Гибридный белок (варианты), штамм бактерий escherichia coli - продуцент гибридного белка (варианты) и способ получения безметионинового интерферона альфа-2 человека


 


Владельцы патента RU 2453604:

Общество с ограниченной ответственностью "ФАРМАПАРК" (RU)

Изобретение относится к микробиологической и медицинской промышленности, генной инженерии, биотехнологии. На основе конструирования рекомбинантных плазмидных ДНК, содержащих структурные гены интерферона альфа-2b или альфа-2а человека под контролем регулируемого промотора, получены штаммы бактерий Escherichia coli, обеспечивающие синтез в нерастворимой форме белков-предшественников зрелых безметиониновых интерферонов альфа-2b или альфа-2а человека. В составе белков-предшественников последовательности зрелых безметиониновых интерферонов альфа-2b или альфа-2а слиты с последовательностью белка SUMO (SMT3) дрожжей Saccharomyces cerevisiae. Получен штамм бактерий Escherichia coli, обеспечивающий биосинтез протеиназы ULP275 для ферментативного процессинга белков-предшественников безметиониновых интерферонов. Разработан способ получения безметиониновых интерферонов, который предусматривает сопряженное проведение процессов ренатурации, формирования дисульфидных связей и ферментативного выщепления безметиониновых интерферонов альфа-2b или альфа-2а из состава белков-предшественников под действием протеиназы ULP275. 4 н. и 2 з.п. ф-лы, 20 пр.

 

Изобретение относится к области биотехнологии и медицины и касается способа получения безметионинового (не содержащего N-концевого метионина) интерферона альфа-2 человека.

К интерферону альфа-2 человека (IFN-α2) относят два аллельных варианта интерферона: интерферон альфа-2b и интерферон альфа-2а, отличающиеся в кодирующей области одиночной нуклеотидной заменой в позиции 137 (2а:А, 2b:G). [Kaluz et al., 1993 Acta Virol. 37:97-100; Kaluz et al., 1994, Acta Virol. 38:101-4; Lee et al., 1995, J Interferon Cytokine Res. 15:341-9], которая приводит к аминокислотной замене (2а:Lys, 2b:Arg).

Интерфероны альфа-2 человека относятся к классу цитокинов,

обладающих противовирусной активностью, и являются представителями семейства альфа-интерферонов, секретируемых практически всеми типами вирус-инфицированных клеток человека [Pfeffer et al., 1998, Cancer Research 58:2489-2499].

Рекомбинантные IFN-α2 применяют для терапии вирусных и опухолевых заболеваний [Samuel, 2001, Clinical Microbiology Reviews, 14:778-809; Schadendorf et al., 2009, Annals of Oncology, 20 (Supplement 6): vi41-vi50; Pfeffer et al., 1998, Cancer Research 58:2489-2499], в том числе для лечения твердых опухолей, таких как рак мочевого пузыря, рак почки, ВИЧ-индуцированная саркома Капоши и др. [Torti, 1988, J.Clin. Oncol., 6:476-483; Vugrin et al., 1985, Cancer Treat. Rep., 69:817-820; Rios et al., 1985, J.Clin. Oncol., 3:506-512]. IFN-α2 являются основными терапевтическими средствами, используемыми для лечения хронических форм гепатитов В и С [Clark V., Nelson D.R., 2009, Clin Liver Dis, 13:351-363].

N-концевым аминокислотным остатком природных IFN-α2 является цистеин, связанный дисульфидной связью с 98 цистеином белка [Bodo G., Fogy I., 1985, The Interferon System, pp.23-27; Wetzel et al., 1981, J.Interfer. Res., 1:381-90]. В то же время у некоторой части молекул рекомбинантных IFN-α2, выделяемых из клеток Escherichia coli (E. coli), на N-конце остается дополнительный остаток метионина (формилметионина), что делает рекомбинантный IFN-α2 модифицированным белком.

Избыточный N-концевой метионин может влиять на стабильность и иммуногенность белков [Ben-Bassat A., Bauer K., 1987, Nature 326, 315], а также в ряде случаев приводит к потере их биологической активности [Rabbani et al., 1988, J Biol Chem, 263:1307-1313]. В связи с тем, что с 2005 г.Европейская Фармакопея ограничила производство и использование на территории европейских стран препаратов, содержащих модифицированный IFN-α2 [Eur. Pharm., 5th ed.: 2004], проблема удаления N-концевого метионина из состава IFN-α2 бактериального происхождения приобрела еще большее значение.

В клетках E. coli, остающихся одними из основных продуцентов рекомбинантных белков, удаление (процессинг) N-концевого метионина детерминируется радиусом бокового радикала следующего за метионином аминокислотного остатка синтезируемого белка [Hirel et al., 1989, Proc Nati Acad Sci USA, 86(21):8247-51; Dalb⌀ge et al., FEBS Lett. 1990; 266(1-2):1-3]. Однако такой процессинг часто оказывается неполным в случае гиперэкспрессии белка [Yasueda et al., 1991, Appl Microbiol Biotechnol, 36:211-215; Hwang et al., 1999, Biochem J, 338:335-342].

К числу ферментативных способов удаления N-концевого метионина из состава рекомбинантных белков относятся:

- удаление метионина с использованием метионинаминопептидазы [Shapiro et al., 1988, Anal. Biochem, 175:450-461; Solbiati et al., 1999, J Mol Biol, 290:607-14; Liao et al., 2004, Protein Science, 13:1802-1810];

- способы, основанные на биосинтезе удлиненного белка, между N-концевым метионином и зрелой частью которого введена короткая последовательность сайта узнавания какой-либо протеиназы. Последующая протеиназная обработка удлиненного белка приводит к удалению введенной последовательности вместе с N-концевым метионином [US 5665566; Belagaje et al., 1997, Protein Sci, 6:1953-1962; Hosfield Т., Lu Q., 1999, Anal Biochem, 269:10-6; Jenny R.J. et al., 2003, Protein Express Purif, 31:1-11].

Заявляемый способ основан на биосинтезе в клетках Е.coli предшественников безметиониновых интерферонов альфа-2 человека, содержащих в своем составе последовательности зрелых интерферонов, слитых с последовательностью дрожжевого белка SUMO (Small Ubiquitine-like protein Modifier) [Johnson et al., 1997, EMBO J, 16:5509-5519; Muller et al., 1998, EMBO J, 17:61-70], относящегося к семейству убиквитин-подобных белков (УПБ).

УПБ представляют собой метки белковой природы, которые в клетках эукариот используются для мечения других белков, в результате последние изменяют свою функциональную активность [Hochstrasser М., 2000, Science, 289:563-564]. Помимо убиквитина в семейство УПБ входят белки SUMO, Rub1, Hub1, ISG15, Apg12, Apg8, Urm1, Ana 1a и Ana 1b. В ходе мечения С-концевые остатки УПБ конъюгируют с ε-аминогруппами лизина на поверхности модифицируемых белков [Jentsch S., Pyrowolakis G., 2000, Trends Cell Biol, 10:335-342; Muller et al., 2001, Nat Rev Mol Cell Biol 2:202-210]. В основе большинства способов биотехнологического использования белков семейства УПБ, за исключением APG12 и URM1, лежит их природное свойство синтезироваться в виде удлиненных предшественников, подвергающихся пост-трансляционному процессингу, приводящему к высвобождению универсальной С-концевой последовательности Гли-Гли [Malakhov et al., 2004, J Struct Funct Genom, 5:75-86].

В геноме дрожжей Saccharomyces cerevisiae (S.cerevisiae) содержится ген SMT3, расположенный между нуклеотидными позициями 1469403-1469708 хромосомы IV [база данных NCBI]. Ген SMT3 кодирует белок SMT3p - дрожжевой SUMO. Дрожжевой SUMO синтезируется в виде 101-аминокислотного предшественника, из которых 98 составляют зрелый белок, из которых остатки 13-98 важны для формирования его нативной структуры [Mossessova E., Lima С.D., 2000, Mol Cell, 5:865-876]. Эукариотические SUMO, включая дрожжевой SMT3p, имеют сходную трехмерную структуру, которая подобна структуре убиквитина и характеризуется плотно уложенными бета-слоями, обернутыми вокруг единственной альфа-спирали [Ваyеr et аl., 1998, J Mol Biol, 280:275-286]. Как и другие члены семейства УПБ, белки SUMO из различных организмов синтезируются в виде предшественникиов, содержащих С-концевые удлинения размером от 2 до 12 аминокислотных остатков, которые являются продолжением консервативного С-концевого мотива Гли-Гли [Muller et al., 2001, Nature, 2:202-210]. Несмотря на различные С-концевые удлинения и довольно низкую степень гомологии аминокислотных последовательностей, например, дрожжевого SUMO и SUMO-1 человека (47%), протеиназа Ulp1 дрожжей S.cerevisiae способна процессировать оба белковых предшественника [Mossessova E., Lima С.D., 2000, Mol. Cell, 5:865-876].

Протеиназа Ulp1 относится к семейству цистеиновых протеиназ ULP. Каталитический домен протеиназы Ulp1 локализован в С-концевой области белка, в частности полноценной ферментативной активностью обладает ее С-концевой фрагмент размером 275 аминокислотных остатков [Li S.-J., Hochstrasser M., 2003, J Cell Biol, 160:1069-1081; Butt et al., 2005, Protein Express Purif, 43:1-9] (в дальнейшем - протеиназа ULP275). Как и другие члены этого семейства in vivo, протеиназа Ulp1 осуществляет деконъюгацию SUMO и меченых белков-мишеней, а также отвечает за процессинг нативного предшественника SUMO. Основными наиболее известными особенностями протеиназы Ulp1 являются две: 1) действие протеиназы Ulp1 направлено на гидролиз пептидных или изопептидных связей, соединяющих консервативный С-концевой дипептид Гли-Гли зрелого SUMO и аминокислотный остаток белка-мишени; 2) связываясь с белком-мишенью, протеиназы семейства ULP узнают не отдельный сайт, а трехмерную структуру белков SUMO [Butt et al., 2005, Protein Express Purif, 43:1-9; Wilkinson, 1997, FASEB J, 11:1245-1256; Chang C.H., Back S.H., 1999, Biochem Biophys Res Commun, 266:633-640].

Свойство нативной протеиназы Ulp1 и ее С-концевого фрагмента распознавать белок SUMO и его производные в составе конъюгатов и предшественников и осуществлять их высокоспецифичный и эффективный процессинг практически независимо от природы аминокислотного остатка (исключая пролин), соединенного с консервативным С-концевым дипептидом Гли-Гли, лежит в основе использования искусственно созданных экспрессионных SUMO-систем. Их отличительной чертой является биосинтез целевых белков в виде гибридных предшественников, содержащих в N-концевой области последовательность белка SUMO или его производных, удаляемых, например, в ходе протеолитического процессинга in vitro [Malakhov et al., 2004, J StructFunctGenom, 5:75-86; Marblestone et al., 2006, Protein Science, 15:182-189]. SUMO-системы используют для: (1) увеличения экспрессии белков в клетках эукариотических и прокариотических организмов; (2) увеличения растворимости экспрессируемых белков; (3) облегчения процесса очистки белков за счет включения в их состав аффинных N-концевых полипептидов; (4) получения белков с измененными N-концевыми остатками [Malakhov et al., 2004, J Struct Funct Genom, 5:75-86].

Известен слитый белок, состоящий из белка SUMO дрожжей и белка IkB человека [US 6872551], который является рекомбинантным продуктом, его очищают из лизатов клеток Е.coli и расщепляют с помощью протеиназы Ulp1. Однако в отличие от IFN-α2 у белка IkB на стыке с SUMO отсутствует образующий дисульфидную связь остаток цистеина. Таким образом, Ulp1-процессинг гибрида SUMO-IkB приводит к высвобождению обычного аминоконцевого аминокислотного остатка белка IkB, а не прочного структурного элемента, содержащего дисульфидную связь, как это требуется в случае нативного безметионинового IFN-α2. По этой причине данные о результативности процессинга гибридных белков, подобных SUMO-IkB, не могли служить гарантией того, что Ulp1-процессинг будет эффективен и в отношении гибридов SUMO и нативных безметиониновых IFN-α2. Сведений о биосинтезе слитых белков IFN-α2 с белком SUMO в источниках информации не обнаружено.

Таким образом, описанные выше свойства системы SUMO-протеиназа Ulp1 можно суммировать следующим образом: 1) известно, что протеиназа Ulp1 способна гидролизовать пептидную связь, соединяющую консервативный С-концевой дипептид Гли-Гли зрелого SUMO с любым последующим аминокислотным остатком (кроме пролина), который, в свою очередь, может быть связан единичной пептидной связью со следующим аминокислотным остатком; 2) известно, что протеиназа Ulp1 способна гидролизовать изопептидную связь, соединяющую консервативный С-концевой дипептид Гли-Гли зрелого SUMO с аминокислотным остатком белка (лизином), который в свою очередь может быть связан двумя пептидными связями с соседними аминокислотными остатками белка; 3) было неизвестно, способна ли протеиназа Ulp1 гидролизовать пептидную связь, соединяющую консервативный С-концевой дипептид Гли-Гли зрелого SUMO с аминокислотным остатком белка (цистеином), который связан с другими аминокислотными остатками белка одновременно пептидной и дисульфидной связями, т.е. входит в состав необычного структурного элемента белка. Однако именно такая активность протеиназы Ulp1 была необходима для гидролиза пептидной связи между С-концевым дипептидом SUMO и N-концевым цистеином нативного IFN-α2 человека.

Ближайшим аналогом заявляемых штаммов является рекомбинантный штамм E. coli КССМ 10053 - продуцент интерферона альфа-2b человека, содержащего N-концевой метионин [KR 20000065580].

Ближайшим аналогом заявляемого способа является способ [KR 20000065580] получения безметионинового интерферона альфа-2b человека путем его выщепления ферментом метионинаминопептидазой из состава синтезированного в клетках штамма E. coli КССМ 10053 белка-предшественника, являющегося метионинсодержащим интерфероном. Основным недостатком способа - ближайшего аналога является необходимость проведения длительной (12-20 часов) ферментативной обработки белка-предшественника. Дополнительные трудности может вызывать последующий перевод безметионинового белка в биологически активное состояние в условиях, необходимых для формирования дисульфидных связей [Morehead et al., 1984, Biochemistry, 23:2500-7], а также процесс отделения целевого безметионинового интерферона от метионинсодержащего предшественника, вследствие их незначительного физико-химического отличия.

Задачей заявляемой группы изобретений является расширение арсенала способов получения безметионинового IFN-α2 человека.

Задачу решают путем конструирования:

- гибридного белка - предшественника безметионинового интерферона альфа-2, составной частью которого является последовательность безметионинового интерферона альфа-2b или альфа-2а человека, слитая с последовательностью белка SUMO дрожжей Saccharomyces cerevisiae;

- штамма бактерий Escherichia coli ВКПМ В-10414 - продуцента предшественника безметионинового интерферона альфа-2b человека;

- штамма бактерий Escherichia coli ВКПМ В-10700 - продуцента предшественника безметионинового интерферона альфа-2а человека

и разработки

- способа получения безметионинового интерферона альфа-2 человека путем микробиологического синтеза и выделения гибридного белка-предшественника безметионинового интерферона альфа-2b или альфа-2а, составной частью которого является последовательность безметионинового интерферона альфа-2b или альфа-2а человека, слитая с последовательностью белка SUMO дрожжей Saccharomyces cerevisiae, с последующим ферментативным выщеплением из его состава безметионинового интерферона путем обработки протеиназой из семейства ULP в условиях, способствующих формированию в интерфероне правильно замкнутых дисульфидных связей.

Слитые белки SUMIN и SUMIN-2a представляют собой принципиальные части гибридных белков HSI и HSI-2a - предшественников безметиониновых интерферонов альфа-2b и альфа-2а человека, соответственно, тогда как N-концевые удлинения слитых белков SUMIN и SUMIN-2a, присутствующие в составе гибридных белков HSI и HSI-2a, выполняют лишь вспомогательную роль и могут использоваться, например, на отдельных этапах очистки белков.

Заявляемый способ основан на биосинтезе гибридных белков HSI и HSI-2a - предшественников безметиониновых интерферонов альфа-2b и альфа-2а, содержащих в своем составе последовательности слитых белков SUMIN и SUMIN-2a, соответственно, и на последующем высвобождении безметиониновых интерферонов альфа-2b и альфа-2а из состава гибридных белков в ходе протеолитического процессинга с использованием протеиназы ULP275.

В основу заявляемого способа положен установленный авторами факт, заключающийся в том, что в отличие от протеиназ, активность которых ингибируется расположенным поблизости от сайта процессинга структурным элементом белка, содержащим дисульфидную связь [Hubbard et al., 1994, Protein Sci, 3:757-768; Hubbard et al., 1998, Protein Engineering, 11:349-359], протеиназа ULP275 способна эффективно гидролизовать пептидную связь вблизи такого структурного элемента. Эта открытая нами, ранее никем не описанная активность протеиназы ULP275 позволяет эффективно и корректно процессировать гибридные белки HSI и HSI-2a, в составе которых последовательность SUMO соединена пептидной связью с первым аминокислотным остатком безметионинового интерферона, соединенным с другими аминокислотными остатками белка одновременно пептидной и дисульфидной связями. Как следствие, ферментативная обработка гибридного белка HSI или HSI-2a протеиназой ULP275 приводит к высвобождению не обычной аминоконцевой последовательности, а целой N-концевой структуры безметионинового IFN-α2, содержащей корректно замкнутую дисульфидную связь.

Это впервые обнаруженное свойство системы SUMO, состоящей из заявляемого слитого белка SUMIN и протеиназы ULP275, дополняет список ранее известных свойств систем SUMO и расширяет возможности их применения.

Обнаруженное нами свойство системы SUMO используют в заявляемом способе, подвергая ферментативной обработке гибридный белок HSI или HSI-2a, содержащий корректно установленные дисульфидные связи, что позволяет проводить ферментативное расщепление предшественников безметиониновых IFN-α2 одновременно с их ренатурацией и приводит к значительному сокращению продолжительности процесса получения безметионинового IFN-α2.

Фермент протеиназу ULP275 для осуществления заявляемого способа получают с использованием сконструированного штамма E. coli ECR-ULP275 (пример 12). Биосинтез, выделение и очистку протеиназы ULP275 осуществляют, как описано в примере 17.

Для осуществления заявляемого способа конструируют штаммы E. coli: заявляемые - ВКПМ В-10414 и ВКПМ В-10700 и лабораторные - Origami-HSI и Origami-HSI-2a - продуценты гибридных белков HSI и HSI-2a - предшественников безметиониновых интерферонов альфа-2b и альфа-2а, соответственно, которые помимо слитых белков SUMIN и SUMIN-2a содержат дополнительную N-концевую последовательность из 10 остатков гистидина, что позволяет очищать белки с использованием металлохелатной аффинной хроматографии на Ni-NTA сорбенте [Porath et al.., 1975, Nature, 258:598-599].

Процесс получения заявляемых штаммов-продуцентов гибридных белков HSI и HSI-2a состоит из нескольких этапов.

Этап 1. Конструирование рекомбинантных плазмид

Рекомбинантные плазмидные ДНК конструируют на основе вектора pET-28b(+) (Novagen), обеспечивающего индуцируемую экспрессию генов в клетках E. coli под контролем промотора РНК-полимеразы Т7. Сконструированные плазмиды pET28-HSI и pET28-HSI-2a помимо векторной части содержат фрагменты ДНК размером 867 пар оснований, кодирующие гибридные белки HSI или HSI-2a - предшественники безметиониновых интерферонов альфа-2b или альфа-2а человека, соответственно.

Этап 2. Трансформация штаммов-реципиентов

В качестве штаммов-реципиентов используют штаммы E. coli BL21(DE3) и Origami 2(DE3) (Novagen), несущие в хромосоме ген РНК полимеразы фага Т7. Плазмиды pET28-HSI или pET28-HSI-2a вводят в клетки этих штаммов с помощью процесса трансформации. Клетки обоих штаммов подготавливают для трансформации с помощью обработки CaCl2 [Маниатис с соавт., 1984, М., Мир]. Трансформированные штаммы отбирают на селективной среде, содержащей антибиотик канамицина-сульфат [Маниатис с соавт., 1984, М., Мир]. В результате трансформации получают штаммы E. coli: заявляемые, сконструированные на основе реципиентного штамма BL21(DE3), и лабораторные - на основе Origami 2(DE3). Полученные штаммы в ответ на внесение в среду культивирования индуктора ИПТГ [Маниатис с соавт., 1984, М., Мир] способны синтезировать гибридные белки - предшественники безметиониновых интерферонов альфа-2b или альфа-2а человека.

Заявляемые штаммы депонированы во Всероссийской Коллекции промышленных микроорганизмов (ВКПМ) как штамм Escherichia coli ВКПМ В-10414 - продуцент предшественника безметионинового интерферона альфа-2b человека (гибридного белка HSI) и штамм Escherichia coli ВКПМ В-10700 - продуцент предшественника безметионинового интерферона альфа-2а человека (гибридного белка HSI-2a).

Свойства заявляемых штаммов ВКПМ В-10414 и ВКПМ В-10700

Морфологические

Грамотрицательные слабоподвижные палочки с закругленными концами 1,5-2,0 мкм в длину.

Через 12 часов роста при температуре 37°С на агаре Луриа [Маниатис с соавт., 1984, М., Мир] образуют беловатые полупрозрачные колонии диаметром 1,5-2,5 мм; поверхность колоний гладкая, края ровные, структура однородная, консистенция пастообразная, легко суспендируются в воде.

Через 40-48 часов роста при температуре 37°С на среде М9 [Маниатис с соавт., 1984, М., Мир] образуют серовато-беловатые полупрозрачные, слегка выпуклые с блестящей поверхностью колонии диаметром 0,5-1,5 мм.

Физиолого-биохимические

Аэробы, желатину не разжижают, индола не образуют.

В качестве источника углерода усваивают глюкозу, сахарозу и различные органические кислоты, в некоторых случаях спирты: этанол, глицерин.

В качестве источника азота используют как минеральные соли в аммонийной и нитратной формах, так и органические соединения в виде аминокислот, пептона, триптона, дрожжевого экстракта и т.д.

В качестве минеральных солей используют фосфаты калия, сульфат магния, хлорид натрия, сульфаты железа и марганца, мел.

Устойчивы к антибиотику канамицину в концентрации до 100 мкг/мл.

Растут при температуре 20-40°С рН5,0 -9,0.

Заявляемые штаммы ВКПМ В-10414 и ВКПМ В-10700 и лабораторные Origami-HSI и Origami-HSI-2a в ответ на индукцию с помощью ИПТГ или лактозы синтезируют гибридные белки HSI или HSI-2a - предшественники безметиониновых интерферонов альфа-2b или альфа-2а человека, соответственно.

Условия хранения

В лиофилизованном состоянии при температуре -70°С.

Для осуществления способа используют штаммы бактерий E. coli, несущие в составе плазмидной ДНК фрагменты ДНК, кодирующие синтез гибридного белка HSI или HSI-2a - предшественника безметионинового интерферона человека альфа-2b или альфа-2а, соответственно.

Штаммы культивируют в подходящей питательной среде, включающей источники углерода, азота и минеральные соли, обычно используемые для выращивания клеток E. coli при температуре от 24 до 37°С [Маниатис с соавт., 1984, М., Мир]. По достижении культурами штаммов ранней логарифмической фазы роста в среду культивирования вносят индуктор ИПТГ в концентрации от 0,1 до 2 мМ или лактозу в концентрации от 0,5 до 3%. Через 0.5-10 часов роста клетки штаммов-продуцентов накапливают целевые белки HSI или HSI-2a в виде нерастворимых телец включения в количестве от 5 до 30% от суммарного белка клеток. Нерастворимые тельца включения выделяют и очищают, а находящийся в их составе синтезированный гибридный белок HSI или HSI-2a подвергают растворению [RU 2319502].

Ренатурацию белка HSI или HSI-2a проводят, как описано [RU 2319502], за исключением того, что перед окончанием ренатурации в ренатурационную смесь вносят фермент - протеиназу ULP275. На этом этапе в ренатурационной смеси ведут одновременно три процесса, а именно: окончание ренатурации и окончание формирования дисульфидных связей в составе целевых белков HSI или HSI-2a, а также ферментативное удаление SUMO из их состава под действием добавленной протеиназы LJLP275. Полученный целевой продукт - ренатурированный безметиониновый интерферон альфа-2b или альфа-2а человека, содержащий корректно замкнутые дисульфидные связи, подвергают окончательной очистке.

Очищенный безметиониновый интерферон альфа-2b или альфа-2а человека имеет следующие характеристики: чистота не ниже 96%, последовательность первых пяти N-концевых аминокислот идентична последовательности нативного безметионинового IFN-α2 человека, специфическая активность составляет 2,0×108 МЕ/мг.

Пример 1. Клонирование гена интерферона альфа-2b человека

Ген интерферона альфа-2b человека амплифицируют в реакции ПЦР с использованием праймеров N466 (ataccatggaaaagagatgtgatctgcctcaaacccacagcctaggtagccgt) и N467 (atctcgagtcattctttacttcttaaggattcttgcaagttt) и матрицы на основе ДНК плазмиды pSX50 [RU 2319502], при этом в 5' - концевую область структурного гена интерферона вводят уникальный сайт рестриктазы XmaJ1 без изменения аминокислотной последовательности кодируемого белка. Полученный в результате амплификации фрагмент ДНК размером 510 п.о. элюируют из агарозного геля с использованием кита Qiagen (Qiagen, саt. №28706), элюированный фрагмент обрабатывают рестриктазами NcoI и XhoI и клонируют в векторе pUC18-NX, содержащем в составе модифицированного полилинкера плазмиды pUC18 сайты NcoI и XhoI.

В результате получают плазмиду pUC18-IFN2b, в составе которой первичную структуру клонированного гена интерферона альфа-2b человека подтверждают путем определения его нуклеотидной последовательности по стандартной методике [Zimmermann J., Voss H., Schwager С., Stegemann J., Ansorge W. 1988; FEBS Lett. 233:432-436] с использованием стандартных pUC-праймеров.

Плазмида pUC18-IFN2b несет ген интерферона альфа-2b человека, в последовательности которого содержится уникальный сайт рестриктазы XmaJ1.

Пример 2. Клонирование гена SMT3 дрожжей S.cerevisiae

Ген SMT3 амплифицируют в ходе ПЦР с использованием в качестве матрицы хромосомной ДНК штамма S.cerevisiae Y618 [Kartasheva et al., 1996, Yeast 12:1297-1300]. Амплификацию проводят в две стадии. Сначала амплифицируют два перекрывающихся фрагмента ДНК, для чего используют следующие пары праймеров:

Фрагмент 1 размером 129 п.о.:

N450 (5'-atatccatggaaaagagatctgactcagaagtcaatcaagaa)

N454 (5'-cttgaagaaaatctctgaa)

Фрагмент 2 размером 230 п.о.:

N453 (5'-ttcagagattttcttcaag)

N468 (5'-tacctaggctgtgggtttgaggcagatcacatccaccaatctgttctctgtga).

Амплифицированные фрагменты ДНК элюируют из агарозного геля, как в примере 1, и их смесь используют для ПЦР-лигирования. Для, этого проводят ПЦР-амплификацию на смеси фрагментов 1 и 2 в качестве матрицы. Праймерами для амплификации служат N450 и N468. Полученный в результате ПЦР фрагмент ДНК размером 340 п.о. элюируют из агарозного геля, обрабатывают рестриктазами NcoI и XmaJ1 и клонируют в плазмиде pUC18-IFN2b (Пример 1), содержащей ген интерферона альфа-2b и расщепленной по тем же сайтам. В результате клонирования получают плазмиду pUC18-SUMO-IFN2b, в составе которой нуклеотидную последовательность клонированного ген SMT3 подтверждают с помощью секвенирования.

Полученная плазмида pUC18-SUMO-IFN2b содержит уникальный фрагмент ДНК NcoI/XhoI, кодирующий ген гибридного белка, составной частью которого является слитый белок SUMIN (SEQ ID NO: 2), представляющий собой последовательность безметионинового интерферона альфа-2b человека, прецизионно слитого с последовательностью белка SUMO дрожжей Saccharomyces cerevisiae.

Пример 3. Конструирование гена гибридного белка HSI

Ген SMT3 амплифицируют в ходе ПЦР с использованием в качестве матрицы ДНК плазмиды pUC18-SUMO-IFN2b. Праймерами для амплификации служат N468 и N533 (5'-aaaagagatctcatcatcatcatcatcatcatcatcatcatggatccgactcagaagtcaatcaa). Амплифицированный фрагмент ДНК размером 366 п.о. элюируют из агарозного геля, как в примере 1, обрабатывают рестриктазами BglII и XmaJ1 и лигируют с AatII/BglII фрагментом вектора pUC18-SUMO-IFN2b размером 484 п.о. и XmaJI/AatII фрагментом вектора pUC18-SUMO-IFN2b размером 2652 п.о. (пример 2). В результате проделанных манипуляций в 5'-концевую область структурного гена SUMO вводят последовательность, кодирующую N-концевое удлинение белка, состоящее из 10 остатков гистидина. В результате получают плазмиду pUC18-HSI, в составе которой подтверждают структуру клонированного фрагмента ДНК.

Плазмида pUC18-HSI содержит уникальный фрагмент ДНК NcoI/XhoI, кодирующий ген гибридного белка HSI (SEQ ID NO: 1) - предшественника безметионинового интерферона альфа-2b человека. Составной частью белка HSI является последовательность слитого белка SUMIN (SEQ ID NO: 2).

Пример 4. Клонирование последовательности, кодирующей протеиназу ULP275

Последовательность ДНК, кодирующую протеиназу ULP275, амплифицируют в ходе ПЦР с использованием в качестве матрицы хромосомной ДНК лабораторного штамма S. cerevisiae Y618. Праймерами для амплификации служат N447 (5'-atatggatcctctttggaaaggaaacataagga) и N448 (5'-attagaattctttaatgcatcggttaaaatcaaatgggcaat). Амплифицированный фрагмент ДНК размером 842 пар оснований (п.о.) элюируют из агарозного геля, как в примере 1, обрабатывают рестриктазами BamHI и EcoRI и клонируют в вектор pUC18-His, содержащий в составе полилинкера последовательность ДНК, фланкированную сайтами EcoRI и XhoI и кодирующую полипептид, состоящий из 6 остатков гистидина.

В результате получают плазмиду pUC18-ULP275, в составе которой подтверждают структуру гена ULP275 путем определения его нуклеотидной последовательности по стандартной методике.

Плазмида pUC18-ULP275 содержит уникальный BamHI/XhoI фрагмент ДНК, кодирующий протеиназу ULP275, несущую на С-конце последовательность из 6 остатков гистидина, отвечающую за связывание белка с Ni-NTA-сорбентом в условиях металлохелатной хроматографической очистки.

Пример 5. Получение плазмиды pET28-HSI

Рекомбинантная плазмида pET28-HSI представляет собой совокупность SalI/NcoI фрагмента ДНК векторной плазмиды рЕТ28b(+) (Novagen) размером 5252 п.о. и NcoI/XhoI фрагмента ДНК плазмиды pUC18-HSI (пример 3) размером 839 п.о., заключающего ген HSI - гибридного предшественника безметионинового интерферона альфа 2b.

Для получения плазмиды pET28-HSI плазмиду pUC18-HSI расщепляют с помощью рестриктаз NcoI и XhoI, образовавшийся фрагмент ДНК размером 839 п.о. элюируют из геля и лигируют с ДНК вектора рЕТ28b(+), расщепленного с помощью рестриктаз NcoI и SalI. Лигирование проводят с помощью ДНК-лигазы фага Т4. В результате получают плазмиду pET28-HSI размером 6091 п.о.

Плазмида pET28-HSI является экспрессионной, ее используют для биосинтеза гибридного белка HSI, необходимого для получения рекомбинантного безметионинового интерферона альфа-2b человека. В составе плазмиды pET28-HSI ген гибридого белка HSI находится под контролем промотора фага Т7.

Пример 6. Получение плазмиды pET28-HSI-2a

Ген интерферона альфа-2а человека амплифицируют в реакции ПЦР с использованием праймеров N467 (atctcgagtcattctttacttcttaaggattcttgcaagttt) и N617 (agcctaggtagccgtcgtaccttgatgctcctggcacagatgcgtaagatctctctttt). Матрицей служит ДНК плазмиды pSX50 [RU 2319502]. Использование таких праймеров для амплификации фрагмента ДНК обеспечивает изменение последовательности гена интерферона альфа-2b человека на последовательность гена интерферона альфа-2а человека. Амплифицированный фрагмент ДНК размером 480 п.о. элюируют из агарозного геля, как в примере 1, обрабатывают рестриктазами XmaJI и XhoI и клонируют в плазмиде pET28-HSI (пример 5), расщепленной по тем же сайтам.

В результате получают плазмиду pET28-HSI-2a, в составе которой с помощью секвенирования подтверждают корректность первичной последовательности клонированного гена интерферона альфа-2а.

Плазмида pET28-HSI является экспрессионной, ее используют для биосинтеза гибридного белка HSI-2a, необходимого для получения рекомбинантного безметионинового интерферона альфа-2а человека. Составной частью белка HSI-2a является последовательность слитого белка SUMIN-2a (SEQ ID NO: 3), представляющего собой последовательность безметионинового интерферона альфа-2а человека, прецизионно слитого с последовательностью белка SUMO дрожжей Saccharomyces cerevisiae. В составе плазмиды pET28-HSI-2a ген гибридого белка HSI-2a находится под контролем промотора фага Т7.

Пример 7. Получение плазмиды pET28-ULP275

Плазмиду pET28-ULP275 получают на основе вектора рЕТ28b(+) (Novagen) в несколько стадий. Сначала из состава вектора удаляют фрагмент ДНК, расположенный между сайтами рестрикции NcoI и BamHI. Для этого ДНК плазмиды рЕТ28b(+) расщепляют с помощью рестриктаз NcoI и BamHI, образовавшиеся липкие концы достраивают до тупых с использованием фермента фрагмента Klenow ДНК-полимеразы I E. coli и лигируют с помощью ДНК-лигазы фага Т4. В результате получают плазмиду рЕТ28-NB1, в составе которой оказываются восстановлены оба использованных сайта рестрикции. На следующем этапе изменяют рамку считывания полипептида, инициируемого с кодона ATG, входящего в состав сайта NcoI. Для этого ДНК плазмиды pET28-NB1 расщепляют с помощью рестриктазы NcoI, образовавшиеся липкие концы достраивают до тупых с использованием фермента фрагмента Klenow ДНК-полимеразы I E. coli и лигируют с помощью ДНК-лигазы фага Т4. В результате получают плазмиду рЕТ28-NB2, которую используют для клонирования гена протеиназы ULP275.

Для получения плазмиды pET28-ULP275 плазмиду pUC18-ULP275 (пример 4) расщепляют с помощью рестриктаз BamHI и XhoI, образовавшийся фрагмент ДНК размером 855 п.о. элюируют из геля, как в примере 1, и лигируют с ДНК вектора pET28-NB2, расщепленного с помощью рестриктаз BamHI и XhoI. В результате получают плазмиду pET28-ULP275 размером 6091 п.о.

Плазмиду pET28-ULP275 используют для биосинтеза протеиназы ULP275. В составе плазмиды pET28-ULP275 ген протеиназы ULP275 находится под контролем промотора фага Т7.

Пример 8. Конструирование заявляемого штамма E. coli ВКПМ В-10414

В качестве штамма-реципиента используют штамм E. coli BL21(DE3) - ВКПМ В-6954. Плазмиду pET28-HSI (пример 5) вводят в клетки реципиентного штамма с помощью процесса трансформации с применением реактива CaCl2 [Маниатис с соавт., 1984, М., Мир]. Трансформант отбирают на селективной среде, содержащей антибиотик канамицина сульфат. В результате трансформации получают заявляемый штамм, который депонирован во Всероссийской Коллекции промышленных микроорганизмов (ВКПМ) как Escherichia coli ВКПМ В-10414.

Штамм ВКПМ В-10414 несет экспрессионную плазмиду pET28-HSI и в ответ на внесение в среду культивирования индуктора ИПТГ способен синтезировать гибридный белок HSI, который используют для получения безметионинового интерферона альфа-2b.

Пример 9. Конструирование заявляемого штамма Е.coli ВКПМ В-10700

Штамм ВКПМ В-10700 конструируют так же, как штамм ВКПМ В-10414 (пример 8), за исключением того, что для трансформации реципиентного штамма E. coli BL21(DE3) - ВКПМ В-6954 используют плазмиду pET28-HSI-2a (пример 6).

В результате трансформации получают заявляемый штамм, который депонирован во Всероссийской Коллекции промышленных микроорганизмов (ВКПМ) как Escherichia coli ВКПМ В-10700.

Штамм ВКПМ В-10700 несет экспрессионную плазмиду pET28-HSI-2a и в ответ на внесение в среду культивирования индуктора ИПТГ способен синтезировать гибридный белок HSI-2a, который используют для получения безметионинового интерферона альфа-2а.

Пример 10. Конструирование лабораторного штамма E. coli Origami-HS

Для конструирования лабораторного штамма E. coli в качестве штамма-реципиента используют штамм E. coli Origami 2(DE3) (Novagen) - ВКПМ В-10187, несущий в хромосоме ген РНК полимеразы фага Т7. Конструирование штамма E. coli Origami-HSI осуществляют, как в примере 8.

В результате получают лабораторный штамм E. coli Origami-HSI, который несет экспрессионную плазмиду pET28-HSI и в ответ на внесение в среду культивирования индуктора ИПТГ способен синтезировать гибридный белок HSI.

Пример 11. Конструирование лабораторного штамма E. coli Origami-HSI-2а

Лабораторный штамм E. coli Origami-HSI-2a конструируют так же, как лабораторный штамм E. coli Origami-HSI (пример 10), за исключением того, что для трансформации реципиентного штамма используют плазмиду рЕТ28-HSI-2a (пример 6).

В результате получают лабораторный штамм E. coli Origami-HSI-2a, который несет экспрессионную плазмиду pET28-HSI-2a и в ответ на внесение в среду культивирования индуктора ИПТГ способен синтезировать гибридный белок HSI-2a.

Пример 12. Конструирование штамма E.coli ECR-ULP275

Штамм E. coli ECR-ULP275 получают методом, как в примере 8, за исключением того, что для трансформации реципиентного штамма Е.coli BL21(DE3) - ВКПМ В-6954 используют плазмиду pET28-ULP275 (пример 7).

В результате трансформации получают штамм E. coli ECR-ULP275. Этот штамм несет экспрессионную плазмиду pET28-ULP275 и в ответ на внесение в среду культивирования индуктора ИПТГ способен синтезировать протеиназу ULP275, которую используют для получения безметионинового интерферона.

Пример 13. Биосинтез и выделение гибридного белка HSI из клеток заявляемого штамма ВКПМ В-10414

Штамм выращивают в колбах, содержащих по 50 мл среды 2xYT состава (в мас.%): триптон - 1,6, дрожжевой экстракт - 1, NaCl - 0,5, вода - остальное, содержащей антибиотик канамицин в концентрации 40 мкг/мл в течение 16-18 часов на орбитальной качалке со скоростью 200-300 об/мин при температуре 37°С. Затем в колбы вносят по 50 мл свежей среды 2xYT, содержащей антибиотик канамицин в концентрации 40 мкг/мл и индуктор ИПТГ в концентрации 80 мкМ. После этого продолжают культивирование в течение 3 часов.

Клеточную биомассу отделяют от среды центрифугированием (15000 g).

Из полученной биомассы выделяют и проводят отмывку тел включения, содержащих нерастворимую форму белка HSI - предшественника безметионинового интерферона. Выделение и отмывку тел включения проводят так же, как выделение и очистку нерастворимой формы интерферона [RU 2319502]. В результате получают грубую фракцию нерастворимых телец включения, содержащих предшественник безметионинового интерферона с выходом не менее 10% от сырого веса клеточной биомассы.

Пример 14. Биосинтез и выделение гибридного белка HSI-2a из клеток заявляемого штамма ВКПМ В-10700

Биосинтез и выделение гибридного белка HSI-2a проводят так же, как белка HSI (пример 13), за исключением того, что штаммом продуцентом служит заявляемый штамм ВКПМ В-10700. В результате получают грубую фракцию нерастворимых телец включения, содержащих предшественник безметионинового интерферона с выходом не менее 10% от сырого веса клеточной биомассы.

Пример 15. Биосинтез гибридного белка HSI клетками лабораторного штамма Origami-HSI

Биосинтез гибридного белка HSI клетками лабораторного штамма Origami-HSI осуществляют, как в примере 13, за исключением того, что штаммом продуцентом служит лабораторный штамм Origami-HSI. В условиях индукции клетки лабораторного штамма Origami-HSI накапливают целевой белок HSI в количестве не менее 10% от суммарного белка клеток.

Пример 16. Биосинтез гибридного белка HSI-2a клетками лабораторного штамма Origami-HSI-2a

Биосинтез гибридного белка HSI-2a клетками лабораторного штамма Origami-HSI-2a осуществляют, как в примере 13, за исключением того, что штаммом продуцентом служит лабораторный штамм Origami-HSI-2a. В условиях индукции клетки лабораторного штамма Origami-HSI-2a накапливают целевой белок HSI-2a в количестве не менее 10% от суммарного белка клеток.

Пример 17. Биосинтез, выделение и очистка протеиназы ULP275

2-3 индивидуальные колонии трансформированных клеток штамма ECR-ULP275 засевают в пробирки в 5 мл среды 2xYT, содержащей антибиотик канамицин в концентрации 40 мкг/мл и глюкозу в концентрации 20 г/л, и выращивают в течение 16-18 часов на орбитальной качалке со скоростью 200-300 об/мин при температуре 37°С. Клетки собирают центрифугированием и суспендируют в 100 мл свежей среды 2xYT, содержащей антибиотик канамицин в концентрации 40 мкг/мл. Суспензию клеток переносят в колбы и культивируют в прежних условиях в течение 1 часа, после чего к растущей культуре добавляют индуктор IPTG до концентрации 40 мкМ. Индукцию проводят в течение 3 часов, культивируя клетки в прежних условиях.

Клетки собирают центрифугированием (15000 g) и суспендируют в 5 мл буфера для лизиса клеток (буфер LB) состава 50 мМ NахН3-хРO4, рН 8,0; 300 мМ NaCl; 20 мМ Имидазол рН 8,0; вода - остальное. К клеточной суспензии добавляют лизоцим до концентрации 1 мг/мл и выдерживают смесь в течение 30 минут во льду. Суспензию озвучивают во льду 6 раз по 30 секунд с 0.5-1.0' перерывами для охлаждения при мощности ультразвукового устройства 200-300W. Лизат осветляют, подвергая его центрифугированию в течение 30 минут при 10000 g при температуре 4°С.

Колонку, содержащую 1 мл Ni-NTA агарозы (Qiagen), промывают 5 мл буфера LB, после чего на колонку наносят осветленный лизат со скоростью потока 1 мл/мин. Промывают колонку последовательно 10 мл буфера LB, 10 мл промывочного буфера состава 50 мМ NaxH3-xPO4, рН 6,0; 300 мМ NaCl; 10% глицерин; вода - остальное, содержащего Имидазол рН 6,0 в концентрации 20 мМ; и 5 мл промывочного буфера, содержащего Имидазол рН 6,0 в концентрации 150 мМ. После этого белок элюируют с колонки, используя 2 мл промывочного буфера, содержащего Имидазол рН 6,0 в концентрации 450 мМ. В полученный элюат вносят Твин-20 до концентрации 0,1%.

Полученный элюат диализуют против буфера, содержащего 50 мМ Трис-НСl рН 8.0, 150 мМ NaCl, 2 мМ дитиотрейтола и 0,1% Твин-20.

Концентрацию элюированного белка измеряют спектрофотометрически при длине волны 280 нм. Для расчетов концентрации белка используют коэффициент экстинкции Кэкс=0.94.

После измерения концентрации диализованный препарат белка протеиназы ULP275 разводят в 2 раза глицерином и хранят при -18°С.

Пример 18. Получение и очистка безметионинового интерферона альфа-2b человека

Получение и очистку интерферона альфа-2b человека без N-концевого метионина с использованием гибридного белка HSI проводят в несколько этапов.

Этап 1. Растворение, ренатурация и процессинг гибридного белка HIS

К полученной суспензии тел включения, содержащих нерастворимую форму белка HSI (пример 13), добавляют сухой гуанидин гидрохлорид (конечная концентрация составляет 6 М) или мочевину (конечная концентрация - 8 М), раствор Трис-HCl, рН 8.0 (конечная концентрация - 20 мМ), ЭДТА (конечная концентрация - 5 мМ), дитиотрейтол (конечная концентрация - 50 мМ). Полученную смесь инкубируют при комнатной температуре в течение 2 часов. Нерастворенный материал удаляют центрифугированием (15000 g), а раствор подвергают стерилизующей фильтрации через мембрану с диаметром пор 0,22 мкм.

Ренатурацию белка HSI проводят путем разбавления полученного раствора в 100 раз буфером состава: 20 мМ Трис-НСl (рН 8.0), 35 мМ NaCl, 0.8 М мочевина, 0.1% Тритон Х-114, 1 мМ окисленного глутатиона, 1 мМ восстановленного глутатиона, вода - остальное. Ренатурацию ведут в течение 18 часов при температуре +5÷12°С и постоянном перемешивании со скоростью 80 об/мин.

По истечении указанного времени в ренатурационную смесь при перемешивании со скоростью 120 об/мин добавляют раствор, содержащий протеиназу ULP-275 из расчета 4 мг протеиназы на 12 г тел включения. Полученную смесь инкубируют в течение 3 часов при температуре +12°С при постоянном перемешивании со скоростью 80 об/мин.

Ферментативное расщепление белка HSI под действием протеиназы ULP-275 останавливают путем разбавления и закисления реакционной смеси. Для этого в реакционную смесь при перемешивании со скоростью 120 об/мин добавляют в указанной последовательности следующие компоненты:

- 0,25 М раствор ЭДТА, рН 8.0 до конечной концентрации 1 мМ;

- воду очищенную, охлажденную до температуры +5°С, до 25% от объема ренатурационной смеси;

- 2,5 М раствор натрия ацетата, рН 4.5, до конечной концентрации 12,5 мМ.

Полученную смесь фильтруют с использованием через фильтр с номинальным размером пор 0,45 мкм. Полученный раствор целевого белка называют - раствор Р.

Этап 2. Захват целевого белка

Все последующие стадии очистки безметионинового интерферона альфа-2b человека проводят с использованием системы жидкостной хроматографии Akta Purifier (GE Healthcare) при температуре +2÷8°С.

Процедуру захвата целевого белка проводят с использованием колонны ХК 50/20 (GE Healthcare) с рабочим объемом 250 мл, содержащей сорбент карбоксиметил-сефарозу Fast Flow (GE Healthcare). Рабочая скорость потока 30 мл/мин. Колонну уравновешивают 650 мл буфера В-8 состава 50 мМ натрия ацетата рН 5.0, 1 мМ ЭДТА, вода - остальное, после чего наносят раствор ренатурированного и процессированного целевого белка - раствор Р. После нанесения белка колонну промывают 4 л буфера В-8. Элюцию целевого белка проводят простым линейным градиентом 0-100% буфера В-9 состава 50 мМ натрия ацетата, 0,5 М натрия хлорида, 1 мМ ЭДТА, рН 5.5, вода - остальное, объем градиента 1200 мл. Элюцию безметионинового интерферона альфа-2b отслеживают по оптической плотности при длине волны 280 нм. Полученный на этом этапе раствор безметионинового интерферона альфа-2b называют - раствор CM-1.

Этап 3. Обращеннофазная хроматография

Процедуру проводят с использованием колонны с рабочим объемом 400 мл, содержащей сорбент С18. Рабочая скорость потока - 50 мл/мин. Колонну уравновешивают 700 мл буфера А состава: 30% ацетонитрил, 0,2% трифторуксусная кислота, вода - остальное. После этого на колонну наносят раствор СМ-1 и промывают колонну 700 мл буфера А.

Элюцию безметионинового интерферона альфа-2b проводят сложным линейным градиентом 0-100% буфера В состава: 80% ацетонитрил, 0,2% трифторуксусная кислота, вода - остальное. Для элюции используют 3 л буфера В. Элюцию проводят последовательно по следующей схеме (буфер В в буфере А):

- 0-20% - 300 мл;

- 20-28% - 500 мл;

- 28-40% - 1,5 л;

- 40-60% - 600 мл;

- 60-100% - 100 мл

Элюцию безметионинового интерферона альфа-2b отслеживают, измеряя при длине волны 280 нм оптическую плотность раствора элюата. При достижении значения 50 мУЕ начинают сбор фракций по 8 мл в стеклянные пробирки, содержащие по 4 мл буфера В-11. После элюции колонну промывают 700 мл буфера В.

Собранные фракции элюата анализируют методом ВЭЖХ. Фракции, содержащие безметиониновый интерферон альфа-2b с чистотой не менее 90%, объединяют и разводят в 3 раза буфером В-11 состава: 12,5 мМ натрия ацетата, 1 мМ ЭДТА, рН 4.5. Полученный раствор называют - раствор ОФ-1.

Этап 4. Концентрирование

Процедуру проводят с использованием колонны ХК 50/20 (GE Healthcare) с рабочим объемом 250 мл, содержащей сорбент карбоксиметилсефарозу Fast Flow (GE Healthcare). Рабочая скорость потока - 30 мл/мин. Колонну уравновешивают 650 мл буфера В-8, после чего наносят раствор ОФ-1 и промывают колонну 650 мл буфера В-8. Элюцию проводят при скорости потока 15 мл/мин простым линейным градиентом 0-100% буфера В-9 протяженностью 400 мл. Элюцию безметионинового интерферона альфа-2b отслеживают, измеряя при длине волны 280 нм оптическую плотность раствора элюата. При достижении значения 50 мУЕ осуществляют сбор фракций по 10 мл в стеклянные пробирки. После элюции колонну промывают 350 мл буфера В-9.

Собранные фракции элюата анализируют методом ВЭЖХ. Фракции, содержащие целевой белок с чистотой не ниже 96%, пропускают через фильтр с диаметром пор 0,22 мкм, после чего полученный раствор безметионинового интерферона альфа-2b называют - раствор СМ-2.

Этап 5. Гель-фильтрация

Процедуру проводят с использованием колонны (GE Healthcare) с рабочим объемом 1700 мл, содержащей сорбент Superdex-75 (GE Healthcare). Рабочая скорость потока - 5 мл/мин. Колонну уравновешивают 1,7 л буфера В-10 состава: 25 мМ натрия ацетата, 150 мМ натрия хлорида, 0,5 мМ ЭДТА, рН 5.1, вода - остальное, после чего наносят раствор СМ-2 и промывают колонну 1,7 л буфера В-10. Элюцию безметионинового интерферона альфа-2b отслеживают, измеряя при длине волны 280 нм оптическую плотность раствора элюата. При достижении значения 30 мУЕ осуществляют сбор фракций в стеклянные пробирки.

Собранные фракции элюата анализируют методом ВЭЖХ. Фракции, содержащие безметиониновый интерферон альфа-2b с чистотой не ниже 96%, объединяют и пропускают через фильтр с диаметром пор 0,22 мкм.

В результате получают высокоочищенный (с чистотой не ниже 96%) препарат безметионинового интерферона альфа-2b человека,

Подлинность, концентрацию и чистоту белка в полученном препарате анализируют методом вертикального электрофореза в полиакриламидном геле с/без добавления ДТТ, с окрашиванием серебром, а также методом ВЭЖХ [Eur. Pharm., 5th ed.: 2004]. Описанный способ позволяет получить не менее 500 мг безметионинового интерферона альфа-2b из 10 г грубой фракции телец включения, содержащих белок HSI - предшественник безметионинового интерферона альфа-2b.

Пример 19. Получение и очистка безметионинового интерферона альфа-2а человека

Получение и очистку интерферона альфа-2а человека без N-концевого метионина проводят также, как и интерферона альфа-2b, за исключением того, что используют гибридный белок HSI-2a (пример 14).

В результате получают высокоочищенный (с чистотой не ниже 96%) препарат интерферона альфа-2а человека, не содержащего N-концевого метионина.

Подлинность, концентрацию и чистоту белка в полученном препарате анализируют методом вертикального электрофореза в полиакриламидном геле с/без добавления ДТТ, с окрашиванием серебром, а также методом ВЭЖХ. Описанный способ позволяет получить не менее 500 мг безметионинового интерферона альфа-2а из 10 г грубой фракции телец включения, содержащих белок HSI-2a - предшественник безметионинового интерферона альфа-2а.

Пример 20. Определение N-концевой последовательности и специфической биологической активности интерферона альфа-2b

Определяют последовательность пяти N-концевых аминокислот выделенного и очищенного интерферона альфа-2b (пример 18). Анализ проводят методом Эдмана [Edman, 1950] на секвенаторе Precise Sequencing System, model 492 (Applied Biosystems). Последовательность, определенная в результате анализа, в точности совпадает с последовательностью пяти первых аминокислотных остатков зрелого природного интерферона альфа-2 человека.

Специфическую биологическую активность выделенного и очищенного интерферона альфа-2b определяют методом La Bormardiere & Laude [1981] в культуре перевиваемых линий клеток MDBK (АТСС №CCL-22), чувствительных к интерферону альфа-типа в сравнении с международным стандартным образцом (МСО) (WHO International Standard INTERFERON ALPHA 2b, (Human rDNA derived) NIBSC code 95/566) против индикаторного вируса. В качестве индикаторного вируса используют вирус везикулярного стоматита (ВВС) штамм «Индиана» ГКВ ГУ НИИ Вирусологии им. Д.И. Ивановского РАМН (депозит №600) с инфекционным титром не менее 10-5 ТЦД50/мл или вирус энцефаломиокардита мышей (ЕМС) ГКВ ГУ НИИ Вирусологии им. Д.И. Ивановского РАМН (депозит №787) с инфекционным титром не менее 10-5 ТЦД50 в 1 мл.

Специфическая активность полученного интерферона альфа-2b составляет 2,0×108 МЕ/мг.

Таким образом, заявляемая группа изобретений позволяет:

- упростить процесс получения биологически активного безметионинового IFN-α2, благодаря использованию эффективной системы ферментативного удаления N-концевого метионина;

- сократить трудозатраты, время и расход реактивов для его получения, благодаря отсутствию необходимости раздельного проведения стадий ренатурации IFN-α2, формирования в нем дисульфидных связей и ферментативного удаления N-концевого метионина;

- облегчить решение задачи очистки нативного IFN-α2 от других продуктов реакции, благодаря использованию в процессе ферментативного расщепления гибридного белка высокоэффективной и специфичной протеиназы ULP275, а также вследствие значительного различия физико-химических свойств безметионинового IFN-α2 и его гибридного предшественника.

К заявляемой группе изобретений приложены: описания сконструированного штамма ECR-ULP275 - продуцирующего протеиназу ULP275, условия его культивирования, а также способы выделения и очистки синтезированной протеиназы.

1. Гибридный белок - предшественник безметионинового интерферона альфа-2, составной частью которого является последовательность безметионинового интерферона альфа-2 человека, слитая с последовательностью белка SUMO дрожжей Saccharomyces cerevisiae, и содержащий N-концевую последовательность из 10 остатков гистидина.

2. Гибридный белок по п.1, где последовательность безметионинового интерферона альфа-2 человека представляет собой последовательность интерферона альфа-2а.

3. Гибридный белок по п.1, где последовательность безметионинового интерферона альфа-2 человека представляет собой последовательность интерферона альфа-2b.

4. Штамм бактерий Escherichia coli ВКПМ В-10414 - продуцент гибридного белка по п.1 предшественника безметионинового интерферона альфа-2b человека.

5. Штамм бактерий Escherichia coli ВКПМ В-10700 - продуцент гибридного белка по п.1 предшественника безметионинового интерферона альфа-2а человека.

6. Способ получения безметионинового интерферона альфа-2 человека путем микробиологического синтеза и выделения белка - предшественника безметионинового интерферона альфа-2 человека с последующим ферментативным выщеплением из его состава безметионинового интерферона, отличающийся тем, что в качестве продуцента белка-предшественника используют бактериальный штамм Escherichia coli - продуцент гибридного белка предшественник безметионинового интерферона альфа-2 по п.4 или 5, а для ферментативного выщепления безметионинового интерферона используют протеиназу ULP275.



 

Похожие патенты:

Изобретение относится к биотехнологии. .

Изобретение относится к микробиологической и медицинской промышленности, генной инженерии, биотехнологии. .

Изобретение относится к микробиологической промышленности, медицинской биотехнологии и генной инженерии. .
Изобретение относится к биотехнологии и может быть использовано как стимулятор роста или компонент питательных сред для культивирования лактобактерий, а также в медицинской микробиологии.
Изобретение относится к области биотехнологии, а именно к биологически активному пептиду, который обладает антигипертонической активностью. .

Изобретение относится к области биотехнологии, в частности к генной инженерии, и может быть использовано в биомедицинской промышленности. .

Изобретение относится к генетической инженерии. .

Изобретение относится к ветеринарии, а именно к средствам для профилактики и лечения желудочно-кишечных заболеваний телят. .

Изобретение относится к области биотехнологии, конкретно к получению аналогов инсулина из их соответствующих предшественников, и может быть использовано в медицине

Изобретение относится к области биотехнологии и может быть использовано при получении рекомбинантных форм представляющих практический интерес белков. Предложен способ получения рекомбинантного белка через его гибридный предшественник с природным сайтом расщепления энтеропептидазой, который обеспечивает повышение качества (гомогенности) и выхода целевого продукта в условиях, когда гибридный белок обнаруживает дополнительные (скрытые) сайты расщепления энтеропептидазой. Результат достигается путем замены в природном сайте расщепления энтеропептидазой Асп-Асп-Асп-Асп-Лиз аминокислотного остатка лизина (Лиз) аминокислотным остатком аргинина (Арг) и последующего расщепления гибридного предшественника легкой каталитической субъединицей энтеропептидазы человека или быка. 3 табл., 3 ил., 4 пр.

Изобретение относится к области молекулярной биологии и медицинской диагностики. Предложен способ детекции белков в амилоидном состоянии, в котором получают образец лизата культуры дрожжей или ткани млекопитающего, добавляют к образцу ионный детергент, концентрируют белки в амилоидной форме на ацетатцеллюлозной мембране и детектируют их с использованием аптамеров, их конъюгатов или антител, специфичных к амилоидной форме белков. Также предложен набор для детекции белков в амилоидном состоянии. Изобретение может быть использовано в медицине для диагностики амилоидозов. 2 н. и 7 з. п. ф-лы, 6 ил., 7 пр.
Изобретение относится к биотехнологии, а именно к способу выделения низкомолекулярных пептидов из сырья животного происхождения, которые могут служить в качестве биологически активных веществ при создании фармацевтических или косметических композиций. Способ включает ферментативный гидролиз исходного сырья, центрифугирование с последующей стерилизующей фильтрацией полученной субстанции через мелкопористые фильтры с диаметром пор 0,2 мкм. В качестве исходного сырья используют эритромассу крови доноров, которую предварительно подвергают гемолизу, вирусинактивации, инактивации фермента после ферментативного гидролиза. Проводят осветление раствором перекиси водорода с конечной концентрацией 0,83% с последующим выдерживанием при 66 °С в течение 15 мин. Изобретение позволяет выделить низкомолекулярные пептиды и повысить их биологическую активность. 2 табл., 1 пр.
Изобретение относится к биотехнологии. Плоды и кожуру бананов взвешивают, промывают, измельчают и смешивают с предварительно подогретой до 45±1°C водой в соотношении 1:3. Подщелачивают до показателя рН 8,2-8,3, вносят фермент, в качестве которого используют поджелудочную железу крупного рогатого скота в количестве 9-15% к общему объему. Вносят консервант, в качестве которого используют хлороформ в количестве 1% к общему объему. Смесь подвергают гидролизу в течение 10 сут при температуре 45-50°C. Первые сутки смесь перемешивают через каждые 15 мин по 5 мин, в дальнейшем через каждые 2 ч по 5 мин. Гидролизат фильтруют через марлю, затем фильтровальные полотенца (бумагу) и стерилизуют методом озонирования. Пробкуют и хранят в герметически закрытом состоянии при температуре от 2°C до 8°C. Изобретение обеспечивает получение прозрачного гидролизата с повышенной стерильностью, с высокой биологической активностью, что приводит к улучшению его свойств при применении его в качестве стимулятора роста лептоспир. 2 табл., 3 пр.

Изобретение относится к пищевой промышленности. Разводят пшеничный глютен в воде с гидромодулем не менее 1:1. Корректируют pH суспензии до значения не более 6,8. Добавляют фермент-протеазу, в качестве которого используют фермент грибного происхождения и/или фермент бактериального происхождения. Нагревают полученную смесь до температуры от 30ºС до 70ºС. Вводят желатин в суспензию в количестве не более 20% или не более 50% от массы глютена для совместного ферментативного гидролиза. При этом момент добавления желатина определяют исходя из требуемой степени его гидролиза: для максимальной степени гидролиза желатин вводят до введения фермента, а для минимальной степени гидролиза желатин вводят незадолго до конца гидролиза. Изобретение заключается в обеспечении более объемной, плотной и устойчивой пены и уменьшении необходимого времени взбивания. 5 з.п. ф-лы, 1 ил., 4 пр.

Изобретение относится к биотехнологии, а именно к способу выявления присутствия двух или более представляющих интерес белков с известными аминокислотными последовательностями в образце растительного происхождения (варианты) и способу сохранения генотипа сорта трансгенного растения. Способы включают расщепление всех белков из образца растительного происхождения специфичной по последовательности протеазой с получением пептидов. Разделяют пептиды в один прием в приборе для жидкостной хроматографии - масс-спектрометрии (ЖХ-МС). Ионизируют пептиды в приборе для ЖХ-МС. Проводят одновременное получение масс-спектральных данных для пептидов в приборе для ЖХ-МС. Сравнивают указанные одновременные масс-спектральные данные для пептидов с ожидаемыми масс-спектральными данными от представляющих интерес белков с известными аминокислотными последовательностями. Осуществляют определение присутствия или отсутствия представляющих интерес белков. Предложенное изобретение позволяет с высокой эффективностью выявления присутствия двух или более представляющих интерес белков растительного происхождения. 3 н. и 14 з.п. ф-лы, 10 ил., 3 табл., 7 пр.

Изобретение относится к биотехнологии и представляет собой выделенный полипептид, обладающий трипсиноподобной эндопептидазной активностью. Изобретение касается также способа получения такого полипептида, включающего культивирование рекомбинантной клетки-хозяина Bacillus subtilis, содержащей полинуклеотид, кодирующий заявленный полипептид, функционально связанный с одной или более контрольными последовательностями, которые направляют продукцию полипептида в условиях, благоприятных для продукции полипептида; и выделения полипептида. Изобретение относится также к применению заявленного полипептида для получения гидролизата белка молочной сыворотки. Изобретение позволяет эффективно использовать трипсиноподобную эндопептидазу для гидролиза белка молочной сыворотки. 4 н. и 1 з.п. ф-лы, 2 ил., 12 табл., 7 пр.

Группа изобретений относится к молочной промышленности. Молочный продукт с гидролизованным белком с низким содержанием лактозы получают следующим способом. Обрабатывают молочный сырьевой материал для удаления лактозы и обрабатывают протеазой, при которой степень гидролиза белка составляет по меньшей мере 60 мг тирозина на 1 л молочного продукта с гидролизованным белком. При этом молочный продукт имеет весовое соотношение белка к углеводам от около 0,5 до 5, весовое соотношение белка к золе от 3 до 9. Содержание лактозы составляет менее 1 вес.%. Молочный продукт имеет внешний вид и органолептические свойства обыкновенного молока. Группа изобретений обеспечивает получение продукта с низким содержанием лактозы, с улучшенной органолептикой и уменьшением проблем с пищеварением (метеоризм, вздутие, боли в области живота, урчание). 2 н. и 16 з.п. ф-лы, 6 ил., 4 табл., 8 пр.
Наверх