении с использованием упомянутой выше, такие как экспрессия в клетке-хозяине; включая способы переноса вышеупомянутой. Настоящее изобретение дополнительно осуществляет способы выделения нуклеотидной последовательности, такой как выделение из клетки-хозяина.

Другие аспекты, имеющие отношение к аминокислотным последовательностям для применения в настоящем изобретении, включают: конструкцию, кодирующую аминокислотные последовательности для применения в настоящем изобретении; вектор, кодирующий аминокислотные последовательности для применения в настоящем изобретении; плазмиду, кодирующую аминокислотные последовательности для применения в настоящем изобретении; трансформированную клетку, экспрессирующую аминокислотные последовательности для применения в настоящем изобретении; трансформированную ткань, экспрессирующую аминокислотные последовательности для применения в настоящем изобретении; трансформированный орган, экспрессирующий аминокислотные последовательности для применения в настоящем изобретении; трансформированного хозяина, экспрессирующего аминокислотные последовательности для применения в настоящем изобретении; трансформированный организм, экспрессирующий аминокислотные последовательности для применения в настоящем изобретении. Настоящее изобретение также осуществляет способы очистки аминокислотной последовательности для применения в настоящем изобретении с использованием вышеупомянутой, такие как экспрессия в клетке-хозяине; включая способы переноса вышеупомянутых и затем очистку указанной последовательности.

Краткое описание чертежей

Фигура 1 показывает SDS PAGE анализ (электрофорез в полиакриламидном геле с додецилсульфатом натрия) рекомбинантной фитазы Buttiauxella P1-29, очищенной с помощью хроматографии с DEAE-сефарозой. Фигура демонстрирует сканирование следа цифрового фотографического изображения полосы, содержащей образец фитазы Buttiauxella.

Фигура 2 показывает профиль pH фитазы Buttiauxella P1-29.

Фигура 3 показывает субстратную специфичность очищенной рекомбинантной фитазы Buttiauxella P1-29 с фракциями инозитфосфата различной степени фосфорилирования и модельных субстратов. Сокращения: IP6 - фитиновая кислота, IP5, IP4 и IP3 - смеси изомерных инозитпента-, тетра- и трифосфатов соответственно. Fru P2 - фруктозо-1,6-дифосфат, Fru P1 - фруктозо-6-фосфат.

SEQ ID NO:1 приводит последовательность, полученную для идентификации бактериального штамма.

SEQ ID NO:2 приводит полинуклеотидную последовательность, включающую фитазный ген Buttiauxella P1-29.

SEQ ID NO:3 приводит аминокислотную последовательность фитазного гена Buttiauxella P1-29.

Подробное описание изобретения

Настоящее изобретение предоставляет фермент, включающий аминокислотную последовательность, соответствующую фитазе Buttiauxella sp. или ее модифицированной форме, гомологу, варианту, функциональному эквиваленту или эффективному фрагменту.

Термин «фитаза» означает белок или полипептид, который способен катализировать гидролиз сложных эфиров фосфорной кислоты, включая фитат, и высвобождать неорганический фосфат. Некоторые фитазы в дополнение к фитату способны гидролизовать, по меньшей мере, некоторые инозитфосфаты промежуточных стадий фосфорилирования.

Термин «соответствующий фитазе Buttiauxella sp.» означает, что фермент не был получен из источника Buttiauxella sp. Зато фермент предпочтительно должен иметь те же самые функциональные характеристики или последовательность как у фитазы Buttiauxella sp. Например, Фитаза Buttiauxella sp. может быть вариантом, полученным из Buttiauxella sp., но который не присутствует в природных видах Buttiauxella.

Buttiauxella spp. включает Buttiauxella agrestis, Buttiauxella brennerae, Buttiauxella ferragutiae, Buttiauxella gaviniae, Buttiauxella izardii, Buttiauxella noackiae, Buttiauxella warmboldiae. Штаммы видов Buttiauxella доступны в DSMZ, Германском национальном центре ресурсов биологического материала. Фитазы предпочтительно идентифицируют из Buttiauxella spp. с помощью способов, описанных в данном описании, например, гибридизацией с SEQ ID No 2. Предпочтительные штаммы Buttiauxella spp. для выделения полипептидов и/или полинуклеотидов перечислены в примерах.

Термины «фитаза дикого типа» или «дикий тип» в соответствии с изобретением описывают фитазный фермент с аминокислотной последовательностью, обнаруженной в природе.

Термины «вариант фитазного фермента», «фитазный вариант» или «вариант» в соответствии с изобретением описывают фитазный фермент с аминокислотной последовательностью, полученной из аминокислотной последовательности исходной фитазы, но отличающийся одной или несколькими аминокислотными замещениями, инсерциями и/или делециями, которые вместе упоминаются как «мутации». Предусматривается, что вариант фитазного фермента также может быть исходным фитазным ферментом для дальнейших раундов способов получения фитазных вариантов, таких как молекулярная эволюция.

Термин «гомологичный полипептид(ы)» в соответствии с настоящим изобретением, описаный также как «гомологи» в данном описании, описывает полипептиды, предпочтительно фитазные ферменты (то есть «гомологичные фитазы» или «гомологичные ферменты») с последовательностью, идентичной более чем на 75% по сравнению с первой аминокислотной последовательностью полипептидов/фитаз/ферментов, которая предпочтительно имеет, по меньшей мере, 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% гомологии последовательности.

Термин «его функциональный эквивалент» означает, что фермент должен иметь примерно такие же функциональные характеристики, что и фитаза Buttiauxella sp. Термин «модифицированная форма» или «вариант» означает, что фермент был модифицирован относительно своей исходной формы, но сохранил такие же ферментативные функциональные характеристики, что и фитаза Buttiauxella sp. В частности, термины «вариант» или «модифицированная форма» включают фитазные ферменты с аминокислотной последовательностью, полученной из аминокислотной последовательности фитазы исходного/дикого типа и имеющей одно или несколько аминокислотных замещений, инсерций и/или делеций, которые вместе упоминаются как мутации. Модифицированные формы или варианты могут проявлять измененные ферментативные характеристики по сравнению с исходным ферментом. Предпочтительно, модифицированные формы или варианты имеют один или несколько следующих улучшенных фенотипов: повышенная термостабильность и/или; повышенная протеолитическая (например, пепсиновая) стабильность и/или; повышенная специфическая активность и/или; более широкая субстратная специфичность и/или; активность в сверхшироком диапазоне pH. Термин «функциональный» или «эффективный» фрагмент означает фрагмент или часть фитазы Buttiauxella sp., которая сохраняет примерно сходную ферментативную функцию или эффект.

Предпочтительно фитазный фермент данного аспекта по изобретению имеет такую же последовательность или последовательность, которая, по меньшей мере, на 75% идентична (гомологична) таковой фитазы Buttiauxella sp.

Соответственно фермент, включает аминокислотную последовательность как показано в SEQ ID NO:3, или последовательность, имеющую, по меньшей мере, 75% идентичности (гомологии) с таковой или ее функциональный фрагмент. В предпочтительном варианте осуществления изобретение предоставляет выделенный и/или очищенный полипептид, имеющий аминокислотную последовательность как представлено в SEQ ID NO:3, или последовательность, имеющую, по меньшей мере, 75% идентичности (гомологии) с таковой или ее функциональный фрагмент. При ссылке на SEQ ID No.3 и полипептиды, включающие SEQ ID No.3, предусмотрено, что это также относится к полипептидам, которые ко- или посттрансляционно процессируются во время экспрессии, например, путем отщепления сигнального пептида. Посттрансляционное отщепление может также происходить по C-концу. Поэтому в предпочтительном варианте осуществления его эффективный фрагмент (также упоминаемый как его функциональный фрагмент) представляет собой зрелый полипептид, продуцированный с помощью нативного хозяина или приемлемого соответствующего экспрессионного хозяина.

В другом варианте осуществления фитаза характеризуется тем, что она получена из штамма P1-29 Buttiauxella sp., депонированного под инвентарным номером NCIMB 41248.

В предпочтительном варианте осуществления изобретение относится к фитазе в соответствии с любым вариантом осуществления первого аспекта по изобретению, которая включает одну или несколько мутаций в следующих положениях (нумерация соответствует нумерации в SEQ ID No. 3): 59, 70, 122, 125, 167, 193, 197, 204, 209, 211, 221, 223, 225, 240, 242, 244, 268, 281, 289, 294, 303, 336, 351.

Эти положения характеризуются тем, что мутагенез фермента в этих положениях ведет к улучшению желаемых ферментативных характеристик.

Следующие замещения могут быть предпочтительными вариантами:

Под «консервативными мутациями» понимают мутации аминокислотных остатков, которые являются консервативными на основе аминокислотных характеристик, по сравнению с указанными аминокислотными остатками. Аминокислотные характеристики включают размер остатка, гидрофобность, полярность, заряд, значение pK и другие аминокислотные характеристики, известные в данной области. Предпочтительные консервативные мутации перечислены ниже как консервативные замещения.

В особенно предпочтительном варианте осуществления мутациями являются одно или несколько из следующих положений: K59; T167; K240; T167; K240; D244; Q289; T209 и F197.

Предпочтительные мутации в этих специфических положениях перечислены выше, более предпочтительные мутации включают: K59E; T167V; K240T; T167I; K240E; D244C; Q289Y; T209K и F197S.

В дальнейшем предпочтительном варианте осуществления предоставляется фитаза, включающая комбинацию мутаций, выбранных из группы, состоящей из:

D125E/H193R;

A294E/N303K;

T167I/K240T;

D223E/K240E/N351D;

T167I/K240T/A294E/N303K;

T167I/K240E/A242S/A294E/N303K;

A122T/T167I/F197S/T209K/A211P/K240E/A294E/N303K;

A122T/T167I/F197S/T209K/A211P/K240E/A242S/S281L/Q289Y/A294E/N303K;

A122T/D125E/H193R/F197S/T209K/A211P/S221N/G225A/K240E/A294E/ N303K;

D125E/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K;

A122T/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K/I336F и

N70Y/D125E/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/

Q289H/A294E/N303K.

Таким образом, предпочтительная фитаза в соответствии с настоящим изобретением представляет собой вариант, включающий аминокислотную последовательность, показанную как SEQ ID NO:3 или ее эффективный фрагмент (или ее гомолог, предпочтительно фитаза характеризуется тем, что она получена из штамма P1-29 Buttiauxella sp., депонированного под инвентарным номером NCIMB 41248, или его гомолога), за исключением имеющих одну или несколько аминокислотных мутаций, перечисленных выше, или одну из комбинаций мутаций, перечисленных выше.

В этих вариантах осуществления номенлатура обозначает фитазу, включающую аминокислотную последовательность, приведенную в SEQ ID NO:3 с мутациями, обозначенными путем ссылки на положения аминокислот в SEQ ID NO:3. Номенклатура описано более детально ниже.

Соответственно эти варианты показывают улучшенные характеристики по отношению к любой одной из следующих: температурная стабильность, диапазон pH, стабильность к пепсину, специфическая активность, субстратная специфичность и расширенная субстратная специфичность. Приемлемые способы определения этих характеристик раскрыты в данном описании.

В частности, улучшение фитазных характеристик направлено на ферментативную стабильность в условиях питания и обработки корма, ферментативную стабильность в процессе прохождения через желудок и ферментативную активность и стабильность в желудке человека или животных и/или кишечнике с получением улучшенных вариантов, особенно приемлемых для применения в качестве кормовых добавок. Таким образом, такие улучшения включают среди других параметров увеличение стабильности при повышенных температурах, предпочтительно при температурах выше 65°C, увеличение стабильности против протеолитического расщепления, предпочтительно протеазы пищеварительного тракта, такой как пепсин, увеличение каталитической активности при низком pH, предпочтительно каталитической активности при pH ниже 5,5, и общей эффективности высвобождения фосфатных групп из фитата и предпочтительно при добавлении инозитфосфатов.

Номенклатура

В настоящем описании и формуле изобретения используется общепринятый однобуквенный и трехбуквеный коды для аминокислотных остатков. Для облегчения ориентирования мутации в ферментативных вариантах описаны посредством использования следующей номенклатуры: аминокислотный остаток в исходном ферменте; положение; замещенный аминокислотный остаток(и). В соответствии с этой номенклатурой замещение, например, аланинового остатка на глициновый остаток в положении 20 обозначают как Ala20Gly или A20G. Делецию аланина в том же положении показывают как Ala20* или A20*. Инсерцию дополнительного аминокислотного остатка (например, глицина) показывают как Ala20AlaGly или A20AG. Делецию последовательных участков аминокислотных остатков (например, между аланином в положении 20 и глицином в положении 21) обозначают как Δ(Ala20-Gly21) или Δ(A20-G21). Когда исходная последовательность фермента содержит делецию по сравнению с последовательностью фермента, применяемой для нумерации, инсерцию в этом положении (например, аланин в делетированном положении 20) обозначают как *20Ala или *20A. Множественные мутации выделяют знаком плюс или косой чертой. Например, две мутации в положениях 20 и 21, замещающие аланин и глутаминовую кислоту на глицин и серин, соответственно, обозначают как A20G+E21S или A20G/E21S. Когда аминокислотный остаток в данном положении замещают двумя или более альтернативными аминокислотными остатками, эти остатки разделяют запятой или косой чертой. Например, замещение аланина в положении 30 на глицин или глутаминовую кислоту обозначают как A20G,E или A20G/E, или A20G, A20E. Когда положение, приемлемое для модификации, идентифицируют в данном описании без предложения о любой специфической модификации, это обусловлено тем, что любой аминокислотный остаток может быть замещен на аминокислотный остаток, представленный в положении. Так, например, когда модификация аланина в положении 20 упомянута, но не уточняется, следует понимать, что аланин может быть делетирован или замещен на любой другой аминокислотный остаток (то есть, любой один из R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, V).

Соответственно фитаза или функциональный эквивалент по настоящему изобретению характеризуются тем, что указанная фитаза имеет специфическую активность, по меньшей мере, 100 U/мг или 200U/мг, предпочтительно, по меньшей мере, 300 U/мг, где указанную специфическую активность определяют путем инкубации указанной фитазы в растворе, содержащем 2 мМ фитата, 0,8 мМ CaCl2 в 200 мМ натрий ацетатного буфера при pH 3,5; как подробно описано в Примере 1. Фитаза по настоящему изобретению или ее функциональный эквивалент также могут быть соответственно охарактеризованы тем, что указанная фитаза имеет максимальную активность при pH около 4-4,5; где указанную активность определяют путем инкубации указанной фитазы в растворе, содержащем 2 мМ фитата, 0,8 мМ CaCl2 в 200 мМ натрий ацетатного буфера. Фитаза по настоящему изобретению также может быть соответственно охарактеризована тем, что указанная фитаза имеет 40% или более максимальную активность, наблюдаемую при pH 2,5 и 5,5; где глицин гидрохлоридный буфер применяется для определения активности при pH 2,5.

Соответственно, в одном варианте осуществления фитаза или ее функциональный эквивалент по настоящему изобретению характеризуются тем, что указанная фитаза имеет специфическую активность 330 U/мг или выше, где указанную специфическую активность определяют путем инкубации указанной фитазы в растворе, содержащем 2 мМ фитата, 0,8 мМ CaCl2 в 200 мМ натрий ацетатного буфера при pH 3,5. В другом варианте осуществления фитаза по настоящему изобретению или ее функциональный эквивалент также могут быть соответственно охарактеризованы тем, что указанная фитаза имеет два максимума активности около pH 3 и pH 4-4,5; где указанную активность определяют путем инкубации указанной фитазы в растворе, содержащем 2 мМ фитата, 0,8 мМ CaCl2 в 200 мМ натрий ацетатного буфера.

В другом аспекте изобретение предоставляет выделенную и/или очищенную молекулу нуклеиновой кислоты или нуклеотидную последовательность, кодирующую фермент, включающий аминокислотную последовательность, соответствующую фитазе Buttiauxella sp., или ее гомолог. Соответственно указанная выделенная и/или очищенная молекула нуклеиновой кислоты кодирует полипептид, включающий аминокислотную последовательность, как показано в SEQ ID NO:3, или последовательность, имеющую, по меньшей мере, 75% идентичности (гомологии) с таковой или ее эффективный фрагмент. В одном варианте осуществления молекула нуклеиновой кислоты кодирует полипептид, включающий SEQ ID NO:3 и включающий мутации в предпочтительных положениях, перечисленных в данном описании или любую из специфических мутаций или комбинаций мутаций, перечисленных в данном описании. В другом варианте осуществления изобретение предоставляет выделенную и/или очищенную молекулу нуклеиновой кислоты, содержащую нуклеотидную последовательность, которая является такой же или комплементарной, или содержит любые приемлемые замещения кодонов для любого такового SEQ ID NO:2 или включает последовательность, которая имеет, по меньшей мере, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% гомологии последовательности с SEQ ID NO:2.

Еще в другом аспекте изобретение относится к нуклеотидной последовательности и к применению нуклеотидной последовательности, показанной как:

(а) нуклеотидная последовательность, представленная как SEQ ID No.2;

(b) нуклеотидная последовательность, которая является вариантом, гомологом, производным или фрагментом нуклеотидной последовательности, представленной как SEQ ID No.2;

(c) нуклеотидная последовательность, которая комплементарна нуклеотидной последовательности, представленной как SEQ ID No.2;

(d) нуклеотидная последовательность, которая комплементарна варианту, гомологу, производному или фрагменту нуклеотидной последовательности, представленной как SEQ ID No.2;

(e) нуклеотидная последовательность, которая способна гибридизироваться с нуклеотидной последовательностью, представленной как SEQ ID No.2;

(f) нуклеотидная последовательность, которая способна гибридизироваться с вариантом, гомологом, производным или фрагментом нуклеотидной последовательности, представленной как SEQ ID No.2;

(g) нуклеотидная последовательность, которая комплементарна нуклеотидной последовательности, которая способна гибридизироваться с нуклеотидной последовательностью, представленной как SEQ ID No.2;

(h) нуклеотидная последовательность, которая комплементарна нуклеотидной последовательности, которая способна гибридизироваться с вариантом, гомологом, производным или фрагментом нуклеотидной последовательности, представленной как SEQ ID No.2;

(i) нуклеотидная последовательность, которая способна гибридизироваться с комплементом нуклеотидной последовательности, представленной как SEQ ID No.2;

(j) нуклеотидная последовательность, которая способна гибридизироваться с комплементом варианта, гомолога, производного или фрагмента нуклеотидной последовательности, представленной как SEQ ID No.2.

Считается, что нуклеотид гибридизируется с одним из вышеупомянутых нуклеотидов (e), (f), (g), (h), (i) или (j), если он спосбен гибридизироваться в условиях средней жесткости, более предпочтительно высокой жесткости, даже более предпочтительно в условиях очень высокой жесткости.

Для приготовления стандартных молекулярно биологических потоколов блот-гибридизации для блоттинга может быть использован, например, Саузерн-блоттинг для гибридизации ДНК. Количество ДНК-мишени зависит от относительной избыточности последовательности-мишени. Если применяют чистую последовательность-мишень, предпочтительно содержание между 1 и 5 пикограмм ДНК на тысячу пар нуклеотидов (т.п.н.) полинуклеотидов. Обычно лимит для детекции составляет около 0,5 пг ДНК для радиоактивного зонда со специфической активностью 109 dpm/мг, который эквивалентен однокопийному гену 500 п.н. длиной в 3,3 мг геномной ДНК сложного генома (например, человека). Практически будет использовано около 10 мг геномной ДНК - например, для скрининга организмов, таких как микроорганизмы, которые содержат кодирующий фитазу полинуклеотид изобретения. Если ДНК-мишенью является бактериальная или, например, плазмидная, она будет разбавлена ДНК соответственно для избежания избыточной экспозиции. ДНК-мишень подвергают блоттингу, например, посредством дот-блоттинга или посредством блоттинга электрофорезного геля. Предпочтительные условия описаны в «Membrane Transfer and Detection Methods, Amersham International plc, UK.- PI/162/85/1». Предпочтительно использование связывающей N+ положительно заряженной нейлоновой мембраны (Amersham Life Science). Зонд предпочтительно готовят согласно Pharmacia's 'Ready to Go DNATM меченому набору для приготовления зонда > 1×109 dpm/микрограмм. Зонд используют в гибридизационном буфере в концентрации 1×106 dpm на миллилитр гибридизационного буфера. Блоты предпочтительно прегибридизируют в гибридизационном буфере (6×SSC, 5 × раствор Денхардта и 0,5% SDS, и ДНК денатурированной спермы лосося в 100 мг/мл буфера) один час при 65°C с последующей гибридизацией в гибридизационном буфере, содержащем денатурированный меченый зонд, со встряхиванием в течение 12 часов при 65°C. Блот(ы) затем промывают в соответствующем объеме промывочного буфера (обычно 50 мл) в 2×SSC, 0,1% SDS в течение 30 минут при 65°C, затем следует вторая промывка в приемлемом объеме промывочного буфера (обычно 50 мл) в любом аналогичном промывочном буфере (2×SSC, 0,1% SDS) для промывки средней жесткости или 0,1% × SSC, 0,1% SDS в течение 10 минут при 65°C (высокая жесткость), вторая промывка может быть повторена при 70°C для промывки в условиях очень высокой жесткости.

Нуклеотидная последовательность по настоящему изобретению может включать последовательности, которые кодируют SEQ ID No.3 или его эффективный фрагмент, или вариант, модифицированную форму, гомолог или его производное.

В частности, изобретение предоставляет плазмиду или векторную систему, включающую фитазу, как описано в данном описании, или ее гомолог или производное. Предпочтительно плазмида или векторная система включают последовательность нуклеиновой кислоты, представленную в SEQ ID No:2, или последовательность, которая, по меньшей мере, на 75% гомологична таковой или ее эффективный фрагмент. Соответственно плазмида или векторная система представляют собой экспрессионный вектор для экспрессии любого фермента, кодируемого последовательностью нуклеиновой кислоты, представленной в любом SEQ ID No:2 или последовательностью, которая, по меньшей мере, на 75% гомологична (идентична) таковой микроорганизма. Приемлемые экспрессионные векторы описаны в данном описании. Кроме того, изобретение предоставляет плазмиду или векторную систему для экспрессии любых модифицированных ферментов или вариантов, или функциональных фрагментов, описанных в данном описании. Приемлемые экспрессионные векторы описаны в данном описании.

Фитазные варианты

Настоящее изобретение заключается в улучшении характеристик исходной фитазы путем модификации одного или нескольких аминокислотных остатков аминокислотной последовательности исходной фитазы.

Фитазные ферменты, применяемые в качестве исходных ферментов в соответствии с настоящим изобретением, включают фитазы дикого типа бактерий, в частности предпочтительно фитазы, доступные из или полученные из Buttiauxella sp., имеющей аминокислотную последовательность, представленную в SEQ ID No.3, или ее эффективный фрагмент, или аминокислотную последовательность, идентичную SEQ ID No.3 более чем на 75%, предпочтительно более чем на 80%, более предпочтительно более чем на 90%, даже более предпочтительно более чем на 95%, 96%, 97%, 98%, предпочтительно более чем на 99% (то есть гомологичный полипептид), или его эффективный фрагмент.

Улучшенные варианты фитазного фермента по изобретению предпочтительно обладают идентичностью, по отношению к Seq ID No.3 или ее эффективному фрагменту более чем на 75%, предпочтительно более чем на 80%, более предпочтительно более чем на 90%, более предпочтительно более чем на 95%, 96%, 97%, 98%, предпочтительно более чем на 99%. Однако также предусмотрено, что варианты могут быть гетерологичными (то есть, негомологичными) по отношению к SEQ ID No.3. Например, варианты, продуцированные с помощью рекомбинантной технологии, такой как экзо-опосредованная рекомбинация, или семейственная перестановка, могут приводить к вариантам, хотя и приготовленным с использованием исходной фитазы в соответствии с настоящим изобретением, которые могут иметь менее чем 75% гомологию.

Выравнивание последовательностей, а также определение идентичности последовательностей соответственно может быть выполнено посредством компьютерных программ, известных в данной области, таких как GAP, обеспеченной пакетом программ GCG (Needleman, S.B. и Wunsch, C.D., (1970), Journal of Molecular Biology, 48, p.443-453). GAP может быть использована со следующими установочными параметрами для сравнения полипептидной последовательности: GAP создание штрафной санкции 3,0 и GAP расширение штрафной санкции 0,1. Выравнивание последовательностей применяют, например, для определения соответствующих положений в гомологичных полипептидах.

Фитазные ферменты были охарактеризованы после гетерологичной экспрессии в одном или нескольких следующих экспрессионных хозяевах: Escherichia coli K12; Bacillus subtilis; Saccharomyces cerevisiae. Могут быть использованы другие экспрессионные хозяева.

Улучшение фитазных характеристик в соответствии с настоящим изобретением направлено на применение для обработки продуктов питания и корма, а также для применения в качестве добавки к продуктам питания и кормам. В частности, улучшение направлено на стабильность в условиях обработки продуктов питания и корма, стабильность в процессе прохождения через желудок и активность и стабильность в желудке человека или животных, и/или кишечнике. Такие улучшения включают среди других параметров увеличение стабильности при повышенных температурах, предпочтительно при температуре выше 65°C, увеличение стабильности против протеолитического расщепления, предпочтительно протеазы пищеварительного тракта, увеличение каталитической активности при низком pH, предпочтительно каталитической активности при pH ниже 5,5; и общей эффективности высвобождения фосфатных групп из фитата.

Увеличение стабильности при повышенных температурах определяют количественно с помощью температуры инактивации фермента. Температуру инактивации определяют как температуру, при которой остаточная активность фитазного фермента после инкубации определенной продолжительности и последующего охлаждения до комнатной температуры составляет 50% остаточной активности такого же фитазного фермента, инкубированного с той же продолжительностью в тех же условиях при комнатной температуре. Различия в термостабильности представляют собой различия в °C между температурами инактивации двух ферментов.

Положения и/или области, которые должны быть мутированы для получения улучшенных характеристик были найдены путем анализа последовательности и структуры фитаз дикого типа, а также путем мутагенеза исходных ферментов, в частности, путем введения мутаций в аминокислотную последовательность дикого типа, представленную в SEQ ID No.3, и скрининга ферментативных вариантов с улучшенными характеристиками. Поэтому были идентифицированы определенные области, а также положения исходных ферментов, которые существенны для улучшения характеристик фитазных ферментов.

Поэтому изобретение относится к фитазным вариантам с улучшенными характеристиками, которые по сравнению с исходной фитазой включают мутации в одном или нескольких из следующих положений (пронумерованных в соответствии с нумерацией в SEQ ID No.3): 59, 70, 122, 125, 167, 193, 197, 204, 209, 211, 221, 223, 225, 240, 242, 244, 268, 281, 289, 294, 303, 336, 351 и/или в соответствующих положениях фитазных гомологов по отношению к фитазе, как показано в аминокислотной последовательности Seq ID No.3. Эти положения характеризуются тем, что мутагенез в этих положениях приводит к улучшению характеристик фермента.

K59E; T167V; K240T; T167I; K240E; D244C; Q289Y; T209K и F197S или консервативные мутации в каждом положении.

Специфические предпочтительные комбинации мутаций включают:

D125E/H193R;

A294E/N303K;

T167I/K240T;

D223E/K240E/N351D;

T167I/K240T/A294E/N303K;

T167I/K240E/A242S/A294E/N303K;

A122T/T167I/F197S/T209K/A211P/K240E/A294E/N303K;

A122T/T167I/F197S/T209K/A211P/K240E/A242S/S281L/Q289Y/A294E/N303K;

A122T/D125E/H193R/F197S/T209K/A211P/S221N/G225A/K240E/A294E/ N303K;

D125E/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K;

A122T/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K/I336F и

N70Y/D125E/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/

Q289H/A294E/N303K.

Способы приготовления фитазных вариантов

В общем варианте осуществления изобретения предоставляются способы приготовления варианта(ов) фитазных ферментов.

В предпочтительном варианте осуществления способ приготовления варианта фитазного фермента включает следующие последовательные стадии:

а) отбор, по меньшей мере, одного исходного фитазного фермента, где по меньшей мере, один исходный фитазный фермент выбран из i) полипептида, включающего аминокислотную последовательность, соответствующую фитазе Buttiauxella sp. или ее модифицированной форме, гомологичному полипептиду, варианту, функциональному эквиваленту или эффективному фрагменту, как описано в данном описании, или ii) по меньшей мере одного варианта фитазного фермента, как описано в данном описании;

b) генерирование, по меньшей мере, одного фитазного варианта путем введения, по меньшей мере, одного изменения указанного исходного фитазного фермента, которое представляет собой инсерцию, делецию или замещение, или их комбинацию, аминокислотного остатка в указанном исходном фитазном ферменте для получения, по меньшей мере, одного варианта фитазного фермента;

c) скрининг, по меньшей мере, одного указанного варианта фитазного фермента для идентификации улучшенного варианта фитазного фермента, который по сравнению с исходным фитазным ферментом обладает улучшенным свойством/свойствами, выбранными из:

i) более высокой термической стабильности и/или

ii) специфической активности и/или

iii) протеолитической стабильности;

d) приготовление указанного улучшенного варианта фитазного фермента, предпочтительно для получения выделенного и/или очищенного варианта фитазного фермента.

В предпочтительном варианте осуществления в процессе стадии b) генерируется популяция вариантов фитазного фермента и в стадии c) подвергается скринингу, по меньшей мере, часть указанной популяции вариантов фитазного фермента.

В предпочтительном варианте осуществления стадия а) включает воздействие на нуклеотидную последовательность по пунктам 11-13, кодирующую исходный фитазный фермент, мутагенезом, и стадия b) включает экспрессию мутантной нуклеотидной последовательности, полученной на стадии (а) в клетке-хозяине, и стадия с) включает скрининг клеток-хозяев или их экстракта(ов) для выявления улучшенного варианта фитазного фермента с указанным улучшенным свойством/свойствами.

В дальнейшем вариант осуществления после стадии с) и необязательно d) дополнительно включает, по меньшей мере, один последовательный цикл повторяющихся стадий а)-с) и необязательно d), где предпочтительно в каждом последовательном цикле(ах), по меньшей мере, один исходный фитазный фермент стадии а) выбран из указанного, по меньшей мере, одного варианта фитазного фермента и/или улучшенного фитазного варианта, приготовленного в соответствии со способом.

В дальнейшем предпочтительном варианте осуществления стадия с) включает скрининг клеток-хозяев, экспрессирующих улучшенный вариант фитазного фермента, который сравнивается либо с i) указанным исходным фитазным ферментом, либо с ii) полипептидом, включающим SEQ ID No.3 своего функционального фрагмента, который имеет различия термической стабильности, по меньшей мере, в 2,5 раза.

В дальнейшем варианте осуществления стадия с) включает скрининг клеток-хозяев, экспрессирующих улучшенный вариант фитазного фермента, который сравнивается либо с i) указанным исходным фитазным ферментом, либо с ii) полипептидом, включающим SEQ ID No.3 своего функционального фрагмента, который имеет стабильность к пепсину, по меньшей мере, 30.

В дальнейшем варианте осуществления стадия с) включает скрининг клеток-хозяев, экспрессирующих улучшенный вариант фитазного фермента, который сравнивается либо с i) указанным исходным фитазным ферментом, либо с ii) полипептидом, включающим SEQ ID No.3 своего функционального фрагмента, который имеет соотношение специфической активности при сравнении с фитазой, кодируемой SEQ ID No.3, по меньшей мере, 110.

Изобретение также предоставляет способ приготовления варианта фитазного фермента, где способ включает:

а) отбор исходного фитазного фермента, где исходный фитазный фермент выбран из:

i) исходного фитазного фермента с, по меньшей мере, 75% гомологией с SEQ ID No.3 его функционального фрагмента,

ii) исходного фитазного фермента, полученного из Buttiauxella spp.,

iii) по меньшей мере, одного варианта фитазного фермента;

b) получение, по меньшей мере, одного изменения, которое является инсерцией, делецией или замещением аминокислотного остатка в исходном фитазном ферменте для получения варианта фитазного фермента;

с) скрининг варианта фитазного фермента, который по сравнению с исходным фитазным ферментом имеет улучшенные характеристики, как описано в данном описании, предпочтительно выбранные из одной или нескольких:

i) более высокой термической стабильности и/или

ii) специфической активности и/или

iii) протеолитической стабильности;

d) приготовление варианта фитазного фермента.

Необязательно, по меньшей мере, стадии а)-c) могут быть повторены в одном или нескольких последовательных (повторяющихся) циклах. Поэтому предусмотрено, что исходный фитазный фермент представляет собой вариант фитазного фермента, приготовленный посредством предыдущих циклов вышеупомянутого способа а)-с).

В дальнейшем варианте осуществления изобретения предоставляется способ приготовления фитазного варианта, включающий следующие стадии:

(а) предоставление исходного фитазного фермента, выбранного из:

(i) фитазного фермента с, по меньшей мере, 75% гомологией с SEQ ID No.3 или его функционального фрагмента,

(ii) фитазного фермента, полученного из Buttiaxella spp.,

(iii) по меньшей мере, одного варианта фитазного фермента;

(b) генерирование популяции фитазных вариантов путем изменения исходной фитазы, педпочтительно указанное изменение(я) получают путем инсерции, делеции или замещения, по меньшей мере, одного аминокислотного остатка в исходный фитазе или любой ее комбинации;

(c) скрининг популяции фитазного варианта, который по сравнению с исходным фитазным ферментом имеет улучшенные характеристики, как описано в данном описании, предпочтительно выбранные из одной или нескольких:

(i) более высокой термической стабильности и/или

(ii) более высокой специфической активности и/или

(iii) более высокой протеолитической стабильности;

(d) отбор одного или нескольких фитазных вариантов из популяции фитаз;

(e) необязательно повторение стадий а)-с) циклически, и предпочтительно, что фитазные варианты, выбранные в одном цикле, применяют как первые фитазы в следующем цикле.

В дальнейшем варианте осуществления изобретения предоставляется способ приготовления варианта фитазного фермента, где способ включает:

а) воздействие на нуклеотидную последовательность, кодирующую исходный фитазный фермент, мутагенезом, где исходный фитазный фермент выбран из:

i) фитазного фермента с, по меньшей мере, 75% гомологией с SEQ ID No.3 или его функционального фрагмента,

ii) исходного фитазного фермента, полученного из Buttiaxella spp.,

iii) по меньшей мере, одного варианта фитазного фермента;

b) экспрессию мутантной нуклеотидной последовательности, полученной на стадии (а) в клетке-хозяине, и

c) скрининг клеток-хозяев, экспрессирующих вариант фитазного фермента, который по сравнению с исходным фитазным ферментом имеет улучшенные характеристики, как описано в данном описании, предпочтительно выбранные из одной или нескольких:

i) более высокой термической стабильности и/или

ii) более высокой специфической активности и/или

iii) более высокой протеолитической стабильности;

d) приготовление варианта фитазного фермента, экспрессируемого клеткой-хозяином.

Необязательно, по меньшей мере, стадии а)-с), необязательно включая d), могут быть повторены в одном или нескольких последовательных повторяющихся циклов.

В дальнейшем варианте осуществления изобретения предоставляется способ приготовления фитазного варианта, включающий следующие стадии:

(а) воздействие на нуклеотидную последовательность, кодирующую исходный фитазный фермент, мутагенезом для генерирования популяции измененных нуклеотидных вариантов, где предпочтительно указанное изменение(я) получено посредством инсерции, делеции или замещения, по меньшей мере, одного аминокислотного остатка в исходный фитазе или любых их комбинаций, и где исходный фитазный фермент выбран из:

(i) фитазного фермента с, по меньшей мере, 75% гомологией с SEQ ID No.3 или его функционального фрагмента,

(ii) фитазного фермента, полученного из Buttiaxella spp.,

(iii) по меньшей мере одного варианта фитазного фермента;

(b) экспрессию популяции нуклеотидных вариантов, полученных на стадии (а) в популяции соответствующих клеток-хозяев, и

(c) скрининг популяции в отношении фитазного варианта, который по сравнению с исходным фитазным ферментом имеет улучшенные характеристики, как описано в данном описании, предпочтительно выбранные из одной или нескольких:

(i) более высокой термической стабильности и/или

(ii) более высокой специфической активности и/или

(iii) более высокой протеолитической стабильности;

(d) отбор одного или нескольких фитазных вариантов из популяции фитаз.

(e) необязательно, повторение стадий (а)-(c) циклически, и предпочтительно, когда фитазные варианты, выбранные в одном цикле, применяются как первые фитазы в следующем цикле.

Когда это целесообразно, в вышеупомянутых способах приготовления варианта фитазного фермента указанной нуклеотидной последовательностью является предпочтительно последовательность ДНК.

Нуклеотидная последовательность представляет собой предпочтительно выделенную и/или очищенную молекулу нуклеиновой кислоты или нуклеотидную последовательность, кодирующую фермент, включающий аминокислотную последовательность, соответствующую фитазе Buttiaxella sp. или ее гомологу, как описано в данном описании.

Исходная фитаза предпочтительно выбрана из SEQ ID No.3 или ее функционального фрагмента, или гомолога фитазы Buttiaxella sp., как раскрыто в SEQ ID No.3, как описано в данном описании.

В вышеупомянутых вариантах осуществления изобретения, которые родственны способам приготовления варианта фитазного фермента, исходный фитазный фермент/нуклеотид, кодирующий исходный фитазный фермент/нуклеотид, представляет собой предпочтительно фитазу дикого типа.

Однако еще одним исходным может быть вариант, приготовленный посредством предварительных раундов мутагенеза. То есть в одном варианте осуществления способы приготовления вариантов фитазного фермента являются повторяющимися, где стадии а)-с) (необязательно включая стадию d)) повторяют более чем один раз. В таких вариантах осуществления способы мутагенеза, применяемые в первом раунде мутагенеза, представляют собой предпочтительно склонную к ошибкам ПЦР, более предпочтительно ПЦР с пороговой погрешностью. Последующие раунды также могут быть склонной к ошибкам ПЦР, более предпочтительно ПЦР с пороговой погрешностью, но могут, альтернативно, представлять собой основанный на рекомбинации мутагенез, где группы, по меньшей мере, двух независимых улучшенных вариантов, идентифицированные в первом раунде мутагенеза, в процессе второго или последующего раунда мутагенеза рекомбинировали, образуя по меньшей мере один рекомбинантный вариант (например, с использованием способов семейственной перестановки или рекомбиназной цепной реакции).

Квалифицированным специалистам совершенно очевидно, что альтернативные способы мутагенеза также могут быть использованы, включая рациональное конструирование, сайт-сканирующий мутагенез или химически/радиационно индуцированный мутагенез.

В вышеупомянутых вариантах осуществления изобретения, которые родственны способам приготовления варианта фитазного фермента, вариант фитазного фермента предпочтительно скринируют в отношении более высокой термической стабильности.

В вышеупомянутых вариантах осуществления изобретения, которые родственны способам приготовления варианта фитазного фермента, вариант фитазного фермента предпочтительно скринируют, по меньшей мере, по одному параметру, предпочтительно выбирая из более высокой термической стабильности, более высокой протеолитической стабильности или более высокой специфической активности, более предпочтительно более высокой термической стабильности.

Предпочтительно скрининг в отношении указанного первого параметра выполняют, по меньшей мере, в первом раунде мутагенеза, включающего, по меньшей мере, стадии а)-с), где с) включает, по меньшей мере, скрининг в отношении указанного первого параметра. За этим первым раундом мутагенеза затем могут следовать дальнейшие (последовательные) раунды мутагенеза и отбор, включающие стадии а)-с) (необязательно включая d)), где отбор указанных дальнейших раундов может быть проведен по тому же самому отборочному параметру, как использовано на стадии с) указанного первого раунда или, альтернативно, по другому параметру.

В процессе повторяющихся циклов вышеупомянутых способов приготовления варианта фитазного фермента, предпочтительно указанный первый параметр выбирают из более высокой термической стабильности, более высокой протеолитической стабильности или более высокой специфической активности, более предпочтительно из более высокой термической стабильности. Предпочтительно, когда первый раунд мутагенеза был выполнен для отбора вариантов с более высокой термической стабильностью, в процессе последующего (повторяющегося) раунда(ов) мутагенеза, включающих стадии а)-с), указанный параметр выбирают из более высокой термической стабильности, более высокой протеолитической стабильности или более высокой специфической активности, более предпочтительно из более высокой протеолитической стабильности или более высокой специфической активности.

В вышеупомянутых вариантах осуществления изобретения, которые родственны способам приготовления варианта фитазного фермента, вариант фитазного фермента предпочтительно скринируют в отношении более высокой термической стабильности и более высокой протеолитической стабильности, и более высокой специфической активности, в, по меньшей мере, одном раунде мутагенеза (стадии а)-с), предпочтительно более чем в одном раунде, то есть повторяющихся раундах отбора.

Исходный фитазный фермент предпочтительно получают из Buttiauxella P1-29.

В способах приготовления варианта фитазного фермента, где способ включает воздействие на последовательность ДНК, кодирующую исходный фитазный фермент, мутагенезом, последовательность ДНК, кодирующая исходный фитазный фермент, предпочтительно подвергается случайному мутагенезу, более предпочтительно склонной к ошибкам ПЦР, более предпочтительно ПЦР с пороговой погрешностью.

Предпочтительными способами мутагенеза последовательности ДНК, кодирующей исходный фитазный фермент, являются склонная к ошибкам ПЦР, более предпочтительно ПЦР с пороговой погрешностью, другие способы мутагенеза могут быть использованы либо вместо ПЦР склонной к ошибкам/с пороговой погрешностью, либо вместе с ними. Смотри Пример 12, который предоставляет ссылки на приемлемые способы склонной к ошибкам ПЦР и ПЦР с пороговой погрешностью. Другой приемлемый способ мутагенной ПЦР раскрыт Cadwell и Joyce (PCR Methods Appl. 3(1994), 136-140).

Термин «экспрессия в клетке-хозяине» при использовании в контексте вариантов осуществления, которые относятся к способу приготовления варианта фитазного фермента, предпочтительно определяют как продуцирование варианта фитазного фермента в живом организме, органе или клетке, как определено в данном описании. Предпочтительными хозяевами являются Escherichia coli K12; Bacillus subtilis; Saccharomyces cerevisiae. Фитазные ферменты, подробно описанные в данном описании, были охарактеризованы после гетерологичной экспрессии в одном или нескольких следующих экспрессионных хозяевах: Escherichia coli K12; Bacillus subtilis; Saccharomyces cerevisiae.

Однако считается, что для целей отбора вариантов фитазного фермента, как описано в данном описании, такие способы можно применять как in vitro способы экспрессии вариантов фитазного фермента, предпочтительно для применения в стадии с) указанных способов, которые используют аппарат транскрипции и трансляции, выделенный из одной или нескольких клеток, изолированных из одного или нескольких живых организмов или вирусов. Такое in vitro продуцирование вариантных фитаз по изобретению также может быть использовано для отбора предпочтительных вариантных фитаз. In vitro экспрессия может быть приемлемо выполнена с использованием стандартной методики. Для ссылки, пожалуйста, смотри «In vitro Expression Guide», доступное от Promega Inc (Part# BR053).

Определение вариантных фенотипов

Варианты с более высокой термической стабильностью (различной термической стабильностью) предпочтительно определены с использованием способов, раскрытых в Примере 12.

Вариант фитазного фермента, приготовленный с помощью способа приготовления вариантов фитазного фермента, имеет отличающуюся термическую стабильность (T.D), по меньшей мере, в 1,5, более предпочтительно в 2; 2,5; 3; 3,5; 4; 5; 6; 7; 8; 9; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19, более предпочтительно, по меньшей мере, в 20 раз.

Варианты с более высокой протеолитической стабильностью предпочтительно определены с использованием способов, раскрытых в Примере 12.

Предпочтительно вариант фитазного фермента по изобретению имеет протеолитическую стабильность (остаточную активность), по меньшей мере, 45%, предпочтительно 50%, 55%, более предпочтительно, по меньшей мере, 60% или 65%, более предпочтительно, по меньшей мере, 70%.

Предпочтительно фитазный вариант по изобретению имеет специфическую активность, большую чем 100% активности дикого типа (дт) при pH 4,0; предпочтительно большую чем 105%, 110%; более предпочтительно большую чем 114%.

Дополнительные варианты осуществления вариантов

В дополнительном варианте осуществления изобретения предоставляются способы приготовления корма для животных, включающего вариант фитазного фермента, где указанный способ включает последовательные стадии: i) выполнение одного или нескольких вышеупомянутых способов приготовления варианта фитазного фермента, и ii) добавление приготовленного варианта фитазного фермента в корм для животных.

В специфическом варианте осуществления изобретения предоставляется способ приготовления корма для животных, включающего вариант фитазного фермента, где указанный способ включает:

а) отбор исходного фитазного фермента, где исходный фитазный фермент выбран из:

i) исходного фитазного фермента с, по меньшей мере, 75% гомологией с SEQ ID No.3 или его функционального фрагмента,

ii) исходного фитазного фермента, полученного из Buttiaxella spp., предпочтительно Buttiaxella P1-29,

iii) по меньшей мере, одного варианта фитазного фермента;

b) получение, по меньшей мере, одного изменения, которое является инсерцией, делецией или замещением аминокислотного остатка в исходном фитазном ферменте для получения варианта фитазного фермента;

с) скрининг варианта фитазного фермента, который по сравнению с исходным фитазным ферментом имеет улучшенные характеристики, как описано в данном описании, предпочтительно выбранные из одной или нескольких:

i) более высокой термической стабильности и/или

ii) специфической активности и/или

iii) протеолитической стабильности;

d) приготовление варианта фитазного фермента;

e) добавление приготовленного варианта фитазного фермента в корм для животных.

В дополнительном варианте осуществления изобретения предоставляются способы приготовления корма для животных, включающего вариант фитазного фермента:

а) воздействие на нуклеотидную (предпочтительно ДНК) последовательность, кодирующую исходный фитазный фермент, мутагенезом, где указанный нуклеотид выбран из нуклеотида, который кодирует:

i) исходный фитазный фермент с, по меньшей мере, 75% гомологией с SEQ ID No.3 его функционального фрагмента, и/или

ii) исходный фитазный фермент, полученный из Buttiaxella spp., предпочтительно Buttiauxella P1-29;

b) экспрессию мутантной нуклеотидной (предпочтительно ДНК) последовательности, полученной на стадии (а) в клетке-хозяине, и

c) скрининг клеток-хозяев, экспрессирующих вариант фитазного фермента, который по сравнению с исходным фитазным ферментом имеет улучшенные характеристики, как описано в данном описании, предпочтительно выбранные из одной или нескольких:

i) более высокой термической стабильности и/или

ii) более высокой специфической активности и/или

iii) более высокой протеолитической стабильности;

d) приготовление варианта фитазного фермента, экспрессируемого клеткой-хозяином;

e) добавление приготовленного варианта фитазного фермента в корм для животных.

Описанные варианты осуществления и предпочтительные аспекты способа приготовления варианта фитазного фермента также применяют с вышеупомянутыми способами приготовления корма для животных, включающего вариант фитазного фермента.

В другом аспекте изобретения предоставляется клетка-хозяин, трансформированная или трансфицированная нуклеиновой кислотой, кодирующей фитазу, как описано в данном описании.

Соответственно клетка-хозяин в соответствии с этим аспектом изобретения включает фитазу, которая содержит аминокислотную последовательность или ее функциональный фрагмент, как представлено в SEQ ID NO:3, или последовательность, которая, по меньшей мере, на 75% гомологична ей.

В предпочтительном варианте осуществления указанная клетка-хозяин продуцирует фитазу.

В дальнейшем аспекте изобретения предоставляется клетка-хозяин, трансформированная или трансфицированная нуклеиновой кислотой, кодирующей фитазу в соответствии с изобретением. Предпочтительно фитаза представляет собой фитазу Buttiauxella sp., как описано в данном описании, или ее гомолог, или производное. Соответственно указанный фитазный фермент включает аминокислотную последовательность или ее функциональный фрагмент, как представлено в SEQ ID NO:3, или последовательность, которая, по меньшей мере, на 75% гомологична (идентична) ей. Предпочтительно указанная клетка-хозяин продуцирует фитазу.

В одном варианте осуществления нуклеотидная последовательность, которая может быть использована в настоящем изобретении, получена из (даже если бы она действительно не была получена из) Buttiauxella sp., хотя следует признать, что ферменты, изолированные и/или очищенные из эквивалентных штаммов, могут быть использованы в равной степени.

Соответственно клетку-хозяина получают из микроорганизма, включающего бактерии, и грибы, включая дрожжи. В особенно предпочтительном варианте осуществления клетка-хозяин представляет собой прокариотическую бактериальную клетку. Подходящие бактериальные клетки-хозяева включают бактерии из различных прокариотических таксономических групп, включая протобактерии, включая члены подраздела альфа, бета, гамма, дельта и эпсилон, грамположительные бактерии, такие как Actinomycetes, Firmicutes, Clostridium и родственные флавобактерии, цианобактерии, зеленые серные бактерии, зеленые несерные бактерии и археи. Практически предпочтительными являются Enterobacteriaceae, такие как протобактерия Escherichia coli, принадлежащая к гамма-подразделу, и небольшая GC-грамположительная бактерия, такая как Bacillus.

Соответственно грибные клетки-хозяева включают дрожжи, выбранные из группы, состоящей из Ascomycota, включая Saccharomycetes, такие как Pichia, Hansenula и Saccharomyces, Schizosaccharmycetes, такие как Schizosaccharomyces pombe и анаморфные Ascomycota, включая Aspergillus.

Другие приемлемые клетки-хозяева включают клетки насекомых, такие как SF9, SF21, Trychplusiani и клетки M121. Например, полипептиды в соответствии с изобретением могут быть преимущественно экспрессированы в клеточных системах насекомых. В дополнение к экспрессии в культуре клеток насекомых фитазные гены могут быть экспрессированы в цельных организмах насекомых. Вирусные векторы, такие как бакуловирус, делают возможным заражение цельных насекомых. Крупные насекомые, такие как тутовые шелкопряды, обеспечивают высокий выход гетерологичного белка. Белок может быть экстрагирован из насекомых в соответствии с общепринятыми методиками экстракции. Экспрессионные векторы, приемлемые для использования в изобретении, включают все векторы, которые способны экспрессировать чужеродные белки в клеточных линиях насекомых.

Другие клетки-хозяева включают растительные клетки, выбранные из группы, состоящей из: протопластов, клеток, каллюса, тканей, органов, семян, зародышей, семяпочек, зигот и т.п. Изобретение также предоставляет целые растения, которые были трансформированы и включают рекомбинантную ДНК по изобретению.

Термин «растение», в общем, включает эукариотическую водоросль, эмбриофиты, включая Bryophyta, Pteridophyta и Spermatophyta, такие как Gymnospermae и Angiospermae.

Предпочтительно указанная клетка-хозяин представляет собой микроорганизм. Предпочтительные микроорганизмы включают прокариотические бактериальные клетки, предпочтительно E.coli, B.subtilis и другие виды рода Bacillus, дрожжи, предпочтительно Hansenula polymorpha и Schizosaccharomyces pombe.

В другом аспекте изобретения предоставляется штамм P1-29 бактериальных клеток Buttiauxella sp., депонированный Danisco Global Innovation, Sokeritehtaantie 20, FIN-02460 Kantvik, Finland 22 сентября 2004 под инвентарным номером NCIMB 41248. Такая клетка может быть введена непосредственно в корм.

В другом аспекте предоставляется способ получения фитаз, включающий трансфекцию клетки-хозяина экспрессионным вектором или плазмидой в соответствии с изобретением, культивирование указанной клетки-хозяина в условиях, обеспечивающих экспрессию фитазы, и экстракцию указанной фитазы из культуральной среды клетки-хозяина.

Соответственно указанный способ служит для продуцирования фитазы и включает экспрессию аминокислотной последовательности, приведенной в SEQ ID NO:3, или последовательности, имеющей, по меньшей мере, 75% гомологию с ней или ее эффективного фрагмента в клетке-хозяине, и экстракцию секретированного белка из культуральной среды клетки-хозяина.

Другой аспект изобретения предоставляет кормовую композицию, включающую фитазу в соответствии с изобретением. Предпочтительно кормовая композиция включает фитазу в концентрации 10-10000 U/кг корма, предпочтительно 200-2000 U/кг корма, более предпочтительно 500-1000 U/кг корма.

В одном варианте осуществления кормовая композиция включает клетку-хозяина в соответствии с изобретением.

В другом аспекте предоставляется применение фитазы в соответствии с изобретением в продуктах питания или корме для животных.

Предпочтительные аспекты

Предпочтительные аспекты представлены в сопутствующей формуле изобретения и в последующем описании, и в разделе Примеры.

Дополнительные преимущества

Настоящее изобретение является выгодным, так как оно предоставляет фитазы, которые обладают рядом свойств, делающих их практически полезными в качестве добавок к кормам для животных.

В частности, фитазы по настоящему изобретению обладают активностью при низком pH и, предпочтительно, в диапазоне pH 2-5,5 с активностью, максимальной около pH 4-4,5. Соответственно фитазы по настоящему изобретению обладают активностью при низких pH (сохраняя примерно 40% максимальной активности при pH 2,5) в окружающей среде желудка.

К тому же фитазы по настоящему изобретению эффективно секретируются как из исходного хозяина, так и в процессе гетерологичной экспрессии, таким образом, приводя к более эффективному продуцированию и выделению для добавления в корм.

Более того, фитазы по настоящему изобретению предпочтительно имеют широкую субстратную специфичность, включая пента-, тетра-, три- и дифосфатные субстраты, вследствие этого увеличивая усвояемость общего фосфата для абсорбции животным (усвояемый фосфат). Фитазы по настоящему изобретению также предпочтительно имеют высокую специфическую активность в области 300 U/мг +/- примерно 10%, предпочтительно, по меньшей мере, 300 U/мг.

Продукты по настоящему изобретению могут быть использованы в качестве дополнений/добавок к продуктам питания и корму. Продукты также могут быть использованы для промышленного получения различных инозитфосфатов.

Фитат/фитиновая кислота/фитазы

Фитиновая кислота (гексакисфосфат мио-инозита) представляет собой важный компонент зерновых, бобовых и культур с масличными семенами. Солевая форма, фитат, представляет собой основную запасающую форму фосфора у этих растений.

Фитазы катализируют гидролиз фосфат сложного моноэфира фитиновой кислоты, который приводит к постадийному формированию мио-инозитпентакис-, тетракис-, трис-, бис- и монофосфатов, а также к высвобождению неорганического фосфата.

Термины «фитаза дикого типа» или «дикий тип», как использовано в данном описании, относится к фитазному ферменту с аминокислотной последовательностью, обнаруженной в природе.

Термины «фитазный вариант» или «вариант», или «модифицированная форма» относятся к фитазному ферменту с аминокислотной последовательностью, полученной из аминокислотной последовательности исходной фитазы, имеющей одно или несколько аминокислотных замещений, инсерций и/или делеций, которые вместе упоминаются как «мутации».

Термины «исходная фитаза» или «исходный фермент» относятся к фитазному ферменту, из которого получен фитазный вариант. Исходная фитаза может быть фитазой дикого типа или другим фитазным вариантом. В частности, по настоящему изобретению «исходная фитаза» может быть получена из Buttiauxella sp. Соответственно «исходная фитаза», полученная из штамма P1-29 Buttiauxella, как описано в данном описании, предпочтительно имеет аминокислотную последовательность, приведенную в SEQ ID NO:3.

Выделенный (изолированный)

В одном аспекте предпочтительно нуклеотидная или аминокислотная последовательность находится в выделенной (изолированной) форме. Термин «выделенный» означает, что последовательность находится, по меньшей мере, в значительной степени, в свободной форме, по меньшей мере, от какого-то другого компонента, последовательность которого естественно ассоциирована с природной и найдена в природе.

Очищенный

В одном аспекте предпочтительно нуклеотидная или аминокислотная последовательность находится в очищенной форме. Термин «очищенный» означает, что последовательность находится в относительно чистом состоянии, по меньшей мере, 1%, 5% чистоты или 10% чистоты, более предпочтительно, по меньшей мере, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% чистоты. В предпочтительном варианте осуществления по отношению к полипептиду чистоту, как определено выше, определяют на примере очистки от других полипептидов с помощью электрофореза SDS-PAGE. В предпочтительном варианте осуществления по отношению к полинуклеотиду чистоту, как определено выше, определяют на примере очистки от других полинуклеотидов.

Нуклеотидная последовательность

Объем настоящего изобретения включает нуклеотидные последовательности, кодирующие ферменты, имеющие специфические свойства, как определено в данном описании.

Термин «нуклеотидная последовательность», как использовано в данном описании, относится к олигонуклеотидной последовательности, нуклеиновой кислоте или полинуклеотидной последовательности и их варианту, гомологу, фрагментам и производным (таким как ее части). Нуклеотидная последовательность может быть геномного или синтетического, или рекомбинантного происхождения, которая может быть двунитевой или однонитевой, представленной или смысловой, или антисмысловой нитью.

Термин «нуклеотидная последовательность» или «молекула нуклеиновой кислоты» по отношению к настоящему изобретению включает геномную ДНК, кДНК, синтетическую ДНК и РНК. Предпочтительно это означает ДНК, более предпочтительно кодирующую кДНК последовательность по настоящему изобретению.

В предпочтительном варианте осуществления нуклеотидная последовательность, если относится к и если включена сама по себе в объем настоящего изобретения, не включает нативную нуклеотидную последовательность в соответствии с настоящим изобретением, если находится в своей природной окружающей среде и если связана со своей природной ассоциированной последовательностью(ями), которые также находятся в своей природной окружающей среде. Для удобства пользования мы назовем этот предпочтительный вариант осуществления «не-нативная нуклеотидная последовательность». В этом отношении термин «нативная нуклеотидная последовательность» означает цельную нуклеотидную последовательность, которая находится в своей нативной окружающей среде и если функционально сцеплена с цельным промотором, с которым она естественно ассоциирована, где промотор также находится в своей нативной окружающей среде. Однако аминокислотная последовательность, включенная в объем настоящего изобретения, может быть выделена и/или очищена после экспрессии нуклеотидной последовательности в своем нативном организме. Предпочтительно, однако же, что аминокислотная последовательность, включенная в объем настоящего изобретения, может быть экспрессирована с помощью нуклеотидной последовательности в своем нативном организме, но где нуклеотидная последовательность не находится под контролем промотора, который естественно ассоциирован с этим организмом.

Приготовление нуклеотидной последовательности

Обычно нуклеотидную последовательность, включенную в объем настоящего изобретения, или нуклеотидные последовательности для применения по настоящему изобретению готовят с использованием технологии рекомбинантной ДНК (то есть рекомбинантной ДНК). Однако в альтернативном варианте осуществления изобретения нуклеотидная последовательность может быть синтезирована полностью или частично с использованием химических способов, хорошо известных в данной области (смотри Caruthers MH с сотр., (1980) Nuc Acids Res Symp Ser 215-23 и Horn T с сотр., (1980) Nuc Acids Res Symp Ser 225-232).

Нуклеотидная последовательность, кодирующая либо фермент, который имеет специфические свойства, как определено в данном описании, либо фермент, который приемлем для модификации, может быть идентифицирована и/или выделена, и/или очищена из любой клетки или организма, продуцирующих указанный фермент. Различные способы хорошо известны в данной области для идентификации и/или выделения, и/или очистки нуклеотидных последовательностей. В качестве примера методика ПЦР-амплификации для приготовления большего количества последовательности может быть использована однократно для приемлемой последовательности, которая была идентифицирована и/или выделена, и/или очищена.

В качестве дополнительного примера, библиотека геномной ДНК или кДНК может быть сконструирована с использованием хромосомной ДНК или матричной РНК из организма, продуцирующего фермент. Если аминокислотная последовательность фермента или часть аминокислотной последовательности известна, меченые олигонуклеотидные зонды могут быть синтезированы и использованы для идентификации фермент-кодирующих клонов геномной библиотеки, приготовленной из организма. Альтернативно, меченый олигонуклеотидный зонд, содержащий последовательности, гомологичные другому известному ферментному гену, может быть использован для идентификации фермент-кодирующих клонов. В последнем случае используют гибридизацию и промывку в условиях низкой жесткости.

Альтернативно, фермент-кодирующие клоны могут быть идентифицированы путем инсерции фрагментов геномной ДНК в экспрессионный вектор, такой как плазмида, трансформирующая негативную по ферменту бактерию с получением библиотеки геномной ДНК, и затем посева трансформированной бактерии на чашки с агаром, содержащие субстрат для фермента (например, мальтозу для глюкозидаза (мальтаза)-продуцирующего фермента), тем самым обеспечивая идентификацию клонов, экспрессирующих фермент.

В качестве дополнительной альтернативы нуклеотидная последовательность, кодирующая фермент, может быть приготовлена синтетически на основе стандартных способов, например, фосфороамидатного способа, описанного Beucage S.L. с сотр., (1981) Tetrahedron Letters 22, p 1859-1869, или способа, описанного Matthes с сотр., (1984) EMBO J. 3, p 801-805. В фосфороамидатном способе олигонуклеотиды синтезируют, например, в автоматическом ДНК-синтезаторе, очищают, отжигают и клонируют в соответствующих векторах.

Нуклеотидная последовательность может быть смешанного геномного и синтетического происхождения, смешанного синтетического и кДНК-происхождения, приготовленная путем лигирования фрагментов синтетического, геномного и кДНК-происхождения (что имеется) в соответствии со стандартными методиками. Каждый лигированный фрагмент соответствует различным частям цельной нуклеотидной последовательности. Последовательность ДНК также может быть приготовлена посредством полимеразной цепной реакции (ПЦР) с использованием специфических праймеров, например, как описано в US 4683202 или у Saiki R.K. с сотр., (Science (1988) 239, pp 487-491).

Вследствие вырожденности генетического кода могут быть легко продуцированы нуклеотидные последовательности, у которых использование триплетного кодона, например, для части или всех аминокислот, кодируемых первоначальной нуклеотидной последовательностью, было изменено посредством продуцирования нуклеотидной последовательности с низкой гомологией первоначальной нуклеотидной последовательности, но которая кодирует такую же или вариантную аминокислотную последовательность, кодируемую первоначальной нуклеотидной последовательностью. Например, для большинства аминокислот вырожденность генетического кода находится в третьем положении триплетного кодона (wobble-положение или вобуляция, или неоднозначное узнавание некоторыми антикодонами тРНК соответствующих кодонов мРНК, вызванное неоднозначностью спаривания 1 и 3 нуклеотидов в кодоне) (для ссылки смотри Stryer, Lubert, Biochemistry, Third Edition, Freeman Press, ISBN 0-7167-1920-7); поэтому нуклеотидная последовательность, в которой все триплетные кодоны были «вобулированы» в третьем положении, должна быть примерно на 66% идентична первоначальной нуклеотидной последовательности, однако усовершенствованная нуклеотидная последовательность будет кодировать такую же или вариантную первичную аминокислотную последовательности как первоначальную нуклеотидную последовательность.

Поэтому настоящее изобретение дополнительно относится к любой нуклеотидной последовательности, у которой имеется альтернативное использование триплетных кодонов, по меньшей мере, триплетного кодона, кодирующего одну аминокислоту, но которая кодирует такую же или вариантную полипептидную последовательность, как полипептидная последовательность, кодируемая первоначальной нуклеотидной последовательностью.

Кроме того, специфические организмы обычно имеют смещение, при котором триплетные кодоны используются для кодирования аминокислот. Таблицы предпочтительного использования кодонов широкодоступны и могут быть использованы для приготовления генов с оптимизированными кодонами. Такую методику оптимизации кодонов обычно применяют для оптимизации экспрессии трансгенов в гетерологичном хозяине.

Молекулярная эволюция

После того как фермент-кодирующая нуклеотидная последовательность была выделена и/или очищена, или предполагаемая фермент-кодирующая нуклеотидная последовательность была идентифицирована, может быть желательно модифицировать отобранную нуклеотидную последовательность, например, может быть желательно мутировать последовательность для того, чтобы приготовить фермент в соответствии с настоящим изобретением.

Мутации могут быть введены с использованием синтетических олигонуклеотидов. Эти олигонуклеотиды содержат нуклеотидные последовательности, фланкирующие желательные мутационные сайты.

Приемлемый способ раскрыт у Morinaga с сотр. (Biotechnology (1984) 2, p646-649). Другой способ введения мутаций в фермент-кодирующие нуклеотидные последовательности описан у Nelson и Long (Analytical Biochemistry (1989), 180, p 147-151).

Вместо сайт-направленного мутагенеза, как описано выше, можно вводить мутации случайным образом, например, используя коммерческий набор, такой как GeneMorph PCR mutagenesis kit от Stratagene или the Diversify PCR random mutagenesis kit от Clontech.

Третий способ получения новых последовательностей представляет собой фрагментацию неидентичных нуклеотидных последовательностей либо путем применения любого числа рестрикционных ферментов, либо фермента, такого как ДНКаза I, и повторную сборку полных нуклеотидных последовательностей, кодирующих функциональные белки. Альтернативно, может быть использованы одна или множество неидентичных нуклеотидных последовательностей и введение мутаций в процессе повторной сборки полной нуклеотидной последовательности.

Таким образом, можно продуцировать многочисленные сайт-направленные или случайные мутации в нуклеотидной последовательности или in vivo, или in vitro и впоследствии скринировать в отношении улучшения функциональности кодируемого полипептида с помощью различных средств.

В качестве неограничивающего примера мутации или природные варианты полинуклеотидной последовательности могут быть рекомбинированы либо с диким типом, либо с другими мутациями или с природными вариантами для продуцирования новых вариантов. Такие новые варианты также могут быть скринированы в отношении улучшения функциональности кодируемого полипептида. Продуцирование новых предпочтительных вариантов может быть достигнуто с помощью различных способов, хорошо известных в данной области, например, Error Threshold Mutagenesis (WO 92/18645), олигонуклеотид-опосредованного случайного мутагенеза (US 5723323), перетасовки ДНК (US 5605793), экзо-опосредованной сборки генов (WO 0058517). Другие приемлемые способы описаны, например, в WO 0134835, WO 02/097130, WO 03/012100, WO 03/057247, WO 2004/018674, US 6303344 и US 6132970.

Применение вышеупомянутых и аналогичных способов молекулярной эволюции позволяет идентифицировать и отбирать варианты ферментов по настоящему изобретению, которые имеют предпочтительные характеристики без какой-либо предварительной информации о белковой структуре или функции, и позволяет продуцировать непрогнозируемые, но полезные мутации или варианты. Существуют многочисленные примеры применения молекулярной эволюции в данной области для оптимизации или изменения ферментативной активности, такие примеры включают, но не ограничиваясь ими, один или несколько следующих: оптимизированную экспрессию и/или активность в клетке-хозяине или in vitro; усиленную ферментативную активность; измененную субстратную и/или продуктную специфичность; увеличенную или сниженную ферментативную или структурную стабильность; измененную ферментативную активность/специфичность в предпочтительных условиях окружающей среды, например, температура, pH, субстрат.

Вышеупомянутые способы молекулярной эволюции могут быть использованы в способах приготовления варианта фитазного фермента, как описано в данном описании.

Аминокислотные последовательности

Объем настоящего изобретения также включает аминокислотные последовательности ферментов, имеющих специфические свойства, как описано в данном описании.

Как использовано в данном описании, термин «аминокислотная последовательность» является синонимичным термину «полипептид» и/или термину «белок». В некоторых примерах термин «аминокислотная последовательность» является синонимичным термину «пептид». В некоторых примерах термин «аминокислотная последовательность» является синонимичным термину «фермент».

Аминокислотная последовательность может быть приготовлена/выделена из приемлемого источника или может быть получена синтетически, или может быть приготовлена путем использования технологии рекомбинантной ДНК.

Фермент, включенный в настоящее изобретение, может быть использован в связи с другими ферментами. Так, настоящее изобретение также охватывает комбинацию ферментов, где комбинация включает фермент по настоящему изобретению и другой фермент, который может быть другим ферментом в соответствии с настоящим изобретением. Этот аспект обсуждается в последующем разделе.

Предпочтительно аминокислотная последовательность, относящаяся к или входящая сама по себе в объем настоящего изобретения, не является нативным ферментом. В этом отношении термин «нативный фермент» означает цельный фермент, который находится в своей нативной окружающей среде и если он был экспрессирован с помощью своей нативной нуклеотидной последовательности.

Варианты/гомологи/производные

Настоящее изобретение также включает применение вариантов, гомологов и производных любой аминокислотной последовательности фермента или любой нуклеотидной последовательности, кодирующей такой фермент.

В данном описании термин «гомолог» означает часть, имеющую определенную гомологию с аминокислотными последовательностями и нуклеотидными последовательностями. В данном описании термин «гомология» может быть приравнен к термину «идентичность». Соответственно «гомологичный» в этом контексте относится к проценту идентичной последовательности между двумя ферментами после выравнивания этих последовательностей с использованием алгоритмов, как описано более детально ниже.

В настоящем контексте гомологичная аминокислотная последовательность включает аминокислотную последовательность, которая может быть, по меньшей мере, на 75, 80, 81, 85 или 90% идентична, предпочтительно, по меньшей мере, на 95, 96, 97, 98 или 99% идентична последовательности. Обычно гомологи включают такие же активные сайты и т.п. - например, как объектная аминокислотная последовательность. Хотя гомология также может быть рассмотрена в терминах подобия (то есть аминокислотные остатки, имеющие сходные химические свойства/функции), в контексте настоящего изобретения предпочтительно выражать гомологию в терминах идентичности последовательности.

Под «функциональным фрагментом» подразумевают фрагмент полипептида, который сохраняет характеристические свойства этого полипептида. В контексте настоящего изобретения функциональный фрагмент фитазного фермента представляет собой фрагмент, который сохраняет каротиноидную расщепляющую способность цельного белка.

В настоящем контексте гомологичная нуклеотидная последовательность включает нуклеотидную последовательность, которая может быть, по меньшей мере, на 75, 80, 81, 85 или 90% идентична, предпочтительно, по меньшей мере, на 95, 96, 97, 98 или 99% идентична нуклеотидной последовательности, кодирующей фермент по настоящему изобретению (объектная последовательность). Обычно гомологи будут включать аналогичные последовательности, которые кодируют активные сайты и т.п. как объектную последовательность. Хотя гомология также может быть рассмотрена в терминах подобия (то есть аминокислотные остатки, имеющие сходные химические свойства/функции), в контексте настоящего изобретения предпочтительно выражать гомологию в терминах идентичности последовательности.

Для аминокислотных последовательностей и нуклеотидных последовательностей сравнение гомологии может быть проведено визуально или, как правило, с помощью легкодоступных сравнительных программ. Эти коммерчески доступные компьютерные программы могут расчитать % гомологии между двумя или большим числом последовательностей.

Процент гомологии может быть расчитан для смежных последовательностей, то есть одну последовательность выравнивают с другой последовательностью и каждую аминокислоту в одной последовательности непосредственно сравнивают с соответствующей аминокислотой другой последовательности, один остаток за один раз. Это называется «безгэповым» выравниванием. Обычно такие безгэповые выравнивания выполняют только в пределах относительного небольшого числа остатков.

Хотя это очень простой и унифицированный способ, он имеет недостаток, который следует принимать во внимание, согласно которому, например, в другой идентичной паре последовательностей одна инсерция или делеция будут вызывать сбой выравнивания следующих аминокислотных остатков, таким образом, потенциально приводя к большому уменьшению % гомологии при выполнении глобального выравнивания. Поэтому большая часть способов сравнения последовательностей разработана для продуцирования оптимальных выравниваний, которые принимают во внимание возможные инсерции и делеции без штрафования излишне общей оценки гомологии. Это достигается путем помещения «гэпов» в выравниваемую последовательность, чтобы попытаться максимизировать локальную гомологию.

Тем не менее, эти более сложные способы оценивают «штрафование гэпов» для каждого гэпа (разрыва), который встречается при выравнивании, так что для сходного числа идентичных аминокислот при выравнивании последовательности с несколькими гэпами по возможности - отражая более высокое родство между двумя сравниваемыми последовательностями - будет достигаться более высокий показатель, чем таковой для множества гэпов. «Цену афинного гэпа» обычно используют, чтобы оценить относительно высокую стоимость существования гэпа и уменьшение штрафа за каждый последующий остаток в гэпе. Это является наиболее обычно применяемой системой оценки гэпов. Высокие гэповые штрафы будут, конечно, продуцировать оптимизированные выравнивания с несколькими гэпами. Большинство программ выравнивания предусматривают модификацию гэповых штрафов. Однако предпочтительно применять используемые по умолчанию значения при применении такого программного обеспечения для сравнения последовательностей. Например, при применении GCG Wisconsin Bestfit пакета гэповый штраф по умолчанию для аминокислотных последовательностей составляет -12 для гэпа и -4 для каждого приращения. Вычисление максимального % гомологии, поэтому, прежде всего требует продуцирования оптимального выравнивания, принимая во внимание гэповые штрафы. Приемлемой компьютерной программой для выполнения такого выравнивания является пакет GCG Wisconsin Bestfit (Devereux с сотр. 1984 Nuc. Acids Research 12 p387). Примерами другого программного обеспечения, которое может выполнять сравнение последовательностей, включает, но не ограничиваясь ими, BLAST пакет (смотри Ausubel с сотр., 1999 Short Protocols in Molecular Biology, 4th Ed - Chapter 18), FASTA (Altschul с сотр., 1990 J. Mol. Biol. 403-410) и GENEWORKS комплект средств сравнения. Как BLAST, так и FASTA доступны для поиска в режиме offline и online (смотри Ausubel с сотр., 1999, Short Protocols in Molecular Biology, pages 7-58 to 7-60).

Однако для некоторых областей применения предпочтительно использовать программу GCG Bestfit. Новое средство, названное BLAST 2 Sequences, также является доступным для сравнения белковой и нуклеотидной последовательности (смотри FEMS Microbiol Lett 1999 174(2): 247-50; FEMS Microbiol Lett 1999 177(1): 187-8 и tatiana@ncbi.nlm.nih.gov).

Хотя конечный % гомологии может быть измерен в терминах идентичности, процесс выравнивания сам по себе обычно не основан на сравнении пар по принципу «все-или-ничего». Вместо этого обычно используют масштабируемую подобную оценочную матрицу, которая определяет оценку каждого попарного сравнения, основанного на химическом сходстве или эволюционном расстоянии. Примером такой обычно применяемой матрицы является матрица BLOSUM62 - заданная по умолчанию матрица для BLAST набора программ. Программы GCG Wisconsin обычно используют либо общедоступные по умолчанию значения, либо пользовательскую сравнительную таблицу символов, если она приведена (смотри руководство для дальнейшей детализации). Для некоторых областей применения предпочтительно использовать общедоступные по умолчанию значения GCG пакета или, в случае другой программы, матрицу, заданную по умолчанию, такую как BLOSUM62.

Альтернативно, процентная гомология может быть вычислена с использованием возможности множественного выравнивания в DNASISTM (Hitachi Software), основанного на алгоритме, аналогичном CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73(1), 237-244).

Как только программа продуцирует оптимальное выравнивание, можно вычислить % гомологии, предпочтительно % идентичности последовательностей. Программное обеспечение обычно не делает этого как часть сравнения последовательностей и генерирует численный результат.

В предпочтительном аспекте по настоящему изобретению применяют следующее программное обеспечение и параметры настройки для вычисления процента гомологии/идентичности последовательностей. Для аминокислотных последовательностей процент идентичности (гомологии) или «позитив» вычисляют с помощью AlignX VectorNTI (Vector NTI Advance 9.1 от Invitrogen Corporation, Карлсбад, Калифорния, США) для каждой возможной пары аминокислотных последовательностей. Параметры настройки являются заданными по умолчанию параметрами (открытие гэпового штрафа - 10, расширение гэпового штрафа 0,1).

Для нуклеиновокислотных последовательностей процент идентичности (гомологии) или «позитив» вычисляют с помощью AlignX VectorNTI программы от Informax Inc. (США) для каждой возможной пары нуклеиновокислотных последовательностей. Параметры настройки являются заданными по умолчанию параметрами для ДНК: открытие гэпового штрафа: 15 и расширение гэпового штрафа: 6,66 (аналогичные параметры настройки для множественных выравниваний).

Предпочтительно аминокислотную идентичность (гомологию) вычисляют по всей полноразмерной аминокислотной последовательности или по нуклеиновой кислоте в соответствующем полинуклеотиде, который кодирует соответствующую полноразмерную аминокислотную последовательность.

Последовательности также могут иметь делеции, инсерции или замещения аминокислотных остатков, которые продуцируют молчащее изменение и приводят к функционально эквивалентной субстанции. Контролируемые аминокислотные замещения могут быть получены на основе сходства аминокислотных свойств (таких как полярность, заряд, растворимость, гидрофобность, гидрофильность и/или амфипатическая природа остатков) и поэтому используются для группирования аминокислот совместно в функциональные группы. Аминокислоты могут быть сгруппированы совместно на основе свойств только своей боковой цепи. Однако более полезно включать мутационные данные с тем же успехом. Полученные таким образом наборы аминокислот являются, вероятно, консервативными по структурным мотивам. Эти наборы могут быть описаны в форме диаграммы Венна (Livingstone C.D. и Barton G.J. (1993) "Protein sequence alignments: a strategy for the hierarchical analysis of residue conservation" Comput.Appl Biosci. 9: 745-756)(Taylor W.R. (1986) "The classification of amino acid conservation" J.Theor.Biol. 119; 205-218). Консервативные замещения могут быть получены, например, в соответствии с таблицей, приведенной ниже, которая описывает общепринятую диаграмму Венна группирования аминокислот.

НАБОР СУБНАБОР
Гидрофобный F W Y H K M I L V A G C Ароматический F W Y H
Алифатический I L V
Полярный W Y H K R E D C S T N Q Заряженный H K R E D
Положительно заряженный H K R
Отрицательно заряженный E D
Небольшой V C A G S P T N D Крошечный A G S

Настоящее изобретение также включает гомологичное замещение (как замещение так и замена, применяемые в данном описании, означают обмен существующего аминокислотного остатка на альтернативный остаток), которое может происходить, то есть, идентичное замещение, такое как основный на основный, кислотный на кислотный, полярный на полярный и т.п. Также может происходить негомологичное замещение, то есть, из одного класса остатка в другой или, альтернативно, включение неприродных аминокислот, таких как орнитин (именуемый в дальнейшем как Z), орнитин диаминомасляной кислоты (именуемый в дальнейшем как B), норлейцин орнитин (именуемый в дальнейшем как O), пириилаланин, тиенилаланин, нафтилаланин и фенилглицин.

Замены также могут быть сделаны с помощью неприродных аминокислот.

Вариантные аминокислотные последовательности могут включать приемлемые спейсерные группы, которые могут быть вставлены между любыми двумя аминокислотными остатками последовательности, включая алкильные группы, такие как метильные, этильные или пропильные группы в добавление к аминокислотным спейсерам, таким как глицин или β-аланиновые остатки. Дальнейшая форма вариации требует присутствия одного или нескольких аминокислотных остатков в пептоидной форме, что будет хорошо понятно специалистам в данной области. Во избежание сомнения «пептоидную форму» используют по отношению к различным аминокислотным остаткам, где α-углерод замещенной группы находится на остатках атома азота, скорее чем α-углерода. Способ приготовления пептидов в пептоидной форме известен в данной области, например, Simon RJ с сотр., PNAS (1992) 89(20), 9367-9371 и Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134.

Нуклеотидные последовательности для применения по настоящему изобретению могут включать синтетические или модифицированные нуклеотиды. Ряд различных типов модификаций олигонуклеотидов известен в данной области. Они включают метилфосфонатные и фосфоротиоатные остовы и/или добавление акридиновых или полилизиновых цепей к 3'- и/или 5'-концам молекулы. Для целей настоящего изобретения следует понимать, что нуклеотидные последовательности, описанные в данном описании, могут быть модифицированы с помощью любого способа, доступного в данной области. Такие модификации могут быть выполнены для того, чтобы повысить in vivo активность или время существования нуклеотидных последовательностей по настоящему изобретению.

Настоящее изобретение также включает применение нуклеотидных последовательностей, которые комплементарны последовательностям, представленным в данном описании, или любому производному, фрагменту или его производному. Если последовательность комплементарна своему фрагменту, эта последовательность может быть использована в качестве зонда для идентификации сходных кодирующих последовательностей в других организмах и т.п.

Полинуклеотиды, которые не на 100% гомологичны последовательностям по настоящему изобретению, но попадают в объем изобретения, могут быть получены несколькими путями. Другие варианты последовательностей, описанные в данном описании, могут быть получены, например путем зондирования ДНК-библиотек, полученных от ряда индивидуумов, например, индивидуумов из различных популяций. Кроме того, другие гомологи могут быть получены, и такие гомологи и их фрагменты, в общем, будут способны селективно гибридизироваться с последовательностями, перечисленными в списке последовательностей в данном описании. Такие последовательности могут быть получены путем зондирования кДНК-библиотек, полученных от или геномных ДНК-библиотек от других видов, и зондирования таких библиотек зондами, включающими всю или часть любой одной из последовательностей в приложенном списке последовательностей в условиях высокой жесткости среды. Аналогичные соображения используют для получения видовых гомологий и аллельных вариантов полипептидных или нуклеотидных последовательностей по изобретению.

Варианты и штаммовые/видовые гомологи также могут быть получены с использованием вырожденной ПЦР, в которой используют праймеры, сконструированные для мишенных последовательностей вариантов и гомологов, кодирующих консервативные аминокислотные последовательности в последовательностях по настоящему изобретению. Консервативные последовательности могут быть предсказаны, например, путем выравнивания аминокислотных последовательностей нескольких вариантов/гомологов. Выравнивание последовательностей может быть выполнено с использованием компьютерного программного обеспечения, известного в данной области. Например, широко применяется программа GCG Wisconsin PileUp.

Праймеры, применяемые в вырожденной ПЦР, будут содержать одно или несколько вырожденных положений и должны применяться в менее жестких условиях, чем применяемые для клонирования последовательностей с отдельными последовательностями праймеров против известных последовательностей.

Альтернативно, такие полинуклеотиды могут быть получены путем сайт-направленного мутагенеза характеризуемых последовательностей. Это может быть использовано, например, где изменение последовательности молчащего кодона требуется для оптимизации предпочтения кодонов для особой клетки-хозяина, в которой экспрессируются полинуклеотидные последовательности. Другие изменения последовательности могут быть желательны для того, чтобы ввести сайты узнавания рестрикционного фермента или изменить свойство или функцию полипептидов, кодируемых полинуклеотидами.

Полинуклеотиды (нуклеотидные последовательности) по изобретению могут быть использованы для продуцирования праймера, например ПЦР-праймера, праймера для реакции альтернативной амплификации, зонда, например, меченого выявляющей меткой с помощью стандартных средств с использованием радиоактивных или нерадиоактивных меток, или полинуклеотиды могут быть клонированы в векторы. Такие праймеры, зонды и другие фрагменты будут состоять из, по меньшей мере, 15, предпочтительно, по меньшей мере, 20, например, по меньшей мере, 25, 30 или 40 нуклеотидов в длину и также включены посредством термина полинуклеотиды по изобретению, как использовано в данном описании.

Полинуклеотиды, такие как ДНК-полинуклеотиды и зонды в соответствии с изобретением могут быть продуцированы рекомбинантно, синтетически или с помощью любых средств, доступных для специалистов в данной области. Они также могут быть клонированы с помощью стандартных методик.

В общем, праймеры должны быть получены с помощью синтетических средств, включая постадийное получение желательной последовательности нуклеиновой кислоты по одному нуклеотиду за один раз. Методики для выполнения этого с использованием автоматического оборудования легкодоступны в данной области.

Более длинные полинуклеотиды будут, в общем, продуцироваться с использованием рекомбинантных средств, например, с использованием ПЦР (полимеразная цепная реакция) клонирующих методик. Могут быть сконструированы праймеры, содержащие приемлемые сайты узнавания рестрикционного фермента, так что амплифицированная ДНК может быть клонирована в приемлемый клонирующий вектор.

Биологически активный

Предпочтительно, вариантные последовательности, например, являются, по меньшей мере, биологически активными как последовательности, представленные в данном описании.

Как использовано в данном описании «биологически активный» относится к последовательности, имеющей сходную структурную функцию (но не обязательно в такой же степени), и/или сходную регуляторную функцию (но не обязательно в такой же степени) природно встречающейся последовательности.

В частности, вариантные последовательности или их модифицированные формы имеют сходный ферментативный профиль по отношению к профилю фитазы, идентифицированной в данном описании. Этот профиль включает характеристики, такие как у секретируемого белка, имеющего оптимум pH в диапазоне pH 2-5,5; предпочтительно 4,0-4,5 с сохранением, по меньшей мере, 50% максимальной активности по сравнению с pH в диапазоне 2,0-5,5 и/или имеющего специфическую активность свыше 300 U/мг.

Гибридизация

Настоящее изобретение также включает последовательности, которые комплементарны последовательностям нуклеиновой кислоты по настоящему изобретению, или последовательностям, которые способны гибридизироваться либо с последовательностями по настоящему изобретению, либо с последовательностями, которые им комплементарны.

Термин «гибридизация», как использовано в данном описании, будет включать «способ, с помощью которого нить нуклеиновой кислоты соединяется с комплементарной нитью посредством спаривания оснований», а также способ амплификации при выполнении техники полимеразной цепной реакции (ПЦР).

Настоящее изобретение также включает применение нуклеотидных последовательностей, которые способны гибридизироваться с последовательностями, которые комплементарны последовательностям, представленным в данном описании, или любому производному, фрагменту или его производному.

Термин «вариант» также включает последовательности, которые комплементарны последовательностям, которые способны гибридизироваться с нуклеотидными последовательностями, представленными в данном описании.

Предпочтительно термин «вариант» включает последовательности, которые комплементарны последовательностям, которые способны гибридизироваться в жестких условиях (например, 50°C и 0,2×SSC {1×SSC = 0,15 M NaCl, 0,015 M Na3 цитрат, pH 7,0}) с нуклеотидными последовательностями, представленными в данном описании.

Более предпочтительно термин «вариант» включает последовательности, которые комплементарны последовательностям, которые способны гибридизироваться в жестких условиях (например, 65°C и 0,1×SSC {1×SSC = 0,15 M NaCl, 0,015 M Na3 цитрат, pH 7,0}) с нуклеотидными последовательностями, представленными в данном описании.

Настоящее изобретение также относится к нуклеотидным последовательностям, которые могут гибридизироваться с нуклеотидными последовательностями по настоящему изобретению (включая комплементарные последовательности по отношению к тем, что представлены в данном описании).

Настоящее изобретение также относится к нуклеотидным последовательностям, которые комплементарны последовательностям, которые могут гибридизироваться с нуклеотидными последовательностями по настоящему изобретению (включая комплементарные последовательности по отношению к тем, что представлены в данном описании).

Также включенными в объем настоящего изобретения являются полинуклеотидные последовательности, которые способны гибридизироваться с нуклеотидными последовательностями, представленными в данном описании, в условиях промежуточных по отношению к максимальной жесткости.

В предпочтительном аспекте настоящее изобретение охватывает нуклеотидные последовательности, которые могут гибридизироваться с нуклеотидной последовательностью по настоящему изобретению или комплементарны ей в жестких условиях (50°C и 0,2×SSC).

В более предпочтительном аспекте настоящее изобретение охватывает нуклеотидные последовательности, которые могут гибридизироваться с нуклеотидной последовательностью по настоящему изобретению или комплементарны ей в жестких условиях (65°C и 0,1×SSC).

Сайт-направленный мутагенез

После того как фермент-кодирующая нуклеотидная последовательность была выделена и/или очищена, или предполагаемая фермент-кодирующая нуклеотидная последовательность была идентифицирована, может быть желательно мутировать последовательность для того, чтобы приготовить фермент по настоящему изобретению.

Мутации могут быть введены с использованием синтетических олигонуклеотидов. Эти олигонуклеотиды содержат нуклеотидные последовательности, фланкирующие желательные мутационные сайты.

Приемлемый способ раскрыт у Morinaga с сотр. (Biotechnology (1984) 2, p646-649). Другой способ введения мутаций в фермент-кодирующие нуклеотидные последовательности описан у Nelson и Long (Analytical Biochemistry (1989), 180, p 147-151). Другой способ описан у Sarkar и Sommer (Biotechniques (1990), 8, p404-407 - “The megaprimer method of site directed mutagenesis”).

Рекомбинантный

В одном аспекте последовательность для применения по настоящему изобретению представляет собой рекомбинантную последовательность, то есть последовательность, которая была приготовлена с использованием технологий рекомбинантной ДНК.

Эти технологии рекомбинантной ДНК находятся в пределах возможностей средних специалистов в данной области. Такие технологии объяснены в литературе, например, J.Sambrook, E.F.Fritsch и T.Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press.

Синтетический

В одном аспекте последовательность для применения по настоящему изобретению представляет собой синтетическую последовательность, то есть последовательность, которая была приготовлена путем in vitro химического или ферментативного синтеза. Она включает, но не ограничиваясь ими, последовательности, полученные при оптимальном использовании кодонов в организмах-хозяевах, таких как метилотрофные дрожжи Pichia и Hansenula.

Экспрессия ферментов

Нуклеотидная последовательность для применения в настоящем изобретении может быть включена в рекомбинантный реплицируемый вектор. Вектор может быть использован для репликации и экспрессии нуклеотидной последовательности в форме фермента, в и/или вне совместимой клетки-хозяина.

Экспрессия может контролироваться с помощью контролирующих последовательностей, например регуляторных последовательностей.

Фермент, продуцируемый с помощью рекомбинантной клетки-хозяина путем экспрессии нуклеотидной последовательности, может секретироваться или может содержаться внутриклеточно в зависимости от последовательности и/или использованного вектора. Кодирующие последовательности могут быть сконструированы с сигнальными последовательностями, которые усиливают прямую секрецию субстанции кодирующих последовательностей через особую прокариотическую или эукариотическую клеточную мембрану.

Преимущественно ферменты по настоящему изобретению являются секретируемыми.

Экспрессионный вектор

Термины «плазмида», «векторная система» или «экспрессионный вектор» означают конструкцию, способную к in vivo или in vitro экспрессии. В контексте настоящего изобретения эти конструкции могут быть использованы для введения генов, кодирующих ферменты, в клетки-хозяева. Соответственно гены, экспрессия которых вводится, могут называться как «экспрессируемые трансгены».

Предпочтительно экспрессионный вектор встраивают в геном приемлемого организма-хозяина. Термин «встроенный» предпочтительно охватывает стабильное встраивание в геном.

Нуклеотидные последовательности, описанные в данном описании, включают нуклеотидную последовательность по настоящему изобретению, которая может быть представлена в вектор, в котором нуклеотидная последовательность функционально сцеплена с регуляторными последовательностями, способными обеспечить экспрессию нуклеотидной последовательности приемлемым организмом-хозяином.

Векторы для применения в настоящем изобретении могут быть трансформированы в приемлемую клетку-хозяина, как описано ниже, для обеспечения экспрессии полипептида по настоящему изобретению.

Выбор вектора, например плазмидного, космидного или фагового вектора, часто будет зависеть от клетки-хозяина, в которую он должен быть введен.

Векторы для применения по настоящему изобретению могут содержать один или несколько селективных маркерных генов, таких как ген, который определяет резистентность к антибиотикам, например ампициллиновую, канамициновую, хлорамфениколовую или тетрациклиновую резистентность. Альтернативно, отбор может сопровождаться ко-трансформацией (как описано в WO 91/17243).

Векторы могут быть использованы in vitro, например, для продуцирования РНК или использованы для трансфекции, трансформации, трансдукции или инфекции клетки-хозяина.

Так в дальнейшем варианте осуществления изобретение предоставляет способ получения нуклеотидных последовательностей по настоящему изобретению путем введения нуклеотидной последовательности по настоящему изобретению в реплицируемый вектор, введения вектора в совместимую клетку-хозяина и выращивания клетки-хозяина в условиях, вызывающих репликацию вектора.

Вектор может дополнительно включать нуклеотидную последовательность, предоставляющую возможность вектору реплицироваться в данной клетке-хозяине. Примерами таких последовательностей являются области инициации репликации (ori) плазмид pUC19, pACYC177, pUB110, pE194, pAMB1, pIJ101, pTZ12 и pET11.

Регуляторные последовательности

В некоторых областях применения нуклеотидная последовательность для применения в настоящем изобретении функционально сцеплена с регуляторной последовательностью, которая способна обеспечить экспрессию нуклеотидной последовательности, как например, с помощью выбранной клетки-хозяина. Посредством примера настоящее изобретение охватывает вектор, включающий нуклеотидную последовательность по настоящему изобретению, функционально сцепленную с такой регуляторной последовательностью, то есть вектор представляет собой экспрессионный вектор.

Термин «функционально сцепленный» относится к непосредственному соседству, где описанные компоненты находятся в связи, позволяющей им функционировать в своей заданной манере. Регуляторная последовательность, «функционально сцепленная» с кодирующей последовательностью, лигируется таким образом, что экспрессия кодирующей последовательности достигается в условиях, совместимых с контрольными последовательностями.

Термин «регуляторные последовательности» включает промоторы и энхансеры, и другие экспрессионные регуляторные сигналы.

Термин «промотор» применяют в обычном смысле в данной области, например, сайт связывания РНК-полимеразы.

Усиленная экспрессия нуклеотидной последовательности, кодирующей фермент по настоящему изобретению, также может быть достигнута путем отбора гетерологичных регуляторных областей, например промотора, секреционного лидера и терминаторных областей.

Предпочтительно нуклеотидная последовательность в соответствии с настоящим изобретением функционально сцеплена с, по меньшей мере, промотором.

Примеры приемлемых промоторов для контроля транскрипции нуклеотидной последовательности в бактериальных, грибных или дрожжевых хозяевах хорошо известны в данной области.

Конструкции

Термин «конструкция», который синонимичен терминам, таким как «конъюгат», «кассета» и «гибрид», включает нуклеотидную последовательность для применения в соответствии с настоящим изобретением, прямо или опосредованно прикрепленную к промотору.

Пример опосредованного прикрепления обеспечен приемлемой спейсерной группой, такой как интронная последовательность, такая как Sh1-интрон или ADH интрон, интермедиат промотора и нуклеотидная последовательность по настоящему изобретению. То же самое верно для термина «слитый» по отношению к настоящему изобретению, который включает прямое или опосредованное прикрепление. В некоторых случаях термины не охватывают природные комбинации нуклеотидной последовательности, кодирующей белок, обычно ассоциированный с промотором гена дикого типа, и когда они оба находятся в своей природной окружающей среде.

Конструкция может даже содержать или экспрессировать маркер, который допускает отбор генетической конструкции.

Для некоторых областей применения предпочтительно конструкция по настоящему изобретению включает, по меньшей мере, нуклеотидную последовательность по настоящему изобретению, функционально сцепленную с промотором.

Клетки-хозяева

Термин «клетка-хозяин» в отношении к настоящему изобретению включает любую клетку, которая включает или нуклеотидную последовательность, или экспрессионный вектор, как описано выше, и которую применяют для рекомбинантного продуцирования фермента, имеющего специфические свойства, как описано в данном описании, или в способах по настоящему изобретению.

Таким образом, дополнительный вариант осуществления по настоящему изобретению предоставляет клетки-хозяева, трансформированные или трансфицированные нуклеотидной последовательностью, которая экспрессирует ферменты, описанные в настоящем изобретении. Клетки будут выбраны по совместимости с указанным вектором и могут, например, быть прокариотическими (например, бактериальными), грибными, дрожжевыми или растительными клетками. Предпочтительно клетки-хозяева не являются человеческими клетками.

Примерами приемлемых бактериальных организмов-хозяев являются грамположительные или грамотрицательные виды бактерий.

В предпочтительном варианте осуществления клетка-хозяин представляет собой Escherichia coli, так как было отмечено, что фитаза Buttiauxella P1-29 эффективно секретируется в E.coli. Фитазные ферменты, включая варианты, были охарактеризованы после гетерологичной экспрессии в одном или нескольких следующих экспрессионных хозяев: Escherichia coli K12; Bacillus subtilis; Saccharomyces cerevisiae. Эти хозяева поэтому также предпочтительны.

В зависимости от природы нуклеотидной последовательности, кодирующей фермент по настоящему изобретению, и/или желательно для дальнейшего процессинга экспрессируемого белка могут быть предпочтительны эукариотические хозяева, такие как дрожжи или другие грибы. Обычно дрожжевые клетки являются предпочтительными по сравнению с грибными клетками, потому что они являются более легкими для манипулирования. Однако некоторые белки либо недостаточно секретируются из дрожжевых клеток, либо в некоторых случаях не процессируются должным образом (например, гипергликозилирование у дрожжей). В этих примерах другой грибной организм-хозяин должен быть отобран.

Применение приемлемых клеток-хозяев, таких как дрожжевые, грибные и растительные клетки-хозяева, может обеспечить посттрансляционные модификации (например, миристоилирование, гликозилирование, укорочение, перекрывание и фосфорилирование по тирозину, серину и треонину), что может быть необходимо для придания оптимальной биологической активности продуктам рекомбинантной экспрессии по настоящему изобретению.

Клетка-хозяин может быть дефектным по протеазе или не содержащим протеазу штаммом.

Примеры модификаций клетки-хозяина включают дефицит протеазы, добавление редких тРНК и модификацию восстановительного потенциала в цитоплазме для усиления формирования дисульфидной связи.

Например, клетка-хозяин E.coli может избыточно экспрессировать редкие тРНК для улучшения экспрессии гетерологичных белков, как пояснено примером/описано у Kane (Curr Opin Biotechnol (1995), 6, 494-500 "Effects of rare codon clusters on high-level expression of heterologous proteins in E.coli"). Клетка-хозяин может быть дефектна по ряду восстанавливающих ферментов, таким образом, содействуя формированию стабильных дисульфидных связей, как пояснено примером/описано у Bessette (Proc Natl Acad Sci USA (1999), 96, 13703-13708 "Efficient folding of proteins with multiple disulphide bonds in the Escherichia coli cytoplasm").

В одном варианте осуществления клетки-хозяева в контексте настоящего изобретения включают те клетки, которые могут быть добавлены непосредственно в корм для животных.

Организм

Термин «организм» по отношению к настоящему изобретению включает любой организм, который может включать нуклеотидную последовательность, кодирующую ферменты, как описано в настоящем изобретении, и/или продукты, полученные посредством этого, и/или где промотор может допустить экспрессию нуклеотидной последовательности в соответствии с настоящим изобретением, когда присутствует в организме.

Приемлемые организмы могут включать прокариоты, грибы, дрожжи или растения.

Термин «трансгенный организм» по отношению к настоящему изобретению включает любой организм, который включает нуклеотидную последовательность, кодирующую ферменты, как описано в настоящем изобретении, и/или продукты, полученные посредством этого, и/или где промотор может допустить экспрессию нуклеотидной последовательности в соответствии с настоящим изобретением в организме. Предпочтительно нуклеотидную последовательность встраивают в геном организма.

Термин «трансгенный организм» не охватывает нативные нуклеотидные кодирующие последовательности в своей природной окружающей среде, когда они находятся под контролем своего нативного промотора, который также находится в своей природной окружающей среде.

Поэтому трансгенный организм по настоящему изобретению включает организм, включающий любую одну из или комбинации из нуклеотидных последовательностей, кодирующих ферменты, как описано в настоящем изобретении, конструкции в соответствии с настоящим изобретением, векторы в соответствии с настоящим изобретением, плазмиды в соответствии с настоящим изобретением, клетки в соответствии с настоящим изобретением, ткани в соответствии с настоящим изобретением или их продукты.

Например, трансгенный организм также может включать нуклеотидную последовательность, кодирующую фермент по настоящему изобретению под контролем гетерологичного промотора.

Трансформация клеток-хозяев/организма

Как указано ранее, организм-хозяин может быть прокариотическим или эукариотическим организмом. Примеры приемлемых прокариотических хозяев включают E.coli и Bacillus subtilis.

Методики трансформации прокариотических хозяев хорошо описаны в документации в данной области, например, смотри Sambrook с сотр. (Molecular Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor Laboratory Press). Другие приемлемые способы приведены в Примерах в данном описании. Если применяют прокариотического хозяина, тогда нуклеотидную последовательность можно действительно модифицировать до трансформации, как, например, путем удаления интронов.

Клетки нитчатых грибов могут быть трансформированы с использованием различных способов, известных в данной области, таких как способ, включающий формирование протопластов и трансформацию протопластов, за которой следует регенерация клеточной стенки известным способом. Применение Aspergillus в качестве микроорганизма-хозяина описано в EP 0238023.

Другим организмом-хозяином может быть растение. Обзор общепринятых методик, применяемых для трансформированных растений, может быть найден в статьях Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42:205-225) и Christou (Agro-Food-Industry Hi-Tech March/April 1994 17-27). Другие способы трансформации растений могут быть найдены в EP-A-0449375.

Обшепринятые методики трансформации грибов, дрожжей и растений представлены в следующих разделах.

Трансформированные грибы

Организмом-хозяином могут быть грибы, такие как нитчатые грибы. Примеры таких приемлемых хозяев включают любой член, принадлежащий роду Thermomyces, Acremonium, Aspergillus, Penicillium, Mucor, Neurospora, Trichoderma и т.п.

Методики трансформации нитчатых грибов рассмотрены в US-A-5741665, в котором заявляется, что стандартные методики трансформации нитчатых грибов и культивирование грибов хорошо известны в данной области. Обширный обзор методики, применяемой для N. crassa, найден, например, у Davis и de Serres, Methods Enzymol (1971) 17A: 79-143.

Другие методики трансформации нитчатых грибов рассмотрены в US-A-5674707.

В одном аспекте организм-хозяин может относиться к роду Aspergillus, такому как Aspergillus niger.

Трансгенный Aspergillus в соответствии с настоящим изобретением также может быть приготовлен в последующем, например, с помощью методики Turner G. 1994 (Vectors for genetic manipulation. In: Martinelli S.D., Kinghorn J.R. (Editors) Aspergillus: 50 years on. Progress in industrial microbiology vol 29. Elsevier Amsterdam 1994. pp.641-666).

Экспрессия генов в нитчатых грибах была рассмотрена в Punt с сотр. (2002) Trends Biotechnol 2002 May; 20(5):200-6, Archer & Peberdy Crit Rev Biotechnol (1997) 17(4):273-306.

Трансформированные дрожжи

В другом варианте осуществления трансгенным организмом могут быть дрожжи.

Обзор принципов гетерологичной экспрессии генов у дрожжей представлен, например, в Methods Mol Biol (1995), 49:341-54, и Curr Opin Biotechnol (1997) Oct;8(5):554-60.

В этом отношении дрожжи, такие как виды Saccharomyces cerevisi или Pichia pastoris (смотри FEMS Microbiol Rev (2000 24(1):45-66), могут быть использованы в качестве вектора для гетерологичной экспрессии генов.

Обзор принципов гетерологичной экспрессии генов у Saccharomyces cerevisiae и секреции генных продуктов предоставлен E Hinchcliffe E Kenny (1993, "Yeast as a vehicle for the expression of heterologous genes", Yeasts, Vol 5, Anthony H Rose and J Stuart Harrison, eds, 2nd edition, Academic Press Ltd.).

Для трансформации дрожжей были разработаны несколько протоколов по трансформации. Например, трансгенные Saccharomyces в соответствии с настоящим изобретением могут быть приготовлены по следующей методике Hinnen с сотр., (1978, Proceedings of the National Academy of Sciences of the USA 75, 1929); Beggs, J D (1978, Nature, London, 275, 104); и Ito, H et al. (1983, J Bacteriology 153, 163-168).

Трансформированные клетки дрожжей могут быть выбраны с использованием различных селективных маркеров, таких как ауксотрофные маркеры, доминантные маркеры резистентности к антибиотикам.

Трансформированные растения/растительные клетки

Организмом-хозяином, приемлемым для настоящего изобретения, может быть растение. Обзор общепринятых методик может быть найден в статьях Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42:205-225) и Christou (Agro-Food-Industry Hi-Tech March/April 1994 17-27).

Культивирование и продуцирование

Клетки-хозяева, трансформированные нуклеотидной последовательностью по настоящему изобретению, могут быть культивированы в условиях, приводящих к продуцированию кодируемого фермента и которые облегчают выделение фермента из клеток и/или культуральной среды.

Средой, применяемой для культивирования клеток, может быть любая стандартная среда, приемлемая для выращивания данных клеток-хозяев и обеспечения экспрессии фермента.

Белок, продуцируемый рекомбинантной клеткой, может быть представлен на поверхности клетки.

Фермент может быть секретирован из клеток-хозяев и может быть с удобством выделен из культуральной среды с использованием хорошо известных процедур.

Секреция

Может быть желательно для фермента, чтобы он секретировался из экспрессионного хозяина в культуральную среду, где фермент может быть легко выделен. В соответствии с настоящим изобретением лидерная последовательность секреции может быть отобрана на основе желательного экспрессионного хозяина. Гибридные сигнальные последовательности также могут быть использованы в контексте настоящего изобретения.

Типичными примерами гетерологичных лидерных последовательностей секреции являются те, которые происходят от грибного гена амилоглюкозидазы (AG) (glaA - версии из 18 и 24 аминокислот, например, из Aspergillus), гена a-фактора (дрожжи, например, Saccharomyces, Kluyveromyces и Hansenula) или гена α-амилазы (Bacillus).

В качестве примера секреция гетерологичных белков в E.coli рассмотрена в Methods Enzymol (1990) 182:132-43.

Детекция

Ряд протоколов для детекции и измерения экспрессии аминокислотной последовательности известны в данной области. Примеры включают твердофазный иммуноферментный анализ (ELISA), радиоиммунный анализ (RIA) и сортировку клеток с активацией флуоресценции (FACS).

Большое разнообразие меток и конъюгационных методик известны специалистам в данной области, и они могут быть использованы в различных анализах нуклеиновых и аминокислот.

Ряд компаний, таких как Pharmacia Biotech (Piscataway, NJ), Promega (Madison, WI) и US Biochemical Corp (Cleveland, OH), поставляют коммерческие наборы и протоколы для этих процедур.

Приемлемые репортерные молекулы или метки включают радионуклиды, ферменты, флуоресцентные, хемилюминесцентные или хромогенные агенты, а также субстраты, кофакторы, ингибиторы, магнитные частицы и т.п. Патенты, обучающие применению таких меток, включают US-A-3817837; US-A-3850752; US-A-3939350; US-A-3996345; US-A-4277437; US-A-4275149 и US-A-4366241.

Также рекомбинантные иммуноглобулины могут быть продуцированы, как показано в US-A-4816567.

Другие приемлемые анализы для детекции фитазной активности известны в данной области и подтверждены примером в данном описании.

Слитые белки

Аминокислотная последовательность для применения в соответствии с настоящим изобретением может быть продуцирована как слитый белок, например, для облегчения экстракции и очистки. Примеры слитых белковых партнеров включают глутатион-S-трансферазу (GST), 6xHis, GAL4 (ДНК-связывающие домены и/или домены транскрипционной активации) и (β-галактозидазу). Также может быть удобно включить сайт протеолитического расщепления между слитым белковым партнером и желательной белковой последовательностью, чтобы позволить удалять слитые белковые последовательности.

Предпочтительно слитый белок не препятствует активности белковой последовательности.

Системы экспрессии слитых генов в E.coli рассмотрены в Curr Opin Biotechnol (1995) 6(5):501-6.

В другом варианте осуществления по настоящему изобретению аминокислотная последовательность может быть лигирована с гетерологичной последовательностью, кодирующей слитый белок. Например, для скрининга пептидных библиотек на агенты, способные изменять активность субстанции, они могут быть использованы для кодирования химерной субстанции, экспрессирующей гетерологичный эпитоп, который узнается коммерчески доступным антителом.

Дополнительные последовательности

Последовательности для применения в соответствии с настоящим изобретением также могут быть использованы в связи с одним или несколькими дополнительными желательными белками (POI) или нуклеотидными последовательностями (NOI).

Неограничивающие примеры POI включают: ксиланазу, липазы, кислые фосфатазы и/или другие. Они включают ферменты, которые, например, модулируют вязкость корма. NOI даже может быть антисмысловой последовательностью по отношению к любой из этих последовательностей.

POI даже могут быть слитым белком, например, для облегчения экстракции и очистки или усиления in vivo метаболизма фитата.

POI даже могут быть слиты с последовательностью секреции.

Другие последовательности также могут облегчать секрецию или повышать выход секретируемого POI. Такие последовательности могут кодировать шапероновые белки, например, продукт гена cyp B Aspergillus niger, описанный в заявке на патент Великобритании 9821198.0.

NOI, кодирующий POI, может быть сконструирован для того, чтобы изменить его активность по ряду причин, включая, но не ограничиваясь ими, изменения, которые модифицируют процессинг и/или экспрессию его экспрессируемого продукта. Посредством дальнейшего примера NOI также может быть модифицирован для оптимизации экспрессии в определенной клетке-хозяине. Другие изменения последовательности могут быть желательны для того, чтобы ввести сайты узнавания рестрикционных ферментов.

NOI, кодирующий POI, может включать синтетические или модифицированные нуклеотиды, такие как метилфосфонатные и фосфоротиоатные остовы.

NOI, кодирующий POI, может быть модифицирован для усиления внутриклеточной стабильности и времени полужизни. Возможные модификации включают, но не ограничиваясь ими, добавление фланкирующих последовательностей к 5'- и/или 3'-концам молекулы или применение фосфоротиоата или 2'-O-метила скорее чем фосфодиэстеразных связей в остове молекулы.

Антитела

Один аспект настоящего изобретения относится к аминокислотам, которые являются иммунологически реактивными по отношению к аминокислоте SEQ ID No.3.

Антитела могут быть продуцированы с помощью стандартных методик, таких как иммунизация веществом изобретения или путем применения библиотеки фагового дисплея.

Для целей этого изобретения термин «антитело», если только не определено иначе, включает, но не ограничиваясь ими, поликлональные, моноклональные, химерные, одноцепочечные, Fab-фрагменты, фрагменты, продуцированные Fab экспрессионной библиотекой, а также их миметики. Такие фрагменты включают фрагменты цельных антител, которые сохраняют свою связывающую активность для мишенного вещества, Fv, F(ab') и F(ab')2 фрагменты, а также одноцепочечные антитела (scFv), слитые белки и другие синтетические белки, которые включают антиген-связывающий сайт антитела. Кроме того, антитела или их фрагменты могут быть гуманизированными антителами. Нейтрализующие антитела, то есть те, которые ингибируют биологическую активность полипептидов вещества, особенно предпочтительны для диагностики и терапии.

Если поликлональные антитела являются желательными, отобранное млекопитающее (например, мышь, кролик, коза, лошадь и т.п.) иммунизируют последовательностью по настоящему изобретению (или последовательностью, включающей свой иммунологический эпитоп). В зависимости от видов хозяев различные адъюванты могут быть использованы для усиления иммунологического ответа.

Сыворотку от иммунизированного животного собирают и обрабатывают в соответствии с известными процедурами. Если сыворотка, содержащая поликлональные антитела к последовательности по настоящему изобретению (или последовательности, включающей свой иммунологический эпитоп), содержит антитела к другим антигенам, поликлональные антитела могут быть очищены с помощью иммуноаффинной хроматографии. Методики продуцирования и обработки поликлональной антисыворотки известны в данной области. Для того чтобы такие антитела могли быть получены, изобретение также предоставляет полипептиды по изобретению или их фрагменты, гаптенизированные другим полипептидом для применения в качестве иммуногенов у животных или людей.

Моноклональные антитела, направленные против последовательности по настоящему изобретению (или последовательности, включающей свой иммунологический эпитоп), также могут быть легко продуцированы специалистом в данной области и включают, но не ограничиваясь ими, гибридомную методику Koehler и Milstein (1975 Nature 256:495-497), методику гибридом B-клеток человека (Kosbor с сотр., (1983) Immunol Today 4:72; Cote et al., (1983) Proc Natl Acad Sci 80:2026-2030) и методику гибридом на основе вируса Эпштейна-Барр (EBV) (Cole с сотр., (1985) Monoclonal Antibodies and Cancer Therapy, Alan Rickman Liss Inc, pp 77-96).

Кроме того, могут быть использованы методики, разработанные для продуцирования «химерных антител», соединения генов мышиного антитела с генами человеческого антитела для получения молекулы с соответствующей антигенной специфичностью и биологической активностью (Morrison с сотр., (1984) Proc Natl Acad Sci 81:6851-6855; Neuberger с сотр., (1984) Nature 312:604-608; Takeda с сотр., (1985) Nature 314:452-454).

Альтернативно, методики, описанные для продуцирования одноцепочечных антител (патент США №4946779), могут быть адаптированы для продуцирования субстанции специфических одноцепочечных антител.

Антительные фрагменты, которые содержат специфические сайты связывания субстанций, также могут быть генерированы. Например, такие фрагменты включают, но не ограничиваясь ими, F(ab')2 фрагменты, которые могут быть продуцированы путем пепсинового переваривания антительной молекулы и Fab-фрагментов, которые могут быть генерированы путем восстанавления дисульфидных мостиков F(ab')2 фрагментов. Альтернативно, экспрессионные Fab-библиотеки могут быть сконструированы для обеспечения быстрой и легкой идентификации моноклональных Fab-фрагментов с желательной специфичностью (Huse WD с сотр., (1989) Science 256:1275-1281).

Крупномасштабное применение

В одном предпочтительном варианте осуществления по настоящему изобретению аминокислотную последовательность, кодирующую полученную из C.freundii фитазу, или способы по настоящему изобретению используют для крупномасштабного применения. В частности, способы по настоящему изобретению могут быть использованы для крупномасштабного продуцирования фитаз для промышленного применения в качестве дополнений/добавок пищевых и кормовых композиций.

Предпочтительно аминокислотную последовательность продуцируют в количестве от 5 г на литр до примерно 10 г на литр общего объема клеточной культуры после культивирования организма-хозяина.

Предпочтительно аминокислотную последовательность продуцируют в количестве от 100 г на литр до примерно 900 г на литр общего объема клеточной культуры после культивирования организма-хозяина.

Предпочтительно аминокислотную последовательность продуцируют в количестве от 250 г на литр до примерно 500 г на литр общего объема клеточной культуры после культивирования организма-хозяина.

Применение фитаз

Как установлено выше, настоящее изобретение также относится к продуцированию фитаз, как описано в данном описании.

В частности, настоящее изобретение также относится к применению аминокислотных последовательностей, как раскрыто в данном описании, для продуцирования органических и неорганических фосфатных соединений.

Таким образом, настоящее изобретение далее относится к нуклеотидным последовательностям, кодирующим фитазы в генерирующих экспрессионных векторах или системах экспрессии фитаз.

Кроме того, настоящее изобретение относится к применению таких экспрессионных векторов или систем в генерации клеток-хозяев, которые экспрессируют фитазы.

Изобретение дополнительно относится к применению модифицированных клеток-хозяев для генерации предшественников органических и неорганических фосфатных соединений или для генерации специфических органических фосфатных соединений.

Приемлемые органические и неорганические фосфатные соединения включают мио-инозитпентакис-, тетракис-, трис-, бис- и монофосфаты.

Соответственно изобретение далее предоставляет способ продуцирования соединения органического фосфата, включающий в себя: обработку фитата фитазой, полученной из Buttiauxella sp. Предпочтительно способ характеризуется тем, что фермент включает аминокислотные последовательности, показанные в SEQ ID NO:3, или последовательности, имеющие, по меньшей мере, 75% идентичности (гомологии) с ними, или эффективный фрагмент, или ее модифицированную форму. Соответственно органический фосфат представляет собой фитат или все возможные стереоизомеры мио-инозитди-, три-, тетра- и пентафосфатов. Другие приемлемые органические фосфаты включают инозиттетрафосфаты и инозитолигофосфаты. В предпочтительном варианте осуществления способ представляет собой in vivo биотехнологический способ.

Такие способы продуцирования соединения органического фосфата могут соответственно включать стадии:

а) предоставление клетки-хозяина, которая включает экспрессирующиеся трансгены, включающие фитазу Buttiauxella sp.;

b) культивирование трансгенного организма в условиях, приемлемых для экспрессии трансгена; и

c) выделение соединения органического фосфата из культуры.

Соединения могут быть использованы в ряде областей применения, включая способы характеристики фитаз. Некоторые инозитфосфаты участвуют в качестве сигнальных молекул во внутриклеточной регуляции и могут быть использованы для исследования химических соединений.

В другом аспекте предоставляется способ продуцирования продуктов питания или корма для животных. Корм для животных обычно продуцируют на комбикормовых заводах, в которых сырье сначала измельчают до приемлемого размера частиц и затем смешивают с соответствующими приправами. Корм может быть затем получен в виде пюре или гранул; последнее обычно включает способ с помощью которого температуру повышают до определенного уровня и затем корм процеживают с образованием гранул определенного размера. Затем жидкие добавки, такие как жир и фермент, могут быть добавлены. Гранулы допускается охладить перед транспортировкой. Получение корма для животных может также включать дополнительную стадию, которая включает экструдирование или вспенивание перед гранулированием.

Соответственно изобретение дополнительно предоставляет применение аминокислотной последовательности, кодирующей фитазу, или клетку-хозяина, экспрессирующую фитазу, для продуцирования фитазы с целью использования для производства продуктов питания или корма. В одном аспекте предоставляется применение аминокислотной последовательности, как описано в данном описании, для производства продуктов питания или корма. В другом аспекте предоставляется применение клетки-хозяина в соответствии с изобретением для производства продуктов питания или корма. В другом аспекте предоставляется применение экспрессионного вектора или системы в соответствии с настоящим изобретением для производства продуктов питания или корма.

Настоящее изобретение также охватывает применение ферментов в качестве компонента кормовых комбинаций с другими компонентами для доставки животным.

Комбинация с другими компонентами

Ферменты по настоящему изобретению могут быть использованы в комбинации с другими компонентами или носителями.

Приемлемые носители кормовых ферментов включают пшеницу (грубозернистую). Кроме того, существует ряд методик инкапсулирования, включая те, которые основаны на покрытии жиром/воском, добавлении растительных камедей и т.д.

Примеры других компонентов включают один или несколько: загустителей, гелеобразователей, эмульгаторов, связующих веществ, кристаллических модификаторов, подслащивающих веществ (включая искусственные подслащивающие вещества), реологических модификаторов, стабилизаторов, антиоксидантов, красителей, ферментов, носителей, переносящих средств, эксципиентов, разбавителей, замасливающих агентов, ароматизирующих агентов, природных красителей, суспендирующих агентов, дезинтегрантов, связующих гранулы веществ и т.д. Эти другие компоненты могут быть природными. Эти другие компоненты могут быть приготовлены с помощью химических и/или ферментативных методик.

Как использовано в данном описании, термин «загуститель или гелеобразующий агент», как использовано в данном описании, относится к продукту, который предотвращает сепарацию путем замедления или предотвращения движения гранул либо каплями несмешивающихся жидкостей, воздухом, либо нерастворимыми твердыми частицами.

Термин «стабилизатор», как использовано в данном описании, определяется как ингредиент или комбинация ингредиентов, которые сохраняют продукт (например, пищевой продукт) от изменения с течением времени.

Термин «эмульгатор», как использовано в данном описании, относится к ингредиенту (например, ингредиенту продукта питания), который предотвращает сепарацию эмульсий.

Как использовано в данном описании, термин «связующее вещество» относится к ингредиенту (например, пищевому ингредиенту), который связывает продукт вместе посредством физической или химической реакции.

Термин «кристаллический модификатор», как использовано в данном описании, относится к ингредиенту (например, пищевому ингредиенту), который влияет на кристаллизацию либо жира, либо воды.

«Носители» или «переносящие средства» означают материалы, приемлемые для введения соединения и включают любой такой материал, используемый в данном описании, как, например, любую жидкость, гель, растворитель, жидкий разбавитель, ожижающий агент или т.п., который является нетоксичным и который не взаимодействует с любыми компонентами композиции вредным образом.

Примеры пищевых допустимых носителей включают, например, зерно, воду, солевые растворы, этанол, силикон, воски, вазелин, растительные масла и т.п.

Примеры эксципиентов включают один или несколько: микрокристаллическую целлюлозу и другие целлюлозы, лактозу, натрия цитрат, кальция карбонат, двухосновной фосфат кальция, глицин, крахмал, молочный сахар и высокомолекулярные полиэтиленгликоли.

Примеры дезинтегрантов включают один или несколько: крахмал (предпочтительно кукурузный, картофельный или маниоковый), натрий гликолат крахмала, кросскармелозу натрия и определенные комплексы силикатов.

Примеры связующих гранулы веществ включают один или несколько: поливинилпирролидон, гидроксипропилметилцеллюлозу (HPMC), гидроксипропилцеллюлозу (HPC), сахарозу, мальтозу, желатин и гуммиарабик.

Примеры замасливающих агентов включают один или несколько: магния стеарат, стеариновую кислоту, глицерил бегенат и тальк.

Примеры разбавителей включают один или несколько: воду, этанол, пропиленгликоль и глицерин, и их комбинации.

Другие компоненты могут быть использованы одновременно (например, когда они подмешиваются вместе или когда они доставляются различными путями) или последовательно (например, они могут быть доставлены различными путями).

Как использовано в данном описании, термин «компонент, приемлемый для потребления животным и человеком» означает соединение, которое является или может быть добавлено в композицию по настоящему изобретению как добавка, которая может быть выгодна в пищевом отношении, заменяет клетчатку или имеет общий благоприятный эффект на потребителя.

В качестве примера компоненты могут быть пребиотиками, такими как альгинат, ксантин, пектин, смола плодоворожкового дерева (LBG), инулин, гуаровая камедь, галактоолигосахарид (GOS), фруктоолигосахарид (FOS), лактосахароза, соевые олигосахариды, палатиноза, изомальтоолигосахариды, глюкоолигосахариды и ксилоолигосахариды.

Пищевое и кормовое вещество

Соединения могут быть использованы как или для приготовления пищевого или кормового вещества. В данном описании термин «продукт питания» применяется в широком смысле и охватывает пищу и продукты питания для людей, а также пищу для животных (то есть корм). Термин «корм» применяют в отношении к продуктам, которые скармливают животным при выращивании домашнего скота. В предпочтительном аспекте продукт питания или корм служит для потребления моногастрическими животными, такими как свинья, домашняя птица и рыба.

Продукт питания или корм может быть в форме раствора или твердого вещества в зависимости от использования и/или способа применения.

Пищевые и кормовые ингредиенты и добавки

Соединения могут быть использованы в качестве пищевого или кормового ингредиента.

Как использовано в данном описании, термин «пищевой или кормовой ингредиент» включают состав, который служит или может быть добавлен в качестве продуктов питания или кормов и включает составы, которые могут быть использованы в небольших количествах в широком круге продуктов.

Пищевой ингредиент может быть в форме раствора или твердого вещества, в зависимости от использования и/или способа применения, или способа введения.

Соединения могут быть или могут быть добавлены к пищевым добавкам.

Пищевые и кормовые композиции

Кормовые составы для моногастрических животных обычно включают композиции, включающие растительные продукты, которые содержит фитат. Такие композиции включают кукурузную муку, соевую муку, шрот из экстрагированных семян рапса, кормовую муку из жмыха семян хлопчатника, кукурузу, пшеницу, ячмень и основанные на сорго корма.

Фитазы, описанные в данном описании, могут быть или могут быть добавлены в продукты питания или кормовые вещества и композиции.

Настоящее изобретение также предоставляет способ приготовления пищевого или кормового ингредиента или добавки, способ включает подмешивание фитаз, продуцированных с помощью способа по настоящему изобретению или композиции в соответствии с настоящим изобретением, к другому пищевому ингредиенту. Способ приготовления или пищевой ингредиент также представляют другой аспект по настоящему изобретению. Способы приготовления корма для животных представлены выше. Фермент может быть добавлен в форме твердого состава или как кормовая добавка, такая как премикс. Твердую форму обычно добавляют до или в течение стадии смешивания; и жидкую форму обычно добавляют после стадии гранулирования.

Фармацевтический препарат

Фитазы по настоящему изобретению также могут быть использованы в фармацевтических препаратах или для комбинации в продуктах питания для того, чтобы обеспечить определенный фармацевтический эффект. Например, EP 1389915 описывает применение фитазы в пище и напитке для повышения доступности кальция, железа и/или цинка пищи или напитка для людей.

Кроме того, EP 1392353 описывает лекарственное средство или пищевую добавку, содержащую фитазу, которую используют для усиления биодоступности биоэлементов, например кальция, железа, и для борьбы с заболеваниями, вызванными нехваткой факторов питания.

В данном описании термин «фармацевтический препарат» применяется в широком смысле и охватывает фармацевтические препараты и/или нутрицевтики для людей, а также фармацевтические препараты и/или нутрицевтики для животных (то есть ветеринарная область применения). В предпочтительном аспекте фармацевтический препарат служит для использования человеком и/или в качестве фармацевтического препарата для сельскохозяйственных животных.

Фармацевтический препарат может служить для терапевтических целей, которые могут быть лечебными, паллиативными или профилактическими по природе.

При использовании как или для приготовления фармацевтического препарата, продукт и/или соединения по настоящему изобретению могут быть использованы в связи с одним или несколькими: фармацевтически приемлемым носителем, фармацевтически приемлемым разбавителем, фармацевтически приемлемым эксципиентом, фармацевтически приемлемым адъювантом, фармацевтически приемлемым ингредиентом.

Фармацевтический препарат может быть в форме раствора или твердого вещества в зависимости от использования и/или способа применения, и/или способа введения.

Фармацевтический ингредиент

Продукт и/или соединения по настоящему изобретению могут быть использованы как фармацевтические ингредиенты. В данном описании продукт и/или композиция по настоящему изобретению могут быть единственно активным компонентом или могут быть, по меньшей мере, одним из ряда (то есть 2 или более) активных компонентов.

Фармацевтический ингредиент может быть в форме раствора или твердого вещества в зависимости от использования и/или способа применения, и/или способа введения.

Фармацевтический ингредиент может быть в форме шипучего продукта для улучшения растворяющих свойств фармацевтического препарата.

Формы

Продукт и/или соединения по настоящему изобретению могут быть использованы в любой приемлемой форме, или отдельно или когда присутствуют в композиции. Подобным образом фитазы, продуцированные в соответствии с настоящим изобретением (то есть ингредиенты, такие как пищевые ингредиенты, функциональные пищевые ингредиенты или фармацевтические ингредиенты), могут быть использованы в любой приемлемой форме.

Соответствующие примеры форм включают одну или несколько: таблетки, пилюли, капсулы, суппозитории, растворы или суспензии, которые могут содержать ароматизирующие или окрашивающие агенты для прямого, замедленного, модифицированного, пролонгированного, пульсирующего применения или для применения с контролируемой скоростью высвобождения.

В качестве примера, если продукт и/или композицию применяют в таблетированной форме, как для применения в качестве функционального ингредиента, таблетки также могут содержать один или несколько: эксципиентов, дезинтегрантов, связывающих гранулы веществ и замасливающих агентов.

Примеры нутритивно доступных носителей, используемых для приготовления форм, включают, например, воду, солевые растворы, этанол, силикон, воски, вазелин и т.п.

Предпочтительные эксципиенты для форм включают лактозу, крахмал, целлюлозу, молочный сахар или высокомолекулярные полиэтиленгликоли.

Для водных суспензий и/или эликсиров расщепляющие каротиноиды соединения могут быть скомбинированы с различными подслащивающими или ароматизирующими агентами, пищевыми красителями или красителями, с эмульгирующими и/или суспендирующими агентами и с разбавителями, такими как вода, этанол, пропиленгликоль и глицерин и их комбинации.

Формы также могут включать желатиновые капсулы; волокнистые капсулы; волокнистые таблетки и т.п.

Общие методики методологии рекомбинантной ДНК

Настоящее изобретение применяет, если не указано иное, общепринятые методики химии, молекулярной биологии, микробиологии, рекомбинантной ДНК и иммунологии, которые находятся в пределах возможностей средних специалистов в данной области. Такие технологии объяснены в литературе. Смотри, например, J.Sambrook, E.F.Fritsch и T.Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F.M. с сотр. (1995 и периодические приложения; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B.Roe, J.Crabtree и A.Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; M.J.Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, Irl Press; и, D.M.J.Lilley и J.E.Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Каждый из этих общих текстов включен в данное описание посредством ссылки.

ПРИМЕРЫ

Теперь изобретение далее иллюстрирует следующие неограниченные примеры.

Пример 1. Анализ фитазной активности

Микро-л = микролитр

Фитазные анализы выполняли в чашках для микротитрования. Реакционная смесь (100 микро-л) содержала 2 мМ фитата и 0,8 мМ CaCl2 в 200 мМ натрий ацетатного буфера, pH 3,5. Реакция предусматривала обработку в течение 1 ч при 37°C, после которой время освобождения фосфата измеряли путем улучшения известной методики (Heinonen J.K., Lahti R.J. Anal Biochem. 113 (2), 313-317 (1981)). Вкратце, 200 микро-л свежеприготовленного раствора AMM (7,5 N H2SO4, 15 мМ аммония молибдата и ацетона - 1:1:2) добавляли к 100 микро-л реакционной смеси в каждую ячейку чашки для микротитрования. Абсорбцию при 390 нм измеряли не ранее чем через 10 мин и не позднее чем через 30 мин после добавления реагента AMM. Количество фосфата определяли путем построения калибровочной кривой с фосфатными растворами известных концентраций. Для анализа фитазной активности при различных значениях pH использовали следующие (все по 200 мМ) буферы: глицин/HCl между pH 2,0 и 3,0; натрий ацетат/уксусная кислота между pH 3,5 и 5,5; Трис/малеиновая кислота между pH 6,0 и 7,5.

Пример 2. Фитаза-продуцирующий штамм P1-29

Бактериальный штамм P1-29 первоначально выделили из массы разлагающегося растительного материала, собранного со дна лужи в лесу южной Финляндии. Штамм можно было аэробно культивировать при 30°C на многих простых культуральных средах, например, LB (1% пептон, 0,5% дрожжевой экстракт, 1% NaCl, pH 7,4) или среде с низким содержанием фосфата PP1 (1% пептон, 1%, мясной экстракт, 0,5% дрожжевой экстракт, CaCl2 - 0,2M). Среду готовили путем доводки pH до примерно 11 посредством NaOH и кипячения в течение 10 мин. Осадок удаляли путем фильтрования, pH повторно доводили до 5,5 и среду стерилизовали путем автоклавирования 15 мин при 121°C).

После выращивания в жидкой среде PP1 было найдено, что штамм проявляет фитазную активность как при pH 3,5, так и при 5,5 (анализировали, как описано в Примере 1). Отношение активностей при 3,5 и 5,5 составляло около 1,3. Активность также измеряли отдельно в клетках и культуральном супернатанте P3-42. В соответствии с этими измерениями большая часть всей фитазной активности была клеточно-связанной с 10-20% активности, найденой в супернатанте культуральной среды.

Штамм депонирован NCIMB под инвентарным № 41248.

Пример 3. Выделение хромосомной ДНК из штамма P1-29

Хромосомную ДНК готовили, в основном, с помощью стандартной методики (Ausubel с сотр., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1996). 250 мл культуры, выращенной в течение ночи при 30°C в среде LB, центрифугировали при 10000 об/мин в течение 30 мин, промывали в 20 мл 50 мМ трис-HCl, 5 мМ ЭДТА, pH 8 и ресуспендировали в 10 мл холодного TES (50 мМ трис-HCl, 5 мМ ЭДТА, 15 % глюкозы, pH 8). Лизосомы добавляли к 10 мг/мл и клеточную суспензию инкубировали при 37°C в течение 30-60 мин до прохождения лизиса, выявленного путем разбавления 100 микро-л реакционной смеси в 1 мл 1% SDS и проверки «слизистой» консистенции. В это время SDS и Протеиназу K (Sigma) добавляли к конечной концентрации 1% и 0,5 мг/мл соответственно. Реакционную смесь инкубировали в течение 30 мин при 56°C с последующим добавлением 2 мл 5 M NaCl и 1,4 мл 10% цетилтриметиламмоний бромида (Sigma). Инкубацию продолжали 15 мин при 65°C. Раствор экстрагировали однократно хлороформом/изоамиловым спиртом (24:1) и однократно фенолом/хлороформом. После экстракций водную фазу смешивали с 0,6 объемом изопропанола, осадок ДНК собирали путем центрифугирования (10000 об/мин, 15 мин), промывали 70% этанолом, сушили вакуумом и ресуспендировали в 2 мл 10 мМ трис-HCl, 1 мМ ЭДТА, pH 8, 5 микро-г/мл РНКазы.

Пример 4. Таксономическая идентификация бактериального штамма P1-29

Фрагмент гена 16S рРНК штамма P1-29 амплифицировали посредством полимеразной цепной реакции (ПЦР) с Taq ДНК-полимеразой (Roche) с использованием праймеров: 536f (CAGCMGCCGCGGTAATWC) и 1392r (ACGGGCGGTGTGTRC), (Lane, D.J. In Nucleic acid techniques in bacterial systematics, Stackbrandt, E. and Goodfellow, M. eds, John Wiley & Sons, New York: pp 115-117 (1991)). Была использована следующая программа: 1) начальная стадия денатурации ДНК 5 мин при 95°C; 2) 30 циклов по 1 мин при 94°C, 1 мин при 55°C, 1 мин при 72°C; 3) конечная стадия достройки при 70°C в течение 10 мин. ПЦР-продукты размером примерно 900 пар оснований очищали с помощью электрофореза в 0,8% агарозном геле и экстрагировали из геля с использованием Gel Purification Kit (Qiagen) согласно инструкциям изготовителя. Очищенные ПЦР-продукты секвенировали посредством Medprobe (Norway) как коммерческой службы. Секвенированная область приведена в SEQ ID No.1. Эту последовательность сравнили с ДНК-последовательностями базы данных GenBank (http://www.ncbi.nlm.nih.gov/blast/). Наивысшие совпадения (688-689 из 691 нуклеотида, 99,6-99,7%) были найдены с последовательностями гена 16S РНК из нескольких штаммов Buttiauxella, таких как B.izardii DSM 9397, B.gaviniae DSM 9393 и B.noackiae ATCC 51607T. Поэтому штамм P1-29 можно было таксономически классифицировать как Buttiauxella sp.

Пример 5. Клонирование фитазного гена Buttiauxella sp. P1-29

Хромосомная ДНК Buttiauxella sp. P1-29 частично была расщеплена рестрикционной эндонуклеазой Sau3A и продукт расщепления фракционировали в 1% агарозном геле. Фрагменты ДНК 3-5 т.п.н. выделяли из геля с использованием Purification Kit (Qiagen) и лигировали с BamHI-расщепленными дефосфорилированными лямбда-ZAP плечами (Stratagene). В последующих стадиях для конструирования библиотеки следовали инструкциям Stratagene's ZAP Express Predigested Vector/Gigapack Cloning Kit. Фаговую форму библиотеки превратили в плазмидную форму путем процедуры «массовой эксцизии», как описано изготовителем (Stratagene). Скрининг плазмидной библиотеки проводили аналогично ранее опубликованным способам детекции фитазной активности на чашках Петри (Howson and Davis. Enzyme Microb. Technol. 5, 377-382 (1983); Chen J.C. Biotechnology techniques 12 (10) 751-761 (1998); Riccio M.L. с сотр., J. Appl. Microbiol. 82, 177-185 (1997)). Несколько фитаза-позитивных клонов выделяли и очищали посредством субклонирования. Эти изоляты выращивали в жидкой культуральной среде (среда LB при 30°C и 200 об/мин в течение 24 ч) и измеряли фитазную активность (Пример 1) в конечных клеточных суспензиях. Один клон, который имел наивысшую фитазную активность, (около 1,2 U/мл при pH 3,5) отобрали для дальнейшей характеристики. Плазмидную ДНК, выделенную из этого клона, обозначили pBK(P1-29) и анализировали путем частичного ДНК-секвенирования вставочной ДНК (услуги по секвенированию получили от Medprobe (Norway)). Последовательность, включающая фитазный ген, приведена в SEQ ID No:2. Выведенная последовательность фитазы Buttiauxella sp. P1-29 приведена в SEQ ID No:3. Сравнение SEQ ID No:3 с последовательностями в GenBank с использованием BLAST-сервиса, предоставленного NCBI (http://www.ncbi.nlm.nih.gov/blast/), идентифицировало фитазу Obesumbacterium proteus (GenBank, инвентарный № AAQ90419) как наиболее близкий гомолог фитазы Buttiauxella sp. P1-29. Однако уровень гомологии несколько ниже - только около 74% аминокислотных остатков являются идентичными у обоих белков.

Пример 6. Амплификация и экспрессия фитазного гена Buttiauxella sp. P1-29

Фитазный ген амплифицировали с помощью ПЦР. Хромосомную ДНК штамма P1-29 Buttiauxella sp. использовали в качестве матрицы и олигонуклеотиды o29-5 (GGAATTCATATGACGATCTCTGCGTTTAAC) и o29-3 (GGAATTCGGATCCTTA-CTGTAGCTGGCAGCCTG) в качестве праймеров. Амплификацию выполняли с использованием Expand High Fidelity PCR System kit (Roche). Применяли следующую программу: 1) первоначальная денатурация ДНК 3 мин при 94°C; 2) 35 циклов по 45 сек при 94°C, 45 сек при 55°C, 1 мин при 68°C, 1 мин при 72°C, 1 мин при 74°C; 3) конечная стадия достройки 10 мин при 72°C. Конечный ПЦР-продукт очищали посредством электрофореза в 0,8% агарозном геле с последующей экстракцией ДНК из геля с использованием Gel Purification Kit (Qiagen). Очищенный ПЦР-продукт расщепляли рестрикционными ферментами NdeI и BamHI и выделяли из реакционной смеси с помощью PCR Purification Kit (Qiagen). Векторную плазмиду pET11a (Novagen) расщепляли рестрикционными эндонуклеазами NdeI и BamHI, дефосфорилировали с использованием щелочной фосфатазы креветки (Roche) и очищали электрофорезом в 0,8% агарозном геле. Полоску линейной плазмидной ДНК вырезали из геля и очищали с использованием Gel Purification Kit (Qiagen). Два очищенных фрагмента ДНК лигировали с использованием ДНК-лигазы фага T4 (Roche). Реакцию лигирования осаждали 70% этанолом, промывали этанолом и ресуспендировали непосредственно в 50 микро-л клеток электрокомпетентной E. coli XL1-Blue MRFґ. Суспензию переносили в 0,1 см кювету для электропорации (BioRad) и электропорировали с использованием Gene Pulser Xcell (BioRad) с установленными значениями 1800 V, 25 мкФ и 200 Ом. Немедленно после электропорации добавляли 1 мл среды LB, клеточную суспензию переносили в пластиковые пробирки на 15 мл (Falcon) и инкубировали при 37°C со встряхиванием (200 об/мин) 1 ч. Трансформированные клетки высевали на чашки Петри со средой LB, содержащей 100 микро-г/мл и инкубировали в течение ночи при 37°C. 24 трансформанта выращивали в жидкой культуре, и культуры использовали для анализа фитазной активности и изоляции плазмидной ДНК. Отобрали один клон, продуцирующий наивысшую фитазную активность и генерирующий ожидаемый рестрикционный паттерн плазмидной ДНК. Плазмиду, содержащуюся в этом клоне, обозначенную pET11(P1-29), использовали для трансформации экспрессионного штамма-хозяина BL21(DE3)pLysS (Novagen). Трансформированную клеточную суспензию встряхивали 1 ч при 37°C в LB, содержащей 2 % глюкозы и инокулировали в 50 мл LB, содержащей ампициллин (100 микро-г/мл) и глюкозу (2%) и выращивали в течение ночи при 30°C со встряхиванием (200 об/мин). OD полученной культуры измеряли при 600 нм и культуру использовали для инокуляции 1 л LB + ампициллин (100 микро-г/мл) при OD600 0,04. Рост продолжался в течение ночи при 30°C. Фитазная активность в таких культурах обычно составляла 8-12 U/мл. Примерно 40% фитазной активности секретировалось в культуральную среду и остальная активность оставалась ассоциированной с клетками. Эти наблюдения показали, что фитаза Buttiauxella P1-29, секретируемая в E.coli, до некоторой степени более эффективна, чем в своем нативном хозяине. Активность в культуре контрольного штамма BL21(DE3)pLysS, трансформированного pET11, выращенного в тех же условиях, была ниже 0,05 U/мл.

Пример 7. Очистка рекомбинантной фитазы Buttiauxella sp. P1-29

Культуру BL21(DE3) pLysS, трансформированную pET11(P1-29), центрифугировали для удаления бактериальных клеток, концентрировали с использованием роторного испарителя до примерно 1/10 первоначального объема и диализировали против воды до проводимости раствора, сниженной ниже 250 микро-S/см. pH раствора доводили до 8,0 с помощью трис основного и вносили в колонку (3x20 см) DEAE Sepharose Fast Flow (Roche), уравновешенную 25 мМ трис-HCl, pH 8,0. Колонку промывали уравновешивающим буфером со скоростью потока 3 мл/мин в течение 30 мин с последующим элюированием с тремя последовательными градиентами NaCl в 25 мМ трис-HCl, pH 8,0: 0-50 мМ, 50-150 мМ и 150-500 мМ. Каждый из трех градиентов программировали на 1 ч с постоянной скоростью потока 3 мл/мин. 9 мл фракций собирали и анализировали на фитазную активность. Детектировали один резко выраженный пик активности. Белок фракции пика концентрировали с использованием концентраторов Centriplus (Amicon) и анализировали в SDS PAGE с использованием 12% геля и стандартной буферной системы Лэммли. Результаты этого анализа показали, что препарат рекомбинантной фитазы Buttiauxella P1-29, полученный с помощью DEAE Sepharose, содержит один заметный белковый компонент. Полуколичественный анализ, основанный на сканировании цифрового изображения геля (Фиг.1), показывает чистоту примерно 65%.

Пример 8. Профиль pH рекомбинантной фитазы Buttiauxella P1-29

Зависимость активности фитазы Buttiauxella P1-29 (очищенной в соответствии с Примером 7) от pH исследовали в буферах и в условиях, описанных в Примере 1. Фермент проявил активность в широком диапазоне pH (2-5,5) с максимумом около pH 4,5 и сильным «плечом» кривой около pH 3 (Фиг. 2).

Пример 9. Субстратная специфичность рекомбинантной фитазы Buttiauxella P1-29

Фракции инозитфосфатов, содержащие три, четыре или пять фосфатов на остаток инозита, выделяли с помощью ионообменной хроматографии из частичного гидролизата фитиновой кислоты, обработанной грибной фитазой (Natuphos). Продуцирование и очистка этих препаратов были проведены коммерческой службой BioChemis Ltd (Санкт-Петербург, Россия). Загрязнение каждой фракции инозитфосфатами, имеющими различную степень фосфорилирования, составляло менее чем 5% как оценили с помощью HPLC (высокоэффективной жидкостной хроматографии) (Sandberg A.S., Ahderinne R. J. Food Sci. 51 (3), 547-550). Коммерческие фруктозо-1,6-дифосфат и фруктозо-6-фосфат (Sigma) использовали в качестве модельных субстратов, применяемых для оценки специфичности фитазы Buttiauxella P1-29 по отношению к ди- и монофосфатным субстратам. Активность фитазы Buttiauxella, очищенной в соответствии с Примером 7, с различными субстратами измеряли с помощью стандартного способа (Пример 1) при pH 3,5 с использованием 2 мМ концентраций субстратов в конечной реакционной смеси. Результаты (Фиг. 3) показывают, что фермент имеет крайне широкую субстратную специфичность. Его активность с пента-, тетра- и трифосфатами была, в основном, равной или слегка повышенной чем активность с фитиновой кислотой как субстратом. Даже фруктозо-1,6-дифосфат - слабый субстрат для большинства фитаз, более эффективно гидролизовался фитазой Buttiauxella sp (в частности, фитазой, полученной из P1-29). Гидролиз фруктозо-6-фосфата также детектировался, хотя и менее эффективный, чем гидролиз других тестированных субстратов.

Пример 10. Специфическая активность рекомбинантной фитазы Buttiauxella P1-29

Специфическую активность фитазы Buttiauxella P1-29 оценивали с использованием очищенного препарата в соответствии с Примером 7. Фитазную активность измеряли при pH 3,5 в соответствии с Примером 1. Фитазную концентрацию расчитывали путем измерения общей белковой концентрации с помощью BCA Protein Assay Kit (Pierce) и корректировали ее путем оценки содержания фитазы с помощью SDS PAGE (Пример 7). В соответствии с этими измерениями специфическая активность рекомбинантной фитазы Buttiauxella P1-29 составляет примерно 300 U/мг при 37°C.

Пример 11. Генерация и характеристика фитазных вариантов

Фитазные варианты сконструировали посредством мутагенеза нуклеотидной последовательности SEQ ID No.2 с использованием способов мутагенеза, как перечислено выше, таких как способы, раскрытые у Morinaga с сотр. (Biotechnology (1984) 2, p 646-649) или у Nelson и Long (Analytical Biochemistry (1989), 180, p 147-151), или в Error Threshold Mutagenesis protocol, описанном в WO 92/18645. Другой приемлемый способ мутагенной ПЦР раскрыт Cadwell и Joyce (PCR Methods Appl. 3(1994), 136-140).

Фитазные варианты охарактеризовали после гетерологичной экспрессии в одном или нескольких следующих экспрессионных хозяев: Escherichia coli K12; Bacillus subtilis; Saccharomyces cerevisiae.

Были получены фитазные варианты, которые отличаются по одной или нескольким аминокислотным положениям из SEQ ID No.3, включая два положения, три положения, четыре положения, пять положений, шесть положений, семь положений, восемь положений, девять положений, десять положений, одинадцать положений, двенадцать положений. Были выполнены соответствующие поворяющиеся раунды мутагенеза, как описано в данном описании.

Характеристика фитазных вариантов

1. Термостабильность

Термостабильность таких вариантов охарактеризовали с помощью температуры инактивации фермента. Температуру инактивации определяли посредством измерения остаточной активности и последующего охлаждения до комнатной температуры. Температура инактивации представляет собой температуру, при которой остаточная активность составляет 50% по сравнению с остаточной активностью после инкубации то же самое время в тех же условиях при комнатной температуре. Были сделаны соответствующие интерполяции и экстраполяции на основе измеренной активности для того, чтобы определить температуру, соответствующую 50% остаточной активности. Различия термостабильности в °C расчитали путем вычитания температур инактивции двух ферментов друг из друга.

В Таблице 1 перечислены различия в термостабильности для разных вариантов:

Таблица 1
Различия в термостабильности (TD) для вариантов, полученных из исходной фитазы, показанной в Seq ID No.3
Вариант T.D.
K59E 2,5
T167V 2,5
K240T 2,1
T167I 3,0
K240E 3,3
D244C 4,2
Q289Y 4,4
T209K 1,8
F197S 1,0
D125E/H193R 1,5
A294E/N303K 3,5
T167I/K240T 4,1
D223E/K240E/N351D 2,7
T167I/K240T/A294E/N303K 6,1
T167I/K240E/A242S/A294E/N303K 8,2
A122T/T167I/F197S/T209K/A211P/K240E/A294E/N303K 11,5
A122T/T167I/F197S/T209K/A211P/K240E/A242S/S281L/Q289Y/A294E/N303K 15,2
A122T/D125E/H193R/F197S/T209K/A211P/S221N/G225A/K240E/A294E/N303K 12,0
D125E/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K 16,5
A122T/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K/I336F 17,7
N70Y/D125E/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K 20,2

2. Другие характеристики

Другие характеристики также были улучшены.

Термостабильность, специфическая активность и стабильность к пепсину отобранных вариантов сравнивали с использованием анализов, как описано выше. Стабильность к пепсину таких вариантов охарактеризовали с помощью остаточных активностей, измеренных при pH 3,5; 37°C после инкубации с пепсином по сравнению с контрольными условиями (остаточная активность = активности после инкубации с пепсином/активности после инкубации в контрольных условиях). Инкубацию с пепсином выполняли в течение 2 часов при pH 2,0; 0,25 мг/мл пепсина, 1 мМ CaCl2 и 5 мг/мл BSA при 37°C. Контрольными условиями были 2 часа при pH 5,0; 1 мМ CaCl2 и 5 мг/мл BSA при 37°C.

В Таблице 2 показаны свойства отобранных вариантов (полученных из и сравненных с фитазой дикого типа (wt) в соответствии с Seq ID No.3).

Таблица 2
Стабильность к пепсину для вариантов, полученных из исходной фитазы, показанной в Seq ID No.3
Вариант Стабильность к пепсину [% остаточной активности]
A122T/T167I/F197S/T209K/A211P/K240E/A294E/N303K 63
A122T/T167I/F197S/T209K/A211P/K240E/A242S/S281L/Q289Y/A294E/N303K 72
A122T/D125E/H193R/F197S/T209K/A211P/S221N/G225A/K240E/A294E/N303K 34
D125E/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K 62
A122T/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K/I336F 61
N70Y/D125E/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K 77
Таблица 3
Специфическая активность варианта, полученного из исходной фитазы, показанной в Seq ID No.3
Вариант Специфическая активность [% wt активности при pH 4,0]
A122T/T167I/F197S/T209K/A211P/K240E/A242S/S281L/Q289Y/A294E/N303K 115

Все публикации, упомянутые в вышеприведенном описании изобретения, и ссылки, цитированные в указанных публикациях, включены в данное описание посредством ссылки. Различные модификации и варианты описанных способов и системы по настоящему изобретению будут очевидными для специалистов в данной области без выхода за пределы объема и сущности настоящего изобретения. Хотя изобретение было описано в связи со специфическими предпочтительными вариантами осуществления, должно быть понятно, что изобретение, как заявлено, не должно быть необосновано ограничено такими специфическими вариантами осуществления. Действительно, различные модификации описанных способов выполнения изобретения, которые очевидны для специалистов в молекулярной биологии или родственных областях, предназначены как входящие в объем следующей формулы изобретения.

1. Полипептид, содержащий:
(a) аминокислотную последовательность, как показано в SEQ ID NO: 3, или последовательность, имеющую, по меньшей мере, 90% идентичности (гомологии) с ней, или
(b) полипептид, характеризующийся тем, что он доступен из, предпочтительно получен из штамма P1-29 Buttiauxella sp., депонированного под инвентарным номером NCIMB 41248, или полипептид, имеющий, по меньшей мере, 90% идентичности с ним,
где указанный полипептид необязательно содержит мутации, по меньшей мере, в одном из следующих положений (нумерация соответствует нумерации в SEQ ID NO: 3): 59, 70, 122, 125, 167, 193, 197, 204, 209, 211, 221, 223, 225, 240, 242, 244, 268, 281, 289, 294, 303, 336 или 351,
где указанный полипептид проявляет фитазную активность.

2. Полипептид по п.1, где указанный полипептид является выделенным и/или очищенным.

3. Полипептид по п.2, характеризующийся тем, что указанный полипептид имеет специфическую фитазную активность, по меньшей мере, 100, более предпочтительно, по меньшей мере, 200, наиболее предпочтительно, по меньшей мере, 300 U/мг, где указанная специфическая активность определена путем инкубации указанного полипептида в растворе, содержащем 2 мМ фитата, 0,8 мМ CaCl2 в 200 мМ натрий ацетатного буфера при рН 4,5, при температуре 37°С.

4. Полипептид по п.2, характеризующийся тем, что указанный полипептид имеет максимум фитазной активности около рН 3-6, предпочтительно около рН 4-5, наиболее предпочтительно около рН 4,5; где указанную фитазную активность определяют путем инкубации указанной фитазы в растворе, содержащем 2 мМ фитата, 0,8 мМ CaCl2 в 200 мМ натрий ацетатного буфера при температуре 37°С.

5. Полипептид по любому из пп.1-4, где указанная фитаза включает одну или несколько следующих мутаций:
К 59 А, С, D, Е, F, G, H, I, L, M, N, P, Q, R, S, Т, V, W или Y;
или
N 70 А, С, D, Е, F, G, H, I, К, L, M, N, P, Q, R, S, V, W или Y;
или
А 122 С, D, Е, F, G, H, I, К, L, M, N, P, Q, R, S, Т, V, W или Y;
или
D 125 А, С, Е, F, G, H, I, К, L, M, N, P, Q, R, S, Т, V, W или Y;
или
Т 167 А, С, D, Е, F, G, H, I, К, L, M, N, P, Q, R, S, V, W или Y;
или
Н 193 А, С, D, Е, F, G, I, К, L, M, N, P, Q, R, S, Т, V, W или Y;
или
F 197 А, С, D, Е, G, Н, I, К, L, M, N, P, Q, R, S, Т, V, W или Y;
или
Т 204 А, С, D, Е, F, G, Н, I, К, L, M, N, P, Q, R, S, V, W или Y;
или
Т 209 А, С, D, Е, F, G, Н, I, К, L, M, N, P, Q, R, S, V, W или Y;
или
A 211 C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W или Y;
или
S 221 А, С, D, E, F, H, I, К, L, M, N, P, Q, R, S, Т, V, W или Y;
или
D 223 А, С, D, E, F, G, H, K, L, M, N, P, Q, R, S, T, V, W или Y;
или
G 225 A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W или Y;
или
К 240 А, С, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W или Y;
или
A 242 С, D, E, F, G, H, I, K, L, M, N, P, Q. R, S, T, V, W или Y;
или
D 244 A, C, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W или Y;
или
A 268 C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W или Y;
или
S 281 A, C, D, E, F, G, H, I, K, M, N, P, Q, R, S, T, V, W или Y;
или
Q 289 A, C, D, E, F, G, H, I, K, L, M, N, P, R, S, T, V, W или Y;
или
A 294 C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W или Y;
или
N 303 A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W или Y;
или
I 336 A, C, D, E, F, G, H, K, L, M, N, P, Q, R, S, T, V, W или Y;
или
N 351 A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W или Y.

6. Полипептид по любому из пп.1-4, включающий, по меньшей мере, одну мутацию, выбранную из группы, состоящей из: К59Е; T167V; К240Т; T167I; К240Е; D244C; Q289Y; Т209К или F197S.

7. Полипептид по любому из пп.1-4, включающий комбинацию мутаций, выбранных из группы, состоящей из:
D125E/H193R; или
A294E/N303K; или
T167I/K240T; или
D223E/K240E/N351D; или
T167I/K240T/A294E/N303K; или
T167I/K240E/A242S/A294E/N303K; или
A122T/T167I/F197S/T209K/A211P/K240E/A294E/N303K; или
A122T/T167I/F197S/T209K/A211P/K240E/A242S/S281L/Q289Y/A294E/N303К; или
A122T/D125E/H193R/F197S/T209K/A211P/S221N/G225A/K240E/A294E/N303K; или
D125E/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K; или
A122T/T167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K/I336F; или
N70Y/D125Е/Т167I/H193R/F197S/T204I/T209K/A211P/K240E/A268V/Q289H/A294E/N303K.

8. Полипептид по любому из пп.1-4, включающий комбинацию мутаций A122T/T167I/F197S/T209K/A211P/K240E/A242S/S281L/Q289Y/A294E/N303К.

9. Полипептид по п.7, где указанный выделенный полипептид представляет собой улучшенный вариант фитазного фермента, который по сравнению с исходным фитазным ферментом обладает улучшенным свойством/свойствами, выбранными из:
i. более высокой термической стабильности и/или
ii. специфической активности и/или
iii. протеолитической стабильности.

10. Выделенная молекула нуклеиновой кислоты, выбранная из
i) выделенной молекулы нуклеиновой кислоты, кодирующей полипептид по любому из пп.1-9;
ii) выделенной молекулы нуклеиновой кислоты, включающей последовательность, приведенную в SEQ ID NO: 2,
где молекула нуклеиновой кислоты кодирует полипептид, имеющий фитазную активность.

11. Выделенная молекула нуклеиновой кислоты по п.10, где указанная молекула нуклеиновой кислоты кодирует полипептид по пп.1-9.

12. Экспрессионный вектор для экспрессии любого из полипептидов по пп.1-9, содержащий нуклеиновую кислоту по любому пп.10-11.

13. Клетка-хозяин, трансформированная или трансфицированная экспрессионным вектором по п.12, для продукции любого из полипептидов по пп.1-9.

14. Клетка-хозяин по п.13, где указанная клетка-хозяин получена из микроорганизма, включая бактерию, такую как В.subtilis и Е.coli и грибы, включая дрожжи, такие как Н.polymorpha, S.pombe, S.cerevisiae, и нитчатые грибы, такие как Trichoderma spp. и Aspergillus spp., такой как А.oryzae.

15. Клетка-хозяин по п.14, где указанным микроорганизмом является прокариотическая бактериальная клетка, предпочтительно Е.coli.

16. Штамм Buttiauxella sp P1-29, депонированный в NCIMB под инвентарным номером 41248, для получения полипептида по п.1.

17. Способ получения полипептида, включающий экспрессию аминокислотной последовательности по пп.1-9 и/или экспрессию полинуклеотидов по пп.10-11 в клетке-хозяине и выделение указанного полипептида из культуральной среды клетки-хозяина.

18. Способ получения продукта питания или корма для животных, включающий стадию распыления полипептида по любому из пп.1-9 в жидкой форме на указанный продукт питания или корм для животных.

19. Способ получения продукта питания или корма для животных, включающий стадию смешивания полипептида по любому из пп.1-9 в виде сухого продукта с указанным продуктом питания или кормом для животных.

20. Применение полипептида по любому из пп.1-9 в продукте питания или корме для животных.

21. Композиция продукта питания или корма для животных, включающая либо i) продукт питания или корм для животных и полипептид по любому из пп.1-9 либо ii) продукт питания или корм для животных, полученный с помощью способа по пп.18 или 19.

22. Способ приготовления варианта фитазного фермента, включающий следующие последовательные стадии:
a) отбор, по меньшей мере, одного исходного фитазного фермента, где, по меньшей мере, один исходный фитазный фермент выбран из полипептидов по пп.1-9;
b) генерирование, по меньшей мере, одного варианта фитазы путем введения, по меньшей мере, одного изменения указанного исходного фитазного фермента, которое представляет собой инсерцию, делецию или замещение аминокислотного остатка, или их комбинацию, в указанном исходном фитазном ферменте для получения, по меньшей мере, одного варианта фитазного фермента;
c) скрининг указанного, по меньшей мере, одного варианта фитазного фермента для идентификации улучшенного варианта фитазного фермента, который по сравнению с исходным фитазным ферментом имеет улучшенные свойство/свойства, выбранные из:
i. более высокой термической стабильности и/или
ii. специфической активности и/или
iii. протеолитической стабильности;
d) приготовление указанного улучшенного варианта фитазного фермента, предпочтительно для получения изолированного и/или очищенного варианта фитазного фермента.

23. Способ по п.22, где в процессе стадии b) генерируется популяция вариантов фитазного фермента и на стадии с) по меньшей мере, часть указанной популяции вариантов фитазного фермента подвергается скринингу.

24. Способ по п.22 или 23, где стадия а) включает воздействие на нуклеотидную последовательность по пп.10-11, кодирующую исходный фитазный фермент, мутагенезом, и стадия b) включает экспрессию мутированной нуклеотидной последовательности, полученной на стадии (а), в клетке-хозяине, и стадия с) включает скрининг клеток-хозяев или их экстракта(ов) для получения улучшенного варианта фитазного фермента с указанным улучшенным свойством/свойствами.

25. Способ по п.22 или 23, который после стадии с) и необязательно d) дополнительно включает, по меньшей мере, один последовательный цикл повторяющихся стадий а)-с) и необязательно d), где предпочтительно в указанном последовательном цикле(ах), по меньшей мере, один исходный фитазный фермент стадии а) выбран из указанного, по меньшей мере, одного варианта фитазного фермента и/или улучшенного фитазного варианта, приготовленного в соответствии со способом по пп.22-24.

26. Способ по п.22 или 23, где стадия с) включает скрининг клеток-хозяев, экспрессирующих улучшенный вариант фитазного фермента, который по сравнению с i) указанным исходным фитазным ферментом и/или ii) полипептидом, включающим SEQ ID NO: 3, имеет отличие по термической стабильности, по меньшей мере в 2,5 раза.

27. Способ по п.23 или 23, где стадия с) включает скрининг клеток-хозяев, экспрессирующих улучшенный вариант фитазного фермента, который по сравнению с i) указанным исходным фитазным ферментом и/или ii) полипептидом, включающим SEQ ID NO: 3, имеет стабильности к пепсину, по меньшей мере, 30.

28. Способ по п.22 или 23, где стадия с) включает скрининг клеток-хозяев, экспрессирующих улучшенный вариант фитазного фермента, который по сравнению с i) указанным исходным фитазным ферментом и/или ii) полипептидом, включающим SEQ ID NO: 3, имеет отношение специфической активности по сравнению с фитазой, кодируемой SEQ ID NO: 3, по меньшей мере, 110.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к получению протеолитических фракций из прокариотических клеток, и может быть использовано при анализе молекулярно-генетических механизмов формирования структуры клетки прокариот и роли белковых компонентов в их организации, что необходимо для получения дополнительной информации в разработках и построении компьютерных моделей организации генных и эпигенных сетей управления.

Изобретение относится к синергическому эффекту комбинации фитаз в отношении гидролиза фитиновой кислоты. .

Изобретение относится к биотехнологии и представляет собой липолитический фермента, который получен из одного из Streptomyces. .

Изобретение относится к измерениям или испытаниям, использующим фермент холинэстеразу, конкретно к измерению концентрации веществ антихолинэстеразного действия (АХД), например фторангидрида O-изопропилового эфира метилфосфоновой кислоты (ИМФК), путем определения остаточной ферментативной активности.

Изобретение относится к биотехнологии и может найти применение в производстве медицинских препаратов - рибонуклеазы панкреатической, дезоксирибонуклеазы панкреатической, трипсина, а также холестеролэстеразы.

Изобретение относится к биотехнологии, в частности к кристаллическим структурам фосфодиэстеразы 5 (PDE5) и комплексов "РDЕ5/лиганд PDE5" и к их применениям для идентификации лигандов PDE5, включая соединения-ингибиторы PDE5.

Изобретение относится к области биотехнологии и может быть использовано в медицине и фармацевтике. .

Изобретение относится к области генной инженерии и биотехнологии и может быть использовано в медицине. .

Изобретение относится к биотехнологии и представляет собой новые эндо-(1-4)- -D-ксиланазы мицелиального гриба Penicillium canescens. .

Изобретение относится к области биотехнологии и касается варианта ДНК, связанного с гиполактазией взрослого типа. .

Изобретение относится к биотехнологии и представляет собой полипептид, обладающий -L-арабинофуранозидазной активностью, выбранный из следующих полипептидов: полипептид с SEQ ID No.2, полипептид, аминокислотная последовательность которого находится между положениями 28 и 400 SEQ ID No.2, фрагмент полипептида с SEQ ID No.2, обладающий активностью -L-арабинофуранозидазы, полипептид, обладающий активностью -L-арабинофуранозидазы В и проявляющий, по меньшей мере, 80% идентичность с полипептидом SEQ ID No.2.

Изобретение относится к биотехнологии и представляет собой полинуклеотидный кластер из Rhodococcus, который содержит нуклеотидные последовательности, кодирующие полипептиды, которые обладают активностью нитрилгидратазы, вспомогательного белка Р15К, активирующего этот фермент, и транспортера кобальта.

Изобретение относится к биотехнологии и представляет собой новую альфа-галактозидазу, молекулу ДНК, ее кодирующую. .

Изобретение относится к биотехнологии. .

Белок // 2380414
Изобретение относится к области биотехнологии, конкретно к новым грибковым липолитическим ферментам, имеющим более высокую активность, направленную на полярные липиды, по сравнению с активностью, направленной на триглицериды.
Наверх