Растения brassica oleracea с устойчивостью к mycosphaerella brassicicola

Авторы патента:

 


Владельцы патента RU 2438298:

БЕЙО ЗАДЕН Б.В. (NL)

Настоящее изобретение относится к получению растений Brassica oleracea, устойчивых к возбудителю кольцевой пятнистости (Mycosphaerella brassicicola). Описано растение Brassica oleracea, содержащее ген резистентности к М. brassicicola, выделенный из устойчивого к заболеванию растения, семена которого депонированы в АТСС под номером РТА-7413, и располагающийся в геноме растения в окружении, по меньшей мере, двух ДНК-маркеров, выявляемых с помощью раскрытых в изобретении специфических праймеров. Предложен способ получения устойчивого к М. brassicicola растения Brassica oleracea, включающий (а) получение первого растения В. oleracea, принадлежащего к М. brassicicola-устойчивой родительской линии, депонированной в АТСС под номером РТА 7413; (b) скрещивание полученного на стадии (а) резистентного растения с восприимчивым вторым растением В. oleracea; (с) выделение из полученного на стадии (b) потомства геномной ДНК и детекцию интрогрессии гена устойчивости по наличию двух или более специфичных ДНК-маркеров, присутствие которых устанавливается с помощью раскрытых в изобретении комбинаций праймеров, и (d) селекцию потомства растения В. oleracea, для которого на этапе (с) было показано присутствие интрогрессии гена устойчивости. 5 н. и 6 з.п. ф-лы, 2 табл.

 

Настоящее изобретение относится к растениям Brassica oleracea, которые устойчивы к Mycosphaerella brassicicola, возбудителю кольцевой пятнистости. Изобретение также относится к семенам, плодам и/или другим частям растения этих устойчивых растений. Настоящее изобретение дополнительно относится к способу получения растения B. oleracea, которое устойчиво к M. brassicicola. Изобретение также относится к применению определенных ДНК-маркеров, которые специфично связаны с геном устойчивости к M. Brassicicola, с целью идентификации устойчивого растения B. oleracea.

Mycosphaerella brassicicola (иногда также встречающаяся под названиями Sphaeria brassicicola, Sphaerella brassicicola, Dothidea brassicae, Asteroma brassicae и Phyllosticta brassicicola (Punithalingham и Holliday, Descriptions of Pathogenic Fungi and Bacteria, CMI (Commonwealth Mycological Institute) England, No. 468, 1975)) является возбудителем так называемой кольцевой пятнистости у растений Brassica. Гриб, который встречается во многих регионах с начала восьмидесятых и в некоторых случаях даже достиг масштабов эпидемии, принадлежит к дрожжевым грибам и образует серо-коричневые поражения на листьях растений, на которых, в конечном счете, формируются аскоспоры. Эти споры являются средством распространения гриба и распространяются, главным образом, ветром и каплями дождя. Гриб лучше всего растет в сырых и умеренных условиях. В силу сочетания факторов M. brassicicola может быстро распространяться на большой территории. Серьезная инфекция M. brassicicola может привести к быстрому старению листа, дефолиации и последовательному снижению урожайности. Кроме того, это может привести к косметическому ущербу продукту (растению и/или части растения), также потому что инфекция M. brassicicola может даже распространяться во время хранения продукта и потому что поражения образуют сайт инвазии для вторичных инфекций (например, Botrvtis spp).

Растения-хозяева M. brassicicola включают почти все виды Brassica, включая B. campestris, B. carinata, B. napus, B. nigra, B. oleracea, и дополнительно Raphanus sativus, и также некоторые крестоцветные сорняки, включая Hirschfeldia incana, Matthiola incana, Sisymbrium officinale и Thlaspi arvense.

Brassica является родом растений семейства Brassicaceae (ранее Cruciferae). Члены этого рода все вместе упоминаются как капуста или горчица. Род Brassica включает многие важные сельскохозяйственные и садоводческие зерновые культуры, включая капусту, цветную капусту, красную капусту, савойскую капусту, капусту белокочанную, капусту бычье сердце, курчавую капусту кале, брокколи, брюссельскую капусту, китайскую капусту, брюкву и капусту португальскую (тронхуда). Почти все части растений используются в качестве пищи, такие как корни (репа), стебли (брюква), листья (капуста белокочанная), пазушные почки (ростки), цветы (цветная капуста, брокколи) и семена (рапс). Некоторые разновидности с белыми или фиолетовыми цветами или отличного цвета или формой листьев выращивают в декоративных целях.

Хотя M. brassicicola возможно контролировать с помощью фунгицидов, число разрешенных средств и применение этих средств становятся все более и более ограниченными по экологическим и связанным со здоровьем причинам. Использование фунгицидов для контроля M. brassicicola, кроме того, нелегко, потому что трудно определить правильный момент для лечения. Поэтому желательно вывести растения Brassica, в частности растения Brassica oleracea, которые устойчивы к вышеуказанному описанному грибу. Не существует никаких доступных сортов Brassica с устойчивостью к M. brassicicola.

Целью настоящего изобретения является предоставление растения Brassica oleracea с устойчивостью к M. brassicicola, возбудителю кольцевой пятнистости.

С этой целью настоящее изобретение предоставляет растение Brassica oleracea, содержащее ген устойчивости к M. brassicicola, в котором указанный ген устойчивости обеспечивает моногенную и доминантную устойчивость к M. brassicicola и в котором ген устойчивости получен из растения B. oleracea, семена которого содержат депонированный в американской коллекции типовых культур (ATCC, Патентный Депозитарий, 10801 University Boulevard, Manassas, VA 20110, United States of America) 1 марта 2006 под номером РТА-7413. Неожиданно было установлено, что геном устойчивости согласно настоящему изобретению обеспечивает доминантная устойчивость к двум физиологическим видам (physio's) M. brassicicola. Эти физиологические виды часто встречаются в Нидерландах и являются более вирулентными физиологическими видами, с которыми часто сталкиваются в регионах выращивания цветной капусты в Западной Франции (особенно Нормандия и Бретань) и в регионах выращивания капусты в Центральной Америке (особенно Гватемала).

В дополнительном предпочтительном варианте осуществления настоящего изобретения ген устойчивости в растении B. oleracea связан с одним или более специфическими ДНК-маркерами. Эти маркеры можно использовать для определения наличия гена устойчивости по настоящему изобретению.

В предпочтительном варианте осуществления настоящего изобретения ген устойчивости к M. brassicicola связан, по меньшей мере, с двумя, предпочтительно, по меньшей мере, с тремя, более предпочтительно, по меньшей мере, с четырьмя, более предпочтительно, по меньшей мере, с пятью, наиболее предпочтительно с шестью ДНК-маркерами, причем ДНК-маркеры окружают ген устойчивости. Под "окружают" в настоящей заявке понимают, что ДНК-маркеры расположены в геноме с обеих сторон от гена устойчивости, то есть "выше" так же, как и "ниже" гена устойчивости. Определение наличия множества ДНК-маркеров, которые связаны с геном устойчивости и окружают ген устойчивости, гарантирует, что интрогрессия гена устойчивости в действительности присутствует.

ДНК-маркеры согласно настоящему изобретению предпочтительно выбраны из таблицы 1, причем наличие ДНК-маркеров в геноме растения определяют, используя праймерные последовательности, выбранные из группы, состоящей из SEQ ID NO: с 1 по включая SEQ ID NO: 6 включительно.

В исследовании, которое привело к настоящему изобретению, было показано, что соответствующие ДНК-маркеры являются признаками интрогрессии устойчивости к M. brassicicola. ДНК-маркеры согласно настоящему изобретению являются фрагментами ДНК, которые связаны с соответствующим геном устойчивости, имеют определенный размер (п.о.), как указано в таблице 1, и их можно определить, используя определенные комбинации праймеров.

Растение согласно настоящему изобретению предпочтительно выбрано из группы, состоящей из B. oleracea convar. botrytis var. botrytis (цветная капуста, романеско), B. oleracea convar. botrytis var. cymosa (брокколи), B. oleracea convar. botrytis var. asparagoides (спаржевая капуста), B. oleracea convar. oleracea var. gemnifera (брюссельская капуста), B. oleracea convar. capitata var. alba (капуста белокочанная, капуста с кочанами округло-конической формы), B. oleracea convar. capitata var. rubra (красная капуста), B. oleracea convar. capitata var. sabauda (капуста савойская), B. oleracea convar. acephela var. sabellica (курчавая капуста кале), B. oleracea convar. acephela var. gongyloides (брюква) и B. oleracea var. tronchuda syn. costata (капуста португальская).

Изобретение также относится к семенам, плодам и/или другим частям растения от вышеуказанных описанных растений. Части растения в рамках настоящего описания означают, среди прочего, съедобные части растения, такие как, например, пазушные почки (ростки).

Изобретение также относится к способу получения растения B. oleracea с устойчивостью к M. brassicicola, который включает, по меньшей мере, следующие этапы:

(a) предоставление первого растения B. oleracea, которое содержит ген устойчивости к M. brassicicola;

(b) скрещивание устойчивого растения со вторым восприимчивым растением B. oleracea;

(c) выделение от потомства геномной ДНК для определения наличия интрогрессии гена устойчивости, используя один или более специфичных ДНК-маркеров, связанных с геном устойчивости; и

(d) отбор потомства растения B. oleracea, в котором наличие интрогрессии гена устойчивости было определено на этапе (c).

Способом согласно настоящему изобретению быстро и несложно можно получить устойчивые растения B. Oleracea, используя ДНК-маркеры, которые являются специфичными к интрогрессии гена устойчивости согласно настоящему изобретению.

Степень тяжести заболевания M. brassicicola может быть очень вариабельной в силу различных природных факторов, таких как ветер, температура, влажность воздуха и окружающая среда (среди прочего, другие растения-хозяева). Поэтому можно наблюдать большие различия в степени инфекции. Кроме того, симптомы можно легко перепутать с болезнями, вызванными Alternaria brassicae и A. brassicicola. Применение способа согласно настоящему изобретению и использование специфичных ДНК-маркеров, связанных с геном устойчивости, простым способом можно определить, содержит ли растение ген устойчивости. Таким образом, устойчивые растения B. oleracea можно, кроме того, получить быстрее, чем с помощью стандартных программ выведения. Многие сорта Brassica имеют двухлетний цикл, в течение которого растение является вегетативным на первом году и цветет и производит семена на втором году. Используя специфичные ДНК-маркеры, связанные с геном устойчивости, способ можно ускорить до одногодичного цикла, поскольку не требуется проводить тест на устойчивость, а также не требуется выращивать растения до взрослой стадии для того, чтобы сделать возможным отбор. Таким образом, такая программа выведения может сохранить много лет.

Растения, отобранные на этапе (d) способа согласно настоящему изобретению, можно необязательно подвергнуть дополнительным этапам, таким как обратное скрещивание или самоопыление растения, полученного на этапе (d), один или более раз с восприимчивым растением B. oleracea и впоследствии выбрать еще раз из потомства устойчивое растение B. oleracea, используя специфичные ДНК-маркеры. Растения, полученные на этапе (d), можно, например, также сделать гомозиготными с помощью методов, известных квалифицированному специалисту, таких как культура пыльника и/или микроспоры.

Первое растение B. oleracea предпочтительно содержит ген устойчивости, который наделяет моногенной и доминирующей устойчивостью к M. brassicicola.

В предпочтительном варианте осуществления первое растение B. oleracea содержит ген устойчивости, полученный из растения B. oleracea, семена которого были депонированы в Американской коллекции типовых культур (ATCC, Патентный Депозитарий, 10801 University Boulevard, Manassas, VA 20110, United States of America) 1 марта 2006 под номером РТА-7413.

В дополнительном предпочтительном варианте осуществления способа согласно настоящему изобретению селекция устойчивого растения B. oleracea на этапе (d) включает отбор растения B. oleracea, которое содержит, по меньшей мере, два, предпочтительно, по меньшей мере, три, более предпочтительно, по меньшей мере, четыре, более предпочтительно, по меньшей мере, пять и наиболее предпочтительно шесть ДНК-маркеров, связанных с геном устойчивости, причем ДНК-маркеры окружают ген устойчивости. Тем самым, можно с уверенностью определить, имеет ли растение интрогрессию гена устойчивости.

ДНК-маркеры согласно настоящему изобретению предпочтительно выбраны из таблицы 1, причем наличие ДНК-маркеров в геноме растения определяют, используя последовательности праймеров, выбранные из группы, состоящей из SEQ ID NO: 1 до SEQ ID NO: 6 включительно (таблица 2).

В частном варианте осуществления согласно настоящему изобретению первое растение B. oleracea содержит ген устойчивости к M. brassicicola, происходящий из растения B. oleracea, семена которого задепонированы в Американской коллекции типовых культур (ATCC, Патентный Депозитарий, 10801 University Boulevard, Manassas, VA 20110, United States of America) 1 марта 2006 под PTA-номером 7413.

Восприимчивое растение B. oleracea, в которое вставлен ген устойчивости, предпочтительно выбрано из группы, состоящей из B. oleracea convar. botrytis var. botrytis (цветная капуста, романеско), B. oleracea convar. botrytis var. cymosa (брокколи), B. oleracea convar. botrytis var. asparagoides (спаржевая капуста), B. oleracea convar. oleracea var. gemnifera (брюссельская капуста), B. oleracea convar. capitata var. alba (капуста белокочанная, капуста бычье сердце), B. oleracea convar. capitata var. rubra (красная капуста), B. oleracea convar. capitata var. sabauda (капуста савойская) B. oleracea convar. acephela var. sabellica (курчавая капуста кале), B. oleracea convar. acephela var. gongyloides (брюква) и B. oleracea var. tronchuda syn. costata (капуста португальская).

Изобретение дополнительно относится к растениям B. oleracea, доступным посредством вышеуказанного описанного способа, и к семенам и/или частям этих растений.

Изобретение также относится к применению, по меньшей мере, одного ДНК-маркера, связанного с геном устойчивости к M. brassicicola, для идентификации растения B. oleracea, которое устойчиво к M. brassicicola, где ДНК-маркер выбран из ДНК-маркеров в таблице 1 и где ДНК-маркер приведен с праймерными последовательностями, выбранными из группы, состоящей из SEQ ID No.: 1-6 (таблица 2).

Ген устойчивости предпочтительно происходит из растения B. oleracea, семена которого были депонированы в Американской коллекции типовых культур (ATCC) под номером РТА - 7413.

Изобретение дополнительно объяснено на основе следующего примера.

ПРИМЕР

M. Brassicicola-устойчивую родительскую линию M. B. oleracea (9009899, тип цветной капусты; депонированный в ATCC под номером РТА-7413) скрещивали с различными сортами B. oleracea (брюква, брокколи, капуста бычье сердце, капуста белокочанная, красная капуста, курчавая капуста кале, капуста савойская, тронхуда, капуста брюссельская и цветная капуста). Популяцию BC1 получали возвратным скрещиванием с восприимчивыми родительскими линиями.

Полевые испытания проводили в различные годы. Растительный материал собирали в год, когда степень инфекции M. brassicicola была высока и единообразна у различных видов Brassica. Поиск ДНК-маркеров устойчивости к M. brassicicola начинали с этих популяций. Почти все популяции имели расщепление 1:1 по устойчивости к M. brassicicola, что свидетельствует об ожидаемой моногенной доминантной устойчивости.

Использовали три популяции (капуста бычье сердце, брокколи и брюква), каждая приблизительно из 150 особей. ДНК всех особей выделяли из образцов листа (~0,3 см2/образец листа). Для поиска близко связанных ДНК-маркеров впоследствии использовали метод BSA (анализ смешанного образца сегреганта), в котором применяли методику RAMP (Matsumoto и др., Mammalian Genome, 9: 531-535, 1998; Reiter, PCR-based marker systems, in: DNA-based markers in plants, Kluwer Academic Publishers, vol. 6: 9-29, 2001; Weising и др., Detecting DNA variation by molecular markers, in: DNA fingerprinting in plants, principles, methods and applications, CRC Press, 2nd ed.: 21-73, 2005).

Методика RAMP, в которой комбинируют iSSR и RAPD-праймер, приводит к паттерну полос, которые представлены фрагментами ДНК, которые специфично косегрегируют с устойчивостью, причем можно провести различие между особями, которые действительно имеют интрогрессию гена устойчивости, и особями, которые не имеют интрогрессию.

Путем картирования RAMP-фрагментов были идентифицированы тесно связанные RAMP-маркеры, которые находятся в пределах интрогрессии и окружают ген устойчивости, см. таблицу 1. Генетическое расстояние между ДНК-маркером и геном устойчивости представлено в сантиморганидах (сМ).

Анализ маркеров и условия ПЦР

Общие условия ПЦР, при которых получали ДНК-маркеры, представлены вкратце далее.

ПЦР-смесь для реакции RAMP:

На реакцию

Приблизительно 1 нг геномной ДНК растения

75 мМ Tris-HCl (pH 8,8)

20 мМ NH4SO4

0,01 (об./об.) Tween 20

2,8 мМ MgCl2

0,15 мкМ прямого праймера

0,20 мкМ обратного праймера

0,25 мМ dNTP

0,04 единиц/мкл Red Hot® ДНК-полимеразы (Abgene, Epsom, UK)

Программа ПЦР:

RAPD35 Количество циклов
1 2 минуты 93°С 1
2 30 секунд 93°С
3 30 секунд 35°С
4 нагревание до 72°С со скоростью 0,3°/сек
5 1 минута 30 секунд 72°С
2-5 40
6 5 минут 72°С 1

PAGE/Licor

Для анализа паттернов RAMP использовали “Gene ReadIR 4200 DNA analyzer” (Licor Inc.). При оптимальной концентрации акриламида 6,5% фрагменты разделяли с разрешением до одного основания. Для того чтобы сделать фрагменты детектируемыми в этой системе, важно использовать меченные праймеры (IRDye метки). С этой целью треть исходного количества прямого праймера замещали меченным праймером с такой же последовательностью.

Обзор маркеров

В исследовании, которое привело к настоящему изобретению, для получения ДНК-маркеров, представленных в таблице 1, использовали праймеры, приведенные в таблице 2.

Таблица 1
Обзор RAMP маркеров
RAMP SEQ ID
Комбинация
Размер фрагмента (п.о.) Положение в сМ относительно гена резистентности
1+6 198 2,4
2+6 360 0,7
3+6 370 0,3
4+6 230 1,2
5+6 173 2,1
5+6 473 3,2
Таблица 2
Обзор SEQ ID номеров
SEQ ID № Sequence
1 iSSR CAGGAAACAGCTATGACAATGTCTCTCTCTCTC
2 iSSR CAGGAAACAGCTATGACTTGCTCTCTCTCTCTC
3 iSSR CAGGAAACAGCTATGACCACTTCTCTCTCTCTC
4 iSSR CAGGAAACAGCTATGACCTTTTCTCTCTCTCTC
5 iSSR CCAGGTGTGTGTGTGT
6 Operon RAPD® 10-mer наборы с A-01 по Z-20
(Operon Biotechnologies, Inc. Huntsville, USA)

Комбинации праймеров образуют фрагменты с определенным размером при интрогрессии гена устойчивости (таблица 1). Эти ДНК-маркеры, таким образом, являются характеристическими для интрогрессии гена устойчивости. Комбинация этих ДНК-маркеров, окружающих ген устойчивости, представляет достоверный признак того, что интрогрессия гена устойчивости к M. brassicicola произошла.

Определения

BSA - анализ смешанного образца сегрегантов - это стратегия селекции, при которой в больших популяциях сегрегантов особи с одинаковым свойством (фенотипом) или ДНК этих особей объединяют в "пулы". После скрининга этих пулов ДНК методиками определяют маркеры, которые связаны с соответствующим фенотипом.

сМ - сантиморганида - это единица генетического расстояния между маркерами, основанная на количестве кроссинговеров на сто особей.

ДНК-маркер - это фрагмент ДНК, который связан с геном или другой частью ДНК с известным местоположением в геноме, который используется для определения наследования этого гена или этого участка.

Гель-электрофорез - это способ разделения молекул (ДНК, РНК, белков, среди прочих) на основе их размера, структуры или заряда в матриксе (агароза или полиакриламид) под действием электрического поля.

Интрогрессия - это фрагмент хромосомы линии, который, например, может быть вставлен в другую линию посредством скрещивания.

IRDye метки - это инфракрасные метки, которые используют для систем отображения Licor, детекция которых происходит при 700 нм или 800 нм.

Моногенный - определяемый одним геном.

ПЦР - полимеразная цепная реакция - это метод амплификации in vitro для увеличения копий определенного фрагмента ДНК. В этой реакции синтеза используется, по меньшей мере, один олигонуклеотид, который гибридизируется с участком ДНК, после чего полимераза амплифицирует фланкирующую область в течение последовательных температурных циклов.

Праймер - это короткий олигонуклеотид (~20-50 п.о.), комплементарный последовательности одноцепочечной молекулы ДНК, который служит отправной точкой для полимеразы.

RAMPs - случайно амплифицируемые микросателлитные полиморфизмы - это метод «ДНК-отпечатка», основанный на RAPD- и iSSR-праймерах, с помощью которых детектируют полиморфизмы ДНК у различных мутантов.

RAPD - случайно амплифицируемая полиморфная ДНК - это случайно амплифицируемый полиморфный ДНК-праймер: 10-членник со "случайной" последовательностью, в котором содержание GC составляет от 60% до 70% и в котором концы праймера не является самокомплементарным.

iSSR - межмикросателлитная последовательность - это праймер к межмикросателлитной последовательности: праймер, выбранный на 5'-конце SSR (микросателлитного повтора); фрагмент ДНК, состоящий из повторения 2 или 3 нуклеотидов.

BC - обратное скрещивание - скрещивание особи с одним из исходных родителей.

1. Растение Brassica oleracea, содержащее ген устойчивости к Mycosphaerella brassicicola, в котором указанный ген устойчивости обеспечивает моногенную и доминантную устойчивость к М. brassicicola, происходит из растения В. oleracea, семена которого депонированы в Американской коллекции типовых культур (АТСС) под номером РТА-7413, и связан в геноме, по меньшей мере, с двумя расположенными по обе стороны от него ДНК-маркерами, присутствие которых устанавливается путем использования указанных в таблице 1 комбинаций праймерных последовательностей, выбранных из группы, состоящей из с SEQ ID NO: 1-6.

2. Растение по п.1, в котором ген устойчивости к М. brassicicola связан, по меньшей мере, с тремя ДНК-маркерами, где ДНК-маркеры окружают ген устойчивости.

3. Растение по п.2, в котором ген устойчивости к М. brassicicola связан, по меньшей мере, с четырьмя ДНК-маркерами, где ДНК-маркеры окружают ген устойчивости.

4. Растение по п.3, в котором ген устойчивости к М. brassicicola связан, по меньшей мере, с пятью ДНК-маркерами, где ДНК-маркеры окружают ген устойчивости.

5. Растение по п.4, в котором ген устойчивости к М. brassicicola связан, по меньшей мере, с шестью ДНК-маркерами, где ДНК-маркеры окружают ген устойчивости.

6. Растение по любому из пп.1-5, где растение выбрано из группы, состоящей из Brassica oleracea convar. botrytis var. botrytis (цветная капуста, романеско), Brassica oleracea convar. botrytis var. cymosa (брокколи), Brassica oleracea convar. botrytis var. asparagoides (спаржевая капуста), Brassica oleracea convar. oleracea var. gemnifera (брюссельская капуста), Brassica oleracea convar. capitata var. alba (капуста белокочанная, капуста бычье сердце), Brassica oleracea convar. capitata var. rubra (красная капуста), Brassica oleracea convar. capitata var. sabauda (капуста савойская), Brassica oleracea convar. acephela var. sabellica (курчавая капуста кале), Brassica oleracea convar. acephela var. gongyloides (брюква) и Brassica oleracea var. tronchuda syn. costata (капуста португальская).

7. Семена, плоды и/или другие части растения, происходящие от растения по любому из пп.1-6 и содержащие ген устойчивости к Mycosphaerella brassicicola, где указанный ген устойчивости определяют в геноме по наличию, по меньшей мере, двух ДНК-маркеров, выявляемых при помощи указанных в таблице 1 комбинаций праймеров с последовательностями, выбранными из группы, состоящей из SEQ ID NO:1-6.

8. Способ получения растения Brassica oleracea с устойчивостью к Mycosphaerella brassicicola по любому из пп.1-6, включающий:
(a) получение первого растения В. oleracea, принадлежащего к М. brassicicola-устойчивой родительской линии, депонированной в АТСС под номером РТА-7413,
(b) скрещивание полученного на стадии (а) резистентного растения с восприимчивым вторым растением В. oleracea;
(c) выделение из полученного на стадии (b) потомства геномной ДНК и детекцию присутствия интрогрессии гена устойчивости по наличию двух или более специфичных ДНК-маркеров, присутствие которых устанавливается путем использования указанных в таблице 1 комбинаций праймеров с последовательностями, выбранными из группы, состоящей из с SEQ ID NO:1-6, и
(d) селекцию потомства растения В. oleracea, в котором на этапе (с) было установлено присутствие интрогрессии гена устойчивости.

9. Способ по п.8, в котором восприимчивое растение В. oleracea выбрано из группы, состоящей из В. oleracea convar. botrytis var. botrytis (цветная капуста, романеско), В. oleracea convar. botrytis var. cymosa (брокколи), В. oleracea convar. botrytis var. asparagoides (спаржевая капуста), В. oleracea convar. oleracea var. gemnifera (брюссельская капуста), В. oleracea convar. capitata var. alba (капуста белокочанная, капуста бычье сердце), В. oleracea convar. capitata var. rubra (красная капуста), В. oleracea convar. capitata var. sabauda (капуста савойская) В.oleracea convar. acephela var. sabellica (курчавая капуста кале), В. oleracea convar. acephela var. gongyloides (брюква) и В. oleracea var. tronchuda syn. costata (капуста португальская).

10. Растение В. oleracea, устойчивое к М. brassicicola, которое получено способом по п.8 или 9.

11. Применение анализа геномной ДНК растения В. oleracea на наличие, по меньшей мере, двух ДНК-маркеров, выявляемых при помощи указанных в таблице 1 комбинаций праймеров с последовательностями, выбранными из группы, состоящей из SEQ ID NO: 1-6.



 

Похожие патенты:

Изобретение относится к биотехнологии. .

Изобретение относится к биотехнологии. .
Изобретение относится к сельскому хозяйству и может быть использовано для возделывания лотоса орехоносного как сельскохозяйственной культуры. .

Изобретение относится к устойчивой к гербицидам линии подсолнечника, которая в настоящем документе обозначена как MUT28. .

Изобретение относится к области сельского хозяйства, в частности к селекции растений, устойчивых к возбудителям болезней растений. .
Изобретение относится к области сельского хозяйства и селекции. .
Изобретение относится к области сельского хозяйства. .

Изобретение относится к области сельского хозяйства, селекции, генетики и ботаники. .
Изобретение относится к сельскому хозяйству и может быть использовано в селекции, семеноводстве, исследовательской работе с полезными культурами (лекарственными, овощными), медицине, животноводстве, ветеринарии.

Изобретение относится к сельскому хозяйству и биотехнологии и может быть использовано в селекции и генетике сельскохозяйственных растений. .

Изобретение относится к области сельского хозяйства (селекция растений) и может быть использовано для отбора высокобелковых линий в процессе селекции зерновых культур, в частности к оценке ячменя на содержание белка в зерне.

Изобретение относится к сельскому хозяйству и может быть использовано в селекции и семеноводстве сои. .
Изобретение относится к области сельского хозяйства, в частности к селекции. .

Изобретение относится к области биотехнологии растений и может быть использовано для мультипликации культур, трудно размножаемых вегетативным способом
Наверх