Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток



Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток
Нуклеиновая кислота, кодирующая основанный на fret дальне-красный биосенсор для измерения активности каспазы 3 внутри клеток

 


Владельцы патента RU 2535981:

Федеральное государственное бюджетное учреждение науки ИНСТИТУТ БИООРГАНИЧЕСКОЙ ХИМИИ им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук (ИБХ РАН) (RU)

Настоящее изобретение относится к биохимии и представляет собой нуклеиновую кислоту, кодирующую основанный на FRET дальне-красный флуоресцентный биосенсор для измерения активности каспазы 3 внутри клеток, где аналитический сигнал флуоресцентного биосенсора представляет собой флуоресценцию в дальне-красной области спектра и в качестве акцептора выступает белок iRFP, а в качестве донора - дальне-красный флуоресцентный белок семейства GFP, где аминокислотная последовательность дальне-красного флуоресцентного биосенсора выбрана из группы SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7. Изобретение позволяет получить новый биосенсор активности каспазы 3 с использованием дальне-красных флуоресцентных белков, обеспечивающих аналитический флуоресцентный сигнал от биосенсора в области длин волн более 650 нм. 7 ил., 3 пр.

 

[002] ОБЛАСТЬ ИЗОБРЕТЕНИЯ

[003] Данное изобретение относится в основном к области биологии и химии. В частности, изобретение направлено на биосенсоры для детекции активности каспазы 3, сконструированные на основе флуоресцентных белков.

[004] УРОВЕНЬ ТЕХНИКИ

[005] Процесс запрограммированной клеточной гибели, апоптоз, является одним из ключевых процессов для эмбрионального развития и поддержания тканей в здоровом состоянии, в частности противодействия опухолевому росту. В инициации и эффекторной стадии апоптоза ключевую роль играют ферменты каспазы.

[006] Каспазы представляют собой семейство внутриклеточных специфичных цистеиновых протеаз, которые являются высококонсервативными в многоклеточных организмах. В млекопитающих было идентифицировано 14 представителей семейства каспаз, сгруппированных в 2 главные руппы, воспалительные и апототические каспазы. Связанные с апоптозом каспазы далее классифицируется на 2 группы: инициирующие каспазы (каспазы 2, 8 и 9), которые функционируют в начале каспазного сигнального пути, и эффекторные каспазы 3, 6 и 7 [Degterev A, Boyce M, Yuan J. A decade of caspases. Oncogene. 2003; 22(53):8543-8567].

[007] Инициирующие каспазы 8 и 9 активицируются посредством автокаталитического расщепления, опосредуемого высокомолекулярным адапторным коплексом, известным как апоптосома. Данный комплекс обычно формируется в ответ на внутриклеточные или внеклеточные стимулы, сигнализирующие о необходимости гибели клетки [Riedl SJ, Salvesen GS. The apoptosome: signalling platform of cell death. Nat Rev Mol CelS Biol. 2007; 8(5):405-413]. Главной мишенью активированных инициирующих каспаз являются неактивные предшественники эффекторных каспаз 3, 6 и 7-прокаспазы. Расщепление каспазами 8 и 9 активирует эффекторные каспазы. Мишенями расщепления эффекторных каспаз, в частности каспазы 3, являются множество клеточных белков, что приводит к контролируемой гибели клетки. В дополнение к ключевой роли в апоптозе недавние исследования демонстрируют наличие не связанных с апоптозом функций эффекторных каспаз, включающих регулирование иммунного ответа, пролиферации, дифференцировки и подвижности клеток [Kuranaga E, Miura M. Nonapoptotic functions of caspases: caspases as regulatory molecules for immunity and cell-fate determination. Trends Cell Biol. 2007; 17(3):135-144; Yi CH, Yuan J. The Jekyll and Hyde functions of caspases. Dev Cell. 2009; 16(1):21-34].

[008] Каспазы характеризуются высокой субстратной специфичностью. Они распознают специфическую последовательность в белках-мишенях. С помощью библиотек флуоресцентно меченых тетрапептидных субстратов было установлено, что каспазы 3 и 7 распознают в качестве мишени последовательность DEVD.

[009] Как указывает ряд авторов, специфичность каспаз к субстратам, определенная in vitro с помощью указанного подхода, не является абсолютно точным отражением необходимых для расщепления условий in vivo. На специфичность расщепления каспаз in vivo влияют особенности конформации аминокислотных последовательностей, фланкирующих расщепляемый тетрапептидный мотив, которые могут контролировать молекулярный электростатический потенциал и стерическую доступность активного центра протеазы и белка-мишени [Muneef Ayyash, Hashem Tamimi, and Yaqoub Ashhab Developing a powerful In Silico tool for the discovery of novel caspase-3 substrates: a preliminary screening of the human proteome. BMC Bioinformatics. 2012; 13: 14]. Например, несмотря на одинаковую расщепляемую тетрапептидную последовательность DEVD, каспазы 3 и 7 характеризуются четким различием расщепляемых природных субстратов [Walsh JG et al. Executioner caspase-3 and caspase-7 are functionally distinct proteases. Proc Natl Acad Sci USA. 2008; 105(35): 12815-12819]. Было показано, что кроме терапептидной расщепляемой последовательности DEVD (P4-P1) расположенные вне коровой последовательности остатки Р6, Р5, Р2' и РЗ' являются исключительно важными для идентификации белков как субстратов каспазы 3 и каспазы 7 [Demon D et al. Proteome-wide substrate analysis indicates substrate exclusion as a mechanism to generate caspase-7 versus caspase-3 specificity. Mol Cell Proteomics. 2009; 8(12):2700-2714].

[010] Описанные выше ограничения по стерической доступности, электростатическому заряду остатков на поверхности белка и влиянию определенных остатков за пределами коровой последовательности DEVD, накладываемые на мишени каспаз in vivo, делают конструирование искусственных белковых субстратов для каспаз нетривиальной задачей. При этом перенос известной расщепляемой каспазой последовательности в новый химерный полипептид, не являющийся субстратом каспазы, не гарантирует работоспособности полученного химерного полипептида в качестве субстрата каспазы.

[011] Среди эффекторных каспаз фермент каспаза 3 считается наиболее важным эффектором, расщепляющим большое количество клеточных субстратов. Инактивация каспазы 3 с использованием антител ингибирует большую часть протеолитических реакций, имеющих место при апоптозе, в то время как инактивация других эффекторных каспаз оказывает незначительный эффект на маркеры апоптоза и эффективность их протеолиза [Walsh JG et al. Executioner caspase-3 and caspase-7 are functionally distinct proteases. Proc Natl Acad Sci USA. 2008; 105(35):12815-12819]. Исследования за последние 10 лет выявили более 200 субстратов каспазы 3 и их количество продолжает расти.

[012] Определение уровня подвергающихся апоптозу клеток, например, через измерение активности каспазы 3, может быть использовано, в частности, для оценки эффективности противораковой терапии [Rossi E et al. Dynamic changes of live/apoptotic circulating tumour cells as predictive marker of response to sunitinib in metastatic renal cancer. Br J Cancer. 2012 Oct 9; 107(8): 1286-94; Yang F et al. Sunitinib induces apoptosis and growth arrest of medulloblastoma tumor cells by inhibiting STAT3 and АКТ signaling pathways. Mol Cancer Res. 2010 Jan; 8(1):35-45]. В литературе описан широко востребованный метод определения активности каспазы 3, основанный на иммунохимическом выявлении продукта активности каспазы, расщепленного цитокератина 18 (М30 CytoDEATH™, Peviva). Однако при высокой чувствительности и надежности данный метод обладает рядом недостатков, таких как невозможность отслеживать изменения активность каспаз в динамике, высокая стоимость и сложность анализа.

[013] Данных недостатков лишены анализы с использованием генетически кодируемых биосенсоров на основе флуоресцентных белков [Chudakov DM, Matz MV, Lukyanov S, Lukyanov KA. Fluorescent Proteins and Their Applications in Imaging. Living Cells and Tissues. Physiol Rev. 2010 Jul; 90(3):1103-63].

[014] Флуоресцентные белки семейства GFP (Green Fluorescent Protein, GFP), включая собственно GFP из медузы Aequorea victoria (avGFP), его мутанты и гомологи, сегодня широко известны благодаря их интенсивному использованию в качестве флуоресцентных маркеров in vivo в биомедицинских исследованиях, что детально рассмотрено Lippincott-Schwartz и Patterson в Science (2003) 300(5616):87-91 и Chudakov et al. (Physiol Rev. 2010 Jul; 90(3): 1103-63).

[015] Флуоресцентные белки способны к флуоресценции при облучением светом подходящей длины волны. Флуоресцентные свойства этих белков обусловлены взаимодействием двух или более аминокислотных остатков, формирующих хромофор, а не флуоресценцией какого-либо одного аминокислотного остатка.

[016] GFP гидромедузы Aequorea aequorea (синоним A. victoria) был описан Johnson et al. в J Cell Comp Physiol. (1962), 60:85-104, как часть биолюминесцентной системы медузы, где GFP играет роль вторичного эммитера, преобразовывающего синий свет от фотобелка экворина в зеленый свет.кДНК, кодирующая A. victoria GFP была клонирована Prasher et al. (Gene (1992), 111(2):229-33). Оказалось, что этот ген может быть гетерологично экспрессирован в практически любом организме благодаря уникальной способности GFP автокаталитически образовывать хромофор (Chalfie et al., Science 263 (1994), 802-805). Эти сведения открыли широкие перспективы для использования GFP в клеточной биологи в качестве генетически кодируемой флуоресцирующей метки.

[017] GFP был использован в широком спектре приложений, включая исследование экспрессии генов и локализацию белков (Chalfie et al., Science 263 (1994), 802-805, and Heim et al. in Proc. Nat. Acad. Sci. (1994), 91: 12501-12504), как инструмент для визуализации внутриклеточного распределения органелл (Rizzuto et al., Curr. Biology (1995), 5: 635-642), для визуализации транспорта белков по секреторному пути (Kaetherand Gerdes, FEBS Letters (1995), 369: 267-271).

[018] Были проведены многочисленные исследования для улучшения свойств avGFP (Aequorea victoria GFP) и для получения вариантов GFP, пригодных и оптимизированных для различных исследовательских целей. Была проведена оптимизация генетического кода avGFP (codon usage) для повышения уровня экспрессии в клетках млекопитающих («гуманизированный« GFP, Haas, et al., Current Biology (1996), 6: 315-324; Yang, et al., Nucleic Acids Research (1996), 24: 4592-4593). Были получены различные мутанты GFP, в том числе «усиленный зеленый флуоресцентный белок« (EGFP), имеющий две аминокислотные замены: F64L и S65T (Heim et al., Nature 373 (1995), 663-664). Другие мутанты являются синим, голубым и желто-зеленым спектральными вариантами avGFP и содержат замены аминокислотных остатков, формирующих хромофор, и/или остатков, формирующих окружение хромофора.

[019] В 1999 г. гомологи GFP были клонированы из небиолюминесцентных видов Arrthozoa (Matz et al., Nature Biotechnol. (1999), 17: 969-973). Это открытие продемонстрировало, что эти белки не являются обязательно компонентом биолюминесцентной системы. GFP-подобные белки из Anthozoa обладали большим спектральным разнообразием и включали циановые, зеленые, желтые, красные флуоресцентные белки и фиолетово-синие нефлуоресцентные хромопротеины (CPs) (Matz et al., Bioessays (2002), 24(10):953-959). В дальнейшем кДНК GFP-подобных белков были клонированы из ряда гидроидных медуз и из копепод (Shagin et al., Mol Biol Evol. (2004), 21(5):841-850). Сегодня семейство GFP-подобных белков включает сотни флуоресцентных и окрашенных гомологов GFP. Сходство этих белков с GFP варьирует от 80-90% до менее чем 25% идентичности аминокислотной последовательности.

[020] Были получены кристаллические структуры avGFP дикого типа, GFP S65T мутанта и ряда гомологов GFP (Ormo et al. Science (1996) 273: 1392-1395; Wall et al. Nat Struct Biol (2000), 7: 1133-1138; Yarbrough et al. Proc Natl Acad Sci USA (2001) 98: 462-467; Prescott et al. Structure (Camb) (2003), 11: 275-284; Petersen et al. J Biol Chem (2003), 278: 44626-44631; Wilmann et al. J Biol Chem (2005), 280: 2401-2404; Remington et al. Biochemistry (2005), 44, 202-212; Quillin et al. Biochemistry (2005), 44: 5774-5787). Было постулировано, что все члены семейства обладают общей 3D структурой (GFP-подобным доменом), представляющей собой так называемый "бочонок" из 11 бета-слоев, образующих компактную встречно-параллельную структуру, внутри которой располагается альфа-спираль, содержащая хромофор. Хромофор формируется внутри GFP-подобного домена путем окислительной циклизации трех консервативных аминокислотных остатков в центральном регионе альфа-спирали (Cody et al., Biochemistry (1993) 32, 1212-1218). Положения аминокислотных остатков, формирующих хромофор, соответствует Ser65-Tyr66-Gly67 региону avGFP. Эти аминокислотные остатки легко могут быть идентифицированы у любого GFP-подобного белка путем выравнивания его последовательности с последовательностью avGFP.

[021] Флуоресцентные белки представляют собой уникальное семейство структурно родственных белков, которые способны формировать хромофор автокаталитически без привлечения внешних субстратов или кофакторов. Под действием индуцирующего света хромофор производит флуоресценцию, легко детектируемую с помощью современного лабораторного оборудования (спектрофлуориметр, флуоресцентный микроскоп, флуоресцентно-активируемый клеточный сортер, планшетный флуориметр).

[022] Процесс автокаталитического формирования хромофора белков с различными спектральными свойствами подробно описан в ряде статей и включает несколько химических реакций (Heim et al. Proc Natl Acad Sci USA. 1994; 91:12501-12504; Ormo et al. Science. 1996;273:1392-1395; Yang et al. Nat Biotechnol. 1996; 14:1246-1251; Brejc et al. J. Proc Natl Acad Sci USA. 1997; 94: 2306-2311; Palm et al. Nat Struct Biol. 1997; 4:361-365; Gurskaya et al., BMC Biochem. 2001; 2:6; Gross et al. Proc Natl Acad Sci USA. 2000; 97:11990-11995; Wall et al. Nat Struct Biol. 2000; 7:1133-1138; Yarbrough et al., J. Proc Natl Acad Sci USA. 2001; 98:462-467; Pakhomov, A.A. and Martynov, V.I. Chem. Biol. 2008, 15, 755-764; Quillinet al. (2005) Biochemistry 44, 5774- 5787; Yampolsky et al. (2005) Biochemistry 44, 5788- 5793; Shu et al. (2006) Biochemistry 45, 9639-9647; Kikuchi et al. (2008) Biochemistry 47, 11573-11580; Yampolsky et al., Biochemistry, 2009, 48 (33), p.8077-8082).

[023] GFP-подобные белки широко используют для создания генетически кодируемых биосенсоров. Исследование внутриклеточных процессов с помощью таких генетически кодируемых биосенсоров становится все более популярным, так как только такие сенсоры могут дать информацию об изменении исследуемого параметра непосредственно в живой системе. Такие биосенсоры востребованы как в фундаментальных исследованиях сигнальных путей организма, так и при тестировании токсических и лекарственных препаратов на модельных клеточных линиях или организмах. В сравнении с химическими и физическими методами регистрации биологически активных субстанций биосенсорами, требующими экзогенно добавляемых красителей, субстратов или кофакторов, генетически кодируемые нанобиосенсоры относятся к классу безреагентных и многоразовых сенсоров.

[024] Для наблюдения за процессами в толще тканей млекопитающих животных, характеризующихся значительным поглощением и светорассеянием при длинах волн менее 650 нм, были разработаны родственные GFP флуоресцентные белки с максимумами эмиссии в дальне-красной области. Были описаны флуоресцентный белок Katushka (максимум возбуждения 588 нм, максимум эмиссии 635 нм) [Shcherbo D et al. Bright far-red fluorescent protein for whole-body imaging. Nat Methods. 2007 Sep; 4(9):741-6], а также его вариант с увеличенной мономерностью mKate2, eqFP650 (димерный белок, максимум возбуждения 592 нм, максимум эмиссии 650 нм), NiRFP (eqFP670, димерный белок, максимум возбуждения 605 нм, максимум эмиссии 670 нм) [Shcherbo D et al. Near-infrared fluorescent proteins. Nat Methods. 2010 Oct; 7(10):827-9]. eqFP650 является одним из самых ярких флуоресцентных белков с максимумом эмиссии с длиной волны более 635 нм, а eqFP670 обладает высокой фотостабильностью и является на сегодняшний день флуоресцентным белком с наиболее длинноволновым максимумом эмиссии флуоресценции среди GFP-подобных белков.

[025] В 2010 году был описан флуоресцентый белок, не родственный белку GFP, обладающий совершенно иной структурой и уникальными спектральными свойствами. Флуоресцентный белок с эмиссией в близкой к инфракрасной области спектра (iRFP) представляет собой белок на основе бактериального фитохрома RpBphP2 из фотосинтетической бактерии Rhodopseudomonas palustris с максимумами поглощения и эмиссии 690 и 713 нм, соответственно. Белок был разработан для функциональных исследований с использованием флуоресценции в тканях млекопитающих животных in vivo, при котором применение большинства родственных GFP флуоресцентных белков ограничено за счет высокого поглощения света гемоглобином и меланином кожи. Для данных целей максиму поглощения и эмиссии должны находиться в близкой к инфракрасной области спектра от 650 до 900 нм, где поглощение и рассеяние света тканями является наименьшим.

[026] Роль флуорофора в белке играет молекула линейного тетрапиррола биливердина IXα, ковалентно присоединяющаяся к остатку цистеина полипептидной цепи. В клетках млекопитающих iRFP не требует дополнительного добавления в среду необходимого для флуоресценции кофактора биливердина, т.к. данное соединение является интермедиатом в метаболизме гема и присутствует в клетках. Белок обладает высокой яркостью флуоресценции, внутриклеточной стабильностью и фотостабильностью по сравнению с ранее известными флуоресцентными белками на основе фитохромов. По сравнению с дальне-красными флуоресцентными белками на основе GFP, iRFP характеризуется более высоким отношением сигнал/фон в тканях животных из-за эмиссии в близкой к инфракрасной области спектра.

[027] Теоретически, из-за своих спектральных свойств белок iRFP может быть использован в качестве акцептора для FRET в паре с такими донорами, как дальне-красные флуоресцентные белки семейства GFP. Теоретически, данный белок может быть использован для конструирования основанных на FRET биосенсоров с использованием таких доноров, как дальне-красные флуоресцентные белки семейства GFP, однако возможность создания таких сенсоров ранее экспериментально не проверялась.

[028] Белок представляет собой димер, что осложняет конструирование биосенсоров с его использованием. Для получения белков слияния с iRFP его разработчиками рекомендуется использовать тандемные димеры данного белка (Filonov GS, Piatkevich KD, Ting LM, Zhang J, Kim K, Verkhusha W. Bright and stable near-infrared fluorescent protein for in vivo imaging. Nat Biotechnol. 2011 Jul 17; 29(8):757-61].

[029] Биосенсоры на основе флуоресцентных белков представляют собой химерные белки, в состав которых входит сенсорный домен - белок, белковый домен или полипептид, чувствительный к изменению определенного параметра клетки, например, изменению активности какого-либо белка фермента (такого как протеаза. например, каспаза). В качестве сигнальной части биосенсора используют GFP-подобные белки или их варианты, между которыми может происходить процесс Ферстеровского резонансного переноса энергии (FRET) [Chudakov DM, Matz MV, Lukyanov S, Lukyanov KA. Fluorescent Proteins and Their Applications in Imaging. Living Cells and Tissues. Physiol Rev. 2010 Jul; 90(3):1103-63].

[030] Ферстеровский перенос энергии, иначе диполь-дипольный перенос энергии; флуоресцентный резонансный перенос энергии; индуктивно-резонансный перенос энергии (FRET) - механизм переноса энергии между двумя хромофорами (от донора к акцептору), который происходит без промежуточного испускания фотонов и является результатом диполь-дипольного взаимодействия между донором и акцептором. Характерной чертой данного процесса является тушение флуоресценции донора и возникновение более длинноволновой флуоресценции акцептора. Эффективность переноса энергии (или отношение числа событий переноса энергии к числу событий возбуждения донора) напрямую связана со скоростью переноса и зависит от расстояния между объектами (убывает как r-6). Эффективное расстояние, на котором скорость перехода составляет 50% от максимума, называют ферстеровским радиусом. Для большинства систем его величина составляет 20-50 Å.

[031] Эффективность переноса энергии также зависит от множества факторов, таких как расстояние между донором и акцептором, степень перекрывания спектров испускания донора и поглощения акцептора, взаимная ориентация диполей донора и акцептора [Lakowicz J.R. Principles of fluorescence spectroscopy. - Springer, 2006].

[032] Таким образом, надежно предсказать эффективность FRET между известными белками-флуорофорами заранее практически невозможно, следовательно, создание работоспособного флуоресцентного биосенсора на основе FRET с новой парой флуорофоров является нестандартной и сложной задачей [Campbell RE. Fluorescent-protein-based biosensors: modulation of energy transfer as a design principle. Anal Chem. 2009 Aug 1; 81(15):5972-9.].

[033] Детекция молекулярной динамики с помощью FRET является современным и высоко востребованным методом анализа белок-белковых взаимодействий при активации внутриклеточных сигнальных путей. Исследования с использованием FRET между мечеными производными GFP молекулами показали образование комплексов между сигнальными белками в различных клеточных компартментах. Также были созданы биосенсоры на основе FRET для детекции каспазной активности [Chudakov DM, Matz MV, Lukyanov S. Lukyanov KA. Fluorescent Proteins and Their Applications in Imaging. Living Cells and Tissues. Physiol Rev. 2010 Jul; 90(3):1103-63].

[034] Например, для детекции активности каспазы 3 был сконструирован и успешно применен биосенсор на основе FRET, состоящий из двух флуоресцентных белков, являющихся производными зеленого флуоресцентного белка GFP, таких как циановый флуоресцентный белок (CFP) и желтый флуоресцентный белок (YFP), и включающий распознаваемую каспазой последовательность в линкере между ними. В данной системе расщепление линкерной части активированной каспазой приводило к исчезновению FRET за счет физического расхождения двух флуорофоров. Также был получен похожий сенсор для каспазы 8 [Luo KQ, Yu VC, Pu Y, Chang DC. Measuring dynamics of caspase-8 activation in a single living HeLa cell during TNFalpha-induced apoptosis. Biochem Biophys Res Commun. 2003 May 2; 304(2):217-22].

[035] Также описан схожий по характеристикам генетически кодируемый биосенсор активности каспазы 3 Casper3-BG (Subach ОМ et al. Chem Biol. 2008 Oct 20; 15(10): 1116-24), основанный на FRET между синим флуоресцентным белком TagBFP и зеленым флуоресцентным белком TagGFP2 из семейства GFP-подобных белков, разделенными линкером с расщепляемой каспазой 3 последовательностью DEVD. Активация каспазы 3 при апоптозе приводит к расщеплению линкерной последовательности между белками и исчезновению FRET, которое можно детектировать по ослаблению зеленой флуоресценции TagGFP2 и одновременному усилению флуоресценции TagBFP. Отмечена меньшая способность белков TagGFP2 и TagBFP по сравнению с YFP и CFP образовывать гетеродимеры, что приводит к уменьшению фонового уровня FRET биосенсора.

[036] К числу биосенсоров каспазной активности на основе FRET также принадлежит генетически кодируемый биосенсор, состоящий из красного флуоресцентного белка TagRFP (максимум эмиссии 584 нм) в качестве донора для FRET и не флуоресцентного в условиях измерения хромобелка KFP в качестве акцептора FRET [Savitsky АР et al. FLIM-FRET Imaging of Caspase-3 Activity in Live Cells Using Pair of Red Fluorescent Proteins. Theranostics. 2012; 2(2):215-261.

[037] Был описан биосенсор на основе FRET для одновременной детекции активности каспазы 8 и каспазы 3 CYR83, сконструированный из трех флуоресцентных белков семейства GFP: цианового флуоресцентного белка seCFP (возбуждение 420 нм, эмиссия 476 нм), желтого флуоресцентного белка Venus (возбуждение 514 нм, эмиссия 528 нм) и красного флуоресцентного белка mRFP1 (возбуждение 500 нм, эмиссия 608 нм). Белки seCFP и Venus были соединены расщепляемым каспазой 8 линкером, далее белок Venus был соединен с белком mRFP1 посредством расщепляемого каспазой 3 линкера. Детекцию активности каспазы 3 осуществляли по исчезновению FRET между Venus и mRFP1 по увеличению флуоресценции при 528 нм и падению флуоресценции при 608 нм.

[038] Однако все описанные генетически кодируемые флуоресцентные биосенсоры каспазной активности не позволяют проводить измерения в удобном для измерения флуоресценции в животных моделях диапазоне длин волн 650-900 нм. Таким образом, существует необходимость разработки новых генетически кодируемых биосенсоров активности каспазы 3 с использованием дальне-красных флуоресцентных белков, обеспечивающих аналитический флуоресцентный сигнал от биосенсора в области длин волн более 650 нм.

[039] До настоящего времени не создано флуоресцентных биосенсоров каспазной активности, работающих на основе FRET, с использованием дальне-красных флуоресцентных белков в качестве доноров для переноса энергии. Не описано также биосенсоров, работающих на основе FRET, сконструированных с использованием флуоресцентного белка с эмиссией в близкой к инфракрасной области спектра iRFP.

[040] Так как наличие и эффективность FRET между донорным и акцепторным флуорофорами, в частности двумя флуоресцентными белками, зависит от множества параметров, предсказать возможность создания основанного на FRET биосенсора, исходя из теоретических предпосылок о свойствах iRFP и дальне-красных мутантов GFP, не представляется возможным.

[041] Так как используемые при конструировании генетически кодируемых биосенсоров по настоящему изобретению флуоресцентные белки семейства GFP eqFP650 и eqFP670 и флуоресцентный белок iRFP in vivo представляют собой димеры, связанные нековалентными связями, биосенсоры по изобретению также представляют собой димеры или структуры более высоко порядка в системах in vivo, что может полностью стерически блокировать чувствительный к каспазе 3 линкер и препятствовать расщеплению биосесора каспазой. Данная ситуация также осложняется тем, что сам фермент каспаза 3 активна в клетке в виде димера [Savitsky АР et al. FLIM-FRET Imaging of Caspase-3 Activity in Live Cells Using Pair of Red Fluorescent Proteins. Theranostics. 2012; 2(2):215-26]. Так как структура белка iRFP кардинально отличается от структуры GFP-подобных белков, структуру биосенсоров по изобретению нельзя аппроксимировать из известных структур биосенсоров на основе только GFP-подобных белков.

[042] РАСКРЫТИЕ ИЗОБРЕТЕНИЯ

[043] Настоящее изобретение обеспечивает выделенные молекулы нуклеиновых кислот, кодирующие флуоресцентные биосенсоры для измерения активности каспазы 3, аналитический сигнал которых представляет собой флуоресценцию в дальне-красной области спектра.

[044] В некоторых воплощениях нуклеиновая кислота настоящего изобретения кодирует флуоресцентный биосенсор для регистрации активности каспазы 3 внутри клеток. В некоторых воплощениях указанный биосенсор при увеличении активности каспазы 3 в среде реагирует увеличением флуоресценции белка донора FRET в дальне-красной области с длиной волны более 650 нм при его возбуждении относительно флуоресценции белка iRFP. В некоторых воплощениях дальне-красный флуоресцентный белок, являющийся донором для FRET, представляет собой белок семейства GFP. В некоторых воплощениях дальне-красный флуоресцентный белок, являющийся донором для FRET, представляет собой белок mKate2, флуоресценцию которого возбуждают светом с длиной волны приблизительно 588 нм и измеряют при длине волны приблизительно, по меньшей мере, 635 нм, предпочтительно приблизительно 650 нм. В некоторых воплощениях дальне-красный флуоресцентный белок, являющийся донором для FRET, представляет собой белок eqFP650, флуоресценцию которого возбуждают светом с длиной волны приблизительно 592 нм и измеряют при длине волны приблизительно, по меньшей мере, 650 нм. В некоторых воплощениях дальне-красный флуоресцентный белок, являющийся донором для FRET, представляет собой белок eqFP670, флуоресценцию которого возбуждают светом с длиной волны приблизительно 605 нм и измеряют при длине волны приблизительно, по меньшей мере, 670 нм. Предпочтительно изменения флуоресценции дальне-красного флуоресцентного белка, являющегося донором для FRET, нормируют на флуоресценцию белка iRFP при длине волны приблизительно, по меньшей мере, 713 нм при возбуждении светом с длиной волны приблизительно 690 нм.

[045] В некоторых воплощениях биосенсор настоящего изобретения состоит из молекулы дальне-красного флуоресцентного белка семейства GFP (SEQ ID NO:1, 2 или 3), оперативно соединенного через подвижный линкер, содержащий сайт расщепления каспазой 3, с флуоресцентным белком iRFP с эмиссией в близкой к инфракрасной области спектра (SEQ ID NO:4). В некоторых воплощениях подвижный линкер, содержащий сайт расщепления каспазой 3, имеет аминокислотную последовательность, приведенную в SEQ ID NO:8. В некоторых воплощениях биосенсор настоящего изобретения имеет аминокислотную последовательность, показанную в SEQ ID NO:5, 6 или 7 (mKate2-kasp-iRFP, FP650-kasp-iRFP или NiRFP-kasp-iRFP). В некоторых воплощениях нуклеиновая кислота, кодирующая биосенсор настоящего изобретения имеет нуклеотидную последовательность, показанную в SEQ ID NO:9, 10 или 11.

[046] Молекулы нуклеиновых кислот, которые отличаются от представленных нуклеотидных последовательностей вследствие вырожденности генетического кода, так же входят в рамки настоящего изобретения.

[047] В других воплощениях также обеспечиваются векторы, включающие нуклеиновую кислоту настоящего изобретения. Кроме того, настоящее изобретение обеспечивает кассеты экспрессии, включающие нуклеиновую кислоту настоящего изобретения и регуляторные элементы, необходимые для экспрессии нуклеиновой кислоты в выбранной клетке-хозяине. Кроме того, также обеспечиваются клетки, стабильные клеточные линии, трансгенные животные и трансгенные растения, включающие нуклеиновые кислоты, векторы или экспрессионные кассеты настоящего изобретения. В других воплощениях обеспечиваются функциональные флуоресцентные биосенсоры настоящего изобретения, которые кодируются нуклеиновыми кислотами указанными выше. Кроме того, обеспечиваются набор, содержащий нуклеиновые кислоты, и/или векторы, и/или экспрессионные кассеты, включающие указанные нуклеиновые кислоты настоящего изобретения.

[048] КРАТКОЕ ОПИСАНИЕ РИСУНКОВ

[049] Рисунок 1 иллюстрирует структуру биосенсоров настоящего изобретения и принцип их работы. Изображены флуоресцентные белки - донор и акцептор для FRET, разделенные содержащим последовательность DEVD линкером. Разрезание линкера каспазой 3 сопровождается исчезновением FRET.

[050] Рисунок 2А показывает спектр возбуждения флуоресценции mKate2-kasp-iRFP до и после добавления каспазы 3 при эмиссии при 740 нм.

[051] Рисунок 2Б показывает спектр возбуждения флуоресценции FP650-kasp-jrfp до и после добавления каспазы 3 при эмиссии при 740 нм.

[052] Рисунок 2В показывает спектр возбуждения флуоресценции NiRFP-kasp-iRFP до и после добавления каспазы 3 при эмиссии при 740 нм.

[053] Рисунок 3А показывает спектры эмиссии флуоресценции mKate2-kasp-iRFP при возбуждении при 550 нм до и после добавления каспазы 3.

[054] Рисунок 3Б показывает спектры эмиссии флуоресценции FP650-kasp-iRFP при возбуждении при 580 нм до и после добавления каспазы 3.

Рисунок 3В показывает спектры эмиссии флуоресценции NiRFP-kasp-iRFP при возбуждении при 590 нм до и после добавления каспазы 3.

[055] ОСУЩЕСТВЛЕНИЕ ИЗОБРЕТЕНИЯ

[056] Для более полного раскрытия вышеперечисленных характеристик настоящего изобретения ниже предлагается детальное описание изобретения, кратко сформулированного выше, в виде ссылок на воплощения, некоторые из которых проиллюстрированы дополнительными фигурами. При этом следует отметить, что прилагаемые фигуры иллюстрируют лишь типичные воплощения настоящего изобретения и, следовательно, не должны быть восприняты в качестве ограничения объема изобретения, которое может допускать другие в равной степени эффективные воплощения.

[057] Как указано выше, настоящее изобретение направлено на молекулы нуклеиновых кислот, которые кодируют флуоресцентные биосенсоры для измерения активности каспазы 3, аналитический сигнал которых представляет собой флуоресценцию в дальне-красной области спектра.

[058] Нуклеиновые кислоты настоящего изобретения получены с помощью рекомбинантных технологий. В предпочтительных воплощениях нуклеиновые кислоты настоящего изобретения кодируют белки, имеющие аминокислотную последовательность, показанную в SEQ ID NO:5, 6 или 7. Также обеспечиваются векторы и кассеты экспрессии, включающие нуклеиновую кислоту настоящего изобретения. Кроме того, обеспечиваются клетки, стабильные клеточные линии, трансгенные животные и трансгенные растения, включающие нуклеиновые кислоты, векторы или экспрессионные кассеты настоящего изобретения.

[059] Указанные нуклеиновые кислоты применяются во многих различных приложениях и методах, в частности для мониторинга изменений активности каспазы 3 внутри клеток.

[060] Определения

[061] Различные термины, относящиеся к биологическим молекулам настоящего изобретения, используются выше и также в описании и в формуле изобретения.

[062] Как здесь используется, термин «флуоресцентный белок» означает белок, который обладает способностью к флуоресценции; например, он может проявлять низкую, среднюю или интенсивную флуоресценцию при облучении светом с подходящей для возбуждения длиной волны. Флуоресцентное свойство флуоресцентного белка представляет собой такое свойство, которое является результатом работы хромофора. Как таковые флуоресцентные белки настоящего изобретения не включают белки, которые обладают флуоресценцией за счет отдельных флуоресцирующих остатков, таких как триптофан, тирозин и фенилаланин.

[063] Как здесь используется, термин «флуоресцентный белок на основе GFP» означает белок, относящийся к семейству GFP-подобных белков, который обладает способностью к флуоресценции; например, он может проявлять низкую, среднюю или интенсивную флуоресценцию при облучении светом с подходящей для возбуждения длиной волны. Флуоресцентное свойство флуоресцентного белка представляет собой такое свойство, которое является результатом работы хромофора, образующегося путем автокаталитической циклизации трех или более аминокислотных остатков в полипептидной цепи. Как таковые флуоресцентные белки настоящего изобретения не включают белки, которые обладают флуоресценцией за счет отдельных флуоресцирующих остатков, таких как триптофан, тирозин и фенилаланин.

[064] Как здесь используется, термин «флуоресцентный белок с эмиссией в близкой к инфракрасной области спектра iRFP» или «iRFP» означает белок на основе бактериального фитохрома RpBphP2 из фотосинтетической бактерии Rhodopseudomonas palustris с максимумами поглощения и эмиссии 690 и 713 нм, обладающий аминокислотной последовательностью, приведенной в SEQ ID NO:4.

[065] Как здесь используется, термин «каспаза» относится к белкам семейства внутриклеточных специфичных цистеиновых протеаз, вовлеченных в процесс апоптоза. Более предпочтительно, термин каспаза относится к эффекторным каспазам, более предпочтительно, к каспазе 3.

[066] Как здесь используется, термин «avGFP» относится к зеленому флуоресцентному белку из медузы Aequorea victoria, включая варианты avGFP, известные из уровня техники, сконструированные для обеспечения большей интенсивности флуоресценции или флуоресценции в других цветовых областях. Последовательность дикого типа avGFP была раскрыта в Prasher et al. (1992, Gene 111: 229-33).

[067] Как здесь используется, термин «Ферстеровский перенос энергии» (FRET) означает механизм переноса энергии между двумя хромофорами (от донора к акцептору), который происходит без промежуточного испускания фотонов и является результатом диполь-дипольного взаимодействия между донором и акцептором. При этом эффективность FRET может быть различной.

[068] Как здесь используется, термин «дальне-красный флуоресцентный белок» относится к белкам семейства GFP с максимумом эмиссии флуоресценции при длине волны более 630 нм, предпочтительно при длине волны более 650 нм, таким как белки Katushka, mKate2, eqFP650, NiRFP (eqFP670).

[069] Как здесь используется, термин «выделенный» или «изолированный» означает молекулу или клетку, которые находятся в среде, отличной от среды, в которой молекула или клетка находятся в естественных условиях.

[070] Как здесь используется, термин «мутант» или «производное» относятся к белку, раскрытому в настоящем изобретении, в котором одна или более аминокислот добавлены, и/или замещены, и/или удалены (делегированы), и/или вставлены (инвертированы) в N-конец и/или С-конец, и/или в пределах нативных аминокислотных последовательностей белков настоящего изобретения. Как здесь используется, термин «мутант» относится к молекуле нуклеиновой кислоты, которая кодирует мутантный белок. Кроме того, термин «мутант« здесь относится к любому варианту, который короче или длиннее белка или нуклеиновой кислоты.

[071] Термин «гомология» используется здесь для описания взаимосвязи последовательностей нуклеотидов или аминокислот с другими последовательностями нуклеотидов или аминокислот, которая определена степенью идентичности и/или сходства между указанными сравниваемыми последовательностями.

[072] Как здесь используется, аминокислотная или нуклеотидная последовательности «по существу сходны» или «по существу такие же, как референсная последовательность», если аминокислотная или нуклеотидная последовательности имеют, по крайней мере, 85% идентичности с указанной последовательностью внутри выбранного для сравнения региона. Таким образом, по существу сходные последовательности включают те, которые имеют, например, по крайней мере, 85% идентичности, по крайней мере, 90% идентичности, по крайней мере, 95% идентичности или по крайней мере, 96%, 97%, 98% или 99% идентичности. Две последовательности, которые идентичны одна другой, так же по существу сходны.

[073] Процент идентичности последовательностей определяется на основании референсной последовательности. Алгоритмы для анализа последовательности известны в данной области, такие как BLAST, описанный в Altschul et al., J. Mol. Biol., 215, p.403-10 (1990). Для целей настоящего изобретения сравнение нуклеотидных и аминокислотных последовательностей, производимое с помощью пакета программ Blast, предоставляемого National Center for Biotechnology Information (http://www.ncbj.nlm.njh.gov/blast) с использованием содержащего разрывы выравнивания со стандартными параметрами, может быть использовано для определения уровня идентичности и сходства между нуклеотидными последовательностями и аминокислотными последовательностями.

[074] Как здесь используется, термин «подобные белки» или «по существу сходные белки» относится к белкам, которые имеют аминокислотные последовательности, идентичные по крайней мере на 85%, как правило идентичные на 90% или более, чаще всего идентичные по крайней мере на 95% или более (например на 96% и более, 97% и более, 98% и более, 99% и более, 100%). Длина гомологичных аминокислотных последовательностей у «подобных белков» при этом может составлять, по крайней мере, 100 аминокислотных остатков, чаще, по крайней мере, 200 аминокислотных остатков или 300 аминокислотных остатков.

[075] В некоторых воплощениях, термин «подобные белки» или «по существу сходные белки» относится к белкам, которые имеют аминокислотные последовательности целого белка, идентичные по крайней мере на 85%, как правило идентичные на 90% или более, чаще всего идентичные по крайней мере на 95% или более (например на 96% и более, 97% и более, 98% и более, 99% и более, 100%).

[076] Как здесь используется, термин «функциональный» означает, что нуклеотидная или аминокислотная последовательность может функционировать для указанного испытания или задачи. Термин «функциональный», используемый для описания биосенсора настоящего изобретения, означает, что он меняет спектральные характеристики при наличии активности каспазы 3 в среде.

[077] Как здесь используется, термин «среда» по отношению к биосенсору означает любую среду, в которой этот биосенсор может функционировать. Для выделенного белка это может быть любой буферный раствор, в котором этот сенсор сохраняет функциональность. Для белка, экспрессированного в клетке, это цитоплазма или клеточный компартмент, в котором биосенсор локализован.

[078] Как здесь используется, «биохимические свойства» относятся к белковому фолдингу (сворачиванию) и скорости созревания, скорости восстановления после реакции с тестируемой субстанцией, времени полужизни, способности к агрегации, способности к олигомеризации, рН и температурной стабильности и другим подобным свойствам.

[079] Как здесь используется, «флуоресцентные свойства» или «спектральные свойства» относятся к коэффициенту молярной экстинкции при подходящей длине волны, к квантовому выходу флуоресценции, форме спектра возбуждения флуоресценции или спектра испускания, длине волны, соответствующей максимуму возбуждения флуоресценции, и длине волны, соответствующей максимуму испускания, отношению амплитуды возбуждения флуоресценции при двух разных длинах волн, отношению амплитуды испускания при двух разных длинах волн, времени жизни возбужденного состояния и анизотропии оптических свойств. Измеряемая разница может быть определена как количество любого количественного флуоресцентного свойства, например интенсивность флуоресценции при определенной длине волны, или интегральная флуоресценция на всем спектре испускания.

[080] Как здесь используется, «агрегация» относится к склонности или способности экспрессированного белка формировать нерастворимый осадок (агрегаты). «Агрегация» должна быть отличаема от «олигомеризации». В частности, мутанты с уменьшенной способностью к агрегации, например с увеличенной растворимостью, не обязательно имеют уменьшенную способность к олигомеризации.

[081] Как здесь используется, «олигомеризация» относится к склонности или способности экспрессированного белка формировать комплексы (олигомеры) в результате специфического взаимодействия двух или более полипептидов. Указанное специфическое взаимодействие наблюдается в специальных условиях, например в физиологических условиях, и относительно стабильно в этих условиях. Ссылка на «способность» белков олигомеризоваться означает, что белки могут формировать димеры, триммеры, тетрамеры или подобные комплексы в специальных условиях. Как правило, флуоресцентные белки обладают способностью к олигомеризации в физиологических условиях. Флуоресцентные белки могут также олигомеризоваться при других, например, рН, нежели рН при физиологических условиях. Условия, при которых флуоресцентные белки формируют олигомеры или проявляют склонность к олигомеризации, могут быть определены с помощью хорошо известных методов, таких как гель-фильтрация, или иным способом, известным в данной области.

[082] Ссылка на нуклеотидную последовательность, «кодирующую» полипептид, означает, что с нуклеотидной последовательности в ходе трансляции и транскрипции мРНК продуцируется этот полипептид. При этом может быть указана как кодирующая цепь, идентичная мРНК и обычно используемая в списке последовательностей, так и комплементарная цепь, которая используется как матрица при транскрипции. Как очевидно для любого специалиста в данной области техники, термин так же включает любые вырожденные нуклеотидные последовательности, кодирующие одинаковую аминокислотную последовательность. Нуклеотидные последовательности, кодирующие полипептид, включают последовательности, содержащие интроны.

[083] Термин «оперативно связанный», «оперативно встроенный» или ему подобные при описании структуры биосенсора или химерных белков на его основе относится к полипептидным последовательностям, которые находятся в физической и функциональной связи одна с другой. В наиболее предпочтительных воплощениях основные функции полипептидных компонентов химерной молекулы не изменены по сравнению с функциональными свойствами выделенных полипептидных компонентов. Например, дальне-красный флуоресцентный белок и белкок iRFP, входящие в состав биосенсора настоящего изобретения, сохраняют способность к флуоресценции. В случае, когда биосенсор настоящего изобретения сшит с представляющим интерес сигналом внутриклеточной локализации, химерный белок сохраняет способность реагировать на изменение активности каспазы 3, но локализуется в определенном клеточном компартменте. Как очевидно для любого специалиста в данной области техники, нуклеотидные последовательности, кодирующие химерный белок, включающий «оперативно связанные» компоненты (белки, полипептиды, линкерные последовательности, белковые домены и т.д.), состоят из фрагментов, кодирующих указанные компоненты, где эти фрагменты ковалентно связаны таким образом, что в ходе трансляции и транскрипции нуклеотидной последовательности продуцируется полноразмерный химерный белок. Иными словами, фрагменты соединены таким образом, что в местах их соединения отсутствуют «сбойки» рамки считывания и стоп-кодоны.

[084] Как здесь используется, термин «активность каспазы 3» относится к способности белка фермента каспазы 3 специфично катализировать реакцию расщепления своих природных или искусственных субстратов.

[085] Как здесь используется, термин «сигнал биосенсора» означает детектируемое изменение спектральной характеристики биосенсора в ответ на активность каспазы 3 в среде.

[086] МОЛЕКУЛЫ НУКЛЕИНОВЫХ КИСЛОТ

[087] Настоящее изобретение обеспечивает молекулы нуклеиновых кислот, кодирующие флуоресцентный биосенсор для регистрации активности каспазы 3, аналитический сигнал которых представляет собой флуоресценцию в дальне-красной области спектра.

[088] Как здесь используется, молекула нуклеиновой кислоты - это молекула ДНК, такая как геномная ДНК или кДНК молекула, или молекула РНК, такая как молекула мРНК. Как здесь используется, термин "кДНК" относится к нуклеиновым кислотам, которые обладают размещением элементов последовательности найденным в нативных зрелых видах мРНК, где элементы последовательности - это экзоны и 5' и 3' некодирующей области.

[089] Структура биосенсора схематически изображена на Рисунке 1. Биосенсор представляет собой химерный белок, состоящий из дальне-красного флуоресцентного белка семейства GFP (SEQ ID NO:1. 2 или 3), к которому через подвижный линкер, содержащий сайт расщепления каспазой 3, оперативно присоединен флуоресцентный белок IRFP с эмиссией в близкой к инфракрасной области спектра (SEQ ID NO:4). В некоторых воплощениях, как показано на Рисунке 1, подвижный линкер, содержащий сайт расщепления каспазой 3, включает последовательность DEVD. В некоторых воплощениях подвижный линкер, содержащий сайт расщепления каспазой 3, имеет аминокислотную последовательность, приведенную в SEQ ID NO:8. В некоторых воплощениях биосенсор настоящего изобретения имеет аминокислотную последовательность, показанную в SEQ ID NO:5, 6 или 7 (mKate2-kasp-iRFP, FP650-kasp-JRFP или NiRFP-kasp-iRFP). В некоторых воплощениях нуклеиновая кислота, кодирующая биосенсор настоящего изобретения, имеет нуклеотидную последовательность, показанную в SEQ ID NO:9, 10 или 11.

[090] Методы получения таких химерных белков хорошо известны профессионалам в данной области. Например, части нуклеиновой кислоты, кодирующие различные элементы (например, аминокислотные последовательности дальне-красных флуоресцентных белков, линкерные последовательности, белок iRFP), могут быть встроены в определенном порядке в полилинкер вектора, таким образом, что между различными частями не будет стоп-кодонов в рамке считывания и не будет сбоек рамки считывания. Альтернативно, желательная нуклеотидная последовательность может быть собрана из фрагментов с помощью ДНК-лигазы или ПЦР с праймерами, содержащими части, комплементарные концевым последовательностям соединяемых фрагментов.

[091] Молекула нуклеиновой кислоты, кодирующая флуоресцентный биосенсор, может быть синтезирована из подходящих нуклеозидтрифосфатов. Этот метод основан на хорошо известных в данной области протоколах. Например, доступность информации о последовательности аминокислот или информации о нуклеотидной последовательности дает возможность изготовить выделенные молекулы нуклеиновых кислот настоящего изобретении с помощью олигонуклеотидного синтеза. В случае информации о последовательности аминокислот может быть синтезировано несколько нуклеиновых кислот, отличающихся друг от друга вследствие вырожденности генетического кода. Методы выбора вариантов кодонов для требуемого хозяина хорошо известны в данной области. Синтетические олигонуклеотиды могут быть приготовлены с помощью фосфорамидитного метода и полученные конструкты могут быть очищены с помощью методов, хорошо известных в данной области, таких как высокоэффективная жидкостная хроматография (ВЭЖХ), или других методов как описано, например, в Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., (1989) Cold Spring Harbor Press, Cold Spring Harbor, NY, и по инструкции, описанной в, например, United States Dept of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research. Длинные двухцепочечные молекулы ДНК настоящего изобретения могут быть синтезированы за следующие стадии: несколько меньших фрагментов с необходимой комплементарностью, которые содержат подходящие концы, способные к когезии с соседним фрагментом. Соседние фрагменты могут быть сшиты с помощью ДНК-лигазы или метода, основанного на ПЦР. Нуклеиновая кислота, кодирующая биосенсор, может быть выделена любым из многих известных методов.

[092] Кроме того, также обеспечиваются вырожденные варианты нуклеиновых кислот, которые кодируют биосенсор настоящего изобретения. Вырожденные варианты нуклеиновых кислот включают замены кодонов нуклеиновой кислоты на другие кодоны, кодирующие те же самые аминокислоты. В частности вырожденные варианты нуклеиновых кислот создаются, чтобы увеличить экспрессию в клетке-хозяине. В этом воплощении кодоны нуклеиновой кислоты, которые не являются предпочтительными или являются менее предпочтительными в генах клетки-хозяина, заменены кодонами, которые обильно представлены в кодирующих последовательностях генов в клетке-хозяине, где указанные замененные кодоны кодируют ту же самую аминокислоту.

[093] Особенный интерес представляют гуманизированные версии нуклеиновых кислот настоящего изобретения. Как здесь используется, термин «гуманизированный« относится к заменам, сделанным в последовательности нуклеиновой кислоты для оптимизации кодонов для экспрессии белка в клетках млекопитающих (человека) (Yang et al., Nucleic Acids Research (1996) 24: 4592-4593). См. также Патент США №5795737, который описывает гуманизацию белков, раскрытие которого здесь включено ссылкой.

[094] В некоторых воплощениях молекула нуклеиновой кислоты настоящего изобретения - это ДНК (или кДНК) молекула, содержащая открытую рамку считывания, которая кодирует биосенсор настоящего изобретения и способна в подходящих условиях (например, физиологические внутриклеточные условия) быть использована для экспрессии белка в клетке-хозяине. Настоящее изобретение так же охватывает нуклеиновые кислоты, которые гомологичны, по существу сходны, идентичны, или получены из нуклеиновых кислот, кодирующих белки настоящего изобретения. Указанные нуклеиновые кислоты находятся в среде, отличной от среды, в которой они находятся в естественных условиях, например они выделены, представлены в увеличенном количестве, находятся или экспрессированы в системах in vitro или в клетках или организмах, отличных от тех, в которых они находятся в естественных условиях.

[095] Заявленные нуклеиновые кислоты могут быть выделены и получены по существу в очищенной форме. По существу очищенная форма означает, что нуклеиновые кислоты являются по меньшей мере приблизительно на 50% чистыми, обычно по меньшей мере приблизительно на 90% чистыми и обычно являются «рекомбинантными«, то есть фланкированы одним или более нуклеотидов, с которыми она обычно не связана в хромосоме, встречающейся в природе в ее естественном организме-хозяине.

[096] Изменения или различия в нуклеотидной последовательности между высоко сходными нуклеотидными последовательностями могут представлять нуклеотидные замены в последовательности, которые возникают в процессе нормальной репликации или дупликации. Другие замены могут быть специально рассчитаны и вставлены в последовательность для определенных целей, таких как изменение кодонов определенных аминокислот или нуклеотидной последовательности регуляторного региона. Такие специальные замены могут быть произведены in vitro с помощью различных технологий мутагенеза или получены в организмах-хозяевах, находящихся в специфических селекционных условиях, которые индуцируют или отбирают эти изменения. Такие специально полученные варианты последовательности могут быть названы «мутантами« или «производными» исходной последовательности.

[097] Мутантные или производные нуклеиновые кислоты могут быть получены на матричной нуклеиновой кислоте, выбранной из вышеописанных нуклеиновых кислот, путем модификации, делеции или добавления одного или более нуклеотидов в матричной последовательности или их комбинации, для получения варианта матричной нуклеиновой кислоты. Модификации, добавления или делеции могут быть выполнены любым способом, известным в данной области (см. например Gustin et al., Biotechniques (1993) 14: 22; Barany, Gene (1985) 37: 111-123; и Colicelli et al., Mol. Gen. Genet. (1985) 199:537-539, Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, p.15.3-15.108), включая подверженный ошибкам ПЦР (error-prone PCR), shuffling, олигонуклеотид-направленный мутагенез, ПЦР со сборкой, парный ПЦР мутагенез, мутагенез in vivo, кассетный мутагенез, рекурсивный множественный мутагенез, экспоненциальный множественный мутагенез, сайт-специфический мутагенез, случайный мутагенез, генное реассемблирование (gene reassembly), генный сайт-насыщающий мутагенез (GSSM), искусственную перестройку с лигированием (SLR) или их комбинации. Модификации, добавления или делеции могут быть также выполнены методом, включающим рекомбинацию, рекурсивную рекомбинацию последовательностей, фосфотиоат-модифицированный мутагенез ДНК, мутагенез на урацил-содержащей матрице, мутагенез с двойным пропуском, точечный восстановительный по рассогласованию мутагенез, мутагенез штамма, дефицитного по восстановлениям, химический мутагенез, радиоактивный мутагенез, делетационный мутагенез, рестрикционно-избирательный мутагенез, рестрикционный мутагенез с очисткой, синтез искусственных генов, множественный мутагенез, создание химерных множественных нуклеиновых кислот и их комбинации.

[098] Также обеспечиваются нуклеиновые кислоты, кодирующие химерные белки, состоящие из биосенсора настоящего изобретения и сигнала определенной внутриклеточной локализации. Такие химерные белки могут быть получены путем оперативного соединения нуклеиновой кислоты настоящего изобретения, кодирующей биосенсор, и нуклеиновой кислоты, кодирующей сигнал внутриклеточной локализации. Методы получения таких нуклеиновых кислот хорошо известны специалистам в данной области.

[099] Также обеспечиваются вектор и другие конструкции нуклеиновой кислоты, содержащие заявленные нуклеиновые кислоты. Подходящие векторы включают вирусные и невирусные векторы, плазмиды, космиды, фаги и т.д., предпочтительно плазмиды, и используются для клонирования, амплификации, экспрессии, переноса и т.д. последовательности нуклеиновой кислоты настоящего изобретения в подходящего хозяина. Выбор подходящего вектора является понятным для квалифицированного специалиста в данной области, и известно много таких доступны коммерчески векторов. Для приготовления конструкции полноразмерная нуклеиновая кислота или ее часть обычно встраивается в вектор посредством прикрепления ДНК-лигазой к расщепленному ферментами рестрикции сайту в векторе. Альтернативно, желательная нуклеотидная последовательность может быть вставлена гомологичной рекомбинацией in vivo, обычно, присоединением гомологичных участков к вектору на флангах желательной нуклеотидной последовательности. Гомологичные участки добавляют лигированием олигонуклеотидов или полимеразной цепной реакцией, с использованием праймеров, включающих, например, как гомологичные участки, так и часть желательной нуклеотидной последовательности.

[0100] Также обеспечиваются кассеты экспрессии или системы, использованные для получения заявленных биосенсоров или химерных белков на их основе или для репликации заявленных молекул нуклеиновой кислоты. Кассета экспрессии может существовать как внехромосомный элемент или может быть включена в геном клетки в результате введения указанной кассеты экспрессии в клетку.

[0101] В кассете экспрессии указанная нуклеиновая кислота является функционально связанной с регуляторной последовательностью, которая может включать промоторы, энхансеры, терминаторы, операторы, репрессоры и индукторы и обеспечивает инициацию считывания РНК (транскрипции) в клетке-хозяине. В кассете экспрессии нуклеиновая кислота настоящего изобретения может быть также связана с сигналами терминации транскрипции, функциональным в клетке-хозяине. Методы изготовления кассет экспрессии или систем для экспрессии желаемого продукта известны специалистам, квалифицированным в данной области.

[0102] Вышеописанные системы экспрессии могут использоваться в прокариотических или эукариотических хозяевах. Клеточные линии, которые устойчиво экспрессируют белки настоящего изобретения, могут быть выбраны способами, известными в данной области (например, ко-трансфекция с селектируемым маркером, таким как dhfr, gpt, неомицин, гигромицин, что делает возможным выявление и выделение транфецированных клеток, которые содержат ген, включенный в геном).

[0103] Белковый продукт, кодируемый нуклеиновой кислотой изобретения, может быть получен путем экспрессии в любой удобной системе экспрессии, включая, например, бактериальные системы, дрожжевые системы, клетки насекомых, земноводных или клетки млекопитающих. Например, для получения белка могут использоваться клетки-хозяева, такие как Е. coli, В. subtilis. S. cerevisiae, клетки насекомого в комбинации с бакуловирусными векторами, или клетки высшего организма, такого как позвоночные, например, COS 7 клетки, НЕК 293, СНО, ооциты Xenopus и т.д.

[0104] Если используется любая вышеупомянутая клетка-хозяин или другие подходящие клетки-хозяева или организмы для репликации и/или экспрессии нуклеиновых кислот изобретения, то полученная реплицированная нуклеиновая кислота, экспрессированный белок или полипептид находятся в рамках притязания изобретения как продукт клетки-хозяина или организма. Продукт может быть выделен подходящим способом, известным в данной области.

[0105] Белки

[0106] Нуклеиновая кислота по настоящему изобретению кодирует флуоресцентный биосенсор для регистрации активности каспазы 3, аналитический сигнал которого представляет собой флуоресценцию в дальне-красной области спектра. Специфические биосенсоры, представляющие интерес, включают биосенсоры, имеющие аминокислотные последовательности SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, свойства которых подробно описаны в экспериментальной части ниже.

[0107] Заявленный биосенсор обладает способностью к детектируемой флуоресценции, которая может быть зарегистрирована с помощью визуального скрининга, спектрофотометрии, спектрофлуориметрии, флуоресцентной микроскопии, с помощью FACS или другим общепринятым способом для регистрации флуоресценции. Заявленные биосенсоры при возбуждении дальне-красного флуоресцентного белка светом с длиной волны в диапазоне 550-620 нм имеют максимум (пик) эмиссии флуоресценции в диапазоне от 630 нм до 680 нм, например, 635 нм, 650 нм или 670 нм, и пик эмиссии флуоресценции, соответствующий белку iRFP, обусловленный FRET, при 700-750 нм. Заявленные биосенсоры при возбуждении белка iRFP светом с длиной волны в диапазоне 670-690 нм имеют максимум (пик) эмиссии флуоресценции в диапазоне 700-750 нм. В преимущественных воплощениях первый пик флуоресценции и второй пик флуоресценции при возбуждении светом с длиной волны 550-620 нм и 670-690 нм могут быть измерены с помощью спектрофотометрии, спектрофлуориметрии, флуоресцентной микроскопии, с помощью FACS или другим общепринятым способом для регистрации флуоресценции.

[0108] Заявленный биосенсор меняет интенсивность флуоресценции в диапазоне от 630 нм до 680 нм и в диапазоне от 700 нм до 750 нм при возбуждении светом с длиной волны 550-620 нм, при этом интенсивность флуоресценции в диапазоне от 700 нм до 750 нм при возбуждении светом с длиной волны 670-690 остается неизменной. Для нужд настоящего изобретения сигналом биосенсора является отношение интенсивности флуоресценции в диапазоне от 630 нм до 680 нм и в диапазоне от 700 нм до 750 нм при возбуждении светом с длиной волны 550-620 к интенсивности флуоресценции при возбуждении светом с длиной волны 670-690 нм. Этот параметр не зависит от концентрации биосенсора в среде.

[0109] В преимущественных воплощениях при наличии активности каспазы 3 в среде интенсивность флуоресценции заявленного биосенсора в диапазоне от 630 нм до 680 нм при возбуждении светом с длиной волны 550-620 нм увеличивается из-за исчезновения переноса энергии на акцептор FRET белок iRFP, a интенсивность флуоресценции заявленного биосенсора в диапазоне от 700 нм до 750 нм при возбуждении светом с длиной волны 550-620 нм уменьшается. Таким образом при наличии активности каспазы 3 в среде происходит изменение аналитического сигнала биосенсора в дальне-красной области спектра.

[110] Регистрация сигнала биосенсора может быть осуществлена с помощью спектрофотометрии, спектрофлуориметрии, флуоресцентной микроскопии, с помощью FACS или другим общепринятым способом для регистрации флуоресценции.

[0111] Заявленный биосенсор способен регистрировать наличие активности каспазы 3 в среде, например, внутри клеток. Определение наличия активности каспазы 3 внутри клеток позволит судить о вступлении клеток в апоптоз.

[0112] Способность биосенсора регистрировать активность каспазы 3 может быть определена с использованием выделенного рекомбинантного белка биосенсора, полученного методами генетической инженерии, как описано в Примерах 1 и 2, при добавлении к нему препарата очищенной активной каспазы 3, как описано в Примере 3. В данной системе каспаза 3 ферментативно гидролизует содержащий сайт DEVD линкер, что приводит к изменению флуоресценции биосенсора по сравнению с флуоресценцией образца до реакции.

[0113] Заявленный биосенсор обладает относительно небольшими размерами и состоит из 600-700 аминокислот, обычно длина биосенсора 600-650 аминокислот, например, 612 аминокислот (включая первый метионин).

[0114] Также обеспечиваются функциональные биосенсоры, которые по существу сходны с указанными выше биосенсорами, где по существу сходны означает, что эти белки имеют аминокислотную последовательность, идентичную последовательности SEQ ID NOs:5, 6, или 7, по крайней мере, на 85% идентичности, обычно, по крайней мере, 90% и чаще, по крайней мере, 95% (например, 95% и выше; 96% и выше, 97% и выше; 98% и выше: 99% и выше или 100% идентичности последовательности).

[0115] Мутанты могут быть получены с использованием стандартных методов молекулярной биологии, как подробно описано в разделе «молекулы нуклеиновых кислот« выше. Примеры обеспечивают общие приемы, и использование стандартных способов, так что специалисты, квалифицированные в данной области, могут легко получить большой ряд дополнительных мутантов и проверить, было ли изменено биологическое (например, биохимическое, спектральное и т.д.) свойство. Например, интенсивность флуоресценции может быть измерена с использованием спектрофлуориметра при различных длинах волн возбуждения.

[0116] Биосенсоры настоящего изобретения присутствуют в среде, отличной от их естественной среды; например, они рекомбинантны. Белки настоящего изобретения могут находиться в выделенном состоянии, что означает, что белки по существу свободны от других белков и других биологических молекул, присутствующих в естественной среде, таких как олигосахариды, нуклеиновые кислоты и их фрагменты и т.п., где термин "по существу свободны" в этом случае означает, что меньше чем 70%, обычно меньше чем 60% и чаще меньше чем 50% композиции, содержащей выделенный белок, представляет собой некоторые другие биологические молекулы, чем встречающиеся в природе. В некоторых воплощениях белки присутствуют в по существу очищенной форме, где «по существу очищенная форма« означает очищенная по меньшей мере на 95%, обычно по меньшей мере на 97% и чаще по меньшей мере на 99%.

[0117] Заявленные биосенсоры могут быть получены искусственным путем, например экспрессией рекомбинантной нуклеиновой кислоты, кодирующей последовательность, белка, представляющего интерес, в соответствующем хозяине, как описано выше. Для очистки белка могут применяться любые обычные методики, где подходящие методы очистки белка описаны в Guide to Protein Purification, (Deuthser ed., Academic Press, 1990). Например, лизат может быть приготовлен из исходного источника и очищен с использованием ВЭЖХ, вытеснительной хроматографии, гель-электрофореза, аффинной хроматографии и т.п.

[0118] Также обеспечиваются белки слияния, включающие биосенсор настоящего изобретения, слитые с последовательностью внутриклеточной локализации (например, с сигналом локализации в ядре, в пероксисомах, аппарате Гольджи, митохондрии и т.д.). Полипептид, обеспечивающий определенную внутриклеточную локализацию, может быть оперативно присоединен к N-концу и/или С-концу биосенсора. Сигналы внутриклеточной локализации хорошо известны специалистам в данной области и описаны, например, Nakai K. (Advances in Protein Chemistry, Vol.54, 2000, p.277-344).

Трансформанты

[0119] Нуклеиновые кислоты настоящего изобретения используют для получения трансформантов, включая трансгенных организмов или сайт-специфичных генных изменений в клеточных линиях. Трансгенные клетки, заявленные в изобретении, содержат одну или более нуклеиновых кислот, заявленных по настоящему изобретению, в качестве трансгена. Для целей изобретения любая приемлемая клетка-хозяин может быть использована, включая прокариотические (например, Escherichia coli. Streptomyces sp., Bacillus subtilis, Lactobacillus acidophilus, и т.д.) или эукариотические клетки-хозяева. Трансгенный организм, заявленный по изобретению, может быть прокариотическим или эукариотическим организмом, включая бактерии, цианобактирии, грибы, растения и животные, в которых одна или больше клеток организма содержат гетерогенную нуклеиновую кислоту, заявленную по изобретению, введенную посредством вмешательства человека, такими способами как технологии трансгеноза, которые известны в данной области.

[0120] Выделенная нуклеиновая кислота настоящего изобретения может быть введена в хозяина способами, известными в данной области, например инфицированием, трансфекцией, трансформацией или трансконъюгацией. Способы переноса молекулы нуклеиновой кислоты (то есть, ДНК) в такие организмы широко известны и обеспечивается в ссылках, таких как Sambrook et al. (Molecular Cloning: A Laboratory Manual, 3nd Ed., (2001) Cold Spring Harbor Press, Cold Spring Harbor, NY).

[0121] В одном воплощении трансгенный организм может быть прокариотическим организмом. Способы трансформации прокариотических хозяев хорошо описаны в данной области (например, см. Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd edition (1989) Cold Spring Harbor Laboratory Press и Ausubel et al., Current Protocols in Molecular Biology (1995) John Wiley & Sons, Inc).

[0122] В другом воплощении трансгенными организмами могут быть грибы, например дрожжи. Дрожжи широко используются как носители для экспрессии гетерогенного гена (например см. Goodey et al Yeast biotechnology, D R Berry et al, eds, (1987) Alien and Unwin, London, p.401-429) и King et al Molecular and Cell Biology of Yeasts, E F Walton and G Т Yarronton, eds, Blackie, Glasgow (1989), p.107-133). Несколько типов дрожжевых векторов доступны, включая интегративные векторы, которые требуют рекомбинации с геномом хозяина для их поддержки, и автономно реплицирующиеся плазмидные векторы.

[0123] В другом воплощении трансгенными организмами могут быть животные. Трансгенные животные могут быть получены трансгенными способами, известными в данной области, и обеспечиваются в ссылках, таких как Pinkert, Transgenic Animal Technology: a Laboratory Handbook, 2nd edition (2203) San Diego: Academic Press; Gersenstein and Vintersten, Manipulating the Mouse Embryo: A Laboratory Manual, 3rd ed, (2002) Nagy A. (Ed), Cold Spring Harbor Laboratory; Blau et al., Laboratory Animal Medicine, 2nd Ed., (2002) Fox J.G., Anderson L.C., Loew P.M., Quimby F.W. (Eds), American Medical Association, American Psychological Association; Gene Targeting: A Practical Approach by Alexandra L. Joyner (Ed.) Oxford University Press; 2 nd edition (2000). Например, трансгенные животные могут быть получены гомологичной рекомбинацией, где изменяется эндогенный локус. Альтернативно, конструкция нуклеиновой кислоты включается случайным образом в геном. Векторы для устойчивого включения включают плазмиды, ретровирусы и другие животные вирусы, YAC, и т.п. Нуклеиновые кислоты могут быть введены в клетку непосредственно или опосредованно, введением в прекурсор клетки, путем намеренной генетической манипуляции, такой как микроинъекция или инфицирование рекомбинантным вирусом или рекомбинантным вирусным вектором и т.п. Термин «генетическая манипуляция» не включает классическое скрещивание или оплодотворение in vitro, a предпочтительно является направленным на введение рекомбинантных молекул нуклеиновых кислот. Эти молекулы нуклеиновой кислоты могут быть включены в хромосому или они являться внехромосомными реплицирующими ДНК. Конструкции ДНК для гомологичной рекомбинации будут содержать, по меньшей мере, часть нуклеиновой кислоты настоящего изобретения, где ген имеет желательную генетическую модификацию(ции) и включает области гомологии с целевым локусом. Конструкциям ДНК для произвольного включения не обязательно содержать область гомологии с медиатором рекомбинации. Легко могут быть включены маркеры для положительной и отрицательной селекции. Способы получения клеток, имеющих целевые генные модификации, через гомологическую комбинацию известны в данной области. Для различных способов трансфекции клеток млекопитающих, см. Keown et al., Meth. Enzymol. (1990) 185:527-537.

[0124] Трансгенные животные могут быть любыми животными, не относящимися к человеку, включая млекопитающее, не относящееся к человеку, (например мышь, крыса), птица или амфибия и т.д., и использованы в функциональном исследовании, скрининге лекарственного средства и т.п.

[0125] Также могут быть получены трансгенные растения. Способы получения трансгенных растительных клеток и растений описаны в патентах США №5767367; 5750870; 5739409; 5689049; 5689045; 5674731; 5656466; 5633155; 5629470; 5595896; 5576198; 5538879; 5484956; раскрытия которых включены сюда ссылкой. Способы получения трансгенных растений также рассмотрены в Plant Biochemistry and Molecular Biology (eds. Lea and Leegood, John Wiley & Sons) (1993) p.275-295 и в Plant Biotechnology and Transgenic Plants (eds. Oksman-Caldentey and Barz), (2002) 719 p. Например, эмбриогенные эксплантаты, содержащие соматические клетки, могут использоваться для получения трансгенного хозяина. После сбора клеток или тканей экзогенная ДНК, представляющая интерес, вводится в растительные клетки, при этом известен для такого введения ряд различных способов. При наличии выделенных протопластов возникает возможность для введения через ДНК-опосредованные протоколы передачи гена, включая инкубацию протопластов с очищенной ДНК, такой как плазмида, содержащая целевую экзогенную последовательность, представляющую интерес, в присутствии поливалентных катионов (например, PEG или PLO); или электропорацию протопластов в присутствии выделенной ДНК, включающей целевую экзогенную последовательность. Протопласты, которые успешно включили экзогенную ДНК, затем отбираются, выращиваются в каллус, и в конечном счете в трансгенное растение при контакте с подходящими количествами и отношениями стимулирующих факторов, таких как ауксины и цитокины. Могут использоваться другие подходящие способы получения растения, которые доступны для квалифицированных специалистов в данной области, такие как применение «генной пушки«, или Agrobacterium-опосредованная трансформация.

Способы применения

[0126] Биосенсоры настоящего изобретения являются генетически кодируемыми флуоресцентными белками, меняющими спектральные свойства в присутствии активной каспазы 3 в среде. Они могут быть использованы для регистрации изменения активности каспазы 3 внутри клеток, например, при вступлении клеток в апоптоз, например, под действием химиотерапевтического агента.

[0127] Для осуществления настоящего применения должна быть получена нуклеиновая кислота, кодирующая биосенсор. Получение таких конструкций очевидно для любого специалиста в данной области. Полученная конструкция должна быть встроена в кассету экспрессии (или вектор), обеспечивающую временную или постоянную экспрессию этой нуклеиновой кислоты в клетках-хозяевах. Вектор или кассета экспрессии может содержать элементы, обеспечивающие адресную доставку конструкции в интересующие клетки, или находится в составе частиц, обеспечивающих адресную доставку. После трансфекции клеток вектором и по истечении времени, необходимого для наработки в клетках продукта экспрессии, может быть осуществлена регистрация изменения активности каспазы 3 внутри клеток.

[0128] Биосенсоры настоящего изобретения могут быть сшиты с сигналами различной внутриклеточной локализации для направления биосенсоров в определенные клеточные компартменты и регистрации активности каспазы 3 в этих клеточных компартментах.

[0129] Следующие примеры приведены в иллюстративных целях и не должны ограничивать объем изобретения.

[0130]

ПРИМЕРЫ

Пример 1. Получение вариантов биосенсора.

[0131] Нуклеиновую кислоту, кодирующую белок IRFP, получали путем ПЦР с плазмиды iRFP-pBAD, любезно предоставленной д.б.н Верхушей В.В., с помощью ген-специфических праймеров и клонировали в pQE-30 (Qiagen, Германия) по стандартной технологии.

[0132] Нуклеиновые кислоты, кодирующие флуоресцентные белки mKate2, FP650 и NiRFP, амплифицировали методом ПЦР с помощью ген-специфических праймеров, используя в качестве матрицы плазмиды mKate2-N, FP650-N, NiRFP-N (Евроген, Россия). С помощью праймеров в процессе реакции ПЦР на 3' концах клонируемых молекул нуклеиновых кислот добавляли последовательности, кодирующие линкер, содержащий узнаваемую каспазой 3 последовательность DEVD. Полученные фрагменты нуклеиновых кислот, кодирующие красные флуоресцентные белки, клонировали в рамку считывания в плазмиду, содержащую нуклеиновую кислоту, кодирующую белок IRFP.

[0133] Для этого соответствующие фрагменты ДНК mKate2, FP650 и NiRPP амплифицировали с ген-специфических праймеров, где обратные праймеры дополнительно содержали последовательность, кодирующую расщепляемый каспазой 3 линкер, и очищали при помощи электрофореза в 1% агарозном геле. Последовательность линкера соответствовала последовательности расщепляемого каспазой 3 линкера из плазмиды Casper3-BG (Евроген, Россия). Амплификацию проводили на приборе РТС-100 Thermal Cycler (MJ Reserch, Германия). Каждая реакционная проба так же содержала праймеры (0,5 мкМ), эквимолярную смесь dNTP (0,5 мкМ), матричную ДНК (10-100 нг), Tersus полимеразу (Евроген). Для доведения смеси до нужного объема использовали стерильную деионизованную воду. Использовали следующий режим амплификации: денатурация 95°С -12 сек; отжиг 65°С - 4 мин; элонгация 72°С - 1 мин, 10 циклов ПЦР. Конструкцию клонировали в pQE-30 (Qiagen) по стандартной технологии и использовали для трансформации клеток E.coli.

[0134] Таким образом были созданы конструкции mKate2-kasp-iRFP, FP650-kasp-iRFP, NiRFP-kasp-iRFP, где kasp - линкер, содержащий узнаваемую каспазой 3 последовательность (Рис.1).

Пример 2. Экспрессия вариантов биосенсора и выделение белков биосенсоров по изобретению.

[0135] Для бактериальной экспрессии был использован штамм E.coli BW25113, коэкспрессирующий одну из экспрессионных плазмид mKate2-kasp-iRFP, FP650-kasp-iRFP, NiRFP-kasp-iRFP, полученных, как описано выше, кодирующих биосенсор по изобретению, и плазмиду, кодирующую гем-оксигеназу (pwa23-HO [Filonov GS, Piatkevich KD, Ting LM. Zhang J, Kirn K, Verkhusha W. Bright and stable near-infrared fluorescent protein for in vivo imaging. Nat Biotechnol. 2011 Jul 17;29(8):757-61]).

[0136] Трансформированные согласно стандартному протоколу бактерии E.coli BW25113 высевали на чашки Петри, содержащие питательную среду LB-агар с арабинозой (150 мг/мл), рамнозой (0,0024% по массе), канамицином (0,1 мг/мл), ампициллином (0,5 мг/мл) и предшественником гема - δ-аминолевулиновой кислотой (0,2 мМ).

[0137] Чашки с трансформантами инкубировали при 37°С в течение 24 ч.

[0138] Белок выделяли из биомассы бактерий, собранных с 5 чашек Петри с помощью TALON (Clontech. США), по стандартному протоколу производителя с элюцией в PBS-имидазоле (0.25М).

Пример 3. Изменение спектральных характеристик биосенсоров mKate2-kasp-iRFP, FP650-kasp-iRFP, NiRFP-kasp-iRFP под действие выделенной каспазы 3 in vitro.

[0139] Биосенсоры mKate2-kasp-iRFP, FP650-kasp-iRFP и NiRFP-kasp-iFP, нуклеиновые кислоты которых были получены, как описано в Примере 1, были выделены из бактерий, как описано в Примере 2, и использованы для тестирования их чувствительности к каспазе 3.

[0140] Для этого в спектрофотометрическую кювету внесли выделенный белок в PBS-имидазоле. Количество белка в различных пробах отличалось, поскольку сигнал сенсора не должен зависеть от его концентрации. Далее сняли спектры возбуждения и эмиссии флуоресценции:

[0141] Для mKate2-kasp-iRFP: спектр возбуждения при эмиссии 740 нм, спектры эмиссии флуоресценции при 550 нм и 650 нм.

[0142] Для FP650-kasp-iRFP: спектр возбуждения при эмиссии 740 нм, спектры эмиссии флуоресценции при 580 нм и 670 нм.

[0143] Для NiRFP-kasp-iRFP: спектр возбуждения при эмиссии 740 нм, спектры эмиссии флуоресценции при 590 нм и 670 нм.

[0144] Далее в систему внесли следующие компоненты реакционной среды: 50 мМ HEPES буфер (рН 7.5), 100 мМ NaCl, 1 мМ ЭДТА, 10% сахарозу (масса/объем), 0,1% CHAPS, 10 мМ ДТТ и каспазу 3, инкубировали 1 час на 37°С.

[0145] Расщепление каспазой сенсора регистрировали по изменению видов графика возбуждения при эмиссии 740 нм (рис.2А, 2Б, 2В) и графика эмиссии флуоресценции при возбуждении 550, 580 и 590 нм, соответственно, для каждого из трех сенсоров (рис.3А, 3Б, 3В). Таким образом, определяли зависимость сигнала сенсора (соотношение интенсивностей возбуждения в области 588, 592, 605 нм, соответственно, на спектре возбуждения до и после реакции; соотношение интенсивностей флуоресценции в области 633, 650, 670 нм, соответственно, - и 710 нм на спектре флуоресценции до и после реакции) от добавления каспазы к сенсору.

Для всех трех вариантов наблюдали уменьшение интенсивности возбуждения при эмиссии на 740 нм: в области 588, 592, 605 нм, соответственно, что может объясняться уменьшением FRET из-за расщепления сенсора каспазой. Для графика флуоресценции при возбуждении 650, 670 и 670 нм, соответственно, в области 740 нм при добавлении каспазы изменений не наблюдали. Все три варианта после добавления каспазы при возбуждении светом 550, 580, 590 нм демонстрировали увеличение интенсивности флуоресценции в области 633, 650, 670 нм - с одновременным уменьшением интенсивности флуоресценции в области 713 нм, что также свидетельствует об уменьшении FRET от донора к акцептору. Варианты FP650-kasp-iRFP и NiRFP-kasp-iRFP после обработки каспазой демонстрировали более значительные изменения, чем mKate2-kasp-IRFP.

Все публикации и патентные заявки, цитируемые в настоящем описании, вводятся в настоящее описание посредством ссылки, как если бы каждая отдельная публикация или патентная заявка была конкретно и отдельно введена посредством ссылки. Цитирование любой публикации приводится в соответствии с контекстом и интерпретацией по настоящему изобретению и не должно истолковываться как признание любой такой публикации прототипом данного изобретения.

SEQ ID NO:1 Аминокислотная последовательность дальне-красного флуоресцентного белка mKate

prt

MVSELIKENMHMKLYMEGTV

NNHHFKCTSEGEGKPYEGTQ

TMRIKAVEGGPLPFAFDILA

TSFMYGSKTFINHTQGIPDF

FKQSFPEGFTWERVTTYEDG

GVLTATQDTSLQDGCLIYNV

KIRGVNFPSNGPVMQKKTLG

WEASTETLYPADGGLEGRAD

MALKLVGGGHLICNLKTTYR

SKKPAKNLKMPGVYYVDRRL

ERIKEADKETYVEQHEVAVA

RYCDLPSKLGHR

SEQ ID NO:2 Аминокислотная последовательность дальне-красного флуоресцентного белка FP650

prt

MGEDSELISENMHMKLYMEG

TVNGHHFKCTSEGEGKPYEG

TQTAKIKVVEGGPLPFAFDI

LATSFMYGSKTFINHTQGIP

DFFKQSFPEGFTWERITTYE

DGGVLTATQDTSLQNGCLIY

NVKINGVNFPSNGPVMQKKT

LGWEASTEMLYPADSGLRGH

SQMALKLVGGGYLHCSLKTT

YRSKKPAKNLKMPGFYFVDR

KLERIKEADKETYVEQHEMA

VARYCDLPSKLGHS

SEQ ID NO:3 Аминокислотная последовательность дальне-красного флуоресцентного белка FP670

prt

MGEDSELISENMHTKLYMEG

TVNGHHFKCTSEGEGKPYEG

TQTCKIKVVEGGPLPFAFDI

LATSFMYGSKTFINHTQGIP

DFFKQSFPEGFTWERITTYE

DGGVLTATQDTSLQNGCLIY

NVKINGVNFPSNGPVMQKKT

LGWEANTEMLYPADSGLRGH

NQMALKLVGGGYLHCSLKTT

YRSKKPAKNLKMPGFYFVDR

KLERIKEADKETYVEQHEMA

VARYCDLPSKLGHS

SEQ ID NO:4 Аминокислотная последовательность флуоресцентного белка iRFP

prt

MASMTGGQQMGRDLYDDDDK

DPSSRSMTEGSVARQPDLLT

CDDEPIHIPGAIQPHGLLLA

LAADMTIVAGSDNLPELTGL

AIGALIGRSAADVFDSETHN

RLTIALAEPGAAVGAPITVG

FTMRKDAGFIGSWHRHDQLI

FLELEPPQRDVAEPQAFFRR

TNSAIRRLQAAETLESACAA

AAQEVRKITGFDRVMIYRFA

SDFSGEVIAEDRCAEVESKL

GLHYPASTVPAQARRLYTIN

PVRIIPDINYRPVPVTPDLN

PVTGRPIDLSFAILRSVSPV

HLEFMRNIGMHGTMSISILR

GERLWGLIVCHHRTPYYVDL

DGRQACELVAQVLAWQIGVM

EE

SEQ ID NO:5 Аминокислотная последовательность флуоресцентного биосенсора mKate2-kasp-iRFP

prt

MVSELIKENMHMKLYMEGTV

NNHHFKCTSEGEGKPYEGTQ

TMRIKAVEGGPLPFAFDILA

TSFMYGSKTFINHTQGIPDF

FKQSFPEGFTWERVTTYEDG

GVLTATQDTSLQDGCLIYNV

KIRGVNFPSNGPVMQKKTLG

WEASTETLYPADGGLEGRAD

MALKLVGGGHLICNLKTTYR

SKKPAKNLKMPGVYYVDRRL

ERIKEADKETYVEQHEVAVA

RYCDLPSKLGHRELGTEFGG

SGSDEVDKLGGSGSMASMTG

GQQMGRDLYDDDDKDPSSRS

MTEGSVARQPDLLTCDDEPI

HIPGAIQPHGLLLALAADMT

IVAGSDNLPELTGLAIGALI

GRSAADVFDSETHNRLTIAL

AEPGAAVGAPITVGFTMRKD

AGFIGSWHRHDQLIFLELEP

PQRDVAEPQAFFRRTNSAIR

RLQAAETLESACAAAAQEVR

KITGFDRVMIYRFASDFSGE

VIAEDRCAEVESKLGLHYPA

STVPAQARRLYTINPVRIIP

DINYRPVPVTPDLNPVTGRP

IDLSFAILRSVSPVHLEFMR

NIGMHGTMSISILRGERLWG

LIVCHHRTPYYVDLDGRQAC

ELVAQVLAWQIGVMEE

SEQ ID NO:6 Аминокислотная последовательность флуоресцентного биосенсора FP650-kasp-iRFP

prt

MGEDSELISENMHMKLYMEG

TVNGHHFKCTSEGEGKPYEG

TQTAKIKVVEGGPLPFAFDI

LATSFMYGSKTFINHTQGIP

DFFKQSFPEGFTWERITTYE

DGGVLTATQDTSLQNGCLIY

NVKINGVNFPSNGPVMQKKT

LGWEASTEMLYPADSGLRGH

SQMALKLVGGGYLHCSLKTT

YRSKKPAKNLKMPGFYFVDR

KLERIKEADKETYVEQHEMA

VARYCDLPSKLGHSELGTEF

GGSGSDEVDKLGGSGSMASM

TGGQQMGRDLYDDDDKDPSS

RSMTEGSVARQPDLLTCDDE

PIHIPGAIQPHGLLLALAAD

MTIVAGSDNLPELTGLAIGA

LIGRSAADVFDSETHNRLTI

ALAEPGAAVGAPITVGFTMR

KDAGFIGSWHRHDQLIFLEL

EPPQRDVAEPQAFFRRTNSA

IRRLQAAETLESACAAAAQE

VRKITGFDRVMIYRFASDFS

GEVIAEDRCAEVESKLGLHY

PASTVPAQARRLYTINPVRI

IPDINYRPVPVTPDLNPVTG

RPIDLSFAILRSVSPVHLEF

MRNIGMHGTMSISILRGERL

WGLIVCHHRTPYYVDLDGRQ

ACELVAQVLAWQIGVMEE

SEQ ID NO:7 Аминокислотная последовательность флуоресцентного биосенсора NiRFP-kasp-iRFP

prt

MGEDSELISENMHTKLYMEG

TVNGHHFKCTSEGEGKPYEG

TQTCKIKVVEGGPLPFAFDI

LATSFMYGSKTFINHTQGIP

DFFKQSFPEGFTWERITTYE

DGGVLTATQDTSLQNGCLIY

NVKINGVNFPSNGPVMQKKT

LGWEANTEMLYPADSGLRGH

NQMALKLVGGGYLHCSLKTT

YRSKKPAKNLKMPGFYFVDR

KLERIKEADKETYVEQHEMA

VARYCDLPSKLGHSELGTEF

GGSGSDEVDKLGGSGSMASM

TGGQQMGRDLYDDDDKDPSS

RSMTEGSVARQPDLLTCDDE

PIHIPGAIQPHGLLLALAAD

MTIVAGSDNLPELTGLAIGA

LIGRSAADVFDSETHNRLTI

ALAEPGAAVGAPITVGFTMR

KDAGFIGSWHRHDQLIFLEL

EPPQRDVAEPQAFFRRTNSA

IRRLQAAETLESACAAAAQE

VRKITGFDRVMIYRFASDFS

GEVIAEDRCAEVESKLGLHY

PASTVPAQARRLYTINPVRI

IPDINYRPVPVTPDLNPVTG

RPIDLSFAILRSVSPVHLEF

MRNIGMHGTMSISILRGERL

WGLIVCHHRTPYYVDLDGRQ

ACELVAQVLAWQIGVMEE

SEQ ID NO:8 Аминоксилотная последовательность расщепляемого каспазой линкера

prt

EFGGSGSDEVDKLGGSGS

SEQ ID NO:9 Последовательность нуклеотидов флуоресцентного биосенсора mKate2-kasp-iRFP

dna

atggtgagcgagctgattaaggagaacatgcacatgaagctgtacatggagggcaccgtg

aacaaccaccacttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccag

accatgagaatcaaggcggtcgagggcggccctctccccttcgccttcgacatcctggct

accagcttcatgtacggcagcaaaaccttcatcaaccacacccagggcatccccgacttc

tttaagcagtccttccccgagggcttcacatgggagagagtcaccacatacgaagacggg

ggcgtgctgaccgctacccaggacaccagcctccaggacggctgcctcatctacaacgtc

aagatcagaggggtgaacttcccatccaacggccctgtgatgcagaagaaaacactcggc

tgggaggcctccaccgagaccctgtaccccgctgacggcggcctggaaggcagagccgac

atggccctgaagctcgtgggcgggggccacctgatctgcaacttgaagaccacatacaga

tccaagaaacccgctaagaacctcaagatgcccggcgtctactatgtggacagaagactg

gaaagaatcaaggaggccgacaaagagacctacgtcgagcagcacgaggtggctgtggcc

agatactgcgacctccctagcaaactggggcacagagagctcggtaccgaattcggtggt

tctggttctgatgaagttgataagcttggtggttctggttctatggctagcatgactggt

ggacagcaaatgggtcgggatctgtacgacgatgacgataaggatccgagctcgagatct

atgacagaaggatccgtcgccaggcagcctgacctcttgacctgcgacgatgagccgatc

catatccccggtgccatccaaccgcatggactgctgctcgccctcgccgccgacatgacg

atcgttgccggcagcgacaaccttcccgaactcaccggactggcgatcggcgccctgatc

ggccgctctgcggccgatgtcttcgactcggagacgcacaaccgtctgacgatcgccttg

gccgagcccggggcggccgtcggagcaccgatcactgtcggcttcacgatgcgaaaggac

gcaggcttcatcggctcctggcatcgccatgatcagctcatcttcctcgagctcgagcct

ccccagcgggacgtcgccgagccgcaggcgttcttccgccgcaccaacagcgccatccgc

cgcctgcaggccgccgaaaccttggaaagcgcctgcgccgccgcggcgcaagaggtgcgg

aagattaccggcttcgatcgggtgatgatctatcgcttcgcctccgacttcagcggcgaa

gtgatcgcagaggatcggtgcgccgaggtcgagtcaaaactaggcctgcactatcctgcc

tcaaccgtgccggcgcaggcccgtcggctctataccatcaacccggtacggatcattccc

gatatcaattatcggccggtgccggtcaccccagacctcaatccggtcaccgggcggccg

attgatcttagcttcgccatcctgcgcagcgtctcgcccgtccatctggaattcatgcgc

aacataggcatgcacggcacgatgtcgatctcgattttgcgcggcgagcgactgtgggga

ttgatcgtttgccatcaccgaacgccgtactacgtcgatctcgatggccgccaagcctgc

gagctagtcgcccaggttctggcctggcagatcggcgtgatggaagag

SEQ ID NO:10 Последовательность нуклеотидов флуоресцентного биосенсора FP650-kasp-iRFP

dna

atgggagaggatagcgagctgatctccgagaacatgcacatgaaactgtacatggagggc

accgtgaacggccaccacttcaagtgcacatccgagggcgaaggcaagccctacgagggc

acccagaccgctaagatcaaggtggtcgagggcggccctctccccttcgccttcgacatc

ctggctaccagcttcatgtacggcagcaaaacctttatcaaccacacccagggcatcccc

gacttctttaagcagtccttccctgagggcttcacatgggagaggatcaccacatacgaa

gacgggggcgtgctgaccgctacccaggacaccagcctccagaacggctgcctcatctac

aacgtcaagatcaacggggtgaacttcccatccaacggccctgtgatgcagaagaaaaca

ctcggctgggaggccagcaccgagatgctgtaccccgctgacagcggcctgagaggccat

agtcagatggccctgaagctcgtgggcgggggctacctgcactgctccctcaagaccaca

tacagatccaagaaacccgctaagaacctcaagatgcccggcttctacttcgtggacagg

aaactggaaagaatcaaggaggccgacaaagagacctacgtcgagcagcacgagatggct

gtggccaggtactgcgacctgcctagcaaactggggcacagcgagctcggtaccgaattc

ggtggttctggttctgatgaagttgataagcttggtggttctggttctatggctagcatg

actggtggacagcaaatgggtcgggatctgtacgacgatgacgataaggatccgagctcg

agatctatgacagaaggatccgtcgccaggcagcctgacctcttgacctgcgacgatgag

ccgatccatatccccggtgccatccaaccgcatggactgctgctcgccctcgccgccgac

atgacgatcgttgccggcagcgacaaccttcccgaactcaccggactggcgatcggcgcc

ctgatcggccgctctgcggccgatgtcttcgactcggagacgcacaaccgtctgacgatc

gccttggccgagcccggggcggccgtcggagcaccgatcactgtcggcttcacgatgcga

aaggacgcaggcttcatcggctcctggcatcgccatgatcagctcatcttcctcgagctc

gagcctccccagcgggacgtcgccgagccgcaggcgttcttccgccgcaccaacagcgcc

atccgccgcctgcaggccgccgaaaccttggaaagcgcctgcgccgccgcggcgcaagag

gtgcggaagattaccggcttcgatcgggtgatgatctatcgcttcgcctccgacttcagc

ggcgaagtgatcgcagaggatcggtgcgccgaggtcgagtcaaaactaggcctgcactat

cctgcctcaaccgtgccggcgcaggcccgtcggctctataccatcaacccggtacggatc

attcccgatatcaattatcggccggtgccggtcaccccagacctcaatccggtcaccggg

cggccgattgatcttagcttcgccatcctgcgcagcgtctcgcccgtccatctggaattc

atgcgcaacataggcatgcacggcacgatgtcgatctcgattttgcgcggcgagcgactg

tggggattgatcgtttgccatcaccgaacgccgtactacgtcgatctcgatggccgccaa

gcctgcgagctagtcgcccaggttctggcctggcagatcggcgtgatggaagag

SEQ ID NO:11 Последовательность нуклеотидов флуоресцентного биосенсора NiRFP-kasp-iRFP

dna

atgggagaggatagcgagctgatctccgagaacatgcacacgaaactgtacatggagggc

accgtgaacggccaccacttcaagtgcacatccgagggcgaaggcaagccctacgagggc

acccagacctgtaagatcaaggtggtcgagggcggccctctccccttcgccttcgacatc

ctggctaccagcttcatgtacggcagcaaaacctttatcaaccacacccagggcatcccc

gacttctttaagcagtccttccctgagggcttcacatgggagaggatcaccacatacgaa

gacgggggcgtgctgaccgctacccaggacaccagcctccagaacggctgcctcatctac

aacgtcaagatcaacggggtgaacttcccatccaacggccctgtgatgcagaagaaaaca

ctcggctgggaggccaacaccgagatgctgtaccccgctgacagcggtctgagaggccat

aatcagatggccctgaagctcgtgggcgggggctacctgcactgctccctcaagaccaca

tacagatccaagaaacccgctaagaacctcaagatgcccggcttctacttcgtggaccgt

aaactggaaagaatcaaggaggccgacaaagagacctacgtcgagcagcacgagatggct

gtggccaggtactgcgacctgcctagcaaactggggcacagcgagctcggtaccgaattc

ggtggttctggttctgatgaagttgataagcttggtggttctggttctatggctagcatg

actggtggacagcaaatgggtcgggatctgtacgacgatgacgataaggatccgagctcg

agatctatgacagaaggatccgtcgccaggcagcctgacctcttgacctgcgacgatgag

ccgatccatatccccggtgccatccaaccgcatggactgctgctcgccctcgccgccgac

atgacgatcgttgccggcagcgacaaccttcccgaactcaccggactggcgatcggcgcc

ctgatcggccgctctgcggccgatgtcttcgactcggagacgcacaaccgtctgacgatc

gccttggccgagcccggggcggccgtcggagcaccgatcactgtcggcttcacgatgcga

aaggacgcaggcttcatcggctcctggcatcgccatgatcagctcatcttcctcgagctc

gagcctccccagcgggacgtcgccgagccgcaggcgttcttccgccgcaccaacagcgcc

atccgccgcctgcaggccgccgaaaccttggaaagcgcctgcgccgccgcggcgcaagag

gtgcggaagattaccggcttcgatcgggtgatgatctatcgcttcgcctccgacttcagc

ggcgaagtgatcgcagaggatcggtgcgccgaggtcgagtcaaaactaggcctgcactat

cctgcctcaaccgtgccggcgcaggcccgtcggctctataccatcaacccggtacggatc

attcccgatatcaattatcggccggtgccggtcaccccagacctcaatccggtcaccggg

cggccgattgatcttagcttcgccatcctgcgcagcgtctcgcccgtccatctggaattc

atgcgcaacataggcatgcacggcacgatgtcgatctcgattttgcgcggcgagcgactg

tggggattgatcgtttgccatcaccgaacgccgtactacgtcgatctcgatggccgccaa

gcctgcgagctagtcgcccaggttctggcctggcagatcggcgtgatggaagag

Нуклеиновая кислота, кодирующая основанный на FRET дальне-красный флуоресцентный биосенсор для измерения активности каспазы 3 внутри клеток, где аналитический сигнал флуоресцентного биосенсора представляет собой флуоресценцию в дальне-красной области спектра и в качестве акцептора выступает белок iRFP, а в качестве донора - дальне-красный флуоресцентный белок семейства GFP, где аминокислотная последовательность дальне-красного флуоресцентного биосенсора выбрана из группы SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7.



 

Похожие патенты:

Настоящее изобретение относится к области микробиологии и касается способа быстрого выращивания, детекции и идентификации или подсчета микроколоний микроорганизмов ранней стадии.

Изобретение относится к лабораторной диагностике заболевания иерсиниозом, вызываемым Yersinia enterocolitica. .
Изобретение относится к биотехнологии и может быть использовано для культивирования микроорганизмов в искусственных питательных двухфазных средах. .
Изобретение относится к биотехнологии, в частности к медицинской микробиологии, и может быть использовано для выделения бруцеллезного микроба. .
Изобретение относится к микробиологии и может быть использовано для выявления антагонистических свойств по отношению к патогенным микобактериям. .
Изобретение относится к микробиологии, касается способа изучения взаимоотношений микроорганизмов и может быть использовано для выявления антагонистических свойств по отношению к патогенным микобактериям у молочнокислых бактерий и бактерий группы кишечной палочки.

Изобретение относится к биотехнологии и может быть использовано для оценки антагонистической активности молочнокислых бактерий и бактерий кишечной группы к патогенным микобактериям.

Изобретение относится к медицине, а именно к медицинской микробиологии. .

Изобретение относится к микробиологической промышленности, медицинской биотехнологии и генной инженерии. .
Изобретение относится к области клеточной биологии, в частности к способу снятия мультипотентных мезенхимальных стромальных клеток с культуральной поверхности при проведении пассажа, и может быть использовано при культивировании стволовых клеток с последующим их использованием в клеточной терапии.
Изобретение относится к биотехнологии и может быть использовано в медицинской, пищевой и сельскохозяйственной отраслях промышленности. .
Изобретение относится к биотехнологии и может быть использовано в медицинской, пищевой и сельскохозяйственной промышленности. .
Изобретение относится к биотехнологии, а именно к получению композиции индивидуальных протеолитических ферментов и может быть использовано в медицине, косметологии.
Изобретение относится к биохимии и может быть использовано в биотехнологии при получении генно-инженерных продуктов. .

Изобретение относится к области биотехнологии и может быть использовано в фармакологии и медицине. .

Изобретение относится к биотехнологии и представляет собой фермент, который катализирует реакцию образования пептида из карбоксильного компонента и аминного компонента.
Наверх