Рекомбинантный штамм бактерий bacillus subtilis - продуцент фосфолипазы с

Изобретение относится к области биотехнологии и представляет собой штамм бактерий Bacillus subtilis ВКПМ В-11270 - продуцент фермента фосфолипазы C. При ферментации полученного штамма в 3 л лабораторном ферментере в минимальной среде при температуре 30°C, активность фермента в культуральной жидкости достигает уровня 210 ЕД/мл. Изобретение позволяет получать фосфолипазу C с высокой степенью эффективности. 3 ил., 5 пр.

 

Изобретение относится к микробиологии и биотехнологии и касается штамма Bacillus subtilis - продуцента фермента фосфолипазы С.

Фосфолипазы - ферменты, осуществляющие гидролиз фосфолипидов - сложных эфиров фосфатидной кислоты (глицерофосфорной) и многоатомного спирта, являющихся основным компонентом всех биологических мембран.

В зависимости от положения гидролизуемой связи различают четыре основных класса фосфолипаз: А1, А2, С и D. Фосфолипазы А1 и А2 приводят к образованию лизофосфолипидов и свободных жирных кислот, фосфолипаза D - фосфатидной кислоты и аминоспирта.

Фосфолипазы класса С гидролизуют фосфодиэфирную связь в фосфолипидах с образованием 1,2-диацилглицерола и фосфорного эфира соответствующего амина, и различаются по субстратной специфичности, определяемой полярной группой.

В настоящее время фосфолипазы С используют в пищевой промышленности в процессе рафинирования растительных масел: соевого, подсолнечного, рапсового и др. Неочищенное растительное масло состоит преимущественно из триглицеридов, но содержит до 3% (по массе) фосфолипидов (в основном, фосфатидилхолин и фосфатидилэтаноламин, в меньших количествах - фосфатидилинозитол и фосфатидную кислоту), которые вызывают потемнение масла в ходе дальнейших этапов его рафинирования, а также уменьшают окислительную стабильность масла. Для удаления фосфолипидов при рафинировании, в частности, используют фосфолипазы [Oil Mill Gazetteer. - 2009. - V.115. - P.2-4].

Поддержание повышенной температуры (50-70°C) на стадии отделения фосфолипидов позволяет облегчить процесс за счет снижения вязкости масла и увеличения скорости реакции, поэтому целесообразно использование термофильных ферментов.

В настоящее время для производства рафинированного растительного масла предложен препарат Lecitase Novo™ (Novozymes A/S), содержащий фосфолипазу A1 [Applied Microbiology and Biotechnology. - 2007. - V.74. - N.2. - P.290-300]. Однако использование фосфолипазы С в процессе рафинирования предпочтительнее, поскольку не приводит к высвобождению жирных кислот, которые необходимо удалять в процессе дальнейшей обработки. Это позволяет сократить потери сырья.

Аналогичную стадию рафинирования осуществляют также для предварительной обработки масла перед получением биодизеля.

Другой перспективной областью приложения фосфолипазы С является получение диацилглицеридов с определенной энантиомерной структурой, которые находят применение в синтезе стереоспецифичных соединений, а также являются клеточными медиаторами [Trends in Biotechnology. - 1997. - V.15. - N.3. - P.90-6]. Исследователями продемонстрировано, что последовательное действие двух классов фосфолипаз: С и D может быть использовано, например, для синтеза дигидроксиацетонфосфата (DHAP) - интермедиата тонкого химического синтеза [Appi Microbiol Biotechnol - 2007. - V.75. - P.33-45], или такого важного для медицины и фармацевтики биоактивного соединения, как сфингозин 1-фосфат (S1P), которое является главным регулятором сосудистой и иммунной системы [Journal of Chemical Research. - 1998. - V.998. - N.12. - P.774-5].

К фосфолипазам С, обладающим широким спектром субстратной специфичности, относится фосфолипаза С бактерий Bacillus cereus, которая характеризуется ценными технологическими свойствами: способностью гидролизовать большинство фосфолипидов, представленных в растительных маслах (фосфатидилхолин, фосфатидилэтаноламин, фосфатидилсерин), и работать в водных, органических [Journal of Molecular Catalysis В: Enzymatic. - 1999. - V.6. - P.125-32] и двухфазных системах. Фермент также обладает высокой удельной активностью и термостабильностью: сохраняет активность после нагрева до 100°С, температурный оптимум катализируемых реакций лежит в диапазоне 60-70°С.

Фосфолипаза С из B.cereus является оптимальным ферментом для использования в промышленном рафинировании растительных масел, поскольку не проявляет гемолитической активности, обладает наиболее подходящим спектром субстратной специфичности, термостабильностью и высокой удельной активностью.

Благодаря высокой степени сходства с фосфолипазой С млекопитающих и способности мимикрировать под нее, вызывая, например, биосинтез простагландинов, фосфолипаза из В.cereus является, помимо прочего, предметом медицинских исследований, в качестве модели менее доступного фермента млекопитающих.

Однако, поскольку бактерии В.cereus относятся к группе условно патогенных микроорганизмов и способны вызывать пищевые отравления, их использование в качестве продуцента невозможно. Поэтому для получения фосфолипазы С целесообразно использовать рекомбинантные продуценты. Существуют примеры создания таких продуцентов на основе бактерий Escherichia coli, Bacillus siihtilis и дрожжей Pichia pastoris.

Экспрессия гена фосфолипазы С в клетках E.coli [Protein Expression and Purification. - 1997. - V.10. - P.365-72] приводит к накоплению больших количеств неактивной формы данного фермента в виде телец включения, поэтому для получения активного фермента дополнительно осуществляют стадии разрушения клеток, очистки, рефолдинга и активации белка, что повышает стоимость конечного продукта.

Экспрессия гена фосфолипазы С в Р.pastoris приводит к секреции активного фермента в культуральную жидкость (до 365 ед/мл) [Biotechnology Letters. - 2004. - V.26. - P.1475-9]. Однако культивирование этого продуцента требует присутствия метанола в качестве индуктора и дорогих сред, что делает его использование не выгодным.

На международном рынке фосфолипаза С представлена препаратом Purifine™, производства компании Verenium (Сан Диего, США; ранее Diversa), основой которого является фосфолипаза С BD16449, выделенная из почвенного метагенома и высоко гомологичная фосфолипазе из В.cereus [Regulatory Toxicology and Pharmacology. - 2006. - V.45. - N.1. - P.1-8]. Фермент имеет оптимум pH, равный 7.3, и температурный оптимум около 60°С. Продуцентом является штамм Р.pastoris, в хромосому которого интегрировано шесть тандемных копий экспрессионной кассеты с геном фосфолипазы, однако нет открытых данных об уровне продукции фермента этим штаммом.

Известен [Applied Microbiology and Biotechnology. - 2006. - V.74. - N.3. - P.634-9] продуцент секретируемой фосфолипазы С из В. cereus SBUG 516 на основе штамма В.suhlilis, дефицитного по восьми протеазам. При ферментации в ферментере на богатых средах при температуре 37°С данный штамм синтезирует фосфолипазу С, обладающую активностью 200 ед/мл или 15 мг белка на литр.

Интерес к созданию высокоэффективных продуцентов фосфолипазы С на основе Bacillus subtilis связан с достаточно хорошей генетической изученностью этого объекта и тем, что данный вид бактерий удобен для промышленной ферментации.

Кроме того, работа со штаммами Bacillus subtilis не требует специальных мер предосторожности, так как бактерии этого вида относится к непатогенным микроорганизмам.

Технической задачей заявляемого изобретения является расширение арсенала рекомбинантных микроорганизмов, продуцирующих фосфолипазу С.

Задача решена путем конструирования рекомбинантного штамма бактерий Bacillus subtilis ВКПМ В-11270 - продуцента фосфолипазы С.

Рекомбинантный штамм Bacillus subtilis ВКПМ В-11270 получен из штамма Bacillus subtilis AJ 73 (ВКПМ В-5036) путем трансформации последнего экспрессионной репликативной плазмидой, полученной на основе вектора pHY300PLK (J. Bacteriol (1983), 153, 813-821), названной p-plc и содержащей ген р1С, кодирующий фосфолипазу С из Bacillus cereus ATCC 14579.

Заявляемый штамм Bacillus subtilis депонирован во Всероссийской коллекции промышленных микроорганизмов (ВКПМ) по адресу 117545 Москва, 1-ый Дорожный проезд, д.1 и имеет регистрационный номер ВКПМ В-11270.

Штамм Bacillus subtilis ВКПМ В-11270 характеризуется следующими признаками:

Культурально-морфологические признаки.

Грамм-положительная спорообразующая палочковидная бактерия. Суточная культура в жидкой LB среде (мас.%: дрожжевой экстракт - 0.5, пептон - 1, NaCl - 1, вода - остальное) представлена подвижными одиночными палочковидными клетками размером 3-5×0,6 мкм. К третьим суткам образует овальные споры, не превышающие размер клетки, расположенные центрально. При росте на агаризованной LB среде образует мелкоморщинистые, бархатисные колонии белого или кремового цвета размером 1-4 мм.

Физиолого-биохимические признаки.

Облигатный аэроб. Сахара не сбраживает. Ассимилирует: сахарозу, D-глюкозу, L-арабинозу, D-ксилозу, D-маннитол, казеин. Отсутствует способность к гидролизу крахмала. Отличается пониженной протеолитической активностью и способностью к восстановлению нитрата.

Оптимальное значение pH для роста - 5,5-8,0. Не растет при 50°C. Оптимальная температура роста - 30-37°С.

Заявляемый штамм при выращивании в колбах на среде LB способен синтезировать фосфолипазу с активностью до 105 ЕД/мл культуральной жидкости, при выращивании в лабораторном ферментере в минимальной среде М9 (мас.%: NH4Cl - 0,1, CaCl2 - 0,06, KH2HPO2 - 0,06, Na2HPO4×3H2O - 0.12, глюкоза - 1, вода - остальное), при температуре 30°С способен синтезировать фосфолипазу С, обладающую активностью до 220 ЕД/мл культуральной жидкости.

Изобретение проиллюстрировано следующими фигурами графического изображения:

Фиг.1 - Электрофореграмма ПЦР-анализа исследуемых штаммов с помощью проверочных праймеров.

Фиг.2 - График зависимости активности рекомбинантной и нативной фосфолипазы С от температуры.

Фиг.3 - График зависимости активности рекомбинантной и нативной фосфолипазы С от pH инкубационной среды.

Получение и культивирование штамма Bacillus subtilis ВКПМ В-11270 подтверждено следующими примерами.

Пример 1. Получение штамма Bacillus subtilis ВКПМ В-11270.

Трансформацию Bacillus subtilis осуществляют методом, основанном на свойстве природной компетенции клеток Bacillus subtilis (J.Bacteriol. - 1961 - N.81 - P.741-746.).

Для приготовления компетентных клеток используют штамм Bacillus suhtilis AJ73 (ВКПМ В-5036). В качестве ДНК используют 1 мкг ДНК плазмиды p-plC. Селекцию трансформантов ведут на агаризованной питательной среде LB с добавлением антибиотика эритромицина.

Наличие целевого рекомбинантного гена в составе плазмид трансформантов подтверждают методом ПЦР-анализа.

Из бактериальныех клонов, полученных в результате генетической трансформации, стандартными методами выделяют плазмидную ДНК, используемую в качестве матрицы для проведения полимеразной цепной реакции с использованием специфических проверочных праймеров.

Последовательность проверочных праймеров:

plc-f TTTCATATGAAAAAGAAAGTACTTGCTTTA

plc-r AAAAGCGCTTACCTCCATTTGTATAGTAAT

Режим реакции ПЦР:

95°С - 3 мин - 1 цикл

35 циклов:

95°С - 30 сек.

60°С - 30 сек.

72°С- 60 сек.

72°С - 5 мин - 1 цикл.

Для контроля величины фрагментов ДНК при электрофорезе используют молекулярный маркер GeneRuler 1kb DNA Ladder (Fermentas) (фиг.1 линия 1 размер фрагментов снизу вверх - 10000, 8000, 6000, 5000, 4000, 3500, 3000, 2500, 2000. 1500, 1000, 750, 500, 250 п.н.).

Наработка фрагментов размером 970 п.н. при использовании проверочных праймеров plc-f и plc-r подтверждает присутствие целевого рекомбинантного гена plc в составе плазмид полученных трансформантов Bacillus sublilis AJ73/p-plc (фиг.1, линии 2 и 3).

Фосфолипазную активность трансформантов первоначально оценивают по зонам помутнения в чашечном тесте [Journal of Dairy Science - 1976 - N.59 - P.2024-2030]. Данный метод позволяет подтвердить присутствие фосфолипазы в исследуемых образцах. В тесте используют агаризованною среду LB (мас.%: дрожжевой экстракт - 0,5, пептон - 1, NaCl2 - 1, агар - 2, вода - остальное) с добавлением лицетина (3 мас.%) и 5 mM хлорида кальция. В качестве контроля используют штамм Bacillus subtilis AJ73.

Клоны трансформантов, у которых обнаружено наибольшее соотношение диаметра зоны помутнения к диаметру колонии на чашках, отбирают для последующего культивирования, которое проводят при 30°С на качалке (250 об/мин) в пробирках (50 мл) с рабочим объемом 10 мл в жидкой питательной среде LB. Посев осуществляют бактериологической петлей. Ферментацию продолжают в течение 24 часов.

Фосфолипазную активность определяют по гидролизу O-(4-итрофенилфосфорил) xonHna(NPPC) [J. Biochem - 1968 - N.63 - Р.681-683].

За единицу активности принимают количество фермента, необходимое для образования 1 мкмоля нитрофенола в минуту.

По результатам ферментации отбирают заявляемый штамм Bacillus suhfilis ВКПМ В-11270, который при культивировании в пробирках позволяет получать фитазу с активностью 80 ЕД/мл культуральной жидкости.

Пример 2. Культивирование штамма Bacillus suhtilis ВКПМ В-11270 в лабораторных условиях.

Культуру Bacillus subtilis ВКПМ В-11270 наращивают в 5 мл среды LB в течение 20 часов при 30°C с аэрацией на качалке (250 об/мин).

Инокулят переносят в колбу объемом 750 мл с 45 мл свежей среды LB и растят при 30°С в течение 24 часов с аэрацией на качалке (250 об/мин).

Через 5, 10, 15, 20 и 24 часа культивирования отбирают пробы растущей бактериальной культуры, осаждают клетки методом центрифугирования и в надосадочной жидкости определяют наличие активности фосфолипазы С.

При ферментации в колбах в питательной среде LB штамм ВКПМ В-11270 синтезирует фосфолипазу С, обладающую активностью 105 ЕД/мл культуральной жидкости.

Пример 3. Культивирование штамма Bacillus subtilis ВКПМ В-11270 в лабораторном ферментере.

Для получения посевного материала в пробирках культуру Bacillus suhtilis ВКПМ В-11270 наращивают в 5 мл среды LB в течение 20 часов при 30°C с аэрацией (250 об/мин). Затем культуру их пробирки переносят в колбу с 50 мл среды LB. Культивируют в шейкере-инкубаторе (250 об/мин) при 30°С в течение 24 часов.

Полученный посевной материал переносят в 3 л ферментер и растят 48 часов в 1 литре минимальной среды (мас.%: NH4Cl - 0,1, CaCl2 - 0,06, KH2PO4 - 0,06, Na2HPO4×3H2O - 0,12, глюкоза - 1, вода - остальное).

Через 12, 24, 36 и 48 часов культивирования отбирают пробы растущей бактериальной культуры, осаждают клетки методом центрифугирования и надосадочную жидкость используют для определения активности фосфолипазы С.

При ферментации в 3 л лабораторном ферментере в минимальной питательной среде при 30°С штамм ВКПМ В-11270 синтезирует фосфолипазу С, обладающую активностью 210 ЕД/мл культуральной жидкости.

Пример 4. Исследование температурного оптимума рекомбинантной фосфолипазы С.

Для определения температурного оптимума рекомбинантной фосфолипазы С измеряют специфическую активность фермента при разных значениях температур по гидролизу O-(4-нитрофенилфосфорил) холина (NPPC). Полученные результаты, приведены на фиг.2 (кривая 2) в сравнении с аналогичными значениями нативной фосфолипазы С из Bacillus cereus ATCC 14579 (кривая 1).

Показано, что температурный оптимум действия нативной и рекомбинантной фосфолипаз С практически совпадают (63-67°C и 60-65°C, соответственно).

Пример 5. Исследование оптимума pH рекомбинантной фосфолипазы С.

Активность фосфолипазы С измеряют при разных значениях pH инкубационной среды по гидролизу 0-(4-нитрофенилфосфорил) холина (NPPC) и сравнивают с аналогичными значениями нативной фосфолипазы С из Bacillus cereus ATCC 14579. Полученные данные, приведенные на фиг.3, показывают, что pH оптимум действия рекомбинантной фосфолипазы С (кривая 1) находится в диапазоне pH от 4.5 до 5.0 и практически совпадает с оптимумом pH нативной фосфолипазы С (кривая 2).

Таким образом, заявляемый штамм Bacillus subtilis ВКПМ В-11270 растет на минимальной среде при температуре 30°C и продуцирует фосфолипазу С, обладающую активностью до 210 ед/мл культуральной жидкости, при этом полученный фермент сохраняет промышленно ценные свойства нативного фермента.

Рекомбинантный штамм Bacillus subtilis ВКПМ В-11270 - продуцент фосфолипазы C.



 

Похожие патенты:
Изобретение относится к биотехнологии, в частности к получению препаратов кератиназы, и может быть использовано для получения препаратов кератиназ, применяемых в медицине, косметологии, легкой промышленности и сельском хозяйстве.
Изобретение относится к биотехнологии, в частности к способам приготовления биологически активных кормовых добавок для животных, птицы, рыбы. Готовят жидкую культуру штамма Corynebacterium glutamicum ВКПМ В-1959 - продуцента лизина глубинным способом и жидкие культуры штаммов Bacillus subtilis ВКПМ В-8130, Bacillus subtilis ВКПМ В-2984, Bacillus subtilis ВКПМ В-4099 и Bacillus licheniformis ВКПМ В-4162.

Изобретение относится к биотехнологии. Штамм Aspergillus oryzae RCAM01135 - продуцент протеолитических и амилолитических ферментов - обладает способностью продуцировать протеолитические и амилолитические ферменты.
Изобретение относится к биотехнологии. Штамм одноклеточных водорослей Dunaliella salina IPPAS 295 - продуцент биологически активных веществ, обладающих антиоксидантной активностью, депонирован в коллекции культур микроводорослей Института физиологии растений им.

Изобретение относится к области медицинской микробиологии и касается штамма бактериофага Escherichia coli ECD4. Штамм бактериофага Escherichia coli ECD4 выделен из фекалий бройлерных кур на культуре бактерий штамма Escherichia coli О104:Н4 RKI№112027 и депонирован в Государственной коллекции патогенных микроорганизмов и клеточных культур «ГКПМ-Оболенск» под номером Рh63.

Изобретение относится к биотехнологии, в частности биодеградации органических соединений с помощью микроорганизмов. Предложен способ биодеградации дротаверина гидрохлорида (спазмолитик НОШПА).

Изобретение относится к биотехнологии, в частности к новому, высокоэффективному способу получения такролимуса (FK-506) методом микробиологического синтеза. Способ предусматривает приготовление инокулята клеток Streptomyces sp.

Плазмида для экспрессии в клетках бактерии рода escherichia неактивного предшественника мутеина [c112s] легкой цепи энтерокиназы человека, бактерия, принадлежащая к роду escherichia, - продуцент предшественника рекомбинантного мутеина [c112s] легкой цепи энтерокиназы человека, предшественник рекомбинантного мутеина [c112s] легкой цепи энтерокиназы человека, способ получения рекомбинантного мутеина [c112s] легкой цепи энтерокиназы человека, рекомбинантный мутеин [c112s] легкой цепи энтерокиназы человека // 2495934
Изобретение относится к биотехнологии и предоставляет способ получения рекомбинантного мутеина [C112S] легкой цепи энтерокиназы человека с использованием бактерии, принадлежащей к роду Escherichia, трансформированной экспрессионной плазмидой, содержащей фрагмент ДНК, кодирующий неактивный предшественник мутеина [C112S] легкой цепи энтерокиназы человека, включающий последовательность, кодирующую отщепляемый N-концевой пептид, включающий гексагистидиновый кластер и последовательность узнавания энтерокиназы, и слитую с ним в рамке последовательность, кодирующую предшественник мутеина [C112S] легкой цепи энтерокиназы человека с неотщепляемым С-концевым гексагистидиновым кластером под контролем промотора, функционирующего в бактериальной клетке.

Плазмида для экспрессии в клетках бактерии рода escherichia предшественника рекомбинантного фрагмента тканевого активатора плазминогена (тап) человека (ретеплазы), бактерия, принадлежащая к роду escherichia, - продуцент предшественника рекомбинантного фрагмента тап человека (ретеплазы) или [-1]метионил-фрагмент тап человека (ретеплазы), предшественник рекомбинантного фрагмента тап человека (ретеплазы), способ получения предшественника рекомбинантного фрагмента тап человека (ретеплазы) // 2495933
Изобретение относится к биотехнологии и представляет собой способ получения предшественника рекомбинантного фрагмента тканевого активатора плазминогена (ТАП) человека (ретеплазы) с использованием бактерии, принадлежащей к роду Escherichia, трансформированной экспрессионной плазмидой, содержащей фрагмент ДНК, кодирующий предшественник рекомбинантного фрагмента тканевого активатора плазминогена (ТАП) человека (ретеплазы), включающий последовательность, кодирующую отщепляемый N-концевой пептид, включающий декагистидиновый кластер и слитую в рамке последовательность узнавания энтерокиназы, или фрагмент ДНК, кодирующий [-1]метионил-фрагмента ТАП человека (ретеплазы), под контролем промотора, функционирующего в указанной бактериальной клетке.
Проводят ферментацию питательной среды на основе гидролизатов кукурузного крахмала актиномицетом. Проводят ультрафильтрацию полученного фильтрата культуральной жидкости с активностью 4250±250 ИЕ/см3 через мембраны с отсечением 5 кДа.
Изобретение относится к фармацевтической промышленности, а именно к способу получения плацентарной щелочной фосфатазы. Способ получения плацентарной щелочной фосфатазы заключается в том, что гомогенизируют отмытую от крови плаценту человека, экстрагируют гомогенат в растворе хлорида калия, центрифугируют полученный экстракт, прогревают, центрифугируют, полученный надосадок после первичного прогревания экстракта повторно прогревают в присутствии сульфата кадмия с последующим быстрым охлаждением колбы, добавляют сульфат аммония, отделяют осадок центрифугированием, надосадочную жидкость подвергают гидрофобной хроматографии на колонке, а ферментсодержащий элюат подвергают очистке препаративным электрофорезом в полиакриламидном геле, окрашивают гель, содержащий фермент, и под визуальным контролем, вырезают окрашенные фракции щелочной фосфатазы.

Изобретение относится к области биотехнологии. .

Изобретение относится к области биотехнологии. .

Изобретение относится к области биохимии и молекулярной биологии и касается способа анализа процесса Арг-Х протеолиза в положительно заряженных фракциях белков супрамолекулярных структур в растущей популяции Escherichia coli.

Изобретение относится к ферментативным способам удаления фосфолипидов из растительных масел. .

Изобретение относится к порошкообразному препарату липазы, предназначенному для трансэтерификации. .
Изобретение относится к области биотехнологии. .

Изобретение относится к области биотехнологии и касается рекомбинантного штамма Escherichia coli ВКПМ В-11246 - продуцента гидролазы эфиров альфа-аминокислот из Xanthomonas rubrilineans ВКПМ В-9915 и способа микробиологического синтеза такой гидролазы.

Изобретение относится к области биотехнологии и представляет собой штамм бактерий Bacillus subtilis ВКПМ В-11270 - продуцент фермента фосфолипазы C. При ферментации полученного штамма в 3 л лабораторном ферментере в минимальной среде при температуре 30°C, активность фермента в культуральной жидкости достигает уровня 210 ЕДмл. Изобретение позволяет получать фосфолипазу C с высокой степенью эффективности. 3 ил., 5 пр.

Наверх