Химерный цирковирус pcv2gen-1rep свиней и его применение



Химерный цирковирус pcv2gen-1rep свиней и его применение
Химерный цирковирус pcv2gen-1rep свиней и его применение
Химерный цирковирус pcv2gen-1rep свиней и его применение
Химерный цирковирус pcv2gen-1rep свиней и его применение

 


Владельцы патента RU 2515901:

ВИРДЖИНИЯ ТЕК ИНТЕЛЛЕКЧУАЛ ПРОПЕРТИЗ, ИНК. (US)

Изобретение относится к области биотехнологии. Описана молекула химерной нуклеиновой кислоты цирковируса свиней (PCV2Gen-1Rep), которая включает молекулу нуклеиновой кислоты, кодирующую цирковирус свиней 2 типа (PCV2), которая содержит последовательность нуклеиновой кислоты, кодирующую белок Rep цирковируса свиней 1 типа (PCV1). Химерную молекулу нуклеиновой кислоты конструируют посредством замещения гена Rep ORF1 PCV2 геном Rep ORF1 PCV1. Изобретение также включает биологически функциональную плазмиду или вирусный вектор, содержащие уникальные молекулы химерных нуклеиновых кислот, подходящие клетки-хозяева, трансфицированные плазмидой или вектором, инфекционные химерные цирковирусы свиней, которые продуцируют подходящие клетки-хозяева, способ получения иммуногенного полипептидного продукта с использованием новой химеры, вирусных вакцин, которые защищают свинью от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного PCV2, способы защиты свиньи от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного PCV2, способы получения уникальной химеры PCV2Gen-1Rep и подобных. Изобретение дополнительно включает новый способ увеличения уровня репликации и титра PCV2 в клеточной культуре. Изобретение может быть использовано в ветеринарии. 9 н. и 12 з.п. ф-лы, 2 ил., 6 пр.

 

Перекрестная ссылка на родственные заявки

По данной заявке испрашивается приоритет согласно 35 U.S.C. § 119(e) предварительной заявки США № 61/124383, поданной 16 апреля 2008 года. Предшествующая заявка включена в настоящий документ в качестве ссылки в полном объеме.

Предпосылки изобретения

Область изобретения

Настоящее изобретение относится к уникальному химерному цирковирусу свиней (PCV2Gen-1Rep), в котором последовательность нуклеиновой кислоты, кодирующую белок Rep PCV1, встраивают в геномный каркас PCV2, и его применению в качестве антигена в новой убитой (инактивированной) или аттенуированной химерной вакцине для защиты свиней от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного PCV2.

Описание связанной области

Все патенты и публикации, процитированные в этом описании, включены, таким образом, в качестве ссылки в полном объеме.

Цирковирус свиней 1 типа (PCV1) первоначально выделили в 1974 г. как примесь, постоянно присутствующую в клеточной линии PK-15 ATCC CCL-33 (I. Tischer et al., «Characterization of papovavirus- and picornavirus-like particles in permanent pig kidney cell lines», Zentralbl. Bakteriol. Hyg. Otg. A. 226(2):153-167 (1974)). После его идентификации определили, что PCV1 является широко распространенным вирусом свиней, который не вызывает у них какого-либо заболевания (G. M. Allan et al., «Pathogenesis of porcine circovirus; experimental infections of colostrum deprived piglets and examination of pig foetal material», Vet. Microbiol. 44:49-64 (1995); G. C. Dulac and A. Afshar, «Porcine circovirus antigens in PK-15 cell line (ATCC CCL-33) and evidence of antibodies to circovirus in Canadian pigs», Can. J. Vet. Res. 53:431-433 (1989); S. Edwards and J. J. Sands, «Evidence of circovirus infection in British pigs», Vet. Rec. 134:680-681 (1994); I. Tischer et al., «Studies on epidemiology and pathogenicity of porcine circovirus», Arch. Virol. 91:271-276 (1986)). В то время как PCV1 не вызывает у свиней какого-либо заболевания, позже определили, что цирковирус свиней 2 типа является патогенным. В 1991 г., в Канаде, у свиней впервые обнаружили вариантный штамм PCV, обозначенный как цирковирус свиней 2 типа (PCV2) и выявили, что он ассоциирован с синдромом мультисистемного послеотъемного истощения (PMWS) (G. M. Allan et al., «Isolation of porcine circovirus-like viruses from pigs with a wasting disease in the USA and Europe», J. Vet. Diagn. Invest. 10:3-10 (1998); I. Morozov et al., «Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome», J. Clin. Microbiol. 36:2535-2541 (1998)).

PCV1 и PCV2 обладают геномной организацией с двумя основными открытыми рамками считывания (ORF): ORF1 кодирует вирусный белок Rep, включенный в вирусную репликацию, а ORF2 кодирует вирусный капсидный белок. В целом, PCV1 и PCV2 в своем полном геноме обладают 68-76% идентичности нуклеотидной последовательности, тогда как штаммы в пределах каждого генотипа обладают более чем 90% идентичности (A.K. Cheung, «The essential and nonessential transcription units for viral protein synthesis and DNA replication of porcine circovirus type 2», Virology 313:452-9 (2003)). PCV1 и PCV2 имеют похожую геномную организацию с двумя основными открытыми рамками считывания (ORF) (A.K. Cheung, «Identification of the essential and non-essential transcription units for protein synthesis, DNA replication and infectious virus production of porcine circovirus type 1», Arch. Virol. 149(5):975-88 (2004); A. K. Cheung, «Transcriptional analysis of porcine circovirus type 2», Virology 305(1):168-180 (2003); A. Mankertz et al., «Identification of a protein essential for replication of porcine circovirus», J. Gen. Virol. 79(Pt 2):381-384 (1998); P. Nawagitgul et al., «Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein», J. Gen. Virol. 81:2281-2287 (2000)). В обоих вирусах ORF1 является ответственной за вирусную репликацию и подвергается альтернативному сплайсингу с образованием 2 основных функциональных белков, Rep и Rep' (A.K. Cheung, «Identification of the essential and non-essential transcription units for protein synthesis, DNA replication and infectious virus production of porcine circovirus type 1», Arch. Virol. 149(5):975-88 (2004); A. K. Cheung, «Transcriptional analysis of porcine circovirus type 2», Virology 305(1):168-180 (2003); A. Mankertz and B. Hillenbrand, «Replication of porcine circovirus type 1 requires two proteins encoded by the viral rep gene», Virology 279:429-38 (2001); A. Mankertz et al., «Identification of a protein essential for replication of porcine circovirus», J. Gen. Virol. 79(Pt 2):381-384 (1998); A. Mankertz et al., «Mapping and characterization of the origin of DNA replication of porcine circovirus», J. Virol. 71:2562-6 (1997)). ORF1 высоко консервативна, приблизительно с 83% идентичности нуклеотидных последовательностей и 86% идентичности аминокислотных последовательностей между PCV1 и PCV2 (I. Morozov et al., «Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome», J. Clin. Microbiol. 36:2535-2541 (1998)). В обоих вирусах ORF2 кодирует иммуногенный вирусный капсидный белок (P. Nawagitgul et al., «Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein», J. Gen. Virol. 81:2281-2287 (2000)), и является более вариабельной, чем белок Rep, приблизительно с 67% идентичности нуклеотидных последовательностей и 65% идентичности аминокислотных последовательностей между PCV1 и PCV2 (I. Morozov et al., «Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome», J. Clin. Microbiol. 36:2535-2541 (1998)). Недавно в PCV2, но не в PCV1, обнаружили третью ORF, ORF3 и, как сообщают, она вовлечена в апоптоз (J. Liu et al., «Characterization of a previously unidentified viral protein in porcine circovirus type 2-infected cells and its role in virus-induced apoptosis», J. Virol. 79:8262-74 (2005)).

Ранее, в патенте США № 7279166 B2, патенте США № 7276353 B2, M. Fenaux et al., «A chimeric porcine circovirus (PCV) with the immunogenic capsid gene of the pathogenic PCV type 2 (PCV2) cloned into the genomic backbone of the nonpathogenic PCV1 induces protective immunity against PCV2 infection in pigs», J. Virol. 78:6297-303 (2004) и M. Fenaux et al., «Immunogenicity and pathogenicity of chimeric infectious DNA clones of pathogenic porcine circovirus type 2 (PCV2) and nonpathogenic PCVI in weanling pigs», J. Virol. 77:11232-243 (2003) описали конструкцию химерного вируса, обозначенного PCV1-2, в котором ORF PCV2 клонируют в каркас генома PCV1. В публикациях описывают перестановку гена капсида ORF2, включая его межгенные последовательности, из PCV2 в PCV1, вместо ORF2, и дополнительно описывают инфекционную реципрокную химерную молекулу нуклеиновой кислоты PCV2-1, содержащую молекулу нуклеиновой кислоты, кодирующую PCV2, которая имеет, вместо гена ORF2 патогенной молекулы нуклеиновой кислоты PCV2, ген иммуногенного продукта ORF2 из непатогенного PCV1. Тогда как химерная молекула PCV1-2 обеспечивала природное свойство авирулентности, реципрокная химерная молекула нуклеиновой кислоты PCV2-1, которую получали только в качестве экспериментальной модели, без каких-либо коммерческих преимуществ перед родительской PCV2, за исключением исследовательских целей, для сравнения вирусных характеристик с PCV1, сохраняла вирулентность. Ни один из указанных выше патентов или статей не раскрывает или не обеспечивает создание любых других реципрокных химерных вирусов, использующих геномный каркас патогенного PCV2 и, определенно, ни один не подразумевает замену альтернативных открытых рамок считывания, кроме указанного и подробно описанного гена иммуногенного капсида ORF2.

Дополнительно, химерный вирус PCV1-2 реплицируется до показателей титра, сходных с показателями титра PCV2 в клетках PK-15 (M. Fenaux et al., «Immunogenicity and pathogenicity of chimeric infectious DNA clones of pathogenic porcine circovirus type 2 (PCV2) and nonpathogenic PCV1 in weanling pigs», J. Virol. 77:11232-243 (2003)). С другой стороны, PCV1 лучше адаптирован для роста в клетках PK-15 и вирус PCV1, адаптированный к культуре клеток PK-15, растет лучше, чем PCV2, с репликацией, по меньшей мере приблизительно до титра на 1-log большего, чем титр PCV2 в клетках PK-15 (M. Fenaux et al., «Two amino acid mutations in the capsid protein of type 2 porcine circovirus (PCV2) enhanced PCV2 replication in vitro and attenuated virus in vivo», J. Virol. 78:13440-6 (2004); M. Fenaux et al., «Immunogenicity and pathogenicity of chimeric infectious DNA clones of pathogenic porcine circovirus type 2 (PCV2) and nonpathogenic PCV1 in weanling pigs», J. Virol. 77:11232-243 (2003)). Эта способность к усиленной репликации PCV1 в клетках PK-15 вероятно является следствием того факта, что PCV1 исходно выделили из клеточной линии PK-15 как примесь, постоянно присутствующую в клеточной культуре и PCV1, таким образом, приспособлен к росту в клетках PK-15. Однако штаммы патогенного PCV2 не обладают способностью к репликации, аналогичной PCV1, что, вследствие относительно низкого титра патогена в клетках PK-15, создает основную проблему, связанную с получением вакцины на основе PCV2. Таким образом, достижение эффективных уровней получения вакцин, основанных на PCV2, таких как инактивированный целый PCV2, от природы авирулентный химерный PCV 1-2 (основанный на геномном каркасе, источником которого является PCV1), рекомбинантные капсидные белки PCV2 и т.п., является основной проблемой и задачей для промышленного производства вакцин.

Ранее, при исследовании межгенных последовательностей в PCV2, в PCV2 обнаружили последовательность (GAAANNGAAA), подобную элементу ответа, стимулированному интерфероном-α (ISRE), которая может активировать транскрипцию гена в ответ на действие IFN-α, аналогично известной в данной области активности элемента ISRE (J.E. Darnell, Jr., et al., «Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins», Science 264:1415-21 (1994)). Показано, что у вируса герпеса, ассоциированного с саркомой Капоши, экспрессируются вирусные гены, которые взаимодействуют с кодируемой вирусом последовательностью, подобной ISRE, которая является ответственной за дополнительную активацию вирусного гена (J. Zhang, «Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 replication and transcription activator regulates viral and cellular genes via interferon-stimulated response elements» J. Virol. 79:5640-52 (2005)). Meerts et al. недавно показали, что и клетки почек свиньи (PK-15), и моноцитарные клетки свиньи (3D4/31), обработанные IFN-α, после инокуляции PCV2 содержали повышенное количество инфицированных клеток, вплоть до 529% и 308%, соответственно (P. Meerts et al., «Enhancement of porcine circovirus 2 replication in porcine cell lines by IFN-gamma before and after treatment and by IFN-alpha after treatment», J. Interferon Cytokine Res 25(11):684-93 (November 2005)). Примечательно, что клетки PK-15, обработанные IFN-α до инокуляции PCV2, содержали сниженное количество инфицированных клеток (69%) (id.). В дополнение к IFN-α, как в клетках PK-15, так и в клетках 3D4/31 также оценили действие IFN-γ на инфицирование PCV2. Выявлено, что обработка IFN-γ после инфицирования PCV2 привела к большему количеству инфицированных клеток в клетках PK-15, на 691%, а добавление IFN-γ до инокуляции PCV2 повысило количество клеток, положительных по антигену PCV2, на 706% в клетках 3D4/31, вследствие усиленной интернализации вируса в клетки (id.). Возможно, что фактор транскрипции, реагирующий на действие IFN-γ, присутствует в промоторной области последовательности PCV2, но, на данный момент, все это является предположением и еще не доказано. Многие вирусы не только реагируют на действие IFN, но также управляют экспрессией IFN посредством ряда транскрипционных путей передачи сигнала, для того, чтобы избежать ответной клеточной реакции на IFN (S. Goodbourn, «Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures», J. Gen. Virol. 81:2341-64 (2000)). Совместное действие IFN-α и IFN-γ на инфицирование клеточных культур вирусом PCV2 и участие последовательности, подобной ISRE, в регулировании ответов на IFN-α и IFN-γ еще не изучено. Однако, как показали предшествующие научные исследования, добавление интерферона для стимулирования роста PCV2 привело к противоречивым результатам. Так как интерферон можно давать свиньям, интерес представлял бы приблизительный уровень дозы в основанном на интерфероне готовом продукте PCV2, поскольку интерферон может вызывать побочные реакции и побочные эффекты, конкретно, нанести вред печени. Было бы более желательно усилить способность к репликации у PCV2, используя природные компоненты, которые можно вводить свиньям без вреда для их здоровья.

Таким образом, существует определенная проблема, известная в данной области, связанная с недостаточными количествами антигенной продукции при производстве вакцин на основе PCV2, настоящее изобретение разрешает проблему, разрабатывая новую химеру на основе цирковируса свиней, что позволяет значительно повысить низкий титр и репликативную способность вируса, что дает возможность осуществлять производство химерных вакцин большими, чем получаемые ранее, партиями.

Таким образом, важной целью по настоящему изобретению является обеспечение уникальной комбинации PCV1 и PCV2, которая сохраняет, для вызова достаточного иммунного ответа, антигенное свойство патогенного PCV2, но достигает, инновационным способом, превосходных свойств роста титра PCV1.

Дополнительной важной целью по настоящему изобретению является создание усовершенствованного продукта - химерной вакцины, основанной на PCV2, для защиты свиней от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного PCV2, где усовершенствование включает усиленную, по сравнению с родительским PCV2, репликацию.

Дополнительные цели по настоящему изобретению будут понятны по мере описания.

Целей, упомянутых выше, достигают, создавая новый химерный вирус PCV2, содержащий ген Rep PCV1 в геномном каркасе PCV2, как описано в настоящем документе.

Сущность изобретения

Настоящее изобретение относится к уникальному химерному цирковирусу свиней, в котором последовательность нуклеиновой кислоты, кодирующую белок репликации или белок Rep цирковируса свиней 1 типа (PCV1), встраивают в геномный каркас цирковируса свиней 2 типа (PCV2). Наиболее предпочтительный вариант осуществления изобретения относится к конструированию химеры PCV2Gen-1Rep, в которой ген Rep открытой рамки считывания 1 (ORF1) вируса PCV1 заменяет ген Rep ORF1 в PCV2 в геномном каркасе PCV2. Изобретение также относится к биологически функциональным плазмидам, вирусным векторам и т.п., которые содержат новые химерные молекулы нуклеиновой кислоты, описываемые в настоящем документе, подходящие клетки-хозяева, трансфицированные плазмидами или векторами, содержащими химерные ДНК и способы получения химерных конструкций. Дополнительно в объем настоящего изобретения включают аттенуированные или инактивированные вакцины, содержащие, например, химерную ДНК, плазмиду, содержащую химерную ДНК, химерный вирус и т.д. и новые способы защиты свиней от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного PCV2, где способы включают введение свинье, нуждающейся в такой защите, иммунологически эффективного количества аттенуированной или инактивированной вакцины. Неожиданно и полезно, химерный цирковирус свиней по данному изобретению обеспечивает значительно повышенные уровни репликации и титра, относительно родительского вируса PCV2 и, таким образом, дополнительный вариант осуществления изобретения используют для нового способа повышения уровней репликации и титра PCV2 в клеточной культуре.

Краткое описание чертежей

Предпосылки изобретения и его отличие от уровня техники будет дополнительно описано в настоящем документе ниже, со ссылкой на прилагаемые чертежи, где:

На фиг.1 показано, что клон химерной ДНК SDM-C6 (с геном Rep PCV1, клонированным в каркас генома PCV2) является инфекционным при трансфекции в клетки PK-15. На панелях A и a проиллюстрированы клетки PK-15, трансфицированные образующим конкатемеры химерным геномом SDM-C6,; на панелях B и b проиллюстрированы клетки PK-15, трансфицированные одной копией линеаризованного химерного генома SDM-C6; и на панелях C и c в качестве отрицательных контролей проиллюстрированы реагенты для трансфекции и MEM. На левых панелях представлены результаты IFA, полученные при мечении моноклональным антителом к продукту ORF2 PCV2; тогда как на правых панелях представлены монослои клеток PK-15, наложенные на результаты IFA.

На фиг.2 проиллюстрировано определение характеристик роста вирусов PCV1 (♦), PCV2 (■) и химерного SDM-C6 (Δ) в клетках PK-15 посредством одноступенчатой кривой роста. Клетки PK-15 в 6-12-луночных планшетах инокулировали, с дублированием, каждым из вирусов из расчета множественности заражения 0,1. Инфицированные клетки из двух продублированных лунок собирали каждые 12 часов и посредством IFA определяли титры вирусов.

Подробное описание изобретения

По настоящему изобретению, создают уникальные молекулы химерных инфекционных нуклеиновых кислот цирковируса свиней (PCV2Gen-1Rep), живые химерные вирусы, полученные из молекулы химерной нуклеиновой кислоты и ветеринарные вакцины для защиты свиней от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного цирковирусом свиней 2 типа (PCV2). Конкретно, изобретение относится к конструированию и определению характеристик химерной молекулы нуклеиновой кислоты цирковируса свиней (PCV2Gen-1Rep) in vitro, в которой молекула нуклеиновой кислоты, которая кодирует PCV2, содержит последовательность нуклеиновой кислоты, кодирующую белок репликации (Rep) цирковируса свиней 1 типа (PCV1). Для целей встраивания молекулы нуклеиновой кислоты в PCV2, последовательность нуклеиновой кислоты, кодирующая белок Rep, может представлять собой одну или несколько функциональных нуклеотидных последовательностей, которые кодируют один или несколько белков репликации, которые являются необходимыми для вирусной репликации непатогенного штамма цирковируса свиней. Желательно использовать ген полной открытой рамки считывания (ORF), которая кодирует белок Rep PCV1 и, предпочтительно, использовать ген Rep ORF1 PCV1 для включения в геномный каркас PCV2. Для оптимальных свойств химеры даже более предпочтительно, чтобы ген Rep ORF1 в PCV1 занимал место открытой рамки считывания PCV2, конкретно, гена Rep ORF1 в PCV2 в геномном каркасе PCV2.

Другой вариант осуществления настоящего изобретения включает новый способ получения молекулы химерной нуклеиновой кислоты PCV2Gen-1Rep, как описано в настоящем документе, который включает следующие стадии:

(a) удаление из молекулы нуклеиновой кислоты, кодирующей PCV1, последовательности нуклеиновой кислоты, которая кодирует белок Rep;

(b) встраивание в молекулу нуклеиновой кислоты, кодирующей PCV2, последовательности нуклеиновой кислоты, которая кодирует белок Rep PCV 1; и

(c) выделение химерной молекулы нуклеиновой кислоты.

Способ можно модифицировать, как удобно, для конструирования вариантов химерного вируса по настоящему изобретению, где стадия (a) может включать удаление последовательности нуклеиновой кислоты, содержащей ген открытой рамки считывания (ORF), который кодирует белок Rep PCV1 или, более конкретно, включать удаление последовательности нуклеиновой кислоты, содержащей ген Rep ORF1 в PCV1. В качестве альтернативного варианта осуществления по данному изобретению, стадия (b) может дополнительно содержать удаление гена ORF1 из PCV2 и последующее встраивание последовательности нуклеиновой кислоты, содержащей ген ORF1 Rep из PCV1 в участок расположения гена ORF1 в молекуле нуклеиновой кислоты, кодирующей PCV2.

Новый химерный цирковирус свиней по данному изобретению предпочтительно конструируют таким образом, чтобы обеспечить способность вируса к значительно усиленной репликации и повышенным, по сравнению с родительским вирусом PCV2, титрам. Типичную химеру конструируют ниже, в примерах данного изобретения и обозначают «SDM-C6». Образец химерного вируса SDM-C6 является инфекционным in vitro, при трансфекции клеток PK-15, что показывает, что ген Rep является взаимозаменяемым между PCV1 и PCV2.

Характерную черту химерного вируса SDM-C6 - усиленный рост описывают посредством одноступенчатой кривой роста, которая позволяет сравнить характеристики роста химерного вируса и вирусов дикого типа PCV1 и PCV2. К удивлению, результаты показывают, что в клеточных культурах вирус-химера реплицируется на 1-log выше и более эффективно, чем его родительский вирус PCV2. Несмотря на то, что химерный вирус реплицируется до тех же титров, что и непатогенный PCV1, дальнейшие исследования неожиданно показали, что при трансфекции (т.е. инфицировании или инокуляции) клеток PK-15, химерный PCV2Gen-1Rep по изобретению реплицируется с большей скоростью, чем оба его родительских вируса PCV1 и PCV2.

Поскольку являлось проблематичным выращивание PCV2 до более высокого титра, необходимого для надлежащей продукции вакцин в промышленном масштабе - где даже увеличение титра на 1-log считают значимым - настоящее изобретение обеспечивает значительный прогресс в области ветеринарии, что имеет важное значение для разработки вакцин на основе PCV2. Хотя различие на 1-log может не являться значимым для других вирусов, увеличение титра на 1-log для PCV2 имеет огромное значение при производстве вакцин на основе PCV2, т.е. более высокие титры приведут к снижению объема вакцины на дозу, что увеличит тем самым эффективность готового продукта и эффективность всего производственного процесса. Предпочтительно, применение новой химеры PCV2Gen-1Rep настоящего изобретения относится к процессу получения вакцин на основе PCV2, значительно улучшенному, чем мог бы быть достигнут ранее в прошлом. Также, поскольку химера PCV2Gen-1Rep уникальным образом основана на геномном каркасе, происходящем из PCV2, это приводит к наличию великолепного антигенного вещества в вакцине для защиты свиней от вирусной инфекции или PMWS, вызванного PCV2, вследствие наличия, в пределах химерной конструкции, гена иммуногенного капсида ORF2 PCV2, который является важным для вызова иммунного ответа у инокулированных свиней.

Одним из самых больших различий, которое отличает химерный вирус SDM-C6 по настоящему изобретению от химерного вируса PCV 1-2, ранее описанного в патентах США № 7279166 B2 и № 7276353 B2, являются последовательности нуклеиновой кислоты: геномная последовательность химерного вируса PCV2Gen-1Rep по настоящему изобретению (SDM-C6) происходит из патогенного PCV2, в то время как описанный ранее химерный вирус PCV 1-2 происходит из непатогенного PCV1. В литературе опубликовано, что межгенные последовательности между генами Cap и Rep двух вирусов (PCV1 и PCV2) могут играть важную роль в регулировании репликации PCV (A. K. Cheung, «Detection of rampant nucleotide reversion at the origin of DNA replication of porcine circovirus type 1», Virology 333:22-30 (2005); A. K. Cheung, «Identification of an octanucleotide motif sequence essential for viral protein, DNA, and progeny virus biosynthesis at the origin of DNA replication of porcine circovirus type 2», Virology 324:28-36 (2004); A. Mankertz et al., «New reporter gene-based replication assay reveals exchangeability of replication factors of porcine circovirus types 1 and 2», J. Virol. 77:9885-93 (2003)). Так как преобразование штамма PCV2 заключается во введении в место расположения гена Rep в последовательности ДНК PCV2 гена Rep из PCV1, с целью конструирования химерного вируса SDM-C6, можно предположить, что ген Rep из PCV1 может способствовать увеличению способности к репликации. Однако до тех пор, пока реально не создадут конструкцию и не протестируют ее в исследованиях, направленных на изучение роста, такие предположения будут всего лишь догадкой, конкретно вследствие того факта, что непатогенный PCV1 и патогенный PCV2 в своих полных геномах имеют только 68-76% гомологии нуклеотидной последовательности. Ген Rep PCV1 не может транслироваться в функциональные коды генома PCV2 или обеспечивать лучшую способность к репликации в пределах другой нуклеотидной последовательности, кодирующей PCV2. Таким образом, текущее наблюдение в отношении настоящего изобретения о том, что химерный вирус SDM-C6 реплицируется до того же титра, что и PCV1, является неожиданным результатом. В качестве другого неожиданного свойства, вирус SDM-C6 также реплицируется быстрее, чем оба родительских штамма PCV1 и PCV2, что показывает, что механизм способности к усиленной репликации для химерного вируса PCV2Gen-1Rep по настоящему изобретению еще предстоит определить.

Предшествующих сообщений о включении гена Rep PCV1 в пределы геномного каркаса патогенного PCV2 и получении инфекционного патогена со свойствами к усиленной, по сравнению с обоими родительскими штаммами, репликации, как описано в настоящем документе, до настоящего времени не было. Вследствие способности к усиленной репликации нового химерного вируса PCV2Gen-1Rep, дополнительный вариант осуществления изобретения относится, таким образом, к новому способу увеличения репликации и титра PCV2 в клеточной культуре, где способ содержит следующие стадии:

(a) конструирование химерного вируса PCV2Gen-1Rep, в котором ген Rep ORF1 PCV2 заменяют геном Rep ORF1 PCV1;

(b) инокуляция подходящей клеточной линии химерой PCV2Gen-1Rep;

(c) культивирование химеры PCV2Gen-1Rep в подходящей среде для выращивания вируса в стандартных условиях в течение достаточного количества времени для индукции вирусной продукции; и

(d) выделение химерного вируса.

В способе выше примеры подходящей клеточной линии представляли бы собой клеточную линию почек свиньи без свиного антигена (клетки PK-15), клеточную линию семенников свиньи (ST) и схожие клеточные линии, обеспечивающие выращивание цирковирусов свиней или адаптированные, конкретно, для выращивания цирковирусов свиней.

Также включенными в объем настоящего изобретения являются биологически функциональные плазмиды, вирусные векторы и т.п., которые содержат новые химерные молекулы нуклеиновой кислоты, описываемые в настоящем документе, подходящие клетки-хозяева, трансфицированные этими плазмидами или векторами и живой химерный цирковирус свиней, продуцируемый клетками-хозяевами. Изобретение дополнительно охватывает способ получения иммуногенного полипептидного продукта, включающий выращивание, в подходящих условиях питательной среды, прокариотических или эукариотических клеток-хозяев, трансфицированных химерной молекулой нуклеиновой кислоты цирковируса свиней (PCV2Gen-1Rep), как описано в настоящем документе, способом, обеспечивающим экспрессию указанного полипептидного продукта и выделение желаемого полипептидного продукта экспрессии химерной молекулы.

Подходящие аттенуированные или инактивированные (т.е. убитые) вакцины химерных вирусных молекул и молекул ДНК и способы их использования также включены в объем настоящего изобретения. Инокулированных свиней защищают от тяжелой вирусной инфекции и PMWS, вызванного PCV2. Новый способ защищает свиней, нуждающихся в защите от вирусной инфекции или PMWS, посредством введения свинье иммунологически эффективного количества вакцины по изобретению, такой как, например, вакцина, содержащая иммуногенное количество химерной последовательности ДНК, кодирующей PCV2Gen-1Rep, клонированный вирус-химера, плазмида или вирусный вектор, содержащие химерные молекулы ДНК, рекомбинантная последовательность ДНК PCV2Gen-1Rep и т.д. Другие антигены, такие как PRRSV, PPV, другие инфекционные и иммуностимулирующие средства для свиней можно давать свинье одновременно, для обеспечения широкого спектра защиты от вирусной инфекции.

Вакцины включают, например, молекулу химерной нуклеиновой кислоты PCV2Gen-1Rep, клонированный химерный геном в подходящих плазмидах или векторах, таких как, например, вектор pSK, убитый (инактивированный) или аттенуированный химерный вирус и т.д., в комбинации с нетоксичным, физиологически приемлемым носителем и, необязательно, одним или несколькими стандартными адъювантами. Предпочтительно, в вакцинах в качестве антигена используют убитый химерный вирус.

Адъювант, который можно вводить в комбинации с вакциной по настоящему изобретению, является средством, которое усиливает иммунную реакцию свиньи в ответ на введение вакцины. Адъювант можно вводить в то же время и в то же место, что и вакцину, или в другое время, например, в виде бустер-инъекции. Преимущественно, адъюванты также можно вводить свинье способом ведения или в место введения, отличными от способа или места введения вакцины. Подходящие адъюванты, известные специалистам в области ветеринарии, включают в качестве неограничивающих примеров гидроксид алюминия (alum), иммуностимулирующие комплексы (ISCOMS), неионные блок-полимеры или сополимеры, цитокины (подобные IL-1, IL-2, IL-7, IFN-α, IFN-β, IFN-γ и т.д.), сапонины, монофосфорил липид A (MLA), мурамил-дипептиды (MDP) и т.п. Другие подходящие адъюванты включают, например, сульфат алюминия-калия, термолабильный или термостабильный энтеротоксин, выделенный из Escherichia coli, токсин холеры или его субъединица B, дифтерийный токсин, столбнячный токсин, токсин коклюша, неполный или полный адъювант Фрейнда и т.д. Адъюванты, основанные на токсинах, таких как дифтерийный токсин, столбнячный токсин и токсин коклюша можно инактивировать до использования, например, посредством обработки формальдегидом.

Вакцины могут дополнительно содержать дополнительные антигены для повышения иммунологической активности химерного вируса или ДНК по настоящему изобретению, такие антигены как, например, вирус репродуктивного-респираторного синдрома свиней (PRRSV), парвовирус свиней (PPV), другие инфекционные средства и иммуностимуляторы для свиней.

Новые вакцины по данному изобретению не ограничены любым конкретным видом или способом получения. Вакцины с клонированным вирусом включают в качестве неограничивающих примеров вакцины на основе инфекционной ДНК (т.е. с использованием плазмид, векторов или других традиционных носителей для прямого введения ДНК свиньям), аттенуированные вакцины, инактивированные (убитые) вакцины, вакцины, созданные способами генетической инженерии и т.д. Вакцины получают общепринятыми, известными в данной области способами.

Так как антигенное средство в вакцине по данному изобретению основано на патогенном штамме PCV2, активное средство должно быть сначала аттенуировано или инактивировано подходящим способом, известным в данной области. Для получения вакцин на основе инактивированного вируса, например, осуществляют выращивание вируса из клона инфекционной ДНК способами, известными в данной области или описываемыми в настоящем документе. Затем оптимизируют последовательную инактивацию вируса посредством протоколов, как правило, известных специалистам в данной области.

Инактивированные вирусные вакцины можно получать, обрабатывая химерный вирус, полученный из клонированной ДНК, инактивирующими средствами, такими как формалин или гидрофобные растворители, кислоты и т.д., посредством облучения ультрафиолетовым светом или рентгеновскими лучами, нагреванием и т.д. Инактивацию проводят способом, известным в данной области. Например, при химической инактивации, подходящий вирусный образец или образец сыворотки, содержащей вирус, как правило, обрабатывают в течение достаточного периода времени достаточным количеством или концентрацией инактивирующего средства при достаточно высокой температуре или рН, для инактивации вируса (или низкой, в зависимости от инактивирующего средства). Инактивацию нагреванием, как правило, осуществляют при температуре и в течение периода времени, достаточного для инактивации вируса. Инактивирование облучением часто выполняют, используя свет с определенной длиной волны или другой источник энергии в течение периода времени, достаточного для инактивации вируса. Как правило, термины «инактивированная», «мертвая» или «убитая» используют взаимозаменяемо в отношении вирусных вакцин для обозначения вакцины, содержащей вирусы, которые инактивированы. Вирус рассматривают как инактивированный, если он не является способным к инфицированию клетки, восприимчивой к инфекции.

Для получения аттенуированных вакцин из патогенных клонов, культуру ткани адаптированного, живого, патогенного PCV2Gen-1Rep сначала аттенуируют (переводят в непатогенное или безвредное состояние) посредством способов, известных в данной области, как правило, посредством выполнения серийных пассажей клеточных культур. Аттенуирование патогенных клонов можно также выполнять посредством делеций генов или мутаций в вирусных генах.

Дополнительно, является возможным определение нуклеотидных последовательностей в вирусном геноме, ответственных за вирулентность, и генная инженерия авирулентного вируса посредством, например, сайт-специфического мутагенеза. При сайт-специфическом мутагенезе возможны вставка, делеция или замена одного или нескольких нуклеотидов (см., например, Zoller et al., DNA 3:479-488, 1984). Синтезируют олигонуклеотид, содержащий желаемую мутацию, и подвергают отжигу с участком одноцепочечной вирусной ДНК. Гибридную молекулу, которая образуется в результате этого способа, используют для трансформации бактерий. Затем выделенную двухцепочечную ДНК, содержащую подходящую мутацию, используют для получения полноразмерной ДНК, посредством лигирования с последним рестрикционным фрагментом, затем трансфицируют в подходящую клеточную культуру. Лигирование генома в подходящий вектор для переноса можно выполнять любым стандартным способом, известным специалистам в данной области. Трансфекцию вектора в клетки-хозяева для продукции вирусного поколения можно осуществлять, используя любые консервативные способы, такие как трансфекция, опосредованная кальций-фосфатным способом или опосредованная DEAE-декстраном, электропорация, слияние протопластов и другие хорошо известные способы (например, Sambrook et al., «Molecular Cloning: A Laboratory Manual», Cold Spring Harbor Laboratory Press, 1989). Клонированный вирус затем демонстрирует желаемую мутацию. Альтернативно, можно синтезировать два олигонуклеотида, которые содержат подходящую мутацию. Их можно подвергать отжигу с образованием двухцепочечной ДНК, которую можно встраивать в вирусную ДНК для получения полноразмерной ДНК.

Клеточную линию насекомого (подобную HI-FIVE) можно трансформировать вектором для переноса, содержащим молекулы нуклеиновой кислоты, полученные из вируса или реплицированные с вирусного генома, который кодирует один или несколько иммунодоминантных белков вируса. Вектор для переноса включает, например, линеаризованную ДНК бакуловируса и плазмиду, содержащую иммуногенные полинуклеотиды. Для создания рекомбинантного бакуловируса клеточную линию-хозяина можно подвергнуть совместной трансфекции линеаризованной бакуловирусной ДНК и плазмидой. Альтернативно, живые векторы, такие как поксвирус или аденовирус, можно использовать в качестве вакцины в комбинации с химерой по изобретению.

Иммунологически эффективное количество вакцин по настоящему изобретению вводят свинье, нуждающейся в защите от вирусной инфекции или PMWS. Иммунологически эффективное количество или иммуногенное количество, которое инокулируют свинье, можно легко определять или протитровать посредством общепринятого тестирования. Эффективное количество представляет собой количество, при котором при введении вакцины достигают иммунологического ответа, достаточного для защиты свиньи, подвергнутой воздействию вируса, который вызывает PMWS. Предпочтительно, свинью защищают до той степени, в которой от одного до всех побочных физиологических симптомов или эффектов вирусного заболевания значительно снижают, улучшают состояние или полностью препятствуют их возникновению.

Вакцину можно вводить в виде однократной дозы или многократными дозами. Дозировка может изменяться, например, приблизительно от 1 микрограмма до приблизительно 1000 микрограмм ДНК плазмиды, содержащей геном инфекционной химерной ДНК (в зависимости от концентрации иммуноактивного средства вакцины), предпочтительно от 100 до 200 микрограмм клона химерной ДНК PCV2Gen-1Rep. Способы определения или титрования подходящих дозировок активного антигенного средства для определения минимальных эффективных дозировок, зависящих от веса свиньи, концентрации антигена и других характерных факторов, известны в данной области.

Желательно, вакцину вводят свинье, которая еще не подвергалась воздействию вируса PCV. Вакцину, содержащую антигенное средство, можно удобно вводить интраназально, трансдермально (т.е. примененную на поверхность кожи или в поверхности кожи для системного всасывания), парентерально и т.д. Парентеральный путь введения включает, в качестве неограничивающих примеров, внутримышечное, внутривенное, интраперитонеальное, внутрикожное (т.е. инъецированное или введенное под кожу другим способом), подкожные способы и т.п. Так как внутримышечные и внутрикожные пути инокуляции успешны в других исследованиях, в которых используют клоны вирусных инфекционных ДНК (E.Е. Sparger et al., «Infection of cats by injection with DNA of feline immunodeficiency virus molecular clone», Virology 238:157-160 (1997); L. Willems et al., «In vivo transfection of bovine leukemia provirus into sheep», Virology 189:775-777 (1992)), эти пути введения наиболее предпочтительны, в дополнение к практичному интраназальному пути введения. Хотя и как менее удобный, также предполагают, что вакцину вводят свинье посредством внутрилимфатического способа инокуляции.

При введении в виде жидкости, настоящую вакцину можно получать в форме водного раствора, сиропа, эликсира, настоя и т.п. Такие составы являются известными в данной области и их, как правило, получают растворением антигена и других типичных адъювантов в подходящих системах носителя или растворителя. Подходящие носители или растворители включают, в качестве неограничивающих примеров, воду, физиологический раствор, этанол, этиленгликоль, глицерин и т.д. Типичные вспомогательные средства представляют собой, например, сертифицированные красители, ароматизаторы, подсластители и противомикробные консерванты, такие как тимеросал (этилртутьтиосалицилат натрия). Подобные растворы можно стабилизировать, например, добавлением частично гидролизованного желатина, сорбита или клеточной среды для культивирования и можно буферизовать общепринятыми способами, используя реагенты, известные в данной области, такие как вторичный кислый фосфат натрия, первичный кислый фосфат натрия, вторичный кислый фосфат калия, первичный кислый фосфат калия, их смесь и т.п.

Жидкие составы также могут включать суспензии и эмульсии, которые содержат суспензии или эмульгаторы в сочетании с другими стандартными ко-формулянтами. Эти виды жидких составов можно получать традиционными способами. Суспензии, например, можно получать, используя коллоидную мельницу. Эмульсии, например, можно получать, используя гомогенизатор.

Парентеральным составам, созданным для инъекции в организм жидких систем, требуется надлежащая изотоничность и буферная емкость с pH, соответствующими уровням в жидкостях организма свиньи. Изотоничность можно соответствующим образом регулировать хлоридом натрия и, по мере необходимости, другими солями. Подходящие растворители, такие как этанол или пропиленгликоль, можно использовать для увеличения растворимости ингредиентов в составе и для стабильности жидкого препарата. Дополнительные вспомогательные средства, которые можно использовать в вакцине по настоящему изобретению, включают, в качестве неограничивающих примеров, декстрозу, традиционные антиоксиданты и хелатирующие средства, такие как этилендиаминтетрауксусная кислота (ЭДТА). Парентеральные лекарственные формы перед использованием необходимо подвергать стерилизации.

Следующие примеры демонстрируют некоторые аспекты по настоящему изобретению. Однако следует понимать, что эти примеры представлены только для иллюстрации и не подразумевают полного соответствия условиям и объему по данному изобретению. Должно быть понятно, что при проведении реакции в стандартных условиях (например, температура, время реакции и т.д.), также можно, хотя в целом, менее удобно, использовать условия и выше и ниже заданных пределов. Примеры выполняют при комнатной температуре (приблизительно от 23°C до приблизительно 28°C) и при атмосферном давлении. Все доли и проценты, упоминаемые в настоящем документе, являются весовыми, и все значения температуры представлены в градусах Цельсия, если не указано иначе.

Дополнительного понимания изобретения можно достигнуть из неограничивающих примеров, которые приведены ниже.

Пример 1

Конструирование химерного PCV2Gen-1Rep

На всем протяжении экспериментов in vitro, которые представлены ниже, использовали клетки PK-15 без PCV. Эти клетки предварительно получали посредством конечного разведения (M. Fenaux et al., «Cloned genomic DNA of type 2 porcine circovirus is infectious when injected directly into the liver and lymph nodes of pigs: characterization of clinical disease, virus distribution, and pathologic lesions», J. Virol. 76:541-51 (2002)). Конструирование единичных копий PCV2 и PCV1 и клонов инфекционной ДНК с димеризованным тандемным повтором описано ранее (id.).

Для конструирования химерного PCV2Gen-1Rep с геном Rep ORF1 из PCV1, заменяющим ген Rep ORF1 PCV2 в каркасе генома PCV2 (включая его межгенные последовательности), клон с единичной копией генома инфекционной ДНК PCV1 в pBluescript II SK+вектор амплифицировали посредством ПЦР с праймерами PCV1REPF (5' CAACTGGCCAAGCAAGAAAAG 3' (которая соответствует SEQ ID NO:1)) и PCV1REPR (5' AACCATTACGATGTGATCAAAAAGACTCAGTAATTTATTTTATATGGGA AAAGGG 3' (которая соответствует SEQ ID NO:2)) для получения фрагмента гена PCV1Rep со сконструированными участками распознавания рестрикционных ферментов BalI и BclI с обоих концов. Реакция ПЦР содержала 45 мкл Platinum PCR SuperMix High Fidelity (Invitrogen, Carlsbad, CA), 20 пМ праймера PCV1REPR, 20 пМ праймера PCV1REPF и 1 мкл клона с единичной копией инфекционной ДНК PCV1. Реакция в термоциклере состояла из начальной денатурации в течение 2 мин при 94°C и 35 циклов денатурации при 94°C в течение 30 с, отжига при 55°C в течение 30 с и достройки при 68°C в течение 30 с, с последующей конечной инкубацией при 68°C в течение 7 мин. Фрагмент PCV1Rep разделяли в геле с 1% агарозой и очищали, используя набор Geneclean II (Qbiogene, Irvine, CA). Фрагмент PCV1Rep затем расщепляли BalI и BclI, раздельно и фрагмент, полученный в результате расщепления разделяли в геле с 1% агарозой и очищали, используя набор Geneclean II.

Фрагмент геномного каркаса PCV2 без гена Rep амплифицировали с клона PCV2 с единичной копией инфекционной ДНК в векторе pBluescript посредством ПЦР, используя праймеры PCV2GENF (5' CTTTTTGATCACTTCGTAATGGTTTTTA 3' (который соответствует SEQ ID NO:3)) и PCV2GENR (5' GCTTACCATGTTGCTGCTGAGGT 3' (который соответствует SEQ ID NO:4)). Участки распознавания рестрикционных ферментов BfrBI и BclI встраивали в оба конца фрагмента. Реакция ПЦР содержала 20 пМ праймера PCV2GENF, 20 пМ праймера PCV2GENR, 40 мМ dNTP (Fisher Scientific, Pittsburgh, PA), 200 мМ MgCl2, 10 мкл 10X буфера для ПЦР, 72 мкл dH2O, 5 единиц AmpliTaq (Applied Biosystems, Foster City, CA) и 1 мкл клона PCV2 с единичной копией инфекционной ДНК. Реакция в термоциклере состояла из начальной денатурации при 94°C в течение 10 мин и 38 циклов денатурации при 94°C в течение 1 мин, отжига при 50°C в течение 1 мин и достройки при 72°C в течение 45 с, с последующей конечной инкубацией при 72°C в течение 7 мин. Фрагмент геномного каркаса PCV2 (без гена Rep), фрагмент PCV2Gen, разделяли в геле с 1% агарозой и очищали, используя набор Geneclean II. Фрагмент PCV2Gen затем расщепляли BfrBI и BclI, раздельно, разделяли в геле с 1% агарозой и очищали, используя набор Geneclean II.

Для создания клона PCV химерной инфекционной ДНК, выполняли лигирование фрагментов Rep PCV1 и PCV2Gen в течение ночи, используя набор для лигирования ДНК Stratagene (LaJolla, CA). Смесь для лигирования использовали для трансформации клеток TOP 10 (Invitrogen), по протоколу производителя. Отбирали белые колонии, культивировали в течение ночи и выделяли плазмиды, используя набор Sigma's GenElute Plasmid Miniprep (St. Louis, MO). Плазмиды подвергали расщеплению ферментом рестрикции KpnI и разделяли в геле с 1% агарозой для определения надлежащих плазмид с 2 полосами приблизительно 1,7 т.п.н. (PCV2Gen-1Rep) и 2,9 т.п.н. (pBluescript II SK+вектор).

Пример 2

Тестирование жизнеспособности клона с химерной ДНК PCV2Gen-1Rep

Тестирование жизнеспособности клона с химерной ДНК PCV2Gen-1Rep осуществляли посредством трансфекции клеток PK-15. Фермент рестрикции KpnI использовали для вырезания химерного генома PCV2Gen-1Rep из pBluescript II SK+плазмидный вектор. Химерный геном PCV2Gen-1Rep разделяли в геле с 1% агарозой, очищали, используя GeneClean II и затем осуществляли образование конкатемеров, используя T4 ДНК лигазу, с использованием, в основном, ранее описанных общепринятых способов (M. Fenaux et al., 2002, выше). Клетки PK-15 при приблизительно 70% конфлюентного роста на предметном стекле Lab-Tek трансфицировали конкатемеризированной геномной ДНК PCV2Gen-1Rep, используя липофектамин и Plus Reagent, по протоколу производителя (Invitrogen). Через трое суток после трансфекции осуществляли непрямой иммунофлуоресцентный анализ (IFA) с использованием поликлонального антитела, специфичного к ORF2 PCV2, как описывали ранее (id.), для определения инфицирующей способности. Для дополнительного анализа инфицирующей способности химерного генома PCV2Gen-1Rep, клетки PK-15 при 70% конфлюэнтного роста во флаконах T-25 трансфицировали приблизительно 12 мкг конкатемеризированного химерного генома на флакон, как описано ранее (id.). Вирусный штамм собирали через 3 суток после трансфекции и титровали посредством IFA с поликлональным антителом, специфичным к ORF2 PCV2, как описано ранее (id.).

Пример 3

Секвенирование ДНК для подтверждения химерного генома

Праймеры Rep830F (5' GGTGTCTTCTTCTGCGGTAACG 3' (который соответствует SEQ ID NO:5)) и Rep830R (5' GTTCTACCCTCTTCCAAACCTTCC 3' (который соответствует SEQ ID NO:6)) использовали для амплификации участка соединения между 3' фрагментом PCV2Gen и 5' фрагментом PCV1Rep. Праймеры Rep10F (5' GGAAGACTGCTGGAGAACAATCC 3' (который соответствует SEQ ID NO:7)) и Rep10R (5' CGTTACTTCACACCCAAACCTG 3' (который соответствует SEQ ID NO:8)) использовали для амплификации участка соединения между 5' фрагментом PCV1Rep и 3' фрагментом PCV2Gen. Для амплифицированных продуктов ПЦР проводили секвенирование для обеих цепей.

Пример 4

Сайт-специфический мутагенез

Первоначальный клон химерной ДНК PCV2Gen-1Rep не являлся инфекционным, будучи трансфицированным в клетки PK-15. После анализа последовательности химерного генома, после стартового кодона ATG гена Rep ORF1 PCV1 обнаружили вставку в 6 нуклеотидов (GTAAGC). Для устранения этой ошибки и нежелательной вставки, привнесенной посредством ПЦР и стадий клонирования, праймеры MVTF (5' CTCAGCAGCAACATGCCAAGCAAGAAAAGCGG 3' (который соответствует SEQ ID NO:9)) и MVTR (5' CCGCTTTTCTTGCTTGGCATGTTGC TGCTGAG 3' (который соответствует SEQ ID NO:10)) использовали для удаления вставки из 6 нуклеотидов, с использованием набора для сайт-специфического мутагенеза QuikChange II (Stratagene). Клетки TOP10 по протоколу производителя (Invitrogen) трансформировали продуктом, подвергнутым сайт-специфическому мутагенезу. Белые колонии отбирали и культивировали в течение ночи. Для клона SDM-C6 делают посев штрихом на планшете с агаром LB, содержащим ампициллин и выращивали в течение ночи при 37°C. Четыре колонии отбирали и культивировали в течение ночи. Из них выделяли плазмиды и секвенировали, используя праймеры Rep830F и Rep830R, для того, чтобы убедиться, что 6 встроенных нуклеотидов удалены из химерного генома.

Обнаружили, что вставка в 6 нуклеотидов (GTAAGC) обеспечивала отсутствие инфекционности у химерного клона, и нежелательную вставку успешно удаляли посредством сайт-специфического мутагенеза. После последующей трансфекции в клетки PK-15 обнаружили, что новый химерный клон, SDM-C6, является инфекционным.

Пример 5

Получение вирусного штамма In Vitro

Характеризация химерного вируса

Вирусные штаммы PCV1 и PCV2 получали из инфекционных клонов ДНК PCV1 и PCV2, соответственно, посредством трансфекции клеток PK-15 в соответствии с общепринятыми способами, описанными ранее (M. Fenaux et al., 2002, выше). Инфекционный титр для каждого вирусного штамма определяли посредством IFA с антителом, специфичным к продукту ORF2 PCV2 (id.)

Химерный геном SDM-C6, содержащий ген Rep PCV1 в каркасе генома PCV2, вырезали из pBluescript II SK+плазмида, используя фермент рестрикции KpnI и очищали, используя набор GeneClean II. Приблизительно 40 мкг химерного генома SDM-C6 подвергали конкатемеризации, используя T4 ДНК лигазу и использовали для трансфекции 4 флакона (10 мкг на флакон) клеток PK-15 при приблизительно 70% конфлюентности, используя липофектамин и Plus Reagent, как описано ранее (id.). Через трое суток после трансфекции, химерный вирус SDM-C6 собирали посредством трехкратного замораживания и оттаивания трансфицированных клеток и инфекционный титр химерного вирусного штамма SDM-C6 определяли посредством IFA с моноклональным антителом к продукту ORF2 PCV2 (Rural Technologies Inc., Brookings, SD) в разведении 1:1000 в фосфатно-солевом буфере (10X, pH 7,4) (Invitrogen). Вирусный штамм SDM-C6 обладал превосходным вирусным инфекционным титром 0,5×105,5 TCID50/мл. Клетки PK-15, трансфицированные как конкатемеризованным, так и линеаризованным геномом SDM-C6, являлись убедительно положительными в IFA (фиг.1), что доказывает, что химерный геном SDM-C6 с геном Rep PCV1, клонированным в каркас генома PCV2, является инфекционным in vitro.

Пример 6

Одноступенчатая кривая роста

Для описания характеристик роста химерного вируса и сравнения его с вирусами дикого типа PCV1 и PCV2, исследовали одноступенчатую кривую роста. Клетки PK-15 культивировали в восьми лунках шести 12-луночных планшетов. При достижении приблизительно 70% конфлюентности, каждую лунку промывали 2 мл MEM. Каждую из восьми лунок, в дублирующих планшетах, инокулировали PCV1, PCV2 и SDM-C6 при множественности инфекции, равной 0,1 (MOI). После 1 часа инкубации инокулят удаляли. Клеточные монослои последовательно промывали три раза, каждый 2 мл PBS для удаления любого избыточного количества вирусного инокулята. Два мл MEM с 2% FBS и 1X антибиотик-противогрибковым средством добавляли в каждую лунку и планшеты непрерывно инкубировали при 37°C с 5% CO2. В 0, 12, 24, 36, 48, 60, 72, 84 и 96 часов после инокуляции (hpi) клетки в одной лунке каждого продублированного планшета собирали посредством соскабливания в супернатант. Собранные клетки замораживали и оттаивали три раза и хранили при -80°C до титрования. В каждой hpi определяли инфекционный титр в 8-луночных покровных стеклах Lab-Tek II (Nalge Nunc International, Rochester, NY), используя серийно разведенный инокулят, с последующим IFA с моноклональным антителом к продукту ORF2 PCV2, используя способ Spearman-Karber (M. Fenaux et al., 2002, выше).

Данные показали, что химерный вирус SDM-C6 размножился, так же как вирус PCV1 (фиг.2) до значения титра, равного 2,2×104,0 TCID50/мл в 96 hpi, тогда как PCV2 размножился только до 2,20×103,0 TCID50/мл в 96 hpi. При 12 hpi, химерный вирус SDM-C6 размножился до титра, равного 6,95×102,0 TCID50/мл, тогда как оба вируса PCV1 и PCV2 показали неопределяемые значения титров, что позволяет заключить, что химерный вирус реплицируется быстрее, чем родительские вирусы. PCV1 обладал определяемым титром вируса в 8,70×102,0 TCID50/мл при 24 hpi, тогда как PCV2 не показали наличия определяемого титра вплоть до 48 hpi (7,91×101,0 TCID50/мл). Таким образом, это показало, что химерный вирус SDM-C6 и вирус PCV1 растут до одних и тех же титров, которые представляли собой значения, приблизительно на 1-log выше, чем титры родительского вируса PCV2.

Выше было представлено подробное описание конкретных вариантов осуществления настоящего изобретения с целью иллюстрации и не для ограничения. Необходимо понимать, что все другие модификации, результаты и эквиваленты, очевидные для тех, кто обладает профессиональным знанием в данной области, основанные на этом описании, подразумеваются как включенные в пределы объема изобретения, охватываемого формулой изобретения.

1. Молекула химерной нуклеиновой кислоты цирковируса свиней (PCV2Gen-1Rep) для защиты свиней от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного цирковирусом свиней 2 типа (PCV2), или для производства вирусной вакцины для защиты свиней от вирусной инфекции или PMWS, вызванного PCV2, содержащая молекулу нуклеиновой кислоты, кодирующую цирковирус свиней 2 типа (PCV2), которая содержит последовательность нуклеиновой кислоты, кодирующую белок Rep цирковируса свиней 1 типа (PCV1), которая заменяет последовательность нуклеиновой кислоты, кодирующую белок Rep цирковируса свиней 2 типа (PCV2), причем вставка GTAAGC удалена, в случае ее присутствия после стартового кодона ATG последовательности нуклеиновой кислоты, кодирующей белок Rep PCV1.

2. Молекула химерной нуклеиновой кислоты по п.1, в которой последовательность нуклеиновой кислоты, кодирующая белки Rep PCV1 и PCV2, представляет собой ген открытой рамки считывания (ORF).

3. Молекула химерной нуклеиновой кислоты по п.2, в которой ген Rep ORF представляет собой ORF1.

4. Плазмида или вирусный вектор для защиты свиней от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного цирковирусом свиней 2 типа (PCV2), конструкции PCV2Gen-1Rep или для производства вирусной вакцины для защиты свиней от вирусной инфекции или PMWS, вызванного PCV2, где вектор содержит молекулу химерной нуклеиновой кислоты по любому из пп.1-3.

5. Клетка-хозяин для защиты свиней от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного цирковирусом свиней 2 типа (PCV2), конструкции PCV2Gen-1Rep или для производства вирусной вакцины для защиты свиней от вирусной инфекции или PMWS, вызванного PCV2, где клетка-хозяин трансфицирована плазмидой или вектором по п.4.

6. Химерный цирковирус свиней для защиты свиней от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного цирковирусом свиней 2 типа (PCV2) или для производства вирусной вакцины для защиты свиней от вирусной инфекции или PMWS, вызванного PCV2, где химерный цирковирус свиней продуцирован клетками-хозяевами по п.5.

7. Способ получения иммуногенного полипептидного продукта, кодируемого молекулой нуклеиновой кислоты по любому из пп. 1-3, включающий: выращивание, в подходящих условиях питательной среды, эукариотических клеток-хозяев, трансфицированных молекулой химерной нуклеиновой кислоты цирковируса свиней по любому из пп.1-3 способом, обеспечивающим экспрессию указанного полипептидного продукта, и выделение желаемого полипептидного продукта экспрессии химерной молекулы.

8. Вирусная вакцина, которая защищает свиней от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного PCV2, где вакцина содержит нетоксичный, физиологически приемлемый носитель и иммуногенное количество подходящего аттенуированного или инактивированного элемента, выбранного из группы, состоящей из:
(a) молекулы химерной нуклеиновой кислоты цирковируса свиней (PCV2Gen-1Rep), содержащей молекулу нуклеиновой кислоты, кодирующую цирковирус свиней 2 типа (PCV2), которая содержит последовательность нуклеиновой кислоты, кодирующую белок Rep цирковируса свиней 1 типа (PCV1), которая заменяет последовательность нуклеиновой кислоты, кодирующую белок Rep цирковируса свиней 2 типа (PCV2);
(b) плазмиды или вирусного вектора, содержащих молекулу химерной нуклеиновой кислоты цирковируса свиней (PCV2Gen-1Rep), которая содержит молекулу нуклеиновой кислоты, кодирующую PCV2, которая содержит последовательность нуклеиновой кислоты, кодирующую белок Rep цирковируса свиней 1 типа (PCV1), которая заменяет последовательность нуклеиновой кислоты, кодирующую белок Rep цирковируса свиней 2 типа (PCV2); и
(c) химерного цирковируса свиней, созданного на основе молекулы химерной нуклеиновой кислоты цирковируса свиней (PCV2Gen-1Rep), содержащей молекулу нуклеиновой кислоты, кодирующую PCV2, которая содержит последовательность нуклеиновой кислоты, кодирующую белок Rep цирковируса свиней 1 типа (PCV1), которая заменяет последовательность нуклеиновой кислоты, кодирующую белок Rep цирковируса свиней 2 типа (PCV2),
причем вставка GTAAGC удалена, в случае ее присутствия после стартового кодона ATG последовательности нуклеиновой кислоты, кодирующей белок Rep PCV1, молекулы химерной нуклеиновой кислоты.

9. Вакцина по п.8, где молекула химерной нуклеиновой кислоты содержит последовательность нуклеиновой кислоты, кодирующую белки Rep PCV1 и PCV2, которая содержит ген открытой рамки считывания (ORF).

10. Вакцина по п.9, где молекула химерной нуклеиновой кислоты содержит ген Rep ORF1 PCV1.

11. Способ защиты свиньи от вирусной инфекции или синдрома мультисистемного послеотъемного истощения (PMWS), вызванного PCV2, включающий введение свинье, нуждающейся в этом, иммунологически эффективного количества вакцины по любому из пп.8-10.

12. Способ по п.11, который включает введение вакцины свинье парентерально, интраназально, внутрикожно или трансдермально.

13. Способ получения молекулы химерной нуклеиновой кислоты PCV2Gen-1Rep по п.1, который включает следующие стадии:
(a) предоставление молекулы нуклеиновой кислоты, которая кодирует PCV2;
(b) удаление последовательности нуклеиновой кислоты, которая кодирует белок Rep, из молекулы нуклеиновой кислоты, кодирующей PCV2;
(c) включение последовательности нуклеиновой кислоты, которая кодирует белок Rep PCV1 в молекулу нуклеиновой кислоты, кодирующую PCV2 для получения химерной молекулы нуклеиновой кислоты PCV2Gen-1Rep;
(d) удаление вставки GTAAGC, в случае ее присутствия после стартового кодона ATG последовательности нуклеиновой кислоты, кодирующей белок Rep PCV1;
(e) извлечение молекулы химерной нуклеиновой кислоты.

14. Способ по п.13, где стадия (b) включает удаление последовательности нуклеиновой кислоты, содержащей ген открытой рамки считывания (ORF), который кодирует белок Rep PCV2.

15. Способ по п.14, где геном ORF, который кодирует белок Rep PCV2, является ген Rep ORF1 PCV2.

16. Способ по п.14, где стадия (с) включает замену удаленной последовательности нуклеиновой кислоты стадии (b) последовательностью нуклеиновой кислоты, содержащей ген ORF, который кодирует белок Rep PCV1.

17. Способ по п.16, где геном ORF, который кодирует белок Rep PCV1, является ген Rep ORF1 PCV1.

18. Способ по п.17, где удаленная последовательность нуклеиновой кислота стадии (b) включает ген открытой рамки считывания (ORF), который кодирует белок Rep PCV2.

19. Способ по п.18, где геном ORF, который кодирует белок Rep PCV2, является ген Rep ORF1 PCV2.

20. Способ повышения уровней репликации и титра PCV2 в эукариотической клеточной культуре, который включает следующие стадии:
(a) конструирование химерного вируса PCV2Gen-1Rep, в котором ген Rep ORF1 PCV2 заменен на ген Rep ORF1 PCV1;
(b) инокуляция подходящей клеточной линии с химерой PCV2Gen-1Rep;
(c) культивирование химеры PCV2Gen-1Rep в подходящей среде для выращивания вирусов, в стандартных условиях, в течение количества времени, достаточного для индукции вирусной продукции; и
(d) сбор химерного вируса.

21. Способ по п.20, где подходящая клеточная линия представляет собой клеточную линию почек свиньи, не содержащую свиной антиген (клетки PK-15), или клеточную линию свиных семенников (ST).



 

Похожие патенты:

Изобретение относится к области биотехнологии, вирусологии и медицины. Предложен поксвирус осповакцины, который содержит дефектный F2L ген и суицидальный ген.

Изобретение относится к области биотехнологии. Создана рекомбинантная псевдоаденовирусная частица на основе генома аденовируса человека 5 серотипа, содержащая экспрессирующую кассету со вставкой гена гемагглютинина вируса гриппа.

Изобретение относится к области биотехнологии и касается рекомбинантных векторов, используемых для производства противогриппозных вакцин. Охарактеризованы рекомбинантная псевдоаденовирусная частица на основе генома аденовируса человека 5 серотипа и способ ее использования.

Изобретение относится к области биотехнологии и касается рекомбинантных векторов, которые могут быть использованы для противогриппозных вакцин. Охарактеризованы рекомбинантная псевдоаденовирусная частица на основе генома аденовируса человека 5 серотипа и способ ее использования в качестве компонента для создания вакцины против вируса гриппа А субтипа H1N1.

Изобретение относится к области биотехнологии и вирусологии. Предложен поксвирус осповакцины, который обладает онколитической активностью.

Изобретение относится к области биохимии и касается посттрансляционной модификации экспонируемых бактериофагом полипептидов. .

Изобретение относится к области биотехнологии, вирусологии и ветеринарии. .

Настоящее изобретение относится к области биохимии. Предложен слитый белок для лечения заболеваний, опосредованных конечными продуктами гликирования (AGE), состоящий из фрагмента варианта рецептора конечных продуктов гликирования (RAGE) человека, имеющего две точечные мутации H217R и R221H, и фрагмента константного домена иммуноглобулина человека IgG4, при необходимости соединенных линкером.

Настоящее изобретение относится к области биотехнологии, конкретно к новому пептидному аналогу инсулиноподобного фактора роста-1 (IGF-1), содержащему аминокислотную замену метионина в положении 59 на Asn, Leu, Nle, Ile, Arg, A6c, Glu, Trp или Tyr, а также другие дополнительные замены, вставки и делеции.

Настоящая группа изобретений относится к области биотехнологии. Предложено гуманизированное анти-CD79b антитело и его антигенсвязывающий фрагмент, полученные из мышиного антитела MA79b и имеющие по существу аналогичную с ним аффинность связывания CD79b.

Изобретение относится к области биотехнологии и иммунологии. Предложено моноклональное антитело и его антиген-связывающие части, которые специфически связывают C-концевую или центральную область фактора ингибирования миграции макрофагов (MIF).

Изобретение относится к области биотехнологии, конкретно к созданию рекомбинантных плазмид, обеспечивающих экспрессию полиэпитопных опухоль-ассоциированных антигенов в дендритных клетках, способных стимулировать специфические цитотоксические клетки, и может быть использовано в медицине.

Настоящее изобретение относится к области иммунологии. Предложены моноклональные антитела, которые связываются с внеклеточным доменом рецепторной тирозинкиназы AXL и которые, по меньшей мере, частично ингибируют активность AXL, а также их антигенсвязывающие фрагменты.

Изобретение относится к области иммунологии. Предложено антитело, которое специфически связывает гепаринсвязывающий EGF-подобный фактор роста (HB-EGF), и его антигенсвязывающий фрагмент.

Настоящее изобретение относится к области иммунологии. Предложено гуманизированное антитело к человеческому интегрину альфа-9 (α9), полученное из антитела Y9A2 мыши и обладающее улучшенной активностью и термостабильностью.

Изобретение относится к области биотехнологии, а именно к эукариотическому вектору для экспрессии целевого рекомбинантного продукта в клетке млекопитающего и его применению, к клетке млекопитающего для продуцирования целевого рекомбинантного продукта и способу ее получения, способу отбора клетки млекопитающего и способу получения целевого рекомбинантного продукта.

Группа изобретений относится к области биотехнологии. Вектор экспрессии содержит: (a) ориджин репликации OriP, полученный из вируса Эпштейна-Барр (EBV), где ориджин репликации содержит: 1) элемент симметрии второго порядка (DS); и 2) участок дупликации (FR), который содержит участок связывания EBNA; (b) ориджин репликации SV40; (c) участок инсерции для вставки представляющего интерес гена; (d) промотор EF-1б, функционально связанный с участком инсерции; (e) сигнал поли-A; (f) бактериальный ориджин репликации; (g) селектируемый маркер; и необязательно содержащий (h) последовательность нуклеиновой кислоты, кодирующую константную область тяжелой или легкой цепи антитела, функционально связанную с участком инсерции.

Изобретение относится к области биотехнологии. Представлен выделенный химерный полинуклеотид для усиления продуцирования представляющего интерес гетерологичного белка, содержащий полинуклеотидную последовательность промотора SigA или SigH, функционально связанную с полинуклеотидом, кодирующим белок YmaH, причем химерный полинуклеотид содержит последовательность, которая по меньшей мере на 90% идентична SEQ ID NO: 1, 2, 3 или 13.
Наверх