Плазмида 40ph, определяющая синтез щелочной фосфатазы cmap, штамм e.coli rosetta(de3)/40ph - продуцент химерного белка, включающего аминокислотную последовательность рекомбинантной щелочной фосфатазы cmap, и способ ее получения

Изобретение относится к области биохимии. Представлена плазмида, определяющая синтез щелочной фосфатазы СmАР, включающая NcoI/SacI-фрагмент плазмиды pET-40b(+) (Novagen) и фрагмент ДНК, размером 1530 пар оснований, содержащий химерный ген, состоящий из структурной части гена СmАР, адаптированной по N-концу для экспрессии в клетках E.coli, и нуклеотид, кодирующий специфическую последовательность для протеазы TEV. Описан штамм E.coli Rosetta(DE3), трансформированный указанной плазмидой, - продуцент химерного белка, включающего аминокислотную последовательность рекомбинантной щелочной фосфатазы СmАР. Предложен способ получения рекомбинантной щелочной фосфатазы СmАР, включающий стадии: инкубирования указанного штамма-продуцента в жидкой питательной среде LB в течение 12 ч при 20°С, осаждения бактериальных клеток центрифугированием, дезинтеграции суспензии клеток в буфере, центрифугирования экстракта, хроматографии надосадочной жидкости на колонке с металлоафинной смолой, элюции белка, концентрирования активных фракций ультрафильтрацией, инкубирования с протеазой TEV, концентрирования раствора белка и выделения целевого продукта гель-фильтрацией. 3 н.п. ф-лы, 1 ил., 3 пр.

 

Изобретение относится к биотехнологии, в частности к генетической инженерии, и касается способа получения рекомбинантного белка фосфатазы морской бактерии Cobetia marina (CmAP), а также плазмиды для его получения и рекомбинантного штамма Escherichia coli. Изобретение позволяет производить высокоактивную рекомбинантную щелочную фосфатазу для использования в медицине, генной инженерии и молекулярной биологии.

Щелочная фосфатаза - фермент, катализирующий удаление 5'-концевой фосфатной группы из линейной ДНК или РНК при высоком рН. Используется в генной инженерии для дефосфорилирования ДНК перед лигированием; получения конъюгатов с олигонуклеотидами для хемилюминесцентного мечения генов в гибридизационной технике; в медицине для получения иммуноконъюгатов; для получения рекомбинантных диагностических антител к клеточным рецепторам с целью создания реперных белков для диагностики и т.д.

На сегодняшний день щелочная фосфатаза морской бактерии Cobetia marina, которая нашла широкое применение в практике лабораторных исследований и иммунодиагностике, продолжает оставаться самой высокоактивной коммерческой щелочной фосфатазой в мире - 11000-14000 ед/мг [Plisova E.Y., Balabanova L.A., Ivanova Е.Р., Kozhemyako V.В., Mikhailov V.V., Agafonova E.V., Rasskazov V.A. A Highly active alkaline phosphatase from the marine bacterium Cobetia // Marine Biotechnology. - 2005. - Vol.7, N 3. - P.173-178.]. Так, наиболее активный коммерческий препарат щелочной фосфатазы из кишечника теленка, предлагаемый производителем, имеет максимальную активность 7500 ед/мг (http:www.bbienzymes.com/), активность препарата рекомбинантной щелочной фосфатазы из дрожжевого гриба Pichia pastoris - 7000 ед/мг (http:www.roche-biochem.jp/).

Известны способы получения природного белка щелочной фосфатазы из штамма-продуцента Cobetia marina [RU 2077577 C1, 20.04.1997]. Основными недостатками этого способа получения являются высокие технологические затраты при хранении и выращивание дикого штамма и очистке целевого белка в четыре этапа.

Способы получения активного рекомбинантного белка щелочной фосфатазы Cobetia marina (CmAP) пока еще не известны.

Недавно была установлена нуклеотидная последовательность предшественника СmАР (код GenBank ABD92772.1). Однако получение высокоактивной СmАР в гетерологичных бактериальных системах имеет ряд проблем. Было установлено, что сверхпродукция высокоактивной СmАР в клетке оказывает неблагоприятное воздействие на клетки хозяйских штаммов бактерий. К тому же гетерологическая экспрессия СmАР не способствует правильному фолдингу белка, что приводит к выпадению неактивного рекомбинантного белка в тельцах включения.

Задача изобретения - конструирование рекомбинантного штамма E.coli, плазмиды, кодирующей синтез рекомбинантного белка СmАР, и разработка способа его получения.

Поставленная задача решена созданием генетической конструкции в виде рекомбинантной плазмиды 40Ph и штамма E.coli Rosetta(DE3)/40Ph, обеспечивающих индуцируемый синтез с высоким и стабильным выходом активной растворимой рекомбинантной щелочной фосфатазы в периплазму клетки кишечной палочки.

Технический результат заявленного изобретения - получение активной рекомбинантной щелочной фосфатазы СmАР с высоким выходом и уровнем очистки.

Плазмида 40Ph имеет 7699 пар оснований (п.о.) и характеризуется наличием NcoI/SacI-фрагмента плазмиды pET-40b(+) (Novagen) и последовательности фрагмента ДНК размером 1530 п.о., содержащего химерный ген, состоящий из структурной части гена СmАР, адаптированной по N-концу для экспрессии в клетках E.coli, и специфической последовательности для протеазы TEV для удаления гистидинов с С-концевой части молекулы рекомбинантного белка.

На фигуре представлена физическая карта плазмиды 40Ph и область плазмиды, ответственная за экспрессию рекомбинантного белка СmАР.

Нуклеотидная последовательность фрагмента плазмиды 40Ph, фланкированная сайтами NcoI и SacI, содержит последовательность структурного гена СmАР с адаптированным N-концом для экпрессии в E.coli, соответствующую открытой рамке считывания для белка СmАР, и последовательность, специфичную для протеазы TEV (SEQ ID N 1).

Штамм E.coli Rosetta(DE3)/40Ph получен трансформацией клеток E.coli Rosetta(DE3) (Novagen) плазмидой 40Ph с использованием традиционной генно-инженерной технологии [Sambrook J., Fritsch E.F., Maniatis T. // Molecular Cloning. A. Laboratory Manual. 2bd ed. Cold Spring Harbor, NY, 1989.].

Рекомбинантный штамм E.coli Rosetta(DE3)/40Ph характеризуется следующими признаками.

Культурально-морфологические признаки.

Клетки штамма образуют крупные круглые с ровными краями, выпуклые колонии до 5 мм в диаметре, поверхность колоний гладкая, консистенция слизистая. Пигмент не накапливается. Грамотрицательны, спор не образуют, капсулы не имеют. Колонии хорошо растут на простых питательных средах (LB). При росте в жидких средах образуют интенсивную ровную муть.

Физико-биологические признаки.

Штамм E.coli Rosetta(DE3)/40Ph видотипичен по своим биохимическим свойствам. Штамм не обладает желатиназной активностью, не ферментирует лизин; расщепляет глюкозу, лактозу, маннит, сахарозу до кислоты и газа. Имеет мутацию в гене lac, обеспечивающую контроль уровня экспрессии, а также трансляцию редких кодонов. Оптимальной для роста является температура 37°С, а для продукции СmАР - 20°С. Устойчивость к антибиотикам.

Клетки штамма характеризуются устойчивостью к хлорамфениколу (34 мкг/мл) и канамицину (25 мкг/мл).

Патогенность и токсичность.

Рекомбинантный штамм E.coli Rosetta(DE3)/40Ph не патогенен и не токсичен для теплокровных животных.

Штамм хранится обычным способом в суспензии с глицерином (30%) при -20°С.

Заявляемый способ получения рекомбинантной щелочной фосфатазы СmАР заключается в культивировании клеток штамма E.coli Rosetta(DE3)/40Ph в питательной среде LB, содержащей канамицин, отделении биомассы от культуральной жидкости, разрушении микробных клеток с последующим выделением целевого продукта водной экстракцией и хроматографической очисткой ферментного препарата. Очистку целевого продукта осуществляют хроматографией на металлоафинной смоле и гель-фильтрацией.

Выход рекомбинантной СmАР в результате применения описанного способа составляет не менее 10 мг рекомбинантного белка с 1 л культуры с удельной активностью более 12000 ед/мг белка.

Рекомбинантный белок СmАР имеет молекулярную массу 56 кДа, оптимальную температуру реакции 37-45°С и его активность не зависит от присутствия ионов двухвалентных металлов в инкубационной среде. Рекомбинантная СmАР может быть успешно использована для отщепления концевых 5'-фосфатных групп в молекулах нуклеиновых кислот, а также при мечении нуклеиновых кислот, так как после окончания реакции легко инактивируется прогреванием при 60°С в течение 10 мин.

Существенными преимуществом заявляемого способа являются:

- использование штамма-продуцента E.coli Rosetta(DE3)/40Ph, что позволяет получать при биосинтезе большое количество полноразмерной и высокоактивной рекомбинантной СmАР;

- использование двухстадийной хроматографической очистки фермента, что позволяет получить чистый рекомбинантный белок за короткое время и с малыми потерями.

Способ получения функционально активного белка на основе использования гена, кодирующего щелочную фосфатазу морской бактерии С.marina, иллюстрируется следующими примерами.

Пример 1. Конструирование плазмиды 40Ph.

Рекомбинантную плазмиду 40Ph, содержащую структурный ген СmАР без лидерного пептида, кодирующий зрелую форму щелочной фосфатазы Cobetia marina, и последовательность, специфичную для пептидазы TEV, фланкированные сайтами рестрикции NcoI и SacI, конструируют на основе коммерческой плазмиды рЕТ-40b(+) (Novagen).

Фрагмент ДНК, содержащий полноразмерный ген СmАР, получают при помощи полимеразной цепной реакции с использованием геномной ДНК штамма морской бактерии Cobetia marina KMM 296 в качестве матрицы и праймеров Pho_F и Pho_R, где Pho_F - праймер, специфичный по отношению к N-концевой последовательности СmАР, Pho_R - обратный праймер, специфичный по отношению к С-концевой последовательности СmАР, включающий последовательность, специфичную для пептидазы TEV:

Pho_F:5'TTAACCATGGCAGAGATCAAGAATGTCATTCTGAT3'

Pho_R:5'TTAACTCGAGGGAACTTTCATCTCTAAGAGCTTCGCTACCACTGTCTT CAG3'

Данную реакцию проводят в следующих условиях: 10х Encyclo буфер, 50х смесь полимераз Encyclo ("Encycio PCR kit", Евроген, Москва), 50х смесь dNTP (10mM каждого), смесь праймеров (5 µМ каждого), 100 нг ДНК. Процесс амплификации состоит из следующих стадий: прогревание при 95°С - 3 мин, 35 циклов ПЦР (15 сек - 95°С, 1 мин 30 сек - 72°С) и инкубация 10 мин при 72°С.После амплификации фрагмент ДНК очищают электрофоретически в 1% агарозном геле. Фрагмент (1 мкг) обрабатывают рестриктазами NcoI и SacI в оптимальном буфере (Fermentas) в течение 3 часов, затем ферменты удаляют из реакционной среды по стандартной методике фенолом (1:1) [3]. В водную фракцию, содержащую фрагмент, добавляют 1/10 объема 0,3 М ацетата Na, pH 5,2, и 1/2 объема изопропанолового спирта и оставляют на -20°С в течение 30 мин. Затем центрифугируют при 14000 об/мин в течение 20 мин, осадок промывают 75% этанолом и высушивают при комнатной температуре. Осадок растворяют в 20 мкл.

5 мкг плазмидной ДНК рЕТ-40b(+) обрабатывают рестриктазами NcoI и SacI в соответствии с методикой, описанной выше, и из полученного гидролизата выделяют векторную часть плазмиды в 1% геле легкоплавкой агарозы.

Полученный фрагмент и векторную часть плазмиды рЕТ-40b(+) сшивают при помощи лигазной реакции в 50 мкл буфера для лигирования согласно инструкции (Fermentas). 10 мкл реакционной смеси используют для трансформации компетентных клеток E.coli Rosetta(DE3). Трансформанты высевают на LB-агар, содержащий 25 мкг/мл канамицина. После инкубирования в течение 16 час при 37°С клоны отсевают, выделяют плазмидную ДНК и анализируют на наличие мутаций при помощи автоматического секвенирования. Отбирают ДНК, содержащую необходимую последовательность, представляющую собой плазмиду 40Ph размером 7699 п.о.

Пример 2. Получение штамма E.coli Rosetta(DE3)/40Ph, трансформированного плазмидой 40Ph - продуцента химерного белка, включающего аминокислотную последовательность рекомбинантной щелочной фосфатазы СmАР.

Штамм-продуцент получают путем трансформации клеток штамма E.coli Rosetta(DE3) рекомбинантной плазмидой 40Ph. Ночную культуру (0,5 мл LB) штамма-продуцента рекомбинантной СmАР выращивают в литровой колбе в жидкой среде LB, содержащей на литр 10 г бакто-триптона, 5 г бакто-дрожжевого экстракта и 10 г NaCl, 25 мг/мл канамицина, рН 7,7, на шейкере при 200 об/мин при температуре 37°С в течение 2 часов до оптической плотности 0,6-0,8 (ОD600), затем добавляют индуктор экспрессии IPTG до конечной концентрации 0,5 мМ и инкубируют далее при 20°С в течение 12 часов.

Для определения продуктивности штамма клеточные водные экстракты анализируют электрофорезом в 12% полиакриламидном геле с додецилсульфатом натрия. Гель окрашивают Кумасси R-250 по стандартной методике и определяют относительное количество белка в полосе целевого продукта. Содержание рекомбинантного белка в растворимой клеточной фракции составляет не менее 50% от всех белков этой фракции.

Пример 3. Выделение и характеристика рекомбинантного белка щелочной

фосфатазы СmАР.

Штамм-продуцент рекомбинантной СmАР E.coli Rosetta(DE3)/40Ph инкубируют в литровой колбе в жидкой среде LB, содержащей на литр 10 г бакто-триптона, 5 г бакто-дрожжевого экстракта и 10 г NaCl, 0,5 мМ IPTG, 25 мг/мл канамицина, рН 7,7, на шейкере при 200 об/мин в течение 12 часов при 20°С. Бактериальные клетки осаждают на проточной центрифуге при 5000 об/мин в течение 10 мин. Суспензию клеток дезинтегрируют в 20 мл буфера А (0,02 М трис-HCl, рН 9.5, 0.1М NaCl, 0.01% NaN3) в течение 5×30 сек, охлаждая во льду. Затем центрифугируют при 5000 об/мин в течение 10 мин. Надосадочную жидкость собирают и помещают на колонку с металлоафинной смолой (TALON, Clontech), предварительно уравновешенную буфером А. Элюцию белка проводят буфером 20 мМ Трис-HCl, 0,5М NaCl, 100 мМ ЭДТА, рН 9,5. Активные фракции собирают, концентрируют ультрафильтрацией на мембране Amicon Ultra 50k (Millipore) и переводят в буфер 50 мМ Трис-HCl, рН 8,0, 0,1 М NaCl, 5 мМ ЭДТА для инкубирования с протеазой TEV (Invitrogen) при комнатной температуре в течение 12 часов. Раствор белка концетрируют на мембране Amicon Ultra 50k (Millipore) и наносят на колонку для гель-фильтрации с сефадексом G-75. Выход рекомбинантного белка составляет 10 мг с 1 литра культуры.

Полученный рекомбинантный полипептид определяют по первым 10 аминокислотам на автоматическом секвенаторе. Проведенное секвенирование препарата рекомбинантной щелочной фосфатазы СmАР, выделенной из клеток штамма E.coli Rosetta(DE3)/40Ph, выявило аминокислотную последовательность Ala-Glu-Ile-Lys-Asn-Val-Ile-Leu-Met-Ile, соответствующую первым 10 аминокислотам полноразмерного нативного белка СmАР с молекулярным весом 56 кДа.

Активность щелочной фосфатазы определяют по расщеплению п-НФФ. Стандартная инкубационная смесь в объеме 500 мкл содержит 15 мМ паранитрофенилфосфата (п-НФФ), 1 М диэтаноламина (ДЭА), рН 10,3 и фермент. После 30 мин инкубации при 37°С реакцию останавливают добавлением 2 мл 0,5 М NaOH. Количество образовавшегося в процессе ферментативной реакции п-НФФ определяют спектрофотометрически при 400 нм. За единицу активности щелочной фосфатазы принимают количество фермента, катализирующего освобождение 1 мкМ п-НФФ (Е400 нм 18600) в течение 1 мин инкубации. Удельную активность выражают в единицах активности фермента на 1 мг белка. Концентрацию белка в растворе определяют по методу Брэдфорд.

Полученные данные по характеристике и ферментативной активности продукта экспрессии искусственного химерного гена СmАР в клетках штамма E.coli Rosetta(DE3)/40Ph свидетельствуют о соответствии исследуемого полипептида его природному аналогу.

Как следует из приведенных примеров, заявляемая группа изобретений позволяет получать активную рекомбинантную щелочную фосфатазу СmАР с высоким выходом при относительно простой и надежной технологии.

Заявленное изобретение позволяет:

- с помощью использования штамма-продуцента E.coli Rosetta(DE3)/40Ph получать активную рекомбинантную щелочную фосфатазу СmАР;

- использование штамма-продуцента E.coli Rosetta(DE3)/40Ph позволяет получать при биосинтезе большое количество полноразмерной рекомбинантной щелочной фосфатазы СmАР;

- использование металлоафинной и гель-фильтрационной хроматографий при очистке фермента из водного экстракта клеток штамма-продуцента позволяет получать фермент с чистотой более 98%.

1. Плазмида 40Ph размером 7699 пар оснований (п.о.), определяющая синтез рекомбинантной щелочной фосфатазы морской бактерии Cobetia marina (CmAP) и характеризующаяся наличием следующих фрагментов: NcoI/SacI-фрагмента плазмиды pET-40b(+) (Novagen) и фрагмента ДНК размером 1530 п.о., содержащего химерный ген, состоящий из структурной части гена CmAP, адаптированной по N-концу для экспрессии в клетках E.coli, и нуклеотида, кодирующего специфическую последовательность для протеазы TEV (SEQ ID N 1).

2. Штамм E.coli Rosetta(DE3), трансформированный плазмидой 40Ph по п.1, - продуцент химерного белка, включающего аминокислотную последовательность рекомбинантной щелочной фосфатазы CmAP.

3. Способ получения рекомбинантной щелочной фосфатазы CmAP, характеризующийся тем, что штамм-продуцент по п.2 инкубируют в жидкой питательной среде LB в течение 12 ч при 20°С, затем бактериальные клетки осаждают центрифугированием, суспензию клеток дезинтегрируют в буфере, далее экстракт центрифугируют, затем надосадочную жидкость помещают на колонку с металлоафинной смолой, далее элюируют белок, затем активные фракции концентрируют ультрафильтрацией, переводят в буфер и инкубируют с протеазой TEV, далее раствор белка концентрируют и выделяют целевой продукт гель-фильтрацией.



 

Похожие патенты:
Изобретение относится к ветеринарии, сельскому хозяйству, медицине, биотехнологии и микробиологической промышленности и может быть использовано для защиты от инфекций, вызываемых ДНК- и РНК-содержащими вирусами.
Изобретение относится к биотехнологии и касается нового штамма гриба - продуцента 1,3- -D-глюканаз (ламинариназ). .

Изобретение относится к биотехнологии и генной инженерии и касается штамма бактерий, продуцирующего новую сайт-специфическую эндонуклеазу KroI. .

Изобретение относится к биотехнологии и представляет собой полипептид, обладающий -L-арабинофуранозидазной активностью, выбранный из следующих полипептидов: полипептид с SEQ ID No.2, полипептид, аминокислотная последовательность которого находится между положениями 28 и 400 SEQ ID No.2, фрагмент полипептида с SEQ ID No.2, обладающий активностью -L-арабинофуранозидазы, полипептид, обладающий активностью -L-арабинофуранозидазы В и проявляющий, по меньшей мере, 80% идентичность с полипептидом SEQ ID No.2.

Изобретение относится к биотехнологии и может быть использовано для сайт-специфического гидролиза ДНК, содержащей С5-метилцитозиновые основания. .
Изобретение относится к биохимии и может быть использовано в биотехнологии при получении генно-инженерных продуктов. .
Изобретение относится к биотехнологии и микробиологической промышленности и может быть использовано для защиты от инфекций, вызываемых микроорганизмами. .

Изобретение относится к области генной и белковой инженерии и касается рекомбинантной плазмидной ДНК pER-Hir, кодирующей гибридный белок, способный к автокаталитическому расщеплению с образованием [Leu1, Thr2]-63-десульфатогирудина, штамму Escherichia coli ER2566/pER-Hir - продуценту указанного белка и способу получения генно-инженерного [Leu1, Thr2]-63-десульфатогирудина.

Изобретение относится к области биотехнологии и может быть использовано в пищевой, фармацевтической и химической промышленности. .

Изобретение относится к биотехнологии, генетической инженерии и микробиологической промышленности и представляет собой рекомбинантную плазмидную ДНК, синтез металлопротеиназы Bacillus amyloliquefaciens А-50 и штамм В, amyloliquefaciens A-50, содержащий эту рекомбинантную плазмиду, - продуцент металлопротеиназы.

Изобретение относится к области биохимии. .

Изобретение относится к области биохимии

Наверх