Рекомбинантный вирус болезни ньюкастла, экспрессирующий н5 гемаглютинин вируса птичьего гриппа (avian ineluenza)



Рекомбинантный вирус болезни ньюкастла, экспрессирующий н5 гемаглютинин вируса птичьего гриппа (avian ineluenza)
Рекомбинантный вирус болезни ньюкастла, экспрессирующий н5 гемаглютинин вируса птичьего гриппа (avian ineluenza)
Рекомбинантный вирус болезни ньюкастла, экспрессирующий н5 гемаглютинин вируса птичьего гриппа (avian ineluenza)
Рекомбинантный вирус болезни ньюкастла, экспрессирующий н5 гемаглютинин вируса птичьего гриппа (avian ineluenza)
Рекомбинантный вирус болезни ньюкастла, экспрессирующий н5 гемаглютинин вируса птичьего гриппа (avian ineluenza)
Рекомбинантный вирус болезни ньюкастла, экспрессирующий н5 гемаглютинин вируса птичьего гриппа (avian ineluenza)
Рекомбинантный вирус болезни ньюкастла, экспрессирующий н5 гемаглютинин вируса птичьего гриппа (avian ineluenza)

 


Владельцы патента RU 2441070:

ИНТЕРВЕТ ИНТЕРНЭШНЛ Б.В. (NL)

Представленное изобретение относится к области биотехнологии и касается рекомбинантного экспрессионного вектора вируса болезни Ньюкастла, способа получения такого вируса и вакцины, содержащей такой вектор. Рекомбинантный вектор вируса болезни Ньюкастла содержит дополнительную транскрипционную единицу, включающую ген, кодирующую белок НА патогенного вируса Н5 птичьего гриппа, операбельно связанный с последовательностью старта гена (GS) начальной части вируса болезни Ньюкастла и последовательностью конца гена (GE) конечной части вируса болезни Ньюкастла, характеризующуюся тем, что указанный белок содержит участок удлинения, состоящий, по крайней мере, из трех основных аминокислот, где указанный участок удлинения состоит из остатков аргинина (Arg) и/или лизина (Lys) и содержит, по крайней мере, один лизин, причем указанный ген не содержит последовательности, которая может узнаваться вирусной полимеразой вируса болезни Ньюкастла как последовательность конца гена. Представленный вектор позволяет получить высокий уровень экспрессии белка НА патогенного вируса Н5 птичьего гриппа, а также вакцина, содержащая такой вектор, обеспечивает иммунную защиту от заражения вирусом болезни Ньюкастла и вируса птичьего гриппа 3 н. и 9 з.п. ф-лы, 5 ил., 1 табл.

 

Данное изобретение относится к рекомбинантному вектору вируса Mononegavirales, содержащего дополнительную транскрипционную единицу, включающую чужеродный ген, операбельно связанный с последовательностью старта гена (GS) начальной части вируса Mononegavirales в положении “апстрим” и последовательностью конца гена (GE) конечной части вируса Mononegavirales в положении “даунстрим”. Это изобретение также относится к способу получения такого рекомбинантного вектора вируса Mononegavirales, а также к вакцине, содержащей такой рекомбинантный вектор вируса Mononegavirales.

Живые вирусы, способные реплицироваться в инфицированной клетке-хозяине, индуцируют сильный и продолжительный иммунный ответ на экспрессируемые ими антигены. Они эффективно вызывают как гуморальный, так и клеточно-опосредованный иммунные ответы, а также стимулируют метаболические пути цитокинов и хемокинов. Поэтому, живые, ослабленные вирусы обладают определенными преимуществами по сравнению с композициями вакцин, основанными как на инактивированных, так и на субъединичных иммуногенах, которые, в основном, только стимулируют гуморальный компонент иммунной системы.

За последнее десятилетие технология рекомбинантных ДНК революционизировала область генетической инженерии геномов как ДНК-, так и РНК-содержащих вирусов. В частности, сейчас стало возможным внедрение чужеродных генов в геном вируса таким образом, что после репликации нового векторного вируса в животном-хозяине экспрессируется чужеродный белок, который может вызвать биологические эффекты у животного-хозяина. По существу, рекомбинантные векторные вирусы использовались не только для контроля и профилактики микробных инфекций, но и для разработки целевой терапии заболеваний немикробной этиологии, таких как злокачественные новообразования, а также в генной терапии.

Создание несегментированных, минус-нитевых РНК вирусов (вирусов порядка Mononegavirales) полностью из клонов кДНК с помощью метода, известного как «обратная генетика» (reverse genetics), впервые опубликованного в 1994 (Schnell et al., EMBO J 13, 4195-4203, 1994), сделало возможным использование в качестве векторов также вирусы порядка Mononegavirales (MV). С тех пор опубликованы исследования, посвященные использованию многих вирусов порядка MV в качестве вирусных векторов для экспрессии чужеродных антигенов, произошедших от патогена, с целью разработки вакцин против этого патогена.

Порядок Mononegavirales подразделяется на 4 основные семейства: Paramyxoviridae, Rhabdoviridae, Filoviridae и Bornaviridae. Вирусы, принадлежащие к этим семействам, имеют геномы, которые представляют собой одноцепочечную минус (-) смысловую молекулу РНК, то есть полярность РНК генома противоположна полярности информационной РНК (мРНК), которая обозначается как плюс (+) смысловая. Классификация основных вирусов человека и животных порядка MV представлена в нижестоящей таблице:

Таблица 1
Классификация вирусов внутри порядка Mononegavirales
Семейство Род Вид
Rhabdoviridae Lyssavirus (вирусы группы бешенства) Вирус бешенства (RV)
Vesiculovirus (везикулярные) Вирус везикулярного стоматита (VSV)
Novirhabdovirus Вирус инфекционного некроза гемопоэтической ткани (IHNV)
Paramyxoviridae Respirovirus (респираторные) Вирус Сендай (SeV)
Вирус парагриппа человека типа 1 и типа 3 (hPIV 1/3)
Вирус бычьего парагриппа тип 3 (bPIV 3)
Morbillivirus (вирус кори) Вирус кори (MV)
Вирус чумы крупного рогатого скота
Вирус чумы собак (CDV)
Rubulavirus (рубулавирусы) Обезьяний вирус типа 5 (SV-5)
Вирус парагриппа человека типа 2 (hPIV 2)
Avulavirus
(вирус птиц)
Вирус болезни Ньюкастла (NDV)
Pneumovirus
(пневмовирусы)
Респираторный синцитиальный вирус (hRSV)
Бычий синцитиальный вирус (bRSV)
Filoviridae Эбола-подобные вирусы Вирус Эбола
Вирус Марбург

В настоящее время организация генома и особенности клеточного цикла вирусов, относящихся к порядку MV, хорошо изучены. Результаты этих исследований опубликованы в работах многих авторов (Neumann et al., J. Gen. Virology 83, 2635-2662, 2002; Whelan et al., Curr. Top. Microbiol. Immunol. 203, 63-119, 2004; Conzelmann, K., Curr. Top. Microbiol. Immunol. 203, 1-41, 2004). Несмотря на то, что у вирусов, относящихся к порядку Mononegavirales, могут быть разные клетки-хозяева и различные морфологические и биологические свойства, у них наблюдается много общих признаков, например, таких как организация генома, а также элементы, существенные для их типичного способа репликации и экспрессии генов, что указывает на общность их происхождения. Они являются вирусами в оболочке, которые реплицируются в цитоплазме клетки и продуцируют незрелые мРНК.

Вирус, относящийся к отряду Mononegavirales, состоит из двух основных единиц: рибонуклеопротеинового комплекса (RNP) и оболочки. Для представителей вирусов, относящихся ко всем родам и семействам, указанным выше, были полностью определены последовательности геномов. Размеры этих геномов составляли от 9000 нуклеотидов до 19000 нуклеотидов, и в них содержалось от 5 до 10 генов. Структура и организация геномов вирусов, относящихся к MV, очень похожи и регулируются с помощью их особого способа экспрессии генов. Все геномы вирусов MV содержат три core-гена, кодирующие: нуклеопротеин (N или NP), фосфопротеин (P) и РНК-зависимую РНК-полимеразу (L). Вирусная оболочка состоит из матриксного белка (M) и одного или более трансмембранных гликопротеинов (например, G, HN и F белков), которые играют некоторую роль в сборке/ почковании вирусов, а также в процессе прикрепления и/или в проникновения вируса в клетку. Состав белков, в зависимости от рода вируса, изменяется за счет вспомогательных белков, которые либо выполняют определенные специфические регуляторные функции в транскрипции и вирусной репликации, либо включены в реакции клетки-хозяина вируса (например, C, V и NS белки). Порядок генов вирусов MV является высоко консервативным: core-гены N и P находятся в или рядом с 3'-концевой областью, а большой (L) ген находится в 5'-концевом участке. Поверхностные гликопротеиновые гены M, так же, как и другие вспомогательные гены, локализованы между N, P и L генами.

В комплексе RNP геномная или антигеномная РНК тесно связана с белком N и ассоциирована с РНК-зависимой РНК-полимеразой, которая состоит из белков L и P. После инфицирования клетки этот комплекс RNP, а не только геном РНК, служит в качестве матрицы в двух различных процессах синтеза РНК: транскрипции субгеномных мРНК и репликации геномной РНК полной длины.

Все тандемно организованные гены разделены структурами, называемыми «генными соединениями». Генное соединение включает в себя консервативную последовательность «конца гена» (GE), нетранскрибируемый «межгенный участок» (IGR) и консервативную последовательность «генного старта» (GS). Эти последовательности являются необходимыми и достаточными для транскрипции гена. Во время транскрипции каждый ген последовательно транскрибируется в мРНК с помощью вирусной РНК-зависимой РНК-полимеразы, которая начинает процесс транскрипции в 3'конце геномной РНК у первой GS последовательности. У каждого генного соединения транкрипция прерывается как результат отсоединения РНК-полимеразы у GS последовательности. Дальнейшая инициация транскрипции происходит у последующей последовательности GS, хотя и с уменьшенной эффективностью. Результатом этого прерываемого процесса, который называют также «стоп - старт», происходит снижение интенсивности транкрипции у каждого генного соединения, в результате которого 3'-проксимальные гены в геноме вирусов MV транскрибируются более интенсивно, чем последующие гены, расположенные в конечной части. Модулированная форма транскрипции генов вирусов MV, при которой каждый ген является частью отдельного цистрона или транскрипционной единицы, делает эти вирусы особенно подходящими для встраивания или экспрессии чужеродных генов. Каждая транскрипционная единица в геноме вируса MV включает в себя следующие элементы: 3'-GS-открытая рамка считывания (ORF)-GS-5'.

В 3'- и 5'-геномных концах во всех геномах вирусов MV имеется короткий нетранскрибируемый район, называемый «лидер» (около 40-50 нт) и «трейлер» (около 20-600 нт), соответственно. Лидер- и трэйлер-последовательности являются важными последовательностями, которые контролируют репликацию геномной РНК, инкапсулирование и упаковывание вирусов.

Благодаря технологии обратной генетики и освобождению инфекционного вируса MV появилась возможность манипулировать РНК-геномом этого вируса, используя его кДНК-копии.

Комплекс RNP является минимальным комплексом инициации репликации, необходимым для синтеза вирусной РНК. Инфекционный вирус MV может быть освобожден с помощью внутриклеточной ко-экспрессии (анти)геномных РНК и соответствующих белков из плазмид, управляемых (T7)РНК-полимеразой. С момента появления первой публикации Шнелля с соавт. в 1994 г.,(Schnell et al., 1994 (см. выше)) было обнаружено много видов вирусов MV с помощью первоначальной методики (или ее небольшой модификации).

Болезнь Ньюкастла и птичий грипп являются серьезными заболеваниями птиц, которые могут вызвать значительные экономические потери в производстве домашней птицы во всем мире. Вирус болезни Ньюкастла - это несегментированный вирус, содержащий минус-нитевую РНК, относящийся к порядку MV. Геном, длина которого составляет 15 тыс. п.о., содержит шесть генов, которые кодируют нуклеопротеин (NP), фосфопротеин (PN) и V белок(P/V) матриксный (M) белок, белок слияния (F), белок гемагглютинин-нейраминидаза(HN) и РНК-зависимую РНК-полимеразу или большой (L) белок. Гены NDV организованные последовательно в следующем порядке 3'-NP-P-M-F-HN-L-5', они разделены межгенными участками разной длины. Каждому гену предшествует последовательность генного старта (GS), за которой следуют некодирующий участок, открытая рамка считывания, кодирующая белки NDV, второй некодирующий участок и последовательность конца гена. Длину NDV генома составляют шесть компонентов, и это необходимо учитывать при введении чужеродных генов.

Птичий грипп (AI) - это заболевание домашней птицы, для которого характерны как мягкие респираторные проявления, так и тяжелое протекание болезни с высоким уровнем смертности. Возбудителем заболевания является вирус птичьего гриппа А (AIV), принадлежащий к семейству Orthomyxoviridae. AIV содержит восемь сегментов геномной РНК отрицательной полярности, которые кодируют 10 белков. На основе антигенных свойств поверхностных гликопротеинов - гемагглютинина (HA) и нейраминидазы (N), вирусы AI были подразделены на подтипы. В настоящее время известно 16 подтипов гемагглютинина (H1-H16) и девять подтипов нейраминидазы (N1-N9). Антитела к H и N являются важным фактором в гуморальном ответе, они подавляют инфекцию или предотвращают заболевание.

Вирусы птичьего гриппа и болезни Ньюкастла подразделяются на два различающихся патотипа в соответствии с их вирулентностью. Симптомы, вызываемые низкопатогенными AIV (LPAIV) или лентогенными NDV, считаются менее существенными. В отличие от этого подтипа, высокопатогенный птичий грипп (HPAI) и болезнь Ньюкастла, вызываемые высоковирулентными вирусами (NDV: мезогенные и велогенные штаммы), являются заболеваниями, подлежащими регистрации.

Для защиты домашних кур от высоковирулентных NDV штаммов проводится рутинная вакцинация против NDV с использованием лентогенными NDV штаммов, но вакцинация против HPAI в большинстве стран не проводится, поскольку HPAI контролируется с помощью ирадикации. Однако вакцинация также может быть использована для минимизации потерь и уменьшения распространения заболевания. Вызываеиый вакцинами иммунитет является видоспецифическим. Это означает, что вакцина подтипа H5 может защищать от H5 AIV, но не от других H подтипов. Обычно репликация вируса гриппа локализована в дыхательном тракте, поскольку гемагглютенин вирусов LPAI может быть расщеплен только с помощью триптазы Clara, сериновой протеазы, локализованой в дыхательном тракте. До сих пор все вирусы HPAI являлись подтипами H5 и H7. Эти вирусы HPAI содержат множественные последовательности основных аминокислот в сайте расщепления H, поэтому он может расщепляться с помощью встречающегося в разных тканях фурина и субтилизиноподобных ферментов на субъединицы HA1 и HA2. Такие вирусы способны, следовательно, размножаться и в других органах.

Вакцины против вирусов подтипов H5 и H7 могут обеспечивать защиту кур и индеек от клинических проявлений и гибели после заражения HPAI. Было доказано экспериментально, что кроме обычных инактивированных масляных цельновирионных AIV, эффективными средствами иммунизации против AI являются также векторный вирус, субъединичный белок и ДНК-вакцины. Создание рекомбинантных вирусов с целью их использования в качестве вакцинных векторов является важным следствием применения методов обратной генетики к различным вирусам. Были сконструированы разные рекомбинантные минус-нитевые РНК вирусы, экспрессирующие чужеродные белки. Кроме того, гемагглютинин AIV был введен в различные векторные вирусы, такие как вирус инфекционного ларинготрахеита (ILTV) (Luschow et al., Vaccine 19, 4249-59, 2001), вирус чумы крупного рогатого скота (Rinderpest virus) (Walsh et al., J. Virol. 74, 10165-75, 2000) и вирус везикулярного стоматита (VSV) (Roberts et al., J. Virol. 247, 4704-11, 1998). NDV используется также для экспрессии гемагглютинина AIV. Ген гемагглютинина гриппа A/WSN/33 был встроен между P и M генами NDV штамма Hitchner B1. Этот рекомбинант защищал мышей от летальной инфекции, хотя у мышей наблюдалась значительная потеря веса, они полностью выздоравливали в течение 10 дней (Nakaya et al., J. Virol. 75, 11868-73, 2001). Полученные позднее рекомбинантные NDV с такими же вставками для чужеродных генов экспрессировали H7 LPAI, однако только 40% вакцинированных кур были защищены от велогенной NDV и HPAI(Swaye et al., Avan Dis. 47, 1047-50, 2003).

HA-белки гриппа синтезируются как белки-предшественники (HA0). Полипептид-предшественник HA0 пострансляционно расщепляется у консервативного остатка аргинина (Arg) на две субъединицы: Ha1 и HA2. Это расщепление способствует инфективности вируса. (По-видимому, чем эффективней HA-предшественник расщепляется, тем более вирулентен вирус). Были проанализированы участки соединения HA1-HA2 разных вирусов гриппа. Было обнаружено, что в геноме патогенных штаммов существует участок, который содержит основные аминокислоты и непосредственно прилегает к сайту расщепления (Senne et al., Avian Diseases, 40: 425-237, 1996; Steinhauser, Virology, 258, 1-20, 1999; Kawaoka and Webster, Proc.Natl.Acad.Sci.USA, 85,1988).

Высокопатогенные вирусы особенно важны с точки зрения защиты, которую должна обеспечивать вакцина гриппа.

Однако, когда эти типы белков, то есть такие белки как HA- белки патогенного гриппа H5, содержащие основную цепь аминокислот в своей последовательности, были встроены в вектор Mononegavirales, возникали определенные проблемы.

Прежде всего, последовательность генов, по-видимому, является нестабильной в определенном отношении. После нескольких пассажей культуры клеток куриных эмбрионов вектора NDV, в который был встроен ген H5 (NDVH5), происходили спонтанные мутации внутри части последовательности генов, которая кодирует основную цепь аминокислот.

Кроме того, кодирующая последовательность для цепи основных аминокислот, по-видимому, содержит последовательность, которая узнается вирусом Mononegavirales как последовательность конца гена (GE). Обзор, посвященный GE-последовательностям для вирусов Mononegavirales, представлен в работе Whelan (Curr. Top. Microbiol. Immunol., 283, 61-119, 2004). GE-последовательности для вирусов Mononegavirales характеризуются обычной консервативной последовательностью: nUUUU.

Было обнаружено, что части кодирующей последовательности для цепи основных аминокислот, таких как та, которая прилегает к участку расщепления HA-белка патогенного вируса птичьего гриппа типа H5, имеют сходство с GE-последовательностью, узнаваемой полимеразами вектора Mononegavirales как GE-последовательность. Это может привести к уменьшению уровней белковой экспрессии белка полной длины, которое может повлиять на эффективность вакцины, основанной на таком векторе.

Целью данного изобретения было создание рекомбинантного вектора вируса MV, который проявлял бы высокий уровень экспрессии белка, кодируемого чужеродным геном, встроенным в геном векторного вируса, и/или который показывал бы более высокую иммуногенность по сравнению с существующими векторными вирусами MV.

Авторы данного изобретения обнаружили, что эта цель может быть реализована с помощью рекомбинантного вируса Mononegavirales согласно изобретению.

Данное изобретение предоставляет способ получения рекомбинантного вектора вируса Mononegavirales, содержащего дополнительную транскрипционную единицу, включающую в себя чужеродный ген, операбельно связанный с последовательностью старта гена (GS) начальной части вируса Mononegavirales и последовательностью конца гена (GE) конечной части вируса Mononegavirales, характеризующуюся тем, что последовательность чужеродного гена кодирует белок. Этот белок содержит удлинение, по крайней мере, из трех основных аминокислот, состоящее из остатков аргинина (Arg) и/или лизина (Lys) и содержащее, по крайней мере, один лизин. При этом последовательность нуклеотидов чужеродного гена подобрана таким образом, что она не содержит последовательности, которая может узнаваться вирусной полимеразой вируса Mononegavirales как последовательность конца гена (GE).

Последовательность, которая может узнаваться вирусной полимеразой вируса Mononegavirales как последовательность конца гена, - это последовательность, которая содержит минимальную консервативную последовательность, имеющуюся у большинства GE-последовательностей вируса Mononegavirales, обозначаемую a/uCUUUU (для отрицательной полярности, которая является полярностью генома вирусов Mononegavirales. Для положительной полярности (уровень кДНК) этим мотивом является t/aGAAAA).

Для специфического вектора Mononegavirales использовали известную специфическую GE-последовательность (Whelan et al., (см выше)). Например, для NDV GE-последовательность, указанная в Whelan это aaucUUUUUUu (отрицательная полярность, являющаяся полярностью генома для вирусов Mononegavirales). В случае положительной полярности (уровень кДНК) в последовательности это удлинение состояло бы из остатков аденина: gAAAAAA.

В векторе, в соответствии с изобретением, такая GE-последовательность не должна находиться внутри кодирующей последовательности чужеродного белка.

Существует несколько способов достижения этой цели, открытых для квалифицированного специалиста. Чужеродная последовательность может быть отобрана так, что она по природе не содержит последовательности, которая может быть узнаваема вирусной полимеразой вируса Mononegavirales как последовательность конца гена (GE).

Например, когда последовательность чужеродного гена кодирует вирусный белок, чужеродный ген может быть получен из штамма вируса, который, по природе, несет ген, кодирующий этот белок, и кодирующая его последовательность не включает в себя потенциальную GE-последовательность (тогда как тот же ген в другом штамме этого вируса включает).

Однако, поскольку шансы получения такого варианта генной последовательности от вируса дикого типа очень малы, то более предпочтительной стратегией был бы вызов мутаций в последовательности чужеродного гена дикого типа с помощью направленного мутагенеза для изменения этой последовательности до такой степени, чтобы потенциальная GE-последовательность больше не присутствовала.

Частью данного изобретения является также создание результирующего рекомбинантного вектора вируса Mononegavirales, в котором чужеродный ген кодирует белок, содержащий удлинение, по крайней мере, из трех основных аминокислот, состоящее из остатков аргинина (Arg) и/или лизина (Lys) и содержащее, по крайней мере, один лизин; чужеродный ген которого не содержит последовательности, узнаваемой вирусной полимеразой вируса Mononegavirales как последовательность конца гена (GE).

Часть чужеродного гена, которую нужно модифицировать, особенно в том случае, если чужеродным белком является HA-белок патогенного вируса H5 птичьего гриппа, может быть частью последовательности чужеродного гена дикого типа, кодирующей цепь, по крайней мере, трех основных аминокислот.

Участок удлинения из основных аминокислот включает в себя, по крайней мере, три основные аминокислоты, отобранные из группы, состоящей из лизина (одна буква кода: K) и аргинина (одна буква кода: R), в которой, по крайней мере, одним аминокислотным остатком является лизин. Это включало бы последовательность KKK, комбинацию 2K с 1R(KKR, KRK, RKK) и комбинацию 1K и 2R (KRR, RKR и RRK), а также более длинные участки удлинения из основных аминокислот, включая специфические последовательности 3 аминокислот, упомянутые здесь. Как можно видеть из работы Steinhauser et al. (см. выше), участки удлинения из основных аминокислот, непосредственно прилегающие к сайтам расщепления в HA- белках патогенных вирусов гриппа, могут быть длиннее и могут включать такие последовательности, как RRKKR или RRRKK.

Кодоны, кодирующие лизин, это aaa и aag, тогда как кодоны, кодирующие аргинин, содержат aga и agg. Было обнаружено, что (особенно в кодирующей последовательности для HA-белка патогенного вируса H5 птичьего гриппа) кодирующая последовательность, которая кодирует основную цепь аминокислот, непосредственно прилегающей к участку расщепления белка, может содержать GE-мотив t/aGAAAA.

Для модификации GE-последовательности, находящейся внутри чужеродного гена дикого типа, должна быть внесена, по крайней мере, одна мутация, при которой внутри GE-последовательности, имеющей обычный мотив (t/aGAAAA), нуклеотид “A” участка, содержащего аденины, который изначально присутствовал в последовательности чужеродного гена дикого типа, замещают на другой нуклеотид. Фактически, если мутация внесена в “aaaa” участок, который есть часть последовательности, узнаваемой как GE-последовательность, по крайней мере, один из нуклеотидов аденина должен быть замещен на другой нуклеотид (например, гуанин(“g”)).

При изменении последовательности с помощью сайт-направленного мутагенеза, эти изменения являются преимущественно молчащими (это означает, что мутация (мутации) не приводят к мутации на уровне аминокислот). Однако также допустимы мутации на уровне нуклеотидных кислот, которые ведут к консервативным мутациям на уровне аминокислот (означающем, что одна основная аминокислота замещается на другую основную аминокислоту, например, L становится R или R становится L). Например, если в той части последовательности гена дикого типа, кодирующей основную цепь аминокислот, где, по крайней мере, один остаток лизина кодируется с помощью кодона “aaa”, то этот кодон в модифицированном чужеродном гене, встроенном в вектор данного изобретения, может быть мутирован в “aag”. Или, там, где в последовательности дикого типа особый остаток аргинина, образующий часть основной цепи аминокислот, кодируется с помощью “aga”, этот кодон в данном гене может быть мутирован в “agg”, так как, согласно изобретению, он сделан частью вектора.

По крайней мере, один кодон “aaa” (кодирующий лизин) в последовательности дикого типа может быть мутирован для создания модифицированной последовательности чужеродного гена, которая инкорпорирована в вектор данного изобретения. Такая мутация может включать замещение кодона “aaa” на кодон “aga”. Более препочтительными являются векторы, в которых, например, участок удлинения из основных аминокислот состоит, по крайней мере, из двух лизиновых аминокислот в ряд, и в которых, по крайней мере, один из этих лизинов кодируется кодоном “aag”, хотя могут быть внесены две или более мутаций. Например, в случае, если кодирующая последовательность содержит два кодона “aaa” в ряд, оба могут быть замещены на кодоны “aag”.

Для того чтобы результирующий вектор был более стабильным, желательно вносить в чужеродный ген, по крайней мере, две мутации. В тех участках, где чужеродный ген содержит два кодона “aaa” в ряд, они оба предпочтительнее подвергаются мутации, и могут быть замещены на кодоны “aag”.

Хорошие результаты были получены при работе с векторами, в которых часть чужеродного гена, кодирующая участок удлинения из основных аминокислот, содержала одну мутацию в каждом из трех или четырех последовательных кодонов, кодирующих основную аминокислоту. В случае если основная цепь включает в себя только три аминокислоты, могут быть вызваны три мутации, но, когда присутствуют четыре или более основные аминокислоты, количество вызываемых мутаций может быть больше.

Например, там, где последовательность дикого типа содержит аминокислотную последовательность RRKK, кодируемую нуклеотидной последовательностью aga aga aaa aaa (последовательность положительной полярности, в которой подчеркнут мотив потенциальной GE-последовательности), эта кодирующая последовательность может быть мутирована в agg agg aag aag, которая все еще кодирует RRKK.

Предпочтительнее, если вектором вируса Mononegavirales является вектор вируса болезни Ньюкастла (NDV) и чужеродный ген HA-белка патогенного вируса H5 птичьего гриппа.

Хорошие результаты были получены при работе с вектором NDV, в который инкорпорировали модифицированный HA-ген патогенного вируса H5 птичьего гриппа (NDVH5m).

Ген HA был инкорпорирован в межгенном участке между NDV генами слияния (F) и гемагглютинин-нейрамидазы (HN) вектора NDV. Ген HA являлся модифицированным H5-геном, в котором последовательность дикого типа “aga aga aaa aaa” была изменена на последовательность “agg agg aag aag” в соответствии со способом настоящего изобретения.

Этот вектор продуцировал значительно больше HA-транскриптов полной длины, экспрессировал значительно более высокий уровень HA и также инкорпорировал больше белков в своей оболочке.

Кроме того, NDVH5m стабильно экспрессировал модифицированный HA-ген на протяжении более 10 пассажей в культуре клеток куриных эмбрионов. Иммунизация цыплят с помощью NDVH5m индуцировала NDV- и AIVH5-специфические антитела и, после заражением летальной дозой велогенного NDV или высоко патогенного AIV, защищала кур от соответствующего клинического заболевания. Отметим, что распространения вируса гриппа не наблюдалось. Более того, иммунизация с помощью NDVH5m позволяла проводить распознавание серологическими методами вакцинированных и инфицированных полевым штаммом вируса AIV животных, основываясь на исследовании антител к нуклеопротеину (NP) AIV. Следовательно, рекомбинантный NDVH5m подходит в качестве бивалентной вакцины против NDV и AIV и может использоваться как маркерная вакцина для контроля над птичьим гриппом (AI).

Способы получения рекомбинантного вектора вируса MV, содержащего дополнительную транскрипционную единицу, включающую в себя чужеродный ген, хорошо известны в технике.

Более конкретно, в способе по изобретению, изолированная молекула нуклеиновой кислоты и геном вируса MV использовались в их кДНК форме (позитивной полярности). Это позволило легко проводить манипулирование и встраивание желаемых молекул нуклеиновых кислот в вирусный геном.

В общем, чужеродный ген мог быть встроен в разные части генома между двумя генами, например, в межгенные районы (IGR), 3'- и 5'-некодирующие участки гена, а также 3'-промотор-проксимальный (перед N/NP генами) или 5'-дистальный конец (после L-генов) генома.

Чужеродный ген мог быть успешно встроен перед геном N/NP, между NP-P, P-M, M-G/F, G/F-HN, HN-L и после L-гена.

Проще всего использовать уже существующую последовательность узнавания рестрикционных ферментов (RE) в одном из этих сайтов с помощью разрезания ферментом и встраивания подходящей кассеты транскрипции. Поскольку естественно существующие последовательности узнавания рестрикционных ферментов не всегда локализованы в желаемом участке, RE-сайты узнавания могут быть внесены в геном общепринятым способом с помощью сайт-направленного или ПЦР-мутагенеза.

Структура встраиваемой транскрипционной кассеты зависит от сайта встраивания. Например, в случае, когда транскрипционная кассета встроена в IGR, кассета может включать в себя следующие элементы: 3' RE сайт узнавания-GS-некодируюший район-ORF (чужеродного гена)-некодирующий район-GE-RE сайт узнавания 5'.

Как альтернатива, в случае, когда транскрипционная кассета встроена в 5'-некодирующий район гена природного вируса MV, кассета может состоять из: 3' RE сайт узнавания-GE-IGR-GS-некодируюший район-ORF(чужеродного гена)-некодирующий район-RE сайт узнавания 5'.

Подобным образом, в случае, когда транскрипционная кассета встроена в 3'-некодирующий район гена природного вируса MV, кассета может состоять из: 3'RE сайт узнавания-некодируюший район-ORF(чужеродного гена)-некодирующий район-GE-IGR-GS-RE сайт узнавания 5'.

Получение таких транскрипционных кассет и внесение их в геном вируса MV являются рутинными молекулярно биологическими процедурами, такими как те, что описаны в публикациях из списка литературы и в Примерах. В частности, для этой цели могут использоваться такие методы, как сайт-направленный мутагенез и ПЦР-мутагенез (Peeters et al., 1999, см. выше; Current Protocols in Molecular Biology, eds.; F.M. Ausubel et al., Wiley N.Y., 1995 edition, pages 8.5.1.-8.5.9; и Kunkel et al., Methods in Enzymology Vol. 154, 376-382, 1987).

В частности, рекомбинантный вектор вируса MV, согласно настоящему изобретению, может быть получен с помощью хорошо известного метода “обратной генетики”, который позволяет провести генетическую модификацию несегментированных, минус-нитевых РНК-вирусов порядка MV (указанных, например, в обзорах Conzelmann, K.K., Current Topics Microbiol. Immunol. 203, 1-41, 2004; и Walpita et al., FEMS Microbiol. Letters 244, 9-18, 2005).

В этом способе, соответствующую клетку котрансфицируют с помощью вектора, содержащего молекулу кДНК, включающую в себя нуклеотидную последовательность, которая кодирует геном полной длины или, что более предпочтительно, антигеном (положительной полярности) вируса MV, и одного или более векторов, содержащих молекулы кДНК, включающие в себя нуклеотидные последовательности, которые кодируют необходимые поддерживающие белки, при подходящих условиях для транскрипции и ко-экспрессии (анти)генома MV и поддерживающих белков и продуцирования рекомбинантного вектора MV. В этом методе, вышеуказанная молекула нуклеиновой кислоты, кодирующая (анти)геном вируса MV полной длины, содержит дополнительную транскрипционную единицу, как пояснялось выше.

Под вектором подразумевается репликон, такой как плазмида, фаг или космида, к которому может быть присоединен другой сегмент ДНК, так, чтобы осуществлять репликацию присоединенного сегмента ДНК и его транскрипцию и/или экспрессию в клетке, трансфицированной с помощью этого вектора.

Предпочтительнее, если вектором для транскрипции генома полной длины является плазмида, которая включает в себя последовательность кДНК, кодирующую (анти)геном вируса MV, фланкированную T7-полимеразным промотором в своем 5'-конце и рибозимной последовательностью (гепатита дельта) в своем 3'-конце, хотя могут использоваться также T3- или SP6- РНК-полимеразные промоторы.

Для внутриклеточной экспрессии соответствующих поддерживающих белков используются преимущественно плазмиды, содержащие последовательности кДНК, кодирующие эти белки, под контролем соответствующих последовательностей контроля экспрессии, например, T7-полимеразного промотора.

В особенно предпочтительном варианте способа получения рекомбинантного вектора вируса MV, согласно данному изобретению, используются экспрессионные плазмиды, которые кодируют N (или NP), P и L белки вирусов MV.

Количество или пропорции трансфектированных поддерживающих плазмид, используемых в этом методе обратной генетики, меняются в широких пределах. Пропорции для поддерживающих плазмид N:P:L могут варьировать от 20:10:1 до 1:1:2, а для каждого вируса известны эффективные методики трансфекции.

В трансфицированной клетке формируется точная копия геномной РНК с помощью комбинированного действия T7 РНК-полимеразного промотора и рибозимной последовательности, и затем эта РНК упаковывается и реплицируется с помощью вирусных структурных белков, поставляемых котрансфицируемыми экспрессионными плазмидами.

Предпочтительнее, если T7 полимераза обеспечивается рекомбинантным вирусом коровьей оспы, который инфицирует трансфицированную клетку, в частности, вирусом коровьей оспы vTF7-3, кроме того, для экспрессии T7 РНК-полимеразы могут использоваться другие рекомбинантные векторы оспы, такие как вирус оспы птиц, например, fpEFLT7pol или другие вирусные векторы.

Отделение освобожденного вируса от вируса коровьей оспы может проводиться простым физическим методом, таким как фильтрация. Освобождение вируса Сендай или NDV можно проводить с помощью инокуляции супернатана трансфицированных клеток в куриные эмбрионы.

Для трансфекции векторов транскрипции и экспрессии, которые постоянно экспрессируют (T7)РНК-полимеразу и/или один или более необходимых поддерживающих белков, даже предпочтительнее использовать клеточные линии.

Например, накопление вируса кори может быть достигнуто в клеточной линии эмбриональной почки человека, 293-3-46, которая экспрессирует как T7 РНК-полимеразу, так и поддерживающие белки вируса кори N и P (Radecke et al., EMBO J. 14, 5773-5784, 1995). Еще одной очень полезной клеточной линией, которая может выгодно использоваться в настоящем изобретении, является клеточная линия BSR, экспрессирующая T7 РНК-полимеразу, то есть клеточная линия BSR-T7/5 (Buchholz et al., J. Virol. 73, 251-259, 1999).

Кроме того, более детальная информация, касающаяся технологии обратной генетики, используемой в данном изобретении для получения вируса MV, дана в обзоре Conzelmann K.K. (см. выше) и в Примере 1.

Поскольку рекомбинантные векторы вируса MV могут стабильно экспрессировать чужеродные гены, векторы стали исследоваться с целью профилактического и терапевтического применений.

В соответствии с настоящим изобретением в рекомбинантном векторе вируса MV чужеродный ген может изменяться в зависимости от специфического вида вектора вируса MV, а также применения векторного вируса.

Чужеродный ген может кодировать антиген (другого) микробиологического патогена (например, вируса, бактерии паразита), особенно важно, что чужеродный ген кодирует антиген патогена, который способен вызывать защитный иммунный ответ.

Примерами гетерологичных генных последовательностей, которые могут быть встроены в вирусные векторы данного изобретения, являются гены гликопротеина вируса гриппа, особенно H5 и H7 гены гемагглютинина вируса птичьего гриппа, гены вируса инфекционного бурсита (IBDV), особенно VP2, гены вируса инфекционного бронхита (IBV), вируса кошачьей лейкемии, вируса собачьей чумы, вируса лошадиной инфекционной анемии, вируса бешенства, Ehrlichia, в особенности Ehrlichia canis, респираторных синцитиальных вирусов, вирусов парагриппа, метапневмовирусов человека и вируса кори.

Альтернативно, чужеродный ген может кодировать полипептидный иммуномодулятор, который способен усиливать или модулировать иммунный ответ на вирусную инфекцию, например, при помощи коэкспрессирования цитокина, такого, как интерлейкин (например, IL-2, IL-12, IFN-y, TNF-α или GM-CSF).

К порядку MV относятся вирусы, способные реплицироваться в организме человека и/или животного (в обоих организмах может реплицироваться, например, вирус бешенства или вирус болезни Ньюкастла). Следовательно, чужеродный ген может отбираться из большого числа микробиологических патогенов человека и животных.

Несмотря на то, что в данном изобретении все вирусы MV могут использоваться как векторные вирусы, в данном изобретении в качестве рекомбинантного вектора вируса MV предлагается вирус семейства Rhabdoviridae, предпочтительнее рода Lyssavirus или Novirhabdovirus, и еще предпочтительнее - вид вируса бешенства или IHNV, соотвественно.

Также, в качестве рекомбинантного вируса MV предлагается вирус семейства Paramyxoviridae, предпочтительнее родов: Respovirus, особенно видов hPIV3 или bPIV3; Morbillivirus, особенно вид CDV; Pneumovirus, особенно вид RSV; и Avulavirus, особенно вид NDV.

В наиболее предпочтительном варианте осуществления данного изобретения в качестве рекомбинантного вектора вируса MV используется вирус болезни Ньюкастла (NDV). Известно, что NDV способен реплицироваться в организмах и человека, и животных, в частности птиц, главным образом кур. Следовательно, согласно данному изобретению, рекомбинантный вектор NDV может содержать чужеродный ген, кодирующий антиген патогена, в частности респираторного патогена, или иммуномодулятор, способный вызывать соответствующий иммунный ответ у человека или у какого-либо из этих животных.

Методы обратной генетики для генетической манипуляции NDV были представлены в работах Peeters с соавт. (J. Virology 73, 5001-5009, 1999), Römer-Oberdörfer с соавт. (J. Gen. Virol. 80, 2987-2995, 1999) и в обзоре Conzelmann, K.K. (см. выше). Кроме того, известно также, что NDV может использоваться в качестве вектора для экспрессии чужеродных генов, например для вызова иммунного ответа у животных, инфицированных вектором NDV (Nakaya et al., 2001,см. выше; Swayne et al., Avian Dis. 47, 1047-50, 2003).

Чужеродный ген может быть введен в геном NDV в различных позициях, как отмечалось выше в общем виде для вирусов MV. В частности, в рекомбинантном векторе NDV, согласно данному изобретению, чужеродный ген (как часть соответствущей транскрипционной единицы) может быть встроен между следующими генами: NP-P, P-M, M-F, F-HN, HN-L и в 3'-проксимальном-, и 5'-дистальном локусах (Zhao et al., 2003, см. выше; Nakaya et al., 2001, см.выше), предпочтительнее в 3'-проксимальном, P-M, M-F и F-HN районах, район F-HN является наиболее предпочтительным.

В частном варианте осуществления данного изобретения в рекомбинантном векторе NDV, дополнительная транскрипционная единица локализована между генами F-HN.

Рекомбинантный вектор NDV, согласно настоящему изобретению, можно использовать для индуцирования иммунного ответа у птиц, в частности у кур, направленного против других патогенов. Следовательно, рекомбинантный вектор NDV предпочтительно содержит чужеродный ген, который кодирует защитный антиген птичьего патогена, в частности: вируса гриппа, вируса болезни Марека (MDV), вируса инфекционного ларинготрахеита (ILTV), вируса инфекционного бронхита (IBV), вируса инфекционного бурсита (IBDV), вируса куриной анемии (CAV), реовируса, ретровируса птиц, аденовируса домашней птицы, вируса ринотрахеита индеек (TRTV), E. coli, вида Eimeria, Cryptosporidia, микоплазм, таких как M. gallinarum, M. synoviae и M. meleagridis, видов Salmonella, Campylobacter, Ornithobacterium (ORT) или Pasteurella sp.

Более предпочтительным является рекомбинантный вектор NDV, содержащий чужеродный ген, который кодирует антиген AIV, MDV, ILTV, IBV, TRTV, E. coli, ORT или Микоплазмы.

В частности, рекомбинантный мутант вектора NDV содержит ген гемагглютинина (HA) вируса гриппа, предпочтительно вируса птичьего гриппа (AlV), более предпочтительно высоко патогенных AIV, в частности H5 или H7 AIV.

В принципе, в этом изобретении можно использовать ген HA всех штаммов птичьего гриппа. Нуклеотидные последовательности многих генов HA уже расшифрованы, и их можно получить в банках данных нуклеотидных последовательностей, таких как GenBank или база данных NCBI.

Как отмечалось выше, в настоящем изобретении в качестве чужеродного гена может успешно использоваться ген гемагглютенина (HA), недавно изолированного высокопатогенного H5N2 подтипа AIV A/chicken/ltaly/8/98. Этот ген обратно транскрибируется, клонируется в эукариотическом экспрессионном векторе pcDNA3 (Invitrogen) и секвенируется (Lüschow et al., Vaccine, vol. 19, p. 4249-4259, 2001, и GenBank, доступ No. AJ305306). Из полученной экспрессионной плазмиды pCD-HA5 можно получать ген HA с помощью амплификации, используя специфические праймеры, которые генерируют искусственные RE-сайты узнавания, позволяющие встраивать ген HA в геномные последовательности NDV.

Как отмечалось выше, в дальнейшем ген HA высоко патогенного H7N1 подтипа AIV A/chicken/ltaly/445/99 может использоваться в данном изобретении в качестве чужеродного гена. Ген HA - обратно транскрибируется и амплифицируется с помощью ПЦР. Продукт, длиной 1711 нп, клонируется в Smal-расщепленном векторе pUC18 (Amersham) и секвенируется (Veits et al., J. Gen. Virol. 84, 3343-3352, 2003; и GenBank, доступ No. AJ580353).

В особенно полезном рекомбинантном векторе вируса MV, согласно данному изобретению, MV векторный вирус аттенуирован, то есть векторный вирус не является патогенным для животного-мишени или проявляет существенное уменьшение вирулентности по сравнению с вирусом дикого типа. Многие вирусы MV, использованные здесь в качестве вирусных векторов, уже длительное время регистрируются как безопасные живые аттенуированные вакцины, к ним относятся вирусы кори и NDV, тогда как другие вирусы, такие как SeV и VSV считаются непатогенными для людей. Кроме того, существуют обычные методы получения и скрининга аттенуированных вирусов, которые выявляют ограниченные репликацию или способность к заражению. Такие методы включают серийное культивирование вируса в гетерологичном субстрате и химический мутагенез.

Рекомбинантный вектор NDV, согласно данному изобретению, может быть получен из любого обычного штамма вакцины ND. Примерами таких подходящих штаммов NDV, входящих в состав коммерчески доступных вакцин ND, являются: Clone-30®, La Sota, Hitchner B1, NDW, C2 и AV4, Clone-30® - предпочтительный штамм.

Изобретатели также обнаружили, что рекомбинантный вектор вируса MV, согласно изобретению, способен индуцировать защитный иммунный ответ у животных.

Следовательно, в еще одном варианте осуществления этого изобретения, предоставляется вакцина против микробиологического патогена, которая содержит рекомбинантный вектор вируса MV, как пояснялось выше, в живой или инактивированной форме, и фармацевтически приемлемом носителе или разбавителе.

Вакцину, согласно изобретению, можно изготавливать обычными методами, такими как те, что обычно используются для изготовления коммерчески доступных живых или инактивированных вакцинах вируса MV.

Кратко, чувствительный субстрат инокулируют рекомбинантным вектором вируса MV и размножают вирус до того момента, пока он не реплицируется до желаемого титра, после этого содержащий вирус материал собирают. Затем собранный материал готовится как фармацевтический препарат с иммунизирующими свойствами.

В данном изобретении может использоваться любой субстрат, способный поддерживать репликацию рекомбинантного вектора вируса MV. В зависимости от вируса MV в качестве субстрата могут использоваться клетки-хозяева как прокариотического, так и эукариотического происхождения. Соответствующими клетками-хозяевами могут быть клетки позвоночных, например клетки приматов. Примерами таких клеток служат: клеточные линии человека HEK, WI-38, MRC-5 или H-239, линия клеток обезьян Vero, линия клеток грызунов CHO, BHK, линия клеток собак MDCK или клетки птиц CEF или CEK.

Наиболее подходящим субстратом, на котором, согласно данному изобретению, может размножаться рекомбинантный вектор NDV, являются куриные эмбрионы SPF. Куриные эмбрионы могут быть инокулированы, например, 0,2 мл NDV, при этом аллантоисная жидкость содержит, по меньшей мере, 1020 EID50 на яйцо. Предподчтительнее, если 9-11-дневные куриные эмбрионы инокулируют приблизительно 1050 EID50 и затем инкубируют при 37 0C в течение 2-4 дней. После 2-4 дней продукт вируса ND может быть собран, предпочтительнее посредством сбора аллантоисной жидкости. Затем жидкость можно центрифугировать в течение 10 мин. при 2500 g с последующей фильтрацией супернатана через фильтр (100 мкм).

Вакцина, согласно данному изобретению, содержит рекомбинантный вектор вируса MV вместе с фармакологически приемлемым носителем или разбавителем, обычно используемым для таких соединений.

Вакцина, содержащая живой вирус, может быть изготовлена и представлена к продаже в форме суспензии или в лиофилизированной форме. В состав носителей входят стабилизаторы, консерванты и буферы. Разбавители включают воду, водный буфер и полиолы.

В другом аспекте данного изобретения предлагается также использование вакцины, содержащей рекомбинантный вектор вируса MV в инактивированной форме. Главные преимущества инактивированной вакцины - это ее безопасность и то, что она может индуцировать высокие уровни защитных антител, сохраняющиеся длительное время.

Для инактивации вирусов, собранных после стадии размножения, необходимо ингибирование репродукции вирусов. Это может быть достигнуто с помощью хорошо известных физических и химических методов.

Если необходимо, вакцина, согласно изобретению, может содержать адьювант. Примерами, подходящих для этой цели соединений и смесей с активностью адъюванта, могут служить: гидроокись, фосфат или окись алюминия, эмульсии масло-в-воде или вода-в-масле, например, на основе минерального масла, такие как Bayol F® или Marcol 52®, или растительного масла, такие как ацетат витамина Е и сапонины.

Согласно изобретению, вакцина может вводиться в виде любой известной эффективной формы в зависимости от типа вектора вируса MV. Подходящими способами введения вакцины могут быть парентеральная, интраназальная, оральная вакцинации, а также вакцинация спреем.

Вакцина вектора NDV, согласно изобретению, преимущественно вводится в виде недорогого массового способа введения вакцины, обычно используемого для вакцинации NDV. Вакцины NDV могут вводиться через питьевую воду, а также применяться в виде спрея.

Вакцина, согласно данному изобретению, содержит в качестве активного компонента эффективную дозу рекомбинантного вектора вируса MV, то есть некоторое количество иимунизирующего MV-вирусного материала, который вызовет иммунитет у вакцинированных птиц против заражения вирулентным микробиологическим организмом. В этом случае иммунитет определяется как индукция значительно более высокого уровня защиты от смертности и клинических симптомов в популяции прошедших вакцинацию людей и животных по сравнению с невакцинированной группой. В частности, согласно изобретению, вакцина защищает большой процент вакцинированных людей и животных от проявления клинических симптомов данного заболевания и смертности.

Обычно, живая вакцина вводится в дозе 102,0-108,0 для культуры ткани/доза для инфицирования эмбриона (TC/ElD50), преимущественно в дозе в пределах 104,0-107,0 TC/ElD50. Инактивированные вакцины могут содержать антигенный эквивалент 1040-1090.

Данное изобретение включает также комбинацию вакцин, содержащих, кроме рекомбинантного вектора вируса MV, согласно данному изобретению, вакцинный штамм, способный индуцировать защиту от дополнительного патогена.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

Фиг. 1.

Строение рекомбинантного NDV, экспрессирующего AIV H5. Сигналы контроля транскрипции отмечены: серым треугольником для старта транскрипции и серым прямоугольником для последовательностей остановки транскрипции. NH ORF NDV, был замещен на H5 ORF AIV, а затем ген HN был встроен так, как описано в материалах и методах (стадии A-C). Рекомбинантный NDVH5 (стадия D) содержит аутентичную последовательность HA, тогда как рекомбинантный NDVH5m несет HA, в котором последовательность сайта расщепления была изменена с помощью молчащей мутации (стадии E-F).

Фиг. 2.

Нозерн-блот анализ транскриптов, продуцируемых NDV рекомбинантами. Тотальная РНК клеток CEK, инфицированных NDV Клон 30(NDV), NDVH5, NDVH5m или AIV A/chicken/ Italy/8/98 (H5N2), и неинфицированных клеток (NI) была выделена после 8-часового инфицирования. После разделения РНК в денатурирующем агарозном геле ее переносили на нейлоновые мембраны и гибридизовали с 32P-меченнными геноспецифичными антисмысловыми кРНК NDV-F(слева), AIV-H5 (в середине) и NDV-HN (справа). Шесть мг соответствующей РНК использовали для нозерн-блот гибридизации, за исключениеме дорожки для AIV в середине блота, где брали только 2 мг для избежания избыточного сигнала AIV. Размеры РНК-маркера указывались в тыс. п.о. слева.

Фиг. 3.

Вестерн-блот анализ белков, продуцируемых в инфицированных клетках или в инкорпорированных в NDV рекомбинанты, экспрессирующие HA AIV. Лизаты инфицированных клеток (A) или очищенные вирионы (B) NDV Clone 30, NDVH5, NDVH5m или AIV (H5N2) были также инкубированы с антисывороткой, специфичной H5-подтипа AIV (α-AIV, верхняя панель) или с NDV-специфичной антисывороткой (α-NDV; нижняя панель). Связывание выявлялось с помощью хемолюминисценции после инкубации с вторичными антителами, конъюгированными с пероксидазой.

Локализация маркерных белков указана слева, а нерасщепленные(HA0) и расщепленные формы (HA1, HA2) гемагглютинина AIV указаны справа.

В инфицированных AIV клетках или вирионах также выявлялись дополнительные вирусные белки, соответствующие NP/NA и M.

Фиг. 4.

HA-специфичные антитела, определенные при помощи теста HI (A, серые столбцы) или теста IF (A, белые столбцы). Уровни смертности и клинические индексы у цыплят, иммунизированных один раз (B,C) или два раза (D) NDVH5m (H5m), и контрольных животных (С) после заражения велогенным NDV Herts (B) или патогенным H5N2 AIV (C,D). В течение 10 дней ежедневно за животными велось наблюдение для выявления клинических признаков, их классифицировали как здоровые (0), больные (1), тяжелобольные (2) или умершие (3). Вычислялся клинический индекс, равный средней величине от количества всех цыплят на группу за этот период.

Фиг. 5.

Серологические исследования методом NP-ELISA. Сыворотка цыплят исследовалась методом непрямой NP-ELISA при разведении 1:500. Увеличенное соотношение H/N графически показано для сыворотки цыплят, иммунизированных rNDV/AIVH5-BMUT, взятой на 21 день после иммунизации (p.i.) и на 21 день после последующего заражения AIV (p.c.). Значение, равное 2,0, отмечено на графике линией из точек.

ПРИМЕРЫ

Пример 1. Строение векторов, содержащих немодифицированный (дикого типа) ген H5 и модифицированный ген H5, и экспрессия белка.

C помощью технологии обратной генетики был сконструирован вирус болезни Ньюкастла (NDV), экспрессирующий гемагглютинин (HA) вируса птичьего гриппа (AIV) подтипа H5. Клонированная копия полной длины генома лентогенного штамма NDV Clon 30 использовалась для встраивания открытой рамки считывания, кодирующей HA высокопатогенного (HP) изолята AIV A/chicken/Italy/8/98 (H5N2, Genbank, номер доступа AJ305306) в межгенном участке между генами NDV, кодирующими белок слияния(F) и гемагглютинин-нейроминидазу (HN).

После трех пассажей культуры клеток куриных эмбрионов титр рекомбинанта NDVH5 был такой же, как и титр родительского вируса Clone 30 (109 TCID50/ml), а наличие встроенного гена H5 подтверждалось с помощью ОТ-ПЦР. Для проверки правильности транскрипции чужеродного гена проводился Нозерн-блот анализ (Фиг. 2). Несмотря на то, что H5 ORF в рекомбинантном NDV и AIV(H5N2) идентичны, H5 ORF, клонированный в NDV, фланкируется приблизительно 270 нуклеотидами, происходящими от некодирующих последовательностей гена HN. Следовательно, различие в размере между NDVH5 и AIV мРНК хорошо согласуется с ожидаемым размером приблизительно 2 тыс. п.о. и 1,7 тыс. п.о. мРНК, соответственно (Фиг. 2, середина). Однако в NDV появляется второй транскрипт длиной около 1 тыс. п.о., (Фиг. 2, середина, дорожка 3).

Как показал Нозерн-блот анализ, рекомбинантный NDVH5m продуцировал только H5 транскрипт ожидаемого размера 2 тыс. п.о. (Фиг. 2, середина, дорожка 4), подтверждая, что короткий транскрипт в NDVH5 заканчивается около сайта расщеплении HA и, наиболее вероятно, представляет только HA1 район.

В результате модификации NDVH5m продуцировал в 1.8 раз больше HA (HA0) полной длины, чем NDVH5. Транскрипты HA полной длины в инфицированных AIV клетках были в 3.4 и 6 раз больше, чем в клетках, инфицированных NDVH5m и NDVH5, соответственно. В отличие от последовательности сайта расщепления H5 NDVH5, которая изменилась за 5 пассажей, последовательность NDVH5 в этом районе оставалась стабильной на протяжении анализируемых 10 пассажей (Таблица 1). Гибридизация с F и HN пробами NDV подтвердила правильную транскрипцию фланкирующих генов NDV, так как не было обнаружено различия в размерах F и HN мРНК родительского NDV Клона 30 (Фиг. 2). Кроме того, наблюдалось только небольшое уменьшение скорости транскрипции гена HN как результат встраивания HN ORF (Фиг. 2, справа).

Для подтверждения специфической экспрессии H5 AIV рекомбинантами NDV инфицированные клетки CEF подвергались непрямому тесту IF. Инкубация с NDV-специфичной антисывороткой выявила явную флуоресценцию в клетках, инфицированных Clone 30, NDVH5 и NDVH5m NDV, чего не наблюдалось в клетках, инфицированных AIV-H5N2. С другой стороны, антисыворотка, специфичная к подтипу H5 AIV, показала наличие специфической экспрессии H5 в клетках, инфицированных AIV, NDVH5 и NDVH5m, тогда как в клетках, инфицированных родительским NDV, такой экспрессии не наблюдалось. Несмотря на то, что интенсивность экспрессии H5 в инфицированных AIV клетках выше, чем в случае инфицирования обоими рекомбинантами, было обнаружено, что уровень экспрессии H5 в клетках, инфицированных рекомбинантами NDV, значителен.

Эти результаты согласуются с данными, подтверждающими, что для получения сравнимых сигналов гибридизации на РНК-гели необходимо было нанести только в 3 раза больше количества РНК NDVH или NDVH5, это показано на Фиг.2 (середина). Этот факт указывает на то, что AIV продуцировал приблизительно в 3 раза больше транскриптов и, по-видимому, настолько же больше белка. Интересно, что, по-видимому, экспрессия H5 в инфицированных NDVH5m клетках более эффективная, чем в клетках, инфицированных NDVH5, их можно было отнести к молчащим мутациям, отменяющим преждевременное окончание транскрипции H5.

Пример 2. AIV H5 белок инкорпорирован в оболочку частиц NDV.

Предыдущие исследования показали, что инкорпорация чужеродных белков в оболочку вирусов могла проходить пассивно в отсутствие специфических сигналов инкорпорации (Kretzschmar, E. Et al., 1997, J. Of Virology, vol. 71, p. 5982-5989). Так как эффективность такой пассивной инкорпорации, в основном, зависит от уровня экспрессии белков, мы определяли, расщеплялся ли должным образом, а также инкорпорировался ли в оболочку рекомбинантов белок HA NDV, экспрессированный рекомбинантными вирусами (Фиг. 3). В клетках, инфицированных обоими рекомбинантами, антисыворотка, специфичная к подтипу H5 AIV, выявляла три белка с размерами молекул приблизительно 70, 50 и 25 кДа, которые, по-видимому, являлись нерасщепленным белком HA0 и расщепленными белками HA1 и HA2 (Фиг. 3A). Это показывает, что HA, экспрессируемый рекомбинантами, доступен для протеолитических ферментов. Тотальный белок HA, продуцируемый в клетках, инфицированных вирусом NDVH5, был значительно меньше, чем в случае NDVH5m, а белок HA2 в клетках, инфицированных NDVH5m, едва заметен. Как ожидали, не было выявлено реактивности в клетках, инфицированных Клоном 30 NDV, тогда как в клетках, инфицированных AIV-H5N2, были обнаружены все соответствующие виды белка HA. Так как наблюдалось увеличение AI-специфической сыворотки против всего вируса, в клетках, инфицированных AIV, были также обнаружены другие виды белка, предположительно соответствующие NP/NA и M (Фиг. 3). Интересно, что Вестерн-блот анализ очищенных вирионов показал, что белок HA успешно инкорпорировался в оболочку обоих рекомбинантов (Фиг.3B). Несмотря на то, что Вестерн-блот анализу подвергалось большее количество NDVH5-вирусного белка, количество белка HA2, инкорпорированного в NDVH5, было значительно ниже, чем количество белка HA2 в вирионах NDVH5. Этот результат показывает, что NDVH5 продуцирует и инкорпорирует намного меньше белка HA2, что, вероятно, обусловлено пригодностью меньшего количества белка как результат преждевременной терминации в сайте расщепления.

Пример 3. Рекомбинантный NDV, несущий белок HA AIV, является безопасным для цыплят.

Одним из чувствительных методов измерения степени вирулентности данного изолята NDV является определение патогенности вируса для 1-дневных цыплят после внутрицеребральной инокуляции (CEC (1992) Official Journal of the European Community L 260, 1-20). Вирусы наибольшей вирулентности дадут индексы, которые приближаются к максимальной величине 2,0, тогда как лентогенные штаммы дадут величины, близкие к 0,0. Так как гемагглютенин AIV - это важный детерминант вирулентности, для оценивания того, меняет ли экспрессия H5 вируса HPAI вирулентность NDV, определялись внутрицеребральные индексы патогенности (ICPI) для NDVH5 и NDVH5m. Величины ICPI были 0,0 при максимальной величине 2 для обоих рекомбинантов. Из этого следует, что экспрессия H5 AIV, в дополнение к его собственным белкам, незначительно влияла на вирулентность NDV. Для сравнения, вакцина NDV, содержащая живые вирусы, пригодна для использования только в случае, если ICPI лентогенного штамма вакцины ниже 0,5.

Пример 4. Рекомбинантный NDV, экспрессирующий белок HA AIV, защищает цыплят от заражения NDV и AIV.

Поскольку наблюдался более высокий уровень экспрессии белка H5 при инфицировании NDVH5m, только этот рекомбинант проверялся в экспериментах на животных. Рекомбинант NDVH5m назначался 25 трехнедельным цыплятам в дозе 106 EID50 для введения окулоназально.

В течение наблюдаемого периода все животные оставались здоровыми без каких-либо неблагоприятных реакций или клинических признаков заболевания. Как показал тест HI, H5-специфичные антитела AIV начинали обнаруживаться на 14 день в 28% сыворотки, и эта величина увеличивалась до 92% на 21 день после вакцинации (Фиг. 4A). Однако, с помощью непрямого теста IF, в 96% сыворотки на 7 день после иммунизации выявили еще более ранние признаки иммунитета против AI (Фиг. 4A).

Для определения защитного действия однократной вакцинации группы из 5, 10 вакцинированных животных и соответствующее количество контрольных животных подвергались первому раунду летальных заражений против NDV и AIV, соответственно. Как и ожидалось, 100% вакцинированных животных были защищены от летального велогенного заражения NDV, тогда как у всех контрольных животных наблюдались типичные признаки ND, и все они погибли в течение 4 дней (Фиг.4B). Заражение высоко патогенным AIV-H5N2 вызывало тяжелое заболевание у неиммунизированных цыплят с уровнем смертности 100%. Однако, все животные из группы иммунизированных NDVH5m выжили после заражения летальной дозой высоко патогенного AIV. Семь из десяти цыалят остались полностью здоровыми, а у трех животных наблюдались очень слабые респираторные симптомы. Однако, величина результирующего клинического индекса 0,05 была незначительна по сравнению с клиническим индексом 2,61 для контрольной группы (Фиг.4C). Для определения действия бустер-вакцинации у защищенных от AI цыплят, оставшиеся десять цыплят получили вторичную иммунизацию на 42 день после первой вакцинации и заражались через две недели после этого. Все животные были полностью защищены от клинического заболевания после получения летальной дозы гомологичного вируса HPAI, тогда как у всех контрольных животных в течение 4 дней развилось тяжелое заболевание и гибель, а величина клинического индекса составляла 2,66 (Фиг. 4D).

Пример 5. NDV-AI вакцина уменьшает распространение AIV.

Для того чтобы вакцина AI успешно применялась, она должна препятствовать распространению вируса, быть безопасной и эффективной в предотвращении заболевания. Чтобы определить степень распространения вируса трахейные и клоакальные мазки подвергались количественному методу ОТ-ПЦР в реальном времени в различные промежутки времени после заражения. На 2 день после заражения у всех неиммунизируванных, но зараженных цыплятах обеих контрольных групп была обнаружена вирусная РНК. Величины порогового цикла (CT) мазков цылят контрольной группы первого и второго заражения AIV изменялась в пределах 32,2-38,1 и 29,2-35,5, соответственно. Поскольку все контрольные животные умерли в течение 4 дней после заражения, в этой группе дальнейший тест не проводился. Для сравнения, у большинства иммунизированных животных вРНК не было обнаружено (49 из 60 мазков).

Пример 6. NP-ELISA выявляет циркулирующий AIV.

Наибольшее опасение, связанное с рутинной вакцинацией птиц, вызывает вероятность того, что вакцина даст возможность вирусу невыявляемо циркулировать среди птиц. Так как рекомбинантная NDV вакцина содержит только ген HA, для анализа сыворотки, взятой от вакцинированных животных до заражения и в разное время после заражения, применялся метод ELISA, основанный на высокоиммуногенном гене нуклеопротеина. До заражения антитела против NP AIV в сыворотке всех животных отсутствовали, однако у 90% и 100% цыплят на 7 и 21 дни после AIV заражения, соответственно, обнаруживалась сероконверсия NP (Фиг. 5). Это показывает, что основанный на NP тест ЕLISA способен не только дифференцировать вакцинированных животных от зараженных, то также способен выявлять любой циркулирующий вирус среди вакцинированных птиц.

Пример 7. Материалы и методы для Примеров 1-6.

Вирусы и клетки.

Рекомбинантный NDV, основанный на вакцинном штамме Clone 30, был описан ранее (Römer-Oberdörfer, A., Mundt, E., Mebatsion, T., Buchholz, U. J.&Mettenleiter, T.C. (1999), J.Gen. Virol. 80 (Pt 11), 2987-2995). Изолят вируса гриппа A/chicken/Italy/8/98 (H5N2) был любезно предоставлен I.Capua. Велогенный NDV-штамм Herts 33/56 и NDV Clone 30 вакцина (Nobilis®) была получена из компании Intervet Int, BV, Boxmeer, Нидерланды. Вирусы были размножены в 10-дневных куриных эмбрионах, свободных от специфического патогена (SPF). Для получения инфекционного NDV из кДНК использовались BSR-T7/5 клетки, стабильно экспрессирующие фаговую T7 РНК полимеразу (Buchholz, U.J., Finke, S. & Conzelmann, K.K. (1999)J.Virol. 73, 251-259).

Для исследования экспрессии белков и репликации вирусов использовались первичные фибробласты куриных эмбрионов (CEF), первичные клетки почки куриных эмбрионов (CEK) или мышечные клетки перепелов (QM9-R).

Строение рекомбинантных вирусов, экспрессирующих ген H5 AIV.

Для встраивания гена H5 AIV использовалась плазмида pflNDV-1, экспрессирующая антигеномную РНК Clone 30 полной длины (Römer-Oberdörfer, A., Mundt, E., Mebatsion, T., Buchholz, U. J. & Mettenleiter, T.C. (1999), J.Gen. Virol. 80 (Pt 11), 2987-2995). Сначала Notl/BsiWl-фрагмент (nt 4953-8852) генома Clone 30 клонировался в pUC18 плазмиде (шаг A, Фиг. 1). Затем вновь созданные сайты Ncol и Aflll были встроены (шаг B) с использованием праймеров MP1 (5'-gacaacagtcctcaaccatggaccgcgccg-3', SEQ ID NO: 1) и MP2 (5'-ctggctagttgagtcaattcttaaggagttggaaagatggc-3', SEQ ID NO: 2). Открытая считывающая рамка (ORF) H5 AIV, которую амплифицировали из плазмиды pCD-H5 (Lüschow, D., Werner, O., Mettenleiter, T.C. & Fuchs, W. (2001) Vaccine 19, 4249-4259) с помощью специфических праймеров, содержащих искусственные сайты рестрикции Ncol и Aflll (PH5F2:5'-ccttccatggagaaaatagtgcttc-3', SEQ ID NO: 3, и PH5R2: 5'-cctccttaagtataattgactcaattaaatgcaaattctgcactgcaatgatcc -3', SEQ ID NO: 4), использовалась для замещения NH ORF Clone-30 после переваривания c Ncol и AfIII (шаг C). Кроме того, новые SgfI- и SnaBI-сайты были внесены в межгенный район впереди L гена (шаг C) с использованием праймеров MP3 (5'-caaaacagctcatggtacgtaatacgggtaggacatgg-3', SEQ ID NO: 5) и MP4 (5'-gaaaaaactaccggcgatcgctgaccaaaggacgatatacggg-3', SEQ ID NO: 6). Cхожие cайты, фланкирующие ген HN (шаг D), были созданы с использованием праймеров MP3 и MP5 (5'- gaaaaaactaccggcgatcgctgaccaaaggacgatatacggg-3', SEQ ID NO: 7) с целью клонирования гена HN после H5 ORF (шаг E). Последовательность расщепления H5, похожая на последовательность терминации транскрипции NDV, была модифицирована с помощью молчащей мутации с использованием праймера MPH5F2 (5'-ggaatgtccctgaaagaaggaggaagaagagaggactatttggggc-3', SEQ ID NO: 8), как показано в шаге F Фиг. 1. Наконец, NotI/BsiWI-фрагмент pflNDV-1 был замещен подобным фрагментом, полученным из шагов E или F для создания полноразмерных клонов NDVH или NDVHm, соответственно (Фиг. 1). Длина полученных в результате клонов (17196 нуклеотидов) делится на шесть, что представляет “правило шести”. Все реакции мутагенеза, описанные здесь, были сделаны с использованием набора реактивов для сайт-направленного мутагенеза Quik Change II XL (Stratagene).

Трансфекция и получение вируса.

Для получения рекомбинантного NDV, экспрессирующего H5 AI, клоны полной длины вместе с плазмидами, экспрессирующими NP, P и L белки, были трансфицированы в клетки BSR-T7 с использованием Lipofectamine 2000 (Invitrogen) при соотношении ДНК:Lipofectamine 2000 1:1,5. Размножение вируса и подтверждение получения инфекционного вируса проводилось, в основном, методом, описанным ранее (Römer-Oberdörfer, 1999, см. выше; Engel-Herbert, I., Werner, O., Teifke, J.P., Mebatsion, T., Mettenleiter, T.C.& Römer-Oberdörfer, A. (2003) J. Virol. Methods 108, 19-28).

Нозерн-блот анализ.

CEK клетки инфицировали NDV Clone 30, NDVH5, NDVH5m или AIV-H5N2 при множественности заражения (MOI), равной 10 на клетку, и инкубировали в течение 8 ч при 37°C. Тотальную РНК инфицированных и неинфицированных клеток приготавливали (Chomczynski, P. & Sacchi, N. (1987) Analytical Biochemostry 162, 156-159), сепарировали в денатурирующих агарозных гелях и гибридизовали с радиактивно меченными кДНК, как было описано ранее (Fuchs, W. & Mettenleiter, T.C. (1996) J. Virol. 77, (Pt 9), 2221-2229). Плазмиды, содержащие открыто считывающие рамки AIV-H5N2 гемагглютинина, NDV Clone 30 F и HN использовались для транскрипции in vitro 32P-меченых кДНК (набор для проведения транскрипции Sp6/T7, Roche).

Вестерн-блот анализ.

CEK клетки инфицировали NDV Clone 30, NDVH5, NDVH5m или AIV-H5N2 при MOI, равной 5, и инкубировали в течение 30 ч при 37°C. Лизаты инфицированных клеток или вирионы, очищенные с помощью непрерывного градиента плотности сахарозы (30-60%), сепарировали с помощью SDS-PAGE и переносили на нитроцеллюлозные фильтры (Trans-Blot SD cell, Bio-Rad). Блоты инкубировали с поликлональной кроличьей антисывороткой против NDV или поликлональной куриной антисывороткой против AIV подтипа H5 (Intervet Int. BV, Boxmeer, NL). Связывание конъюгированных с пероксидазой видоспецифичных вторичных антител (Dianova) выявлялось с помощью хемолюминисценции с использованием набора с хемолюминисцентным субстратом SuperSignal West Pico (производства Pierce) на рентгеновских пленках (Hyperfilm MP, Amersham).

Эксперименты с животными.

Безопасность NDV рекомбинантов оценивалась с помощью определения индекса внутрицеребральной патогенности (ICPI) у 1-дневных цыплят согласно методу, описанному в Директиве Совета Европейского Сообщества (CEK (1992) Official Journal of the European Community L 260, 1-20). Эксперименты по вакцинации проводились на 25 трехнедельных SPF цыплятах, которым вводилось 106 ELD50 NDVH5m окулоназально. Для определения защитных возможностей рекомбинанта, через три недели после однократной вакцинации, пять вакцинированных и пять дополнительных контрольных животных заражались внутримышечно 105,3ELD50 NDV штаммом Herts 33/56. Более того, 10 вакцинированных животных и 9 дополнительных контрольных животных заражались окулоназально 107,7 ELD50 высоко патонгенным AIV H5N2. Через шесть месяцев после первой вакцинации оставшиеся десять цыплят подвергались вторичной иммунизации, затем через две недели их вместе с пятью дополнительными контрольными животными заражали такой же AI. После иммунизаций и инфицирований все птицы в течение 10 дней ежедневно обследовались для выявления клинических признаков.

Анализ распространения вирусов с помощью ОТ-ПЦР в реальном времени.

Для изучения распространения AIV на 2, 4, 8 и 14 дни после заражения были взяты орофарингеальные и клоакальные мазки для анализа с помощью ОТ-ПЦР в реальном времени. РНК из орофарингеальных и клоакальных мазков была приготовлена с помощью Tecan-Automat с использованием набора Nucleo Spin (Macherey-Nagel) или мануально с использованием набора для выделения вирусной РНК (Qiagen). Для детекции распространения AIV после заражения инфекцией, для вируса гриппа A использовался метод ОТ-ПЦР в реальном времени, основанный на амплификации гена M (18). Экстракция РНК и факторы ингибирования во время ОТ-ПЦР проверялись с помощью гетерологичной системы внутреннего контроля (19). Двойной анализ проводился на циклере MX3000p (Stratagene) с использованием одношагового набора для ОТ-ПЦР (SuperscriptTM III One-Step ОТ-ПЦР system c Platinum® Taq DNA Polymerase (Invitrogen)). Температурный профиль был следующим: 30 мин 50°С, 2 мин 94°С, затем следовали 42 цикла 30 сек при 94°С, 30 сек при 57°С и 30 сек при 68°С.

HI и NP-ELISA.

Для определения наличия антител NDV и AIVH5 на 0, 7, 14 и 21 дни проводили забор образцов крови, которые затем исследовали с помощью реакции торможения гемагглютинации (HI) по методу, описанному в Директиве Совета Европейского Сообщества (CEK (1992) Official Journal of the European Community L 260, 1-20; CEK (1992) Official Journal of the European Community L 167, 1-1620б 21). Для выявления наличия AIV-H5 антител после иммунизации дополнительно использовались сыворотки для непрямой иммунофлюоресценции (IF) c помощью инкубирования сывороток в разведении 1:100 с AIV инфицированными CEF. Антитела против AIV нуклеопротеина (NP) изучались с помощью непрямых энзим-связных иммуносорбентных анализов (ELISAs), основанных на нуклеопротеине (NP-ELISA). С этой целью, в качестве антигена использовали очищенный рекомбинантный белок слияния глутатион-S-трансфераза-NP, полученный с использованием бакуловируса, охватывающий полный кодирующий район гена NP AIV. Сыворотки, разведенные 1:300 в PBS, содержащие 0,05% Tween 20, исследовали в двух экземплярах. Связывание вторичных POD-конъюгированных козьих-антикуриных IgG (H+L) (ROCKLAND) антител выявляли с помощью цветной реакции с использованием o-фенилендиамина, а поглощение измеряли при 492 нм.

Пример 8. Строение векторов NDV, содержащих модифицированный ген H7.

В экспериментах, в основном похожих на те, что были описаны выше, сконструировали вектор NDV, несущий модифицированный ген H7. Вставка была получена из HP H7N1 AIV изолята: A/chicken/Italy/445/99, последовательность которого опубликована в GenBank под номером доступа AJ 580353; см. также: Veits, J et al. 2003 (J. of Gen. Virol., vol.84, p. 3343). Ген H7 вставлен в вектор NDV между F и HN генами и фланкирован некодирующими последовательностями от гена HN.

Потенциальная последовательность конца гена находится после района сайта расщепления H7 HA гена. Первоначальную последовательность в нуклеотидах 1195-1206: ata gaa aaa act, кодирующую аминокислоты IEKT, мутировали в: ata ga g aa g act, все еще кодирующую IEKT.

В результате наблюдалась стабильная и улучшенная экспрессия (по сравнению с экспрессией немодифицированного H7 гена) и представление модифицированной H7 последовательности с помощью вектора NDV.

1. Способ получения рекомбинантного вектора на основе вируса болезни Ньюкастла, содержащего дополнительную транскрипционную единицу, включающую ген, кодирующий белок НА патогенного вируса Н5 птичьего гриппа, операбельно связанный с последовательностью старта гена (GS) начальной части вируса болезни Ньюкастла и последовательностью конца гена (GE) конечной части вируса болезни Ньюкастла, характеризующуюся тем, что указанный белок содержит участок удлинения, состоящий, по крайней мере, из трех основных аминокислот, где указанный участок удлинения состоит из остатков аргинина (Arg) и/или лизина (Lys) и содержит, по крайней мере, один лизин, причем последовательность нуклеотидов указанного гена, кодирующего белок НА, выбрана таким образом, что она не содержит последовательности, которая может узнаваться вирусной полимеразой вируса болезни Ньюкастла как последовательность конца гена (GE).

2. Способ по п.1, характеризующийся тем, что для создания модифицированной последовательности гена, кодирующего белок НА патогенного вируса Н5 птичьего гриппа, часть последовательности дикого типа гена, кодирующего белок НА патогенного вируса Н5 птичьего гриппа, кодирующая указанный участок удлинения, состоящий, по крайней мере, из трех основных аминокислот, модифицирована с помощью сайт-направленного мутагенеза для устранения любой последовательности, которая может быть узнана вирусной полимеразой вируса болезни Ньюкастла как последовательность конца гена (GE).

3. Способ по п.2, характеризующийся тем, что внутри последовательности t/aGAAAA, изначально представленной в последовательности дикого типа гена, кодирующего белок НА патогенного вируса Н5 птичьего гриппа, по крайней мере, одна мутация внесена так, что "А" участка удлинения, включающего аденин, замещается другим нуклеотидом.

4. Способ по п.3, характеризующийся тем, что эта мутация (ции) являются молчащими.

5. Способ по п.3 или 4, характеризующийся тем, что, по крайней мере, один кодон ааа замещен на кодон aag.

6. Способ по пп.3 и 4, характеризующийся тем, что внесены, по крайней мере, две точечные мутации.

7. Способ по пп.3 и 4, характеризующийся тем, что, по крайней мере, два кодона ааа замещены на кодон aag.

8. Способ по пп.3 и 4, характеризующийся тем, что кодирующая последовательность aga aga ааа ааа замещается на кодирующую последовательность agg agg aag aag.

9. Рекомбинантный экспрессионный вектор вируса болезни Ньюкастла, содержащий дополнительную транскрипционную единицу, включающую ген, кодирующий белок НА патогенного вируса Н5 птичьего гриппа, операбельно связанный с последовательностью старта гена (GS) начальной части вируса болезни Ньюкастла и последовательностью конца гена (GE) конечной части вируса болезни Ньюкастла, характеризующуюся тем, что указанный белок содержит участок удлинения, состоящий, по крайней мере, из трех основных аминокислот, где указанный участок удлинения состоит из остатков аргинина (Arg) и/или лизина (Lys) и содержит, по крайней мере, один лизин, причем указанный ген не содержит последовательности, которая может узнаваться вирусной полимеразой вируса болезни Ньюкастла как последовательность конца гена.

10. Вектор по п.9, характеризующийся тем, что участок удлинения из основных аминокислот содержит, по крайней мере, два лизина в ряд, и в котором, по крайней мере, один из этих лизинов кодируется кодоном aag.

11. Вектор по п.9 или 10, характеризующийся тем, что участок удлинения основных аминокислот содержит последовательность аминокислот Arg Lys Lys, кодируемую последовательностью нуклеотидов aggaagaag.

12. Вакцина для защиты птиц от вирусных заболеваний, содержащая рекомбинантный вектор вируса болезни Ньюкастла по любому из пп.9-11 и фармацевтически приемлемый носитель или разбавитель.



 

Похожие патенты:

Изобретение относится к биотехнологии, к вариантам глюкоамилазы с измененными свойствами и к способам применения вариантов глюкоамилазы. .

Изобретение относится к области биотехнологии, конкретно к модификациям молекулы IL-7, и может быть использовано в медицине. .

Изобретение относится к области биотехнологии и касается способа секреторной продукции белка. .

Изобретение относится к области генной и белковой инженерии и касается рекомбинантной плазмидной ДНК pER-Hir, кодирующей гибридный белок, способный к автокаталитическому расщеплению с образованием [Leu1, Thr2]-63-десульфатогирудина, штамму Escherichia coli ER2566/pER-Hir - продуценту указанного белка и способу получения генно-инженерного [Leu1, Thr2]-63-десульфатогирудина.

Изобретение относится к области биотехнологии и касается вектора на основе рекомбинантного вируса отряда Mononegavirales и включающей такой вектор вакцины. .

Изобретение относится к области биохимии. .

Изобретение относится к области биотехнологии, а именно к рекомбинантной плазмидной ДНК pZEN16 для переноса и гетерологичной экспрессии генов в Acremonium chrysogenum. .

Изобретение относится к области ветеринарии и касается термообработанных бактеринов и эмульсионных вакцин, полученных из таких термообработанных бактеринов. .

Изобретение относится к ветеринарной вирусологии и биотехнологии и может быть использовано для изготовления вакцинных и диагностических препаратов. .
Изобретение относится к медицине, в частности к гинекологии, и может найти применение для лечения заболеваний шейки матки. .
Изобретение относится к медицине, в частности к гинекологии, и может найти применение для лечения предраковых заболеваний шейки матки. .

Изобретение относится к области молекулярной биологии, вирусологии, иммунологии и медицине. .
Изобретение относится к медицине и фармацевтической промышленности, а именно к гинекологии, и может найти применение для лечения предраковых заболеваний шейки матки.

Изобретение относится к области биотехнологии и касается вектора на основе рекомбинантного вируса отряда Mononegavirales и включающей такой вектор вакцины. .
Изобретение относится к области биотехнологии, в частности к способу получения комбинированной бивалентной, культуральной, инактивированной, концентрированной, очищенной вакцины для профилактики геморрагической лихорадки с почечным синдромом (ГЛПС)
Наверх