Иммунологические тесты на активность эндопептидаз с измененной нацеленностью



Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью
Иммунологические тесты на активность эндопептидаз с измененной нацеленностью

 


Владельцы патента RU 2543650:

Аллерган, Инк. (US)

Изобретение относится к области медицины и предназначено для детектирования активности эндопептидаз с измененной нацеленностью. Способ по изобретению включает этап обработки клетки из стабильной клеточной линии образцом, содержащим эндопептидазу с измененной нацеленностью, выделения из обработанной клетки компонента SNAP-25, содержащего продукт расщепления SNAP-25197, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, осуществление контакта компонента SNAP-25 с анти-SNAP-25 антителом, иммобилизованным на твердофазной подложке, и детектирование присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25197. Детектирование продукта расщепления SNAP-25197 с помощью указанного комплекса антитело-антиген является показателем того, что эндопептидаза с измененной нацеленностью активна. Изобретение обеспечивает эффективное детектирование активности эндопептидаз с измененной нацеленностью. 5 з.п. ф-лы, 9 ил., 33 табл., 17 пр.

 

[01] Настоящая заявка на патент испрашивает приоритет в соответствии с §119(е) раздела 35 Свода законов США согласно предварительной заявке на патент США №61/160217, поданной 13 марта 2009 г., содержание которой полностью включено в настоящую заявку посредством ссылки.

[02] Последовательности, охарактеризованные в настоящем описании, приведены в перечне последовательностей, поданном совместно с настоящей заявкой, который полностью включен в настоящую заявку посредством ссылки.

[03] Способность токсинов клостридий, таких как, например, ботулинические нейротоксины (BoNT), BoNT/A, BoNT/B, BoNT/C1, BoNT/D, BoNT/E, BoNT/F и BoNT/G, и столбнячный нейротоксин (ТеМТ), ингибировать нейронную передачу сигнала находит широкое применение в терапии и косметологии, см., например, William J. Lipham, Cosmetic and Clinical Applications of Botulinum Toxin (Slack, Inc., 2004). Токсины клостридий, коммерчески доступные в форме фармацевтических композиций, включают препараты BoNT/A, такие как, например, ВОТОХ® (Allergan, Inc., Ирвин, Калифорния), DYSPORT®/RELOXIN® (Ipsen Ltd., Слау, Англия), PURTOX® (Mentor Corp., Санта-Барбара, Калифорния), XEOMIN® (Merz Pharmaceuticals, GmbH., Франкфурт, Германия), NEURONOX® (Medy-Tox, Inc., Очанг-миеон, Южная Корея), ВТХ-А (Biogen-tech Ltd., University, Яньтай, Шаньдун, Китай); и препараты BoNT/B, такие как, например, MYOBLOC®/NEL)ROBLOC® (Solstice Neurosciences, Inc., Южный Сан-Франциско, Калифорния). Например, ВОТОХ® в настоящее время одобрен в одной или нескольких странах для следующих показаний: ахалазия, мышечная спластичность у взрослых, анальные трещины, боль в спине, блефароспазм, бруксизм, шейная дистония, эссенциальный тремор, межбровные морщины или гиперкинетические лицевые морщины, головная боль, гемифациальный спазм, гиперактивность мочевого пузыря, повышенное потоотделение, детский церебральный паралич, рассеянный склероз, миоклонические нарушения, носогубные морщины, спастическая дисфония, косоглазие и поражение VII нерва.

[04] Обработка токсином клостридий приводит к ингибированию высвобождения нейромедиаторов и нейропептидов путем нарушения процесса экзоцитоза, с помощью которого осуществляется секреция нейромедиаторов и нейропептидов в синаптическую щель. Фармацевтическая промышленность стремится расширить терапевтическое применение токсина клостридий за пределы нынешнего использования в качестве миорелаксанта и применять его для лечения заболеваний, связанных с сенсорными нервами, таких как, например, различные виды хронической боли, нейрогенного воспаления и урогенитальных нарушений, а также других заболеваний, таких как, например, панкреатит. Один подход, используемый в настоящее время для расширения сферы применения способов лечения на основе токсина клостридий, включает модификацию токсина клостридий, в результате которой модифицированный токсин обладает измененной нацеленностью по отношению к нервным или не относящимся к нервным клеткам, представляющим интерес. Эти молекулы, называемые эндопептидазами с измененной нацеленностью или белками-модуляторами направленного везикулярного экзоцитоза (TVEMP), осуществляют свое ингибирующее действие в отношении экзоцитоза, используя рецептор-мишень, который присутствует на нервных или не относящихся к нервным клетках-мишенях, представляющих интерес. Такое изменение специфичности по отношению к клеткам-мишеням достигается за счет замены природного домена связывания токсина клостридий на нацеливающий домен, который демонстрирует избирательную связывающую активность по отношению к рецептору, отличному от рецептора токсина клостридий и присутствующему на нервных или не относящихся к нервным клетках-мишенях, представляющих интерес. Такие модификации домена связывания приводят к тому, что молекула приобретает способность избирательно связывать рецептор, отличный от рецептора токсина клостридий и присутствующий на клетках-мишенях. Эндопептидаза с измененной нацеленностью способна связываться с рецептором-мишенью, перемещаться в цитоплазму и проявлять свой протеолитический эффект по отношению к комплексу SNARE нервных или не относящихся к нервным клеток-мишеней, представляющих интерес.

[05] Одна группа эндопептидаз с измененной нацеленностью включает молекулы, имеющие домен связывания с опиоидными рецепторами. Эти эндопептидазы с измененной опиоидной нацеленностью включают домен связывания с опиоидными рецепторами, транслокационный домен токсина клостридий и ферментативный домен токсина клостридий. Неограничивающие примеры эндопептидаз с измененной опиоидной нацеленностью или опиоидно-TVEMP описаны, например, в Keith A. Foster et al., Clostridial Toxin Derivatives Able To Modify Peripheral Sensory Afferent Functions, патенте США 5989545; J. Oliver Dolly et al., Activatable Recombinant Neurotoxins, патенте США 7132259; Stephan Donovan, Closthdial Toxin Derivatives and Methods For Treating Pain, патенте США 7244437; Stephan Donovan, Clostridial Toxin Derivatives and Methods For Treating Pain, патенте США 7413742; Stephan Donovan, Clostridial Toxin Derivatives and Methods For Treating Pain, патенте США 7415338; Lance E. Steward et al., Multivalent Clostridial Toxin Derivatives and Methods of Their Use, патенте США 7514088; Keith A. Foster, Fusion Proteins, публикации заявки на патент США 2008/0064092; Keith A. Foster, Fusion Proteins, публикации заявки на патент США 2009/0035822; Lance E. Steward et al., Multivalent Clostridial Toxin Derivatives and Methods of Their Use, публикации заявки на патент США 2009/0048431; Keith A. Foster, Non-Cytotoxic Protein Conjugates, публикации заявки на патент США 2009/0162341; Keith A. Foster et al., Re-targeted Toxin Conjugates, публикации международной заявки WO 2005/023309; и Lance E. Steward, Modified Clostridial Toxins with Enhanced Translocation Capabilities and Altered Targeting Capabilities for Non-Closthdial Toxin Target Cells, публикации международной заявки WO 2008/008805; содержание каждого из которых полностью включено в настоящую заявку посредством ссылки.

[06] Одно из главных различий между эндопептидазами с измененной нацеленностью и токсинами клостридий заключается в том, что поскольку мотонейроны обычно не являются мишенями эндопептидаз с измененной нацеленностью, смертность, связанная с превышением дозы эндопептидаз с измененной нацеленностью, у млекопитающих значительно снижена или даже полностью исключена. Например, эндопептидазы с измененной опиоидной нацеленностью можно ввести в дозе, превышающей терапевтически эффективную дозу в 10000 раз без проявления свидетельств летальности, которая в данном случае является результатом пассивной диффузии молекулы, а не процесса интоксикации. Таким образом, эндопептидазы с измененной нацеленностью представляют собой нелетальные молекулы при любых практических применениях. Хотя это свойство отсутствия летальности имеет большие преимущества для применения в терапии, возникает проблема, связанная с производством, поскольку стандартным тестом на активность, используемым в производстве биопрепаратов на основе токсина клостридий, является биотест ЛД50 на мышах, тест на летальность. S.S.Arnon et al., JAMA 285: 1059-1070 (2001). В настоящее время биотест ЛД50 на мышах используется всеми производителями фармацевтической продукции для выражения активности их препаратов на основе токсина клостридий. Фактически, единицы активности токсинов клостридий представляют собой единицы ЛД50 у мышей. Однако, вследствие того, что эндопептидазы с измененной нацеленностью по существу нелегальны, биотест ЛД50 на мышах нельзя использовать для оценки активности этих молекул. Таким образом, простой, надежный, проверенный и приемлемый с точки зрения государственных органов тест на активность, позволяющий оценить надежность всех этапов, необходимых для поглощения эндопептидазы с измененной нацеленностью, имел бы значительную ценность.

[07] Согласно настоящей заявке предложены новые композиции, клетки и способы для оценки активности эндопептидаз с измененной нацеленностью, подходящие для применения в различных отраслях промышленности, таких как, например, фармацевтическая и пищевая промышленность, с обеспечением связанных с этим преимуществ. Эти композиции, клетки и способы не предполагают использования живых животных или тканей, взятых у живых животных, но позволяют оценить все этапы, необходимые для действия эндопептидаз с измененной нацеленностью.

ПОДРОБНОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

[08] На ФИГ.1 показана схема современной парадигмы высвобождения нейромедиатора и токсического действия токсина клостридий в центральном и периферическом нейроне. На ФИГ.1А показана схема механизма высвобождения нейромедиатора в центральном и периферическом нейроне. Процесс высвобождения можно описать как состоящий из двух этапов: 1) стыковки пузырька, при которой связанный с пузырьком белок SNARE пузырька, содержащего молекулы нейромедиатора, взаимодействует со связанными с мембраной белками SNARE, расположенными на плазматической мембране; и 2) высвобождения нейромедиатора, при котором пузырек сливается с плазматической мембраной и происходит экзоцитоз молекул нейромедиатора. На ФИГ.15 показана схема механизма токсического действия столбнячного и ботулинического токсинов в центральном и периферическом нейроне. Этот процесс интоксикации можно описать как состоящий из четырех этапов: 1) связывания рецептора, при котором токсин клостридий связывается с рецепторным комплексом клостридий и инициирует процесс интоксикации; 2) интернализации комплекса, при которой после связывания токсина происходит перенос пузырька, содержащего комплекс токсин/рецепторная система, в клетку путем эндоцитоза; 3) транслокации легкой цепи, при которой, как предполагают, имеет место множество событий, включая изменение pH внутри пузырька, формирование канала поры, включающего домен HN тяжелой цепи токсина клостридий, разделение легкой и тяжелой цепей токсина клостридий и высвобождение легкой цепи, и 4) ферментативной модификации мишени, при которой легкая цепь токсина клостридий протеолитически расщепляет свои субстраты-мишени SNARE, такие как, например, SNAP-25, VAMP или Syntaxin, таким образом предотвращая стыковку пузырька и высвобождение нейромедиатора.

[09] На ФИГ.2 показан полнодозовый ответ на эндопептидазу с измененной нацеленностью Noc/A в клональной клеточной линии ORL-1 Clone #6 с повышенной экспрессией ORL-1. Специфичное поглощение Noc/A можно наблюдать в клональной клеточной линии ORL-1 Clone #6, сверхэкспрессирующей ORL-1. Обработка Noc/A (LHN/A плюс вариант связывающего лиганда ноцицептина) и LHN/A (LC/A и HN без домена связывания), проведенная на клоне №6 стабильной клеточной линии ORL-1 в тесте методом твердофазного ИФА в модификации ECL на расщепленный SNAP-25197, продемонстрировала, что поглощение Noc/A является специфичным в этой клональной клеточной линии. Клональная клеточная линия также демонстрирует значительную чувствительность к Noc/A, характеризующуюся значением EC50, равным 1,2 нМ.

[010] На ФИГ.3 показан полнодозовый ответ на Noc/A в клонах №3 и №22 SK-N-DZ, полученных из одной клетки. Специфичное поглощение Noc/A в клонах №3 и №22 SK-N-DZ по сравнению с LHN/A (n=4 проведенных независимых эксперимента). Клетки рассевали на 96-луночные планшеты, покрытые поли-D-лизином, в СБС RPMI+N2+B27+NGF. Обработка веществами длилась 22 часа. Тест методом твердофазного ИФА в модификации ECL на расщепленный SNAP-25197 продемонстрировал, что поглощение Noc/A является специфичным в этих клональных клеточных линиях. Клональные клеточные линии также демонстрируют значительную чувствительность к Noc/A, характеризующуюся значением EC50, равным 0,3 нМ для клона №3 и 0,9 нМ для клона №22.

[011] На ФИГ.4 показаны результаты анализа "сэндвич"-методом твердофазного ИФА в модификации ECL на клонах 1С11, 4 В7 и 4С9 ORL1 ND7, обработанных эндопептидазой с измененной нацеленностью Noc/A. Родительские клоны ND7 и ORL1 ND7 обрабатывали Noc/A в течение 24 часов, после чего проводили инкубацию в течение двух дней. EC50 для родительского ND7 невозможно было вычислить, так как расщепление SNAP-25197 происходило лишь примерно на 50%. В клонах 4 В7 и 1С11 расщепление SNAP-25197 происходило более чем на 80%. Вычисленные значения EC50 составляли соответственно 5,7±0,5, 6,7±1 и 8,6±2 нМ.

[012] На ФИГ.5 показано, что поликлональные антитела против ноцицептина способны блокировать поглощение эндопептидазы с измененной нацеленностью Noc/A в клеточных линиях клона №3, клона №22 SK-N-DZ и клона №6 AGN Р33 ORL-1. Клетки рассевали на 96-луночные планшеты, покрытые поли-D-лизином, в СБС RPMI+N2+B27+NGF и обрабатывали в течение 22 часов средой без сыворотки, содержащей поликлональные антитела против ноцицептина в различных разбавлениях (0-3 мкг/мл) в 1 нМ Noc/A.

[013] На ФИГ. 6 показаны клетки клона AF4 SiMa и стабильной клеточной линии PC-12, обработанные эндопептидазой с измененной нацеленностью Dyn/A в концентрации от 0,017 нМ до 1 мкМ, как представлено на изображении Вестерн блота. У обеих клеточных линий наблюдали дозозависимое поглощение.

[014] На ФИГ. 7 показаны нормированные кривые анализа методом поверхностного плазмонного резонанса SPR BIAcore с использованием 7,8 нМ антител 2Е2А6, 1D3B8, 3С1А5 и 2С9 В10 и коммерческих МС-6050 и МС-6053. На ФИГ.7А показаны нормированные данные по скорости ассоциации для каждого антитела. На ФИГ.7Б показаны нормированные данные по скорости диссоциации для каждого антитела.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

[015] Согласно настоящему изобретению предложены новые тесты для анализа присутствия или отсутствия в образце активной эндопептидазы с измененной нацеленностью и для анализа активности эндопептидазы с измененной нацеленностью. Новые клеточные тесты, описанные в настоящей заявке, основаны на клетках, реагентах и способах детектирования, благодаря которым данные тесты можно использовать для детектирования наномолярных количеств эндопептидазы с измененной нацеленностью в образце. Клеточные тесты, описанные в настоящей заявке, предназначены для анализа множественных функций эндопептидазы с измененной нацеленностью, а именно, связывания эндопептидазы с измененной нацеленностью с рецептором на поверхности клетки, интернализации комплекса эндопептидаза-рецептор, транслокации ферментативного домена в цитоплазму и расщепления субстрата ферментативным доменом. Как более подробно обсуждается ниже, новые способы и композиции можно использовать для анализа как необработанных и объединенных образцов, так и высокоочищенных двуцепочечных эндопептидаз с измененной нацеленностью и составов на основе эндопептидаз с измененной нацеленностью, а также в формате автоматизированного высокопроизводительного анализа.

[016] Таким образом, согласно одному аспекту настоящего изобретения предложены вызывающие иммунный ответ композиции для получения анти-ЗМАР-25 антител, избирательно связывающихся с эпитопом, содержащим продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Вызывающие иммунный ответ композиции могут включать адъювант и вызывающую иммунный ответ композицию, включая антиген SNAP-25, носитель, связанный с антигеном SNAP-25, или носитель, связанный с гибким спейсером, в свою очередь связанным с антигеном SNAP-25, где между антигеном SNAP-25 и носителем помещен гибкий линкер. Предполагается, что все без исключения антигены SNAP-25, которые вызывают иммунный ответ, приводящий к выработке анти-SNAP-25 антител, способных избирательно связываться с эпитопом SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, могут быть пригодны в качестве антигенов SNAP-25, включая, но не ограничиваясь перечисленными: антигены SNAP-25, полученные из природного SNAP-25, антигены SNAP-25, полученные из не встречающегося в природе SNAP-25, и антигены SNAP-25, включающие иммунореактивные фрагменты SNAP-25, SNAP-25 из природного SNAP-25 или не встречающегося в природе SNAP-25. Антигены SNAP-25, пригодные для получения анти-SNAP-25 антител, способных избирательно связываться с эпитопом SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, включают, без ограничения, антигены SNAP-25, включающие пептид SNAP-25, на С-конце которого находится карбоксилированный остаток глутамина, связанный с пептидом-носителем, включая, без ограничения, SEQ ID NO: 38. Другие вызывающие иммунный ответ композиции, пригодные для получения aHTH-SNAP-25 антител, способных избирательно связываться с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, включают, без ограничения, вызывающие иммунный ответ композиции, содержащие носитель, связанный с гибким линкером, в свою очередь связанным с антигеном SNAP-25-карбоксилированным С-концевым глутамином, причем гибкий линкер помещен между антигеном SNAP-25 и носителем. Предполагается, что в такой вызывающей иммунный ответ композиции могут применяться любые адъюванты, включая, но не ограничиваясь перечисленными: полиэтиленгликоль (ПЭГ), монометоксиполиэтиленгликоль (мПЭГ), поливинилалкоголь (ПВА), полный и неполный адъювант Фрейнда.

[017] Согласно другому аспекту настоящего изобретения предложены способы получения анти-SNAP-25 антител, избирательно связывающихся с эпитопом, содержащим продукт расщепления SNAP-25, карбоксильный конец которого соответствует остатку Pi разрезаемой связи в сайте расщепления токсином BoNT/A. Аспекты настоящего способа включают этапы (а) введения животным композиции, вызывающей иммунный ответ в отношении SNAP-25, которая описана в настоящей заявке; (б) отбор у животных образца, содержащего анти-SNAP-25 антитело или клетку, продуцирующую анти-SNAP-25 антитело; и (в) выделение анти-SNAP-25 антитела из образца. Описанные способы пригодны для получения моноклональных анти-SNAP-25 антител, избирательно связывающихся с эпитопом, содержащим продукт расщепления SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, или поликлональных анти-SNAP-25 антител, избирательно связывающихся с эпитопом, содержащим продукт расщепления SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A.

[018] Согласно еще одному аспекту настоящего изобретения предложены анти-SNAP-25 антитела, избирательно связывающиеся с эпитопом, содержащим SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A. Такие анти-SNAP-25 антитела включают как природные антитела, так и не встречающиеся в природе антитела, а также моноклональные антитела или поликлональные анти-SNAP-25 антитела. Моноклональные анти-SNAP-25 антитела, пригодные в качестве анти-SNAP-25 антител, которые избирательно связываются с антигеном SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, включают, без ограничения, моноклональные анти-SNAP-25 антитела, полученные в гибридомных клеточных линиях 1D3B8, 2С9 В10, 2Е2А6, ЗС1А5 и 3С3Е2.

[019] Согласно еще одному аспекту настоящего изобретения предложены иммунологические способы детектирования активности эндопептидаз с измененной нацеленностью. Аспекты настоящего способа включают этапы (а) обработки клетки из стабильной клеточной линии образцом, содержащим эндопептидазу с измененной нацеленностью, причем клетка из стабильной клеточной линии чувствительна к активности эндопептидазы с измененной нацеленностью; (б) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A; (в) приведения компонента SNAP-25 в контакт с анти-SNAP-25 антителами, описанными в настоящей заявке; и (г) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A; при этом детектирование с использованием комплекса антитело-антиген является показателем активности эндопептидазы с измененной нацеленностью. анти-SNAP-25 антитела с этапа (в) необязательно могут быть связаны с твердофазной подложкой.

[020] Согласно еще одному аспекту настоящего изобретения предложены иммунологические способы детектирования активности опиоидно-TVEMP. Аспекты настоящего способа включают этапы (а) обработки клетки из стабильной клеточной линии образцом, содержащим эндопептидазу с измененной нацеленностью, причем клетка из стабильной клеточной линии обладает способностью к поглощению эндопептидазы с измененной нацеленностью; (б) выделения из обработанных клеток компонента SNAP-25, содержащего SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A; (в) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителами, описанными в настоящей заявке; и (г) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A; при этом детектирование с использованием комплекса антитело-антиген является показателем активности эндопептидазы с измененной нацеленностью. анти-SNAP-25 антитела с этапа (в) необязательно могут быть связаны с твердофазной подложкой.

[021] Согласно дальнейшему аспекту настоящего изобретения предложены способы определения иммунной резистентности млекопитающих по отношению к эндопептидазе с измененной нацеленностью. Аспекты настоящего способа включают этапы (а) добавления эндопептидазы с измененной нацеленностью к тестируемому образцу, полученному из организма млекопитающего, исследуемого на наличие или отсутствие нейтрализующих антител против эндопептидазы с измененной нацеленностью; (б) обработки клетки из стабильной клеточной линии тестируемым образцом, причем клетка из стабильной клеточной линии чувствительна к активности эндопептидазы с измененной нацеленностью; (в) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, карбоксильный конец которого соответствует остатку Р, разрезаемой связи в сайте расщепления токсином BoNT/A; (г) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителами, описанными в настоящей заявке; (д) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A; (е) повторения этапов а-д с образцом для отрицательного контроля вместо тестируемого образца; (ж) сравнения количества комплекса антитело-антиген, детектированного на этапе (д), с количеством комплекса антитело-антиген, детектированным на этапе (е), при этом детекция меньшего количества комплекса антитело-антиген, детектированного на этапе (д), по сравнению с количеством комплекса антитело-антиген, детектированным на этапе (е), свидетельствует о присутствии нейтрализующих антител против эндопептидазы с измененной нацеленностью. Анти-SNAP-25 антитела с этапа (г) необязательно могут быть связаны с твердофазной подложкой. Контрольный образец с этапа (е) может также включать образец для положительного контроля в дополнение к образцу для отрицательного контроля.

[022] Токсины кпостридий, вырабатываемые Clostridium botulinum, Clostridium tetani, Closthdium baratii и Clostridium butyn'cum, являются наиболее широко используемыми в терапевтических и косметических целях у человека и других млекопитающих. Штаммы С.botulinum вырабатывают семь иммунологически отличных серотипов ботулинических токсинов (BoNTs), которые были обнаружены при исследовании вспышек ботулизма у человека (BoNT/A, BoNT/B, BoNT/E и BoNT/F), животных (BoNT/C1 и BoNT/D) или были изолированы из почвы (BoNT/G). Хотя все семь серотипов ботулинического токсина обладают сходной структурой и биологическими свойствами, каждый из них также демонстрирует гетерогенные характеристики, такие как, например, различные фармакологические свойства. Напротив, токсин столбняка (TeNT) вырабатывает однородная группа С.tetani. Два другие вида Clostridia, С.baratii и С.butyricum, также вырабатывают токсины, подобные соответственно BoNT/F и BoNT/E.

[023] Каждый из токсинов клостридий транслируется в виде одной полицепи массой приблизительно 150 кДа, которая впоследствии протеолитически разрезается в пределах дисульфидной петли природной протеазой, такой как, например, эндогенная протеаза токсина клостридий или природной протеазой, вырабатываемой в окружающей среде. Этот посттрансляционный процессинг приводит к образованию молекулы, состоящей из двух цепей и включающей легкую цепь (LC) массой приблизительно 50 кДа и тяжелую цепь (НС) массой приблизительно 100 кДа, удерживаемые вместе единственной дисульфидной связью и нековалентными взаимодействиями. Каждая зрелая двуцепочечная молекула включает три функционально отличных домена: 1) ферментативный домен, расположенный в LC, который включает металлопротеазную область, имеющую цинк-зависимую эндопептидазную активность, специфической мишенью которой являются основные компоненты аппарата высвобождения нейромедиатора; 2) транслокационный домен, который содержится в пределах амино-концевой половины HC (HN) и облегчает высвобождение LC из внутриклеточных пузырьков в цитоплазму клетки-мишени; и 3) связывающий домен, находящийся в пределах карбокси-концевой половины HC (HC), который определяет связывающую активность и специфичность связывания токсина с рецепторным комплексом, расположенным на поверхности клетки-мишени.

[024] Связывающая, транслокационная и ферментативная активности этих трех функциональных доменов необходимы для токсичности. Хотя детали этого процесса еще не известны полностью, общие механизмы клеточной интоксикации, благодаря которым токсины клостридий проникают в нейрон и ингибируют высвобождение нейромедиатора, являются сходными, независимо от серотипа или подтипа. Хотя заявители не подразумевают, что настоящее описание будет ограничивать данное изобретение, механизм интоксикации можно описать как включающий по меньшей мере четыре этапа: 1) связывание рецептора, 2) интернализация комплекса, 3) транслокация легкой цепи и 4) ферментативная модификация мишени (ФИГ.1). Процесс начинается, когда домен НС токсина клостридий связывается с токсин-специфичной рецепторной системой, расположенной на поверхности плазматической мембраны клетки-мишени. Специфичность связывания рецепторного комплекса, как полагают, частично обеспечивается определенными комбинациями ганглиозидов и белковых рецепторов, которые, по-видимому, включают каждый отдельный рецепторный комплекс токсина клостридий. После образования комплекса токсин/рецептор он интернализируется по механизму эндоцитоза, а интернализированные пузырьки направляются по определенным внутриклеточным маршрутам. Предполагают, что этап транслокации инициируется закислением компартмента пузырька. Этот процесс, по-видимому, инициирует важные зависимые от pH структурные перестройки, которые увеличивают гидрофобность, способствуют формированию поры и облегчают разделение тяжелых и легких цепей токсина. После разделения эндопептидаза легкой цепи токсина высвобождается из внутриклеточного пузырька в цитозоль, где, как предполагают, ее специфическими мишенями являются основные компоненты аппарата высвобождения нейромедиатора. Эти основные белки, связанный с пузырьком мембранный белок (VAMP, vesicle-associated membrane рго1ет)/синаптобревин, связанный с синаптосомой белок массой 25 кДа (SNAP-25, synaptosomal-associated protein of 25 kDa) и Синтаксин, необходимы для стыковки синаптических пузырьков и слияния в нервном окончании и являются членами семейства растворимых белковых рецепторов прикрепления N-этилмалеимид-чувствительного фактора (SNARE, soluble N-ethylmaleimide-sensitive factor-attachment protein-receptor). BoNT/A и BoNT/E расщепляют SNAP-25 в карбокси-концевой области, высвобождая фрагмент, состоящий соответственно из девяти или двадцати шести аминокислот, a BoNT/C1 также расщепляет SNAP-25 около карбоксильного конца, высвобождая фрагмент, состоящий из восьми аминокислот. Ботулинические серотипы BoNT/B, BoNT/D, BoNT/F и BoNT/G и токсин столбняка воздействуют на консервативную центральную часть VAMP и высвобождают амино-концевую часть VAMP в цитозоль. BoNT/C1 расщепляет синтаксин в единственном месте около поверхности цитоплазматической мембраны. Избирательный протеолиз синаптических белков SNARE приводит к блокировке высвобождения нейромедиатора, вызываемой токсинами клостридий in vivo. Мишени токсинов клостридий, белки SNARE, характерны для экзоцитоза во множестве типов клеток, не относящихся к нейронам; в этих клетках, как и в нейронах, пептидазная активность легкой цепи ингибирует экзоцитоз, см., например, Yann Humeau et al., How Botulinum and Tetanus Neurotoxins Block Neurotransmitter Release, 82(5) Biochimie. 427-446 (2000); Kathryn Turton et al., Botulinum and Tetanus Neurotoxins: Structure, Function and Therapeutic Utility, 27(11) Trends Biochem. Sci. 552-558. (2002); Giovanna Lalii et al., The Journey of Tetanus and Botulinum Neurotoxins in Neurons, 11(9) Trends Microbiol. 431-437, (2003).

[025] Эндопептидазы с измененной нацеленностью обычно замещают сайт расщепления природных двуцепочечных протеаз с петлевой структурой сайтом расщепления экзогенных протеаз. См., например, Dolly, J.O. et al., Activatable Clostridial Toxins, патент США 7419676, включенный в настоящую заявку посредством ссылки. Хотя эндопептидазы с измененной нацеленностью варьируют по общей молекулярной массе из-за размера нацеливающего домена, процесс активации и его зависимость от расщепления по экзогенному сайту расщепления с образованием двуцепочечной молекулы является, по существу, тем же самым, как и для токсинов клостридий. См., например, Steward, L.E. et al., Activatable Clostridial Toxins, публикация заявки на патент США 2009/0005313; Steward, L.E. et al., Modified Clostridial Toxins with Enhanced Translation Capabilities and Altered Targeting Activity For Non-Closthdial Toxin Target Cells, заявка на патент США 11/776,075; Steward, L.E. et al., Modified Clostridial Toxins with Enhanced Translation Capabilities and Altered Targeting Activity for Clostridial Toxin Target Cells, публикация заявки на патент США 2008/0241881, содержание каждого из которых включено в настоящую заявку посредством ссылки.

[026] Часть аспектов настоящего описания включает вызывающую иммунный ответ композицию для получения анти-SNAP-25 антител, способных избирательно связываться со SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A. В настоящей заявке термин "вызывающая иммунный ответ композиция" относится к композиции, включающей антиген SNAP-25, которая при введении животному стимулирует иммунный ответ в отношении антигена SNAP-25, тем самым приводя к образованию анти-SNAP-25 антител, способных избирательно связываться со SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A. Термин "иммунный ответ" относится к любому ответу иммунной системы животного на вызывающую иммунный ответ композицию. Примеры иммунных ответов включают, но не ограничиваются перечисленными: клеточный, а также местный и системный гуморальный иммунитет, такие как, например, ответы цитолитических лимфоцитов, включая антиген-специфичную индукцию CD8+цитолитических лимфоцитов, ответы Т-клеток-хелперов, включая пролиферативные ответы Т-клеток и высвобождение цитокинов, и ответы В-клеток, включая, например, ответ образования антител. Термин "стимуляция иммунного ответа" относится к введению вызывающей иммунный ответ композиции или полинуклеотида, кодирующего вызывающую иммунный ответ композицию, при котором затронут иммунный ответ, т.е. он стимулируется, инициируется или индуцируется.

[027] Композиция, вызывающая иммунный ответ в отношении SNAP-25, включает антиген SNAP-25. В настоящей заявке термин "антиген" относится к молекуле, которая вызывает иммунный ответ и включает, но не ограничивается перечисленными: пептиды, полисахариды и конъюгаты липидов, такие как, например, липопротеины и гликолипиды. В настоящей заявке термин "антиген SNAP-25" относится к любому антигену, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, способному вызывать иммунный ответ. Антиген SNAP-25, используемый в составе вызывающей иммунный ответ композиции, должен быть достаточно большим для того, чтобы его последовательность являлась по существу уникальной, чтобы обеспечить снижение вероятности получения антител, обладающих перекрестной нацеленностью в отношении антигенов, отличных от SNAP-25. Кроме того, антиген SNAP-25, используемый в составе вызывающей иммунный ответ композиции, должен быть достаточно небольшим для того, чтобы вызывать иммунный ответ существенной интенсивности только против SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, для повышения вероятности получения анти-SNAP-25 антител, способных отличать SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, от SNAP-25, на карбоксильном конце которого отсутствует остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Кроме того, очень желательно также получить с хорошим выходом анти-SNAP-25 антитела одной аминокислотной последовательности, которые воспроизводимо избирательны и связываются с приемлемой авидностью, чтобы сделать возможной разработку высокочувствительного теста.

[028] Последовательность, окружающая сайт расщепления BoNT/A, присутствующий в SNAP-25, обозначена как P5-P4-P3-P2-P1-P1'-P2'-P3'-P4'-P5', где P1-P1' означает разрезаемую связь. После расщепления эндопептидазой с измененной нацеленностью, образующиеся продукты расщепления содержат фрагмент, включающий последовательность P5-P4-P3-P2-P1, и фрагмент, включающий P1'-P2'-P3'-P4'-P5'. Таким образом, в настоящей заявке термин "SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A" относится к любому SNAP-25, у которого карбокси-концевой аминокислотой является остаток Pi. Например, Q197-R198 SNAP-25 человека (SEQ ID NO: 5) представляет собой разрезаемую связь P1-P1' сайта расщепления BoNT/A. В связи с этим "SNAP-25, на карбоксильном конце которого находится глутамин разрезаемой связи в сайте расщепления BoNT/A" является любой продукт расщепления SNAP-25, у которого карбокси-концевой аминокислотой является глутамин, причем глутамин представляет собой Q197 разрезаемой связи. В качестве другого примера можно привести K204-H205 SNAP-25 Torpedo marmorata (SEQ ID NO: 16), который представляет собой разрезаемую связь P1-P1' сайта расщепления BoNT/A. В связи с этим "SNAP-25, на карбоксильном конце которого находится лизин разрезаемой связи в сайте расщепления BoNT/А" является любой продукт расщепления SNAP-25, у которого карбокси-концевой аминокислотой является лизин, причем лизин представляет собой K204 разрезаемой связи.

[029] Антиген SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, можно модифицировать с повышением иммуногенности антигена SNAP-25, гаптена или любого другого антигенного соединения, которое в отсутствие модификации является иммуногенным, неиммуногенным или слабоиммуногенным. Согласно одному аспекту настоящего варианта реализации, карбокси-концевой остаток P1 разрезаемой связи антигена SNAP-25 может карбоксилироваться. Карбоксилирование увеличивает желаемые иммуногенные свойства антигена SNAP-25 в двух отношениях. Во-первых, поскольку заряженные аминокислоты увеличивают иммуногенность, добавление COO--группы к карбокси-концевому остатку увеличит общую иммуногенность антигена SNAP-25. Во-вторых, поскольку остаток P1 разрезаемой связи в сайте расщепления BoNT/A находится в заряженном состоянии после расщепления, добавление COO--группы к карбокси-концевому остатку повысит сходство данного антигена с исходным антигеном, для избирательного связывания с которым разработаны анти-SNAP-25 антитела, описанные в настоящей заявке.

[030] Согласно одному аспекту настоящего варианта реализации, амино-концевой остаток антигена SNAP-25 может быть модифицирован путем добавления аминокислоты, приспособленной для присоединения антигена SNAP-25 к белку-носителю, такому как, например, гемоцианин фиссуреллы (KLH), овальбумин (OVA), тиреоглобулин (THY), бычий сывороточный альбумин (BSA), соевый ингибитор трипсина (STI) или пептид множественного прикрепления (MAP). Например, остаток цистеина может быть помещен на N-конец с тем, чтобы присоединить белок-носитель KLH.

[031] Таким образом, согласно одному варианту реализации, длина антигена SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, может составлять, например, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19, по меньшей мере 20, по меньшей мере 25 или по меньшей мере 30 аминокислот. Согласно другому варианту реализации, длина антигена SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A, может составлять, например, самое большее 5, самое большее 6, самое большее 7, самое большее 8, самое большее 9, самое большее 10, самое большее 11, самое большее 12, самое большее 13, самое большее 14, самое большее 15, самое большее 16, самое большее 17, самое большее 18, самое большее 19, самое большее 20, самое большее 25 или самое большее 30 аминокислот. Согласно еще одному варианту реализации, длина антигена SNAP-25, на карбоксильном конце которого находится остаток pi разрезаемой связи в сайте расщепления BoNT/A, может находиться, например, в пределах 7-12 аминокислот, в пределах 10-15 аминокислот или в пределах 13-18 аминокислот.

[032] Согласно другому варианту реализации, антиген SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, включает SEQ ID NO: 33. Согласно аспектам настоящего варианта реализации, антиген SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, включает SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38 или SEQ ID NO: 39. Согласно дальнейшему варианту реализации, антиген SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A, включает SEQ ID NO: 40.

[033] Согласно еще одному варианту реализации, антиген SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, включает SEQ ID NO: 41. Согласно аспектам настоящего варианта реализации, антиген SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, включает SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 SEQ ID NO: 45, SEQ ID NO: 46. Согласно дальнейшему варианту реализации, антиген SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, включает SEQ ID NO: 47.

[034] Предполагается, что все без исключения антигены SNAP-25, которые вызывают иммунный ответ, приводящий к выработке aHTH-SNAP-25 антител, способных избирательно связываться со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, могут быть пригодны в качестве антигенов SNAP-25. Таким образом, варианты аминокислотных последовательностей, включающие SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45 или SEQ ID NO; 46, могут быть пригодны в качестве антигенов SNAP-25, которые вызывают иммунный ответ, приводящий к выработке анти-SNAP-25 антител, способных избирательно связываться со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Таким образом, согласно одному варианту реализации, антиген SNAP-25 может содержать по меньшей мере 1, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4 или по меньшей мере 5 замен, делеций или инсерций в аминокислотных последовательностях антигенов SNAP-25, включающих SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45 или SEQ ID NO: 46. Согласно еще одному варианту реализации, антиген SNAP-25 может быть по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот антигенам SNAP-25, включающим SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45 или SEQ ID NO: 46.

[035] Предполагается, что с антигеном SNAP-25 может быть связан один или несколько носителей, обеспечивающих повышение иммуногенности антигена SNAP-25, который является иммуногенным, неиммуногенным или слабоиммуногенным в не связанном с носителем виде. Неограничивающие примеры включают, например, гемоцианин фиссуреллы (KLH), овальбумин (OVA), тиреоглобулин (THY), бычий сывороточный альбумин (BSA), соевый ингибитор трипсина (STI) или пептид множественного прикрепления (MAP). Как хорошо известно в данной области техники, неантигенный или слабоантигенный антиген может быть превращен в антигенный путем связывания антигена с носителем. Множество других носителей и способов связывания антигена с носителем хорошо известны в данной области техники. См., например, Harlow and Lane, см. выше, 1998а; Harlow and Lane, см. выше, 1998b; и David W. Waggoner, Jr. et al., Immunogenicity-enhancing carriers and compositions thereof and methods of using the same, публикация заявки на патент США №20040057958 (25 марта 2004 г.). Эпитоп также может быть получен путем экспрессии эпитопа в составе химерного белка. Способы экспрессии химерных полипептидов хорошо известны специалистам в данной области техники, как описано, например, в Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999). Поскольку на карбоксильном конце антигена SNAP-25 должен находиться остаток P1 разрезаемой связи в сайте расщепления BoNT/A, носитель должен быть присоединен к N-концу антигена SNAP-25.

[036] Предполагается, что с антигеном SNAP-25 может быть связан один или несколько гибких спейсеров, повышающих иммуногенность антигена SNAP-25, который является иммуногенным, неиммуногенным или слабоиммуногенным в не связанном с гибкими линкерами виде. Гибкий спейсер увеличивает общую длину пептида антигена SNAP-25 и обеспечивает гибкость, тем самым облегчая надлежащую презентацию антигена SNAP-25 иммуноцитам. В качестве неограничивающего примера, композиция, вызывающая иммунный ответ в отношении SNAP-25, может включать антиген SNAP-25, связанный с одним или несколькими гибкими спейсерами в тандеме для лучшей презентации антигена SNAP-25 иммуноцитам, тем самым облегчая иммунный ответ.

[037] Гибкий спейсер, содержащий пептид, составляет в длину по меньшей мере одну аминокислоту и включает незаряженные аминокислоты с небольшими группами боковых цепей (R), такие как, например, глицин, аланин, валин, лейцин или серин. Таким образом, согласно одному варианту реализации, длина гибкого спейсера может составлять, например, по меньшей мере 1, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9 или по меньшей мере 10 аминокислот. Согласно другому варианту реализации, длина гибкого спейсера может составлять, например, по меньшей мере 1, самое большее 2, самое большее 3, самое большее 4, самое большее 5, самое большее 6, самое большее 7, самое большее 8, самое большее 9 или самое большее 10 аминокислот. Согласно еще одному варианту реализации, длина гибкого спейсера может находиться, например, в пределах 1-3 аминокислот, в пределах 2-4 аминокислот, в пределах 3-5 аминокислот, в пределах 4-6 аминокислот или в пределах 5-7 аминокислот. Неограничивающие примеры гибкого спейсера включают, например, G-спейсеры, такие как GGG, GGGG (SEQ ID NO: 57) и GGGGS (SEQ ID NO: 58), или F-спейсеры, такие как ААА, АААА (SEQ ID NO: 59) и AAAAV (SEQ ID NO: 60). Гибкий спейсер связан с антигеном SNAP-25 в одной рамке считывания в составе химерного белка.

[038] Как отмечалось выше, гибкий спейсер отчасти используют для увеличения общей длины пептида антигена SNAP-25. Например, общую длину антигена SNAP-25 из 5-10 аминокислот можно увеличить путем присоединения гибкого спейсера длиной 3-5 аминокислот к N-концу антигена SNAP-25. В качестве другого примера, общую длину антигена SNAP-25 из 5-10 аминокислот можно увеличить путем присоединения гибкого спейсера длиной 4-6 аминокислот к N-концу антигена SNAP-25. В качестве другого примера, общую длину антигена SNAP-25 из 5-10 аминокислот можно увеличить путем присоединения гибкого спейсера длиной 7-10 аминокислот к N-концу антигена SNAP-25. В качестве другого примера, общую длину антигена SNAP-25 из 7-12 аминокислот можно увеличить путем присоединения гибкого спейсера длиной 1-3 аминокислот к N-концу антигена SNAP-25. В качестве другого примера, общую длину антигена SNAP-25 из 7-12 аминокислот можно увеличить путем присоединения гибкого спейсера длиной 4-6 аминокислот к N-концу антигена SNAP-25. Увеличение длины, обеспечиваемое гибким спейсером, позволяет выбрать антиген SNAP-25 небольшого размера, тем самым увеличивая вероятность того, что антиген SNAP-25 вызывет иммунный ответ существенной интенсивности только против SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, таким образом повышая возможность получения анти-SNAP-25 антител, способных отличать SNAP-25, на карбоксильном конце которого находится остаток pi разрезаемой связи в сайте расщепления BoNT/A, от SNAP-25, на карбоксильном конце которого отсутствует остаток P1 разрезаемой связи в сайте расщепления BoNT/A.

[039] Предполагается, что композиция, вызывающая иммунный ответ в отношении SNAP-25, которая описана в настоящей заявке, может включать антиген SNAP-25, описанный в настоящей заявке, и один или несколько адъювантов. В настоящей заявке термин "адъювант" применительно к композиции, вызывающей иммунный ответ в отношении SNAP-25, относится к любому веществу или смеси веществ, которые увеличивают или разнообразят иммунный ответ на антиген SNAP-25. Вызывающий иммунный ответ адъювант может, например, служить для снижения числа иммунизации или количества антигена, необходимого для защитной иммунизации. Хорошо известно использование вызывающих иммунный ответ адъювантов в составе вызывающей иммунный ответ композиции. Основное назначение этих адъювантов состоит в увеличении иммунного ответа. Неограничивающие примеры адъювантов включают, например, липосомы, масляные фазы, включая, без ограничения, адъюванты типа Фрейнда, такие как, например, полный адъювант Фрейнда (ПАФ); неполный адъювант Фрейнда (НАФ); гликозиды сапогемима, такие как, например, сапонины; карбопол; N-ацетилмурамил-L-аланил-D-изоглутамин (обычно называемый мурамилдипептид или "МДП"); и липополисахариды (ЛПС). Такие адъюванты обычно используют в форме эмульсии, содержащей водную фазу, или чаще могут состоять из не растворимых в воде неорганических солей. Эти неорганические соли могут состоять, например, из гидроксида алюминия, сульфата цинка, коллоидного гидроксида железа, фосфата кальция или хлорида кальция. Гидроксид алюминия (Al(OH)3) является широко используемым адъювантом. В настоящее время единственным адъювантом, одобренным FDA для использования у людей, являются соли алюминия (Alum), которые используются для "депонирования" антигенов посредством их преципитации. Указанные выше адъюванты приведены просто в качестве примеров. Фактически, любой вызывающий иммунный ответ адъювант можно использовать в составе вызывающей иммунный ответ композиции, описанной в настоящей заявке, при условии, что адъювант обладает характеристиками, необходимыми для того, чтобы вызвать иммунный ответ.

[040] Носитель, описанный в настоящей заявке, может также действовать в качестве адъюванта. Конкретные адъюванты и способы их получения и использования описаны, например, в Gupta et al. Vaccine, 11: 993-306, 1993; Arnon, R. (Ed.) Synthetic Vaccines 1:83-92, CRC Press, Inc., Boca Raton, Fla., 1987; и David W. Waggoner, Jr. et al., Immunogenicity-Enhancing Carriers and Compositions Thereof and Methods of Using the Same, публикация патента США №20040057958 (25 марта 2004 г.). Дополнительные адъюванты включают любые соединения, описанные в 7 главе (стр.141-227) "Vaccine Design, The Subunit and Adjuvant Approach" (eds. Powell, M.F. and Newman, M.J.) Pharmaceutical Biotechnology, Volume 6, Plenum Press (New York). Примеры из этого справочника включают мурамилдипептид (МДП) и Монтанид 720. Молекулы, такие как полиинозин:цитозин (polyl:C) или плазмидная ДНК, содержащая мотивы CpG, можно также вводить в качестве адъювантов в комбинации с антигенами, заключенными в микрочастицы. В другом примере адъювант представляет собой агент, который облегчает проникновение антигенного соединения в цитоплазму клетки, такой как листериолизин, стрептолизин или их смесь.

[041] Таким образом, согласно одному варианту реализации, композиция, вызывающая иммунный ответ в отношении SNAP-25, включает антиген SNAP-25, на карбоксильном конце которого находится карбоксилированный остаток глутамина, связанный с пептидом-носителем. Согласно аспектам настоящего варианта реализации, антиген SNAP-25, на карбоксильном конце которого находится карбоксилированный остаток глутамина, включает SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38 или SEQ ID NO: 39. Согласно другому аспекту настоящего варианта реализации, антиген SNAP-25 включает SEQ ID NO: 40. Согласно аспектам настоящего варианта реализации, пептид-носитель представляет собой гемоцианин фиссуреллы (KLH), овальбумин (OVA), тиреоглобулин (THY), бычий сывороточный альбумин (BSA), соевый ингибитор трипсина (STI) или пептид множественного прикрепления (MAP).

[042] Согласно другому варианту реализации, композиция, вызывающая иммунный ответ в отношении SNAP-25, включает антиген SNAP-25, на карбоксильном конце которого находится карбоксилированный остаток лизина, связанный с пептидом-носителем. Согласно аспектам настоящего варианта реализации, антиген SNAP-25, на карбоксильном конце которого находится карбоксилированный остаток лизина, включает SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45 или SEQ ID NO: 46. Согласно другому аспекту настоящего варианта реализации, антиген SNAP-25 включает SEQ ID NO: 47. Согласно аспектам настоящего варианта реализации, пептид-носитель представляет собой гемоцианин фиссуреллы (KLH), овальбумин (OVA), тиреоглобулин (THY), бычий сывороточный альбумин (BSA), соевый ингибитор трипсина (STI) или пептид множественного прикрепления (MAP).

[043] Согласно еще одному варианту реализации, композиция, вызывающая иммунный ответ в отношении SNAP-25, включает антиген SNAP-25, на С-конце которого находится карбоксилированный остаток глутамина, связанный с одним или несколькими гибкими линкерами и пептидом-носителем, причем гибкие линкеры помещены между антигеном SNAP-25 и пептидом-носителем. Согласно аспектам настоящего варианта реализации, антиген SNAP-25, на карбоксильном конце которого находится карбоксилированный остаток глутамина, включает SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38 или SEQ ID NO: 39. Согласно другому варианту реализации, антиген SNAP-25 включает SEQ ID NO: 46. Согласно аспектам настоящего варианта реализации, пептид-носитель представляет собой гемоцианин фиссуреллы (KLH), овальбумин (OVA), тиреоглобулин (THY), бычий сывороточный альбумин (BSA), соевый ингибитор трипсина (STI) или пептид множественного прикрепления (MAP). Согласно аспектам настоящего варианта реализации, гибкий линкер представляет собой G-спейсер или A-спейсер, [044] Согласно еще одному варианту реализации, композиция, вызывающая иммунный ответ в отношении SNAP-25, включает антиген SNAP-25, на С-конце которого находится карбоксилированный остаток лизина, связанный с гибким линкером и пептидом-носителем, причем гибкий линкер помещен между антигеном SNAP-25 и пептидом-носителем. Согласно аспектам настоящего варианта реализации, антиген SNAP-25, на карбоксильном конце которого находится карбоксилированный остаток лизина, включает SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45 или SEQ ID NO: 46. Согласно другому аспекту настоящего варианта реализации, антиген SNAP-25 включает SEQ ID NO: 47. Согласно аспектам настоящего варианта реализации, пептид-носитель представляет собой гемоцианин фиссуреллы (KLH), овальбумин (OVA), тиреоглобулин (THY), бычий сывороточный альбумин (BSA), соевый ингибитор трипсина (STI) или пептид множественного прикрепления (MAP). Согласно аспектам настоящего варианта реализации, гибкий линкер представляет собой G-спейсер или A-спейсер.

[045] Часть аспектов настоящего описания включает способ получения анти-SNAP-25 антител, способных избирательно связываться с SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Анти-SNAP-25 антитела, избирательно связывающиеся с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, можно получить множеством способов, хорошо известных в данной области техники. Конкретные протоколы для получения и использования антител, а также для детектирования и измерения специфичности связывания, аффинности связывания и авидности связывания антител известны в данной области техники. См., например, Antibodies: A Laboratory Manual (Edward Harlow & David Lane, eds., Cold Spring Harbor Laboratory Press, 2nd ed. 1998a); и Using Antibodies: A Laboratory Manual: Portable Protocol No. I (Edward Harlow & David Lane, Cold Spring Harbor Laboratory Press, 1998b); Molecular Cloning, A Laboratory Manual, 2001; и Current Protocols in Molecular Biology, 2004; David Anderson et al., Therapeutic Polypeptides, Nucleic Acids Encoding Same, and Methods of Use, патент США 7034132 (25 апреля 2005 г.); и Beatriz М. Carreno et al., Antibodies Against CTLA4, патент США 7034121 (25 апреля 2006 г.).

[046] В качестве неограничивающего примера можно привести поликлональные анти-SNAP-25 антитела, избирательно связывающиеся со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, которые могут быть получены путем введения животным, таким как, например, кролик, коза, мышь или другие млекопитающие, одной или нескольких инъекций вызывающей иммунный ответ композиции, описанной в настоящей заявке. В качестве другого неограничивающего примера можно привести поликлональные aHTH-SNAP-25 антитела, избирательно связывающиеся со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления ВоМТ/А, которые могут быть получены путем введения в яйцо, такое как, например, куриное яйцо, одной или нескольких инъекций вызывающей иммунный ответ композиции, описанной в настоящей заявке. Титр антител у иммунизированного животного можно контролировать с течением времени стандартными методами, такими как твердофазный иммуноферментный анализ (твердофазный ИФА) с использованием иммобилизованного антигена или тест на активность в клетках. При желании, в качестве анти-SNAP-25 антител, избирательно связывающихся с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, можно использовать поликлональные антитела, которые можно выделить из млекопитающих (например, из крови) и далее очистить с использованием хорошо известных методов, таких как аффинная хроматография с помощью белка А для получения фракции IgG, или с использованием аффинной очистки с помощью пептида, используемого для получения антител.

[047] В качестве другого неограничивающего примера можно привести моноклональные анти-SNAP-25 антитела, избирательно связывающиеся со SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A, которые можно получить с использованием гибридомного способа. См., например, Chapter 6 Monoclonal Antibodies, pp.196-244, Harlow & Lane, см. выше, 1998а; и Chapter 7 Growing Hybridomas, pp.245-282, Harlow & Lane, см. выше, 1998а; и Coding, pp.59-103, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986). Согласно этому способу, животное-хозяин, такое как, например, мышь, хомяк или другое подходящее животное-хозяин, обычно подвергают одной или нескольким инъекциям антигена SNAP-25, описанного в настоящей заявке, для стимуляции образования лимфоцитов, которые производят или способны производить анти-SNAP-25 антитела, избирательно связывающиеся со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Титр антител у иммунизированного животного можно контролировать с течением времени стандартными методами, такими как твердофазный иммуноферментный анализ (твердофазный ИФА) с использованием иммобилизованного антигена или тест на активность в клетках. В качестве альтернативы, лимфоциты можно иммунизировать in vitro с использованием подходящей линии клеточной культуры. В подходящее время после иммунизации, например, когда титр антител является наивысшим, клетки, производящие антитела, выделяют из животного. В целом, используют либо лимфоциты периферической крови, если требуются клетки человеческого происхождения, либо клетки селезенки или клетки лимфатического узла, если в качестве источников необходимы млекопитающие, отличные от человека. Выделенные клетки, производящие антитела, объединяют с иммортализованной клеточной линией, используя подходящий агент, стимулирующий слияние клеток, такой как полиэтиленгликоль, с получением клетки гибридомы. Иммортализованные клеточные линии обычно представляют собой трансформированные клетки млекопитающих, в частности клетки миеломы грызунов, крупного рогатого скота и человека. Как правило, клеточную линию миеломы мыши объединяют со спленоцитами, собранными из соответствующим образом иммунизированной мыши, для получения гибридомы. Предпочтительные иммортализованные клеточные линии представляют собой клеточные линии миеломы мыши, которые чувствительны к культуральной среде, содержащей гипоксантин, аминоптерин и тимидин (ГАТ). Любую из множества клеточных линий миеломы можно использовать в качестве партнера для слияния согласно стандартным методам, например, линии миеломы P3-NS1/1-Ag4-1, P3-x63-Ag8.653 или Sp2/O-Ag14. Клетки гибридомы, образующиеся в результате слияния, затем отбирают с помощью среды ГАТ, на которой погибают клетки миеломы, которые не прошли слияние или прошли непродуктивное слияние (не прошедшие слияние спленоциты погибают в культуре после нескольких дней, поскольку они не трансформированы). Культуральную среду, в которой выращивают клетки гибридомы, можно затем протестировать на присутствие моноклональных анти-SNAP-25 антител, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления ВоМТ/А. Например, можно провести скрининг супернатантов гибридомы с использованием a-SNAP-25-позитивных сред путем иммунопреципитации, анализа связывания in vitro, такого как, например, радиоиммунологический анализ (РИА) или твердофазный иммуноферментный анализ (твердофазный ИФА), или теста на активность в клетках. Подобные методы и тесты известны в данной области техники. См., например, Chapter 11 Immunoprecipitation, pp.421-470, Harlow & Lane, см. выше, 1998а; Chapter 12 Immunoblotting, pp.471-510, Harlow & Lane, см. выше, 1998а; Chapter 14 Immunoassays, pp.553-612, Harlow & Lane, см. выше, 1998а. Затем можно провести дополнительные исследования, чтобы определить, отсутствует ли у антител реактивность также по отношению к SNAP-25, на карбоксильном конце которого отсутствует остаток P1 разрезаемой связи в сайте расщепления ВоМТ/А. Можно также определить аффинность связывания моноклональных анти-SNAP-25 антител, например, с помощью анализа Скэтчарда. См., например, Peter J. Munson and David Rodbard, Ligand: A Versatile Computerized Approach For Characterization of Ligand-Binding Systems, 107(1) Anal. Biochem, 220-239 (1980). После идентификации искомых клеток гибридомы используют метод предельных разведении для изоляции клонов, происходящих из единственной клетки, до получения клональной клеточной линии, экспрессирующей требуемые моноклональные антитела. Эти антитела, которые проявляют существенную избирательность в отношении SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, и связываются с достаточно высокой авидностью, отбирают для дальнейшей характеризации и исследования.

[048] Другой альтернативой для получения моноклональных анти-8ЫАР-25 антител, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, является скрининг рекомбинантной комбинаторной библиотеки иммуноглобулинов, такой как, например, библиотека антител на основе фагового дисплея, с помощью пептида SNAP-25 и идентификация компонентов библиотеки иммуноглобулинов, которые связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Наборы для конструирования и скрининга библиотек на основе фагового дисплея коммерчески доступны, например, Рекомбинантная Фаговая Система Антител (Amersham GE Healthcare, Пискэтэуэй, Нью-Джерси) и Набор для Фагового Дисплея SurfZAP™ (Stratagene, Ла-Хойя, Калифорния). Кроме того, примеры способов и реагентов, подходящих для получения и скрининга библиотеки антител на основе дисплея, можно найти, например, в Ladner et al., патент США 5223409; Borrebaeck et al., патент США 5712089; Griffiths et al., патент США 5885793; Griffiths et al., патент США 5962255; McCafferty et al., патент США 5969108; Griffiths et al., патент США 6010884; Jespers et al., патент США 6017732; Borrebaeck et al., патент США 6027930; Johnson et al., патент США 6140471; McCafferty et al., патент США 6172197, содержание каждого из которых полностью включено в настоящую заявку посредством ссылки.

[049] Часть аспектов настоящего описания включает сбор образца, содержащего анти-SNAP-25 антитела или клетки, производящие анти-SNAP-25 антитела. В настоящей заявке термин "образец, содержащий анти-SNAP-25 антитела или клетки, производящие анти-SNAP-25 антитела", относится к любому биологическому материалу, который содержит или потенциально содержит по меньшей мере одно антитело α-SNAP-25, которое избирательно связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Предполагается, что все без исключения образцы, которые могут содержать анти-SNAP-25 антитела, избирательно связывающиеся с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, можно использовать в этом способе, включая, без ограничения, кровь, плазму, сыворотку и лимфатическую жидкость. Также предполагается, что любая клетка, способная вырабатывать анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, можно использовать в этом способе, включая, без ограничения, клетки CD8, клетки ЦТЛ, Т-клетки-хелперы и В-клетки. Для получения из особи образца, содержащего анти-SNAP-25 антитела или клетки, производящие анти-SNAP-25 антитела, можно использовать множество хорошо известных способов, см., например, Harlow & Lane, см. выше, 1998а; и Harlow & Lane, см. выше, 1998b. Сходным образом, множество хорошо известных способов можно использовать для обработки образца с целью выделения анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Процедуру сбора образца можно выбрать исходя из типа антител, которые необходимо выделить. В качестве неограничивающего примера, при выделении поликлональных анти-SNAP-25 антител, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, подходящий образец может представлять собой образец крови, содержащий такие анти-SNAP-25 антитела, тогда как при выделении моноклональных анти-SNAP-25 антител, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, подходящий образец может представлять собой клетку, производящую aHTH-SNAP-25 антитела, такую как клетка селезенки или гибридома.

[050] Часть аспектов настоящего описания включает выделение из образца анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Способы выделения таких анти-SNAP-25 антител, таких как, например, поликлональные анти-SNAP-25 антитела, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, или моноклональные анти-SNAP-25 антитела, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления ВоМТ/А, хорошо известны специалистам в данной области техники. См., например, Harlowand Lane, см. выше, 1998а; и Harlow and Lane, см. выше, 1998b. Например, такие поликлональные анти-SNAP-25 антитела можно выделить из образца с помощью хорошо известных методов, таких как, например, аффинная хроматография с использованием белка А или белка G, которая позволяет выделить главным образом фракцию IgG иммунной сыворотки. Впоследствии, или в качестве альтернативы, конкретный антиген SNAP-25 можно иммобилизировать на колонке или магнитных шариках для очистки поликлональных анти-SNAP-25 антител, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A, с помощью иммуноаффинной хроматографии. Моноклональные анти-SNAP-25 антитела, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, можно выделить из культуральной среды или асцитной жидкости с помощью обычных процедур для очистки иммуноглобулинов, таких как, например, белок А-сефароза, хроматография с гидроксилапатитом, гель-электрофорез, диализ или аффинная хроматография.

[051] Таким образом, согласно одному варианту реализации, способ получения анти-SNAP-25 антител, которые способны избирательно связываться со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, включает этапы (а) введения животному композиции, вызывающей иммунный ответ в отношении SNAP-25, которая включает антиген SNAP-25, на С-конце которого находится карбоксилированный остаток глутамина, связанный с пептидом-носителем; (б) отбор у животного образца, содержащего анти-SNAP-25 антитела или клетки, производящие анти-SNAP-25 антитела; и (в) выделение компонентов анти-SNAP-25 антител из образца. Согласно одному аспекту настоящего варианта реализации, анти-SNAP-25 антитела, которые способны избирательно связываться со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, являются поликлональными антителами. Согласно другому аспекту настоящего варианта реализации, анти-SNAP-25 антитела, которые способны избирательно связываться со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, являются моноклональными антителами. Согласно дальнейшему аспекту настоящего варианта реализации, получаемые моноклональные анти-SNAP-25 антитела, которые способны избирательно связываться со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления ВоМТ/А, относятся к подтипу IgG. Согласно другим аспектам настоящего варианта реализации, композиция, вызывающая иммунный ответ в отношении SNAP-25, дополнительно содержит адъювант, такой как, например, полиэтиленгликоль (ПЭГ), монометоксиполиэтиленгликоль (мПЭГ) или поливинилалкоголь (ПВА).

[052] Согласно другому варианту реализации, способ получения анти-SNAP-25 антител, которые способны избирательно связываться со SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A, включает этапы (а) введения животному композиции, вызывающей иммунный ответ в отношении SNAP-25, которая включает пептид SNAP-25, на С-конце которого находится карбоксилированный остаток глутамина, связанный с гибким линкером и пептидом-носителем, причем гибкий линкер помещен между пептидом SNAP-25 и пептидом-носителем; (б) отбор у животного образца, содержащего анти-SNAP-25 антитела или клетки, производящие анти-SNAP-25 антитела; и (в) выделение анти-SNAP-25 антител из образца. Согласно одному аспекту настоящего варианта реализации, анти-SNAP-25 антитела, которые способны избирательно связываться со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, являются поликлональными антителами. Согласно другому аспекту настоящего варианта реализации, анти-SNAP-25 антитела, которые способны избирательно связываться со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, являются моноклональными антителами. Согласно дальнейшему аспекту настоящего варианта реализации, получаемые моноклональные анти-SNAP-25 антитела, которые способны избирательно связываться со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, относятся к подтипу IgG. Согласно другим аспектам настоящего варианта реализации, композиция, вызывающая иммунный ответ в отношении SNAP-25, дополнительно содержит адъювант, такой как, например, полиэтиленгликоль (ПЭГ), монометоксиполиэтиленгликоль (мПЭГ) или поливинилалкоголь (ПВА).

[053] Часть аспектов настоящего описания включает изолированные aHTH-SNAP-25 антитела которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. В настоящей заявке термин "антитело" относится к молекуле, вырабатываемой иммунной системой, которая продуцируется в ответ на определенный антиген и которая специфично связывается с этим антигеном, и охватывает как природные антитела, так и не встречающиеся в природе антитела. В настоящей заявке термин "изолированный" относится к выделению молекулы из ее естественного окружения в результате вмешательства человека. Например, антитело может быть поликлональным антителом, моноклональным антителом, димером, мультимером, мультиспецифическим антителом, гуманизированным антителом, химерным антителом, бифункциональным антителом, связанным с клеткой антителом, как ИГ рецептор, линейным антителом, диателом или миниантителом, если фрагмент демонстрирует желаемую биологическую активность, и их производными, состоящими из одной цепи. Антитело может представлять собой полноразмерную молекулу иммуноглобулина, включая домены VH и VL, а также константный домен легкой цепи (CL) и константные домены тяжелой цепи, CH1, CH2 и CH3, или иммунологически активный фрагмент полноразмерной молекулы иммуноглобулина, такой как, например, Fab-фрагмент, F(ab')2-фрагмент, Fc-фрагмент, Fd-фрагмент, Fv-фрагмент. Антитело может быть получено от любых видов позвоночных (например, человека, козы, лошади, осла, мыши, крысы, кролика или курицы) и может принадлежать к любому типу (например, IgG, IgE, IgM, IgD и IgA), классу (например, IgA, IgD, IgE, IgG и IgM) или подклассу (IgG1, IgG2, IgGS, IgG4, IgA1 и IgA2). Общее описание структуры природных антител, не встречающихся в природе антител и их фрагментов, связывающих соединения антигенов можно найти, например, у Pluckthun в The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg и Moore eds., Springer-Verlag, New York, pp.269-315 (1994); Borrabeck, Antibody Engineering. 2d ed. (Oxford University Press 1995), содержание каждого из которых полностью включено в настоящую заявку посредством ссылки.

[054] Природные антитела обычно представляют собой гетеротетрамерные гликопротеины массой около 150000 дальтон, состоящие из двух идентичных легких (L) цепей и двух идентичных тяжелых (Н) цепей. Каждая легкая цепь связана с тяжелой цепью одной ковалентной дисульфидной связью, при этом число дисульфидных связей варьирует для тяжелых цепей различных иммуноглобулиновых изотипов. Каждая тяжелая и легкая цепь также содержит расположенные с равными интервалами дисульфидные мостики внутри цепи. На одном конце каждой тяжелой цепи находится вариабельный домен (VH), за которым следует несколько константных доменов. У каждой легкой цепи на одном конце находится вариабельный домен (VL), а на другом конце - константный домен. Константный домен легкой цепи расположен напротив первого константного домена тяжелой цепи, а вариабельный домен легкой цепи расположен напротив вариабельного домена тяжелой цепи. Определенные остатки аминокислот, как полагают, формируют область контакта между вариабельными доменами легкой и тяжелой цепи.

[055] Полные антигенраспознающая и антигенсвязывающая области содержатся в пределах вариабельных доменов антитела, т.е. Fv-фрагмента. Этот фрагмент включает димер одного вариабельного домена тяжелой цепи (VH) и одного вариабельного домена легкой цепи (VL), которые находятся в плотном нековалентном взаимодействии. Каждый домен включает четыре каркасные области (FR), которые в значительной степени принимают конфигурацию β-слоев, связанные тремя гипервариабельными участками, которые формируют петли, соединяющие и в некоторых случаях являющиеся частью β-слойной структуры. Каждый гипервариабельный участок включает последовательность аминокислот, соответствующую участку, определяющему комплиментарность (CDR). В совокупности, эта трехмерная конфигурация шести CDR формирует антигенсвязывающий участок на поверхности димера VH-VL, который определяет специфичность связывания антигена. См., например, Cyrus Chothia, et al., Conformations of Immunoglobulin Hypeivanable Regions, Nature 342(6252): 877-883 (1989); Elvin A. Kabat, et al Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991), каждый из которых полностью включен в настоящую заявку посредством ссылки. Константные домены антител непосредственно не участвуют в связывании антитела с антигеном, но демонстрируют различные эффекторные функции, такие как участие антитела в антителозависимой клеточно-опосредованной цитотоксичности.

[056] Антиген-мишень обычно имеет один или несколько участков связывания, также называемых эпитопами, которые распознаются антигенсвязывающими участками, образованными CDR. В настоящей заявке термин "эпитоп" является синонимом термина "антигенная детерминанта" и относится к участку антигена-мишени, такого как, например, пептида, полисахарида или липидсодержащей молекулы, способному специфически связываться с иммуноглобулином или рецептором Т-лимфоцитов или иным образом взаимодействующему с молекулой. Антитела, которые специфически связываются с различными эпитопами, имеют различную структуру. Таким образом, одному антигену может соответствовать более одного антитела.

[057] Термин «поликлональные антитела» относится к гетерогенной популяции молекул антител, которая содержит по меньшей мере два вида антител, способных связываться с конкретным антигеном. По определению, поликлональные антитела включают два различных антитела, которые связываются по меньшей мере с двумя различными эпитопами. В настоящей заявке термины "моноклональное антитело" или "моноклональные антитела" относятся к по существу гомогенной степени популяции молекул антител, которая содержит только один вид антител, способных связываться с конкретным антигеном, т.е. индивидуальные антитела, составляющие популяцию, идентичны, за исключением возможных природных мутаций, которые могут присутствовать в малых количествах. По определению, моноклональные антитела связываются с единственным эпитопом. Моноклональные антитела высокоспецифичны и направлены против одного участка антигена. Более того, в отличие от поликлональных антител, каждое моноклональное антитело направлено против единственной антигенной детерминатны. Помимо специфичности, преимуществом моноклональных антител является возможность синтезировать их в отсутствие загрязнения другими антителами. Определение "моноклональные" отражает особенность данных антител, заключающуюся в том, что они получены из гомогенной в значительной степени популяции антител, и не должно пониматься как требование, чтобы анитела были получены каким-либо конкретным способом. Например, моноклональные антитела для применения в соответствии с настоящей заявкой можно получить гибридомным способом, впервые описанным Kohler et al (1975) Nature 256:495, или с помощью способа, основанного на использовании технологий рекомбинантной ДНК (см., например, патент США №4816567; патент США №5807715). Моноклональные антитела также можно выделить из фаговых библиотек антител с использованием методов, описанных, например, в Clackson et al (1991) Nature, 352:624-628; Marks et al (1991) J. Mol. Biol., 222:581-597.

[058] Таким образом, согласно одному варианту реализации, анти-SNAP-25 антитела включают вариабельный домен тяжелой цепи (VH) и вариабельный домен легкой цепи (VL), которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Согласно одному аспекту настоящего варианта реализации, вариабельный домен тяжелой цепи (VH) представляет собой SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 82 или SEQ ID NO: 133. Согласно другому аспекту настоящего варианта реализации, вариабельный домен легкой цепи (VL) представляет собой SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90 или SEQ ID NO: 92.

[059] Согласно другому варианту реализации, последовательность нуклеиновой кислоты кодирует анти-SNAP-25 антитела, включающие вариабельный домен тяжелой цепи (VH) и вариабельный домен легкой цепи (VL), которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Согласно одному аспекту настоящего варианта реализации, вариабельный домен тяжелой цепи (VH) кодирует последовательность нуклеиновой кислоты SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81 или SEQ ID NO: 132. Согласно другому аспекту настоящего варианта реализации, вариабельный домен тяжелой цепи (VH) кодирует последовательность нуклеиновой кислоты, которая по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентична SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81 или SEQ ID NO: 132. Согласно еще одному аспекту настоящего варианта реализации, вариабельный домен легкой цепи (VL) кодирует SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89 или SEQ ID NO: 91. Согласно еще одному аспекту настоящего варианта реализации, вариабельный домен легкой цепи (VL) кодирует последовательность нуклеиновой кислоты, которая по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентична SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89 или SEQ ID NO: 91.

[060] Согласно другому варианту реализации, анти-SNAP-25 антитела включают участки CDR1, CDR2 и CDR3 вариабельного домена тяжелой цепи (VH) или любые их комбинации, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Согласно одному аспекту настоящего варианта реализации, участок CDR1 вариабельного домена тяжелой цепи (VH) представляет собой SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 118, SEQ ID NO: 119 или SEQ ID NO: 120. Согласно другому аспекту настоящего варианта реализации, участок CDR2 вариабельного домена тяжелой цепи (VH) представляет собой SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 121, SEQ ID NO: 122 или SEQ ID NO: 123. Согласно еще одному аспекту настоящего варианта реализации, участок CDR3 вариабельного домена тяжелой цепи (VH) представляет собой SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 124, SEQ ID NO: 134 или SEQ ID NO: 135.

[061] Согласно другому варианту реализации, анти-SNAP-25 антитела включают участки CDR1, CDR2 и CDR3 вариабельного домена легкой цепи (VL) или любые их комбинации, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток Р1 разрезаемой связи в сайте расщепления BoNT/A. Согласно одному аспекту настоящего варианта реализации, участок CDR1 вариабельного домена легкой цепи (VL) представляет собой SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128 или SEQ ID NO: 129. Согласно другому аспекту настоящего варианта реализации, участок CDR2 вариабельного домена легкой цепи (VL) представляет собой SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111 или SEQ ID NO: 112. Согласно еще одному аспекту настоящего варианта реализации, участок CDR3 вариабельного домена легкой цепи (VL) представляет собой SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116 или SEQ ID NO: 117.

[062] Согласно еще одному варианту реализации, анти-SNAP-25 антитела специфически связываются с эпитопом, содержащим SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Согласно одному аспекту настоящего варианта реализации, эпитоп включает SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 или SEQ ID NO: 37. Согласно одному аспекту настоящего варианта реализации, эпитоп включает SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 или SEQ ID NO: 44.

[063] Как обсуждалось выше, последовательность, окружающая сайт расщепления BoNT/A, присутствующий в SNAP-25, обозначена как P5-P43211'-Р2'-Р3'-Р4'-Р5', где P1-P1' означает разрезаемую связь. После расщепления BoNT/A образующиеся продукты расщепления содержат фрагмент, включающий последовательность P5-P4-P3-P2-P1, и фрагмент, включающий P1'-P2'-P3'-P4'-P5'. В настоящей заявке термин анти-SNAP-25 антитела, которые специфически связываются со SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A" относится к антителам α-SNAP-25, которые специфически связываются с любым фрагментом продукта расщепления SNAP-25, содержащим последовательность Р54321. но не с любым фрагментом продукта расщепления SNAP-25, содержащим последовательность Р1'-Р2'-Р3'-Р4'-Р5', или любым SNAP-25, у которого присутствует в интактном виде разрезаемая связь P1-P1' в сайте расщепления BoNT/A. В настоящей заявке термин "анти-SNAP-25 антитела197" относится к антителам, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1, соответствующий глутамину 197 из SEQ ID NO: 5. В настоящей заявке термин "анти-SNAP-25 антитела204" относится к антителам, которые избирательно связываются со SNAP-25, на карбоксильном конце которого находится остаток P1, соответствующий лизину 204 из SEQ ID NO: 16.

[064] В настоящей заявке термин "избирательно" относится к уникальному эффекту или влиянию или способности реагировать только одним определенным образом или только с одним определенным партнером. В настоящей заявке термин "избирательно связывается" или "избирательное связывание" в отношении антител относится к селективному связыванию антител с указанным эпитопом-мишенью, такому, что антитела существенным образом не проявляют перекрестной реактивности по отношению к эпитопам, не являющимся мишенями. Согласно настоящей заявке минимальный размер пептидного эпитопа составляет около пяти аминокислот, и пептидный эпитоп, как правило, содержит по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15 или по меньшей мере 20 аминокислот. Пептидный эпитоп может быть прерывистым, т.е. содержать остатки аминокислот, которые расположены не рядом друг с другом в первичной структуре пептида, но объединены в эпитоп посредством вторичной, третичной или четвертичной структуры пептида. Кроме того, отмечают, что эпитоп может включать часть молекулы, не являющуюся последовательностью аминокислот, как, например, углеводную группу, липидную группу, как у липопротеинов или гликолипидов, или химически модифицированную аминокислотную группу, например, фосфорилированную аминокислоту. Согласно некоторым аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток Р, разрезаемой связи в сайте расщепления BoNT/A, способны избирательно связываться с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, который включает по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15 или по меньшей мере 20 аминокислот. Согласно другим аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления ВоМТ/А, способны избирательно связываться с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, который включает самое большее 5, самое большее 6, самое большее 7, самое большее 8, самое большее 9, самое большее 10, самое большее 15 или самое большее 20 аминокислот.

[065] Избирательное связывание включает такие свойства связывания, как например аффинность связывания, специфичность связывания и авидность связывания. См. David J. King, Applications and Engineering of Monoclonal Antibodies, pp.240 (1998). Аффинность связывания относится к длительности нахождения антитела в сайте связывания соответствующего эпитопа, и ее можно рассматривать как силу, с которой антитело связывается со своим эпитопом. Аффинность связывания можно описать с помощью равновесной константы диссоциации антитела (KD), которая определяется как отношение Kd/Ka в состоянии равновесия, где Ka представляет собой константу скорости ассоциации антитела, a Kd - константу скорости диссоциации антитела. Аффинность связывания определяется как ассоциацией, так и диссоциацией, и по отдельности ни высокая степень ассоциации, ни низкая степень диссоциации не может гарантировать высокую аффинность. Константа скорости ассоциации (Ka), или константа скорости прямой реакции (Kon), является мерой числа событий связывания за единицу времени или склонности антитела и антигена подвергаться обратимой ассоциации с образованием комплекса антитело-антиген. Константа скорости ассоциации выражается в М-1с-1 и обозначается следующим образом: [Ab]×[Ag]×Kon. Чем больше константа скорости ассоциации, тем быстрее антитело связывается с антигеном или тем выше аффинность связывания между антителом и антигеном. Константа скорости диссоциации (Kd), или константа скорости обратной реакции (Koff), является мерой числа событий диссоциации за единицу времени или склонности комплекса антитело-антиген обратимо разделяться (диссоциировать) на молекулярные компоненты, а именно антитело и антиген. Константа скорости диссоциации выражается в с-1 и обозначается следующим образом: [Ab+Ag]×Koff. Чем меньше константа скорости диссоциации, тем более прочно антитело связано с антигеном или тем выше аффинность связывания между антителом и антигеном. Равновесная константа диссоциации (KD) является мерой скорости, с которой образуются новые комплексы антитело-антиген, равной скорости, с которой комплексы антитело-антиген подвергаются диссоциации, в равновесном состоянии. Равновесная константа диссоциации выражается в М и определяется как Koff/Kon=[Ab]×[Ag]/[Ab+Ag], где [Ab] соответствует молярной концентрации антитела, [Ag] соответствует молярной концентрации антигена, a [Ab+Ag] соответствует молярной концентрации комплекса антитело-антиген, при этом все концентрации соответствуют равновесному состоянию. Чем меньше равновесная константа диссоциации, тем более прочно антитело связано с антигеном или тем выше аффинность связывания между антителом и антигеном.

[066] Таким образом, согласно одному варианту реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления ВоМТ/А, может характеризоваться константой скорости ассоциации, которая составляет, например, менее 1×105 М-1 с-1, менее 1×106 М-1 с-1, менее 1×107 М-1 с-1 или менее 1×108 М-1 с-1. Согласно другому варианту реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться константой скорости ассоциации, которая составляет, например, более 1×105 М-1 с-1, более 1×106 М-1 с-1, более 1×107 М-1 с-1 или более 1×108 М-1 с-1. Согласно другим аспектам, аффинность связывания aHTH-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток Р, разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться константой скорости ассоциации, которая находится в диапазоне от 1×105 М-1 с-1 до 1×108 М-1 с1, от 1×106 М-1 с-1 до 1×108 М-1 с-1, от 1×105 М-1 с-1 до 1×107 М-1 с-1 или от 1×106 М-1 с-1 до 1×107 М-1 с-1.

[067] Согласно другому варианту реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться константой скорости диссоциации, которая составляет менее 1×10-3 с-1, менее 1×10-4 с-1 или менее 1×10-5 с-1. Согласно другим аспектам настоящего варианта реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться константой скорости диссоциации, которая составляет, например, менее 1,0×10-4 с-1, менее 2,0×10-4 с-1, менее 3,0×10-4 с-1, менее 4,0×10-4 с-1, менее 5,0×10-4 с-1, менее 6,0×10-4 с-1, менее 7,0×10-4 с-1, менее 8,0×10-4 с-1 или менее 9,0×10-4 с-1. Согласно другому варианту реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться константой скорости диссоциации, которая составляет, например, более 1×10-3 с-1, более 1×10-4 с-1 или более 1×10-5 с-1. Согласно другим аспектам настоящего варианта реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться константой скорости диссоциации, которая составляет, например, более 1,0×10-4 с-1, более 2,0×10-4 с-1, более 3,0×10-4 с-1, более 4,0×10-4 с-1, более 5,0×10-4 с-1, более 6,0×10-4 с-1, более 7,0×10-4 с-1, более 8,0×10-4 с-1 или более 9,0×10-4 с-1.

[068] Согласно другому варианту реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться равновесной константой диссоциации, которая составляет менее 0,500 нМ. Согласно аспектам настоящего варианта реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться равновесной константой диссоциации, которая составляет, например, менее 0,500 нМ, менее 0,450 нМ, менее 0,400 нМ, менее 0,350 нМ, менее 0,300 нМ, менее 0,250 нМ, менее 0,200 нМ, менее 0,150 нМ, менее 0,100 нМ или менее 0,050 нМ. Согласно другому варианту реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться равновесной константой диссоциации, которая составляет более 0,500 нМ. Согласно аспектам настоящего варианта реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться равновесной константой диссоциации, которая составляет, например, более 0,500 нМ, более 0,450 нМ, более 0,400 нМ, более 0,350 нМ, более 0,300 нМ, более 0,250 нМ, более 0,200 нМ, более 0,150 нМ, более 0,100 нМ или более 0,050 нМ.

[069] Согласно еще одному варианту реализации, аффинность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться константой скорости ассоциации для интактного SNAP-25, которая составляет, например, менее 1×100 М-1 с-1, менее 1×101 М-1 с-1, менее 1×102 М-1 с-1, менее 1×103 М-1 с-1 или менее 1×104 М-1 с-1. Согласно другому варианту реализации, аффинность связывания am-n-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, может характеризоваться константой скорости ассоциации для интактного SNAP-25, которая составляет, например, не более 1×100 М-1 с-1, не более 1×101 М-1 с-1, не более 1×102 М-1 с-1, не более 1×103 М-1 с-1 или не более 1×104 М-1 с-1.

[070] Специфичность связывания представляет собой способность антител отличать молекулы, содержащие эпитоп данного антитела, от молекул, не содержащих этот эпитоп. Одним из способов измерения специфичности связывания является сравнение скорости ассоциации антитела Коп для молекулы, содержащей эпитоп данного антитела, со скоростью ассоциации антитела Kon для молекулы, которая не содержит этот эпитоп. Например, сравнение константы скорости ассоциации (Ka) анти-SNAP-25 антител для эпитопа SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, со SNAP-25, не содержащим этот эпитоп, таким как, например, эпитоп SNAP-25, на карбоксильном конце которого отсутствует остаток P1 разрезаемой связи в сайте расщепления BoNT/A, или эпитоп SNAP-25, содержащий интактную разрезаемую связь P1-P1' в сайте расщепления BoNT/A. Согласно аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, характеризуются константой скорости ассоциации (Ka) для SNAP-25, не содержащего соответствующий эпитоп(ы), которая составляет, например, менее 1×100 М-1 с-1, менее 1×101 М-1 с-1, менее 1×102 М-1 с-1, менее 1×103 М-1 с-1 или менее 1×104 М-1 с-1. Согласно другим аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, характеризуются константой скорости ассоциации (Ka) для SNAP-25, не содержащего соответствующий эпитоп(ы), которая составляет, например, не более 1×100 М-1 с-1, не более 1×101 М-1 с-1, не более 1×102 M-1 c-1, не более 1×103 M-1 c-1 или не более 1×104 M-1 c-1.

[071] Согласно другим аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A, характеризуются константой скорости ассоциации (Ka) для соответствующего им эпитопа, которая, например, по меньшей мере в 2 раза, по меньшей мере в 3 раза, по меньшей мере в 4 раза, по меньшей мере в 5 раз, по меньшей мере в 6 раз, по меньшей мере в 7 раз, по меньшей мере в 8 раз или по меньшей мере в 9 раз больше по сравнению со значением для SNAP-25, не содержащего этот эпитоп .Согласно дальнейшим аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, характеризуются константой скорости ассоциации (Ka) для соответствующего им эпитопа, которая, например, по меньшей мере в 10 раз, по меньшей мере в 100 раз, по меньшей мере в 1000 раз или по меньшей мере в 10000 раз больше по сравнению со значением для SNAP-25, не содержащего этот эпитоп. Согласно другим аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, характеризуются константой скорости ассоциации (Ka) для соответствующего им эпитопа, которая, например, не более чем однократно, не более чем в 2 раза, не более чем в 3 раза, не более чем в 4 раза, не более чем в 5 раз, не более чем в 6 раз, не более чем в 7 раз, не более чем в 8 раз или не более чем в 9 раз превышает значение для SNAP-25, не содержащего этот эпитоп. Согласно другим аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, характеризуются константой скорости ассоциации (Ka) для соответствующего им эпитопа, которая, например, не более чем в 10 раз, не более чем в 100 раз, не более чем в 1000 раз или не более чем в 10000 раз превышает значение для SNAP-25, не содержащего этот эпитоп.

[072] Специфичность связывания анти-SNAP-25 антител, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, можно также охарактеризовать как отношение, с которым данные анти-SNAP-25 антитела способны отличать соответствующий им эпитоп SNAP-25 от SNAP-25, не содержащих этот эпитоп, таких как, например, эпитоп SNAP-25, на карбоксильном конце которого отсутствует остаток Pi разрезаемой связи в сайте расщепления BoNT/A, или эпитоп SNAP-25, содержащий интактную разрезаемую связь P1-P1' в сайте расщепления BoNT/A. Согласно аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, характеризуются отношением специфичности связывания соответствующего эпитопа SNAP-25 по сравнению со связыванием SNAP-25, не содержащих этот эпитоп, составляющим, например, по меньшей мере 2:1, по меньшей мере 3:1, по меньшей мере 4:1, по меньшей мере 5:1, по меньшей мере 64:1, по меньшей мере 7:1, по меньшей мере 8:1, по меньшей мере 9:1, по меньшей мере 10:1, по меньшей мере 15:1, по меньшей мере 20:1, по меньшей мере 25:1, по меньшей мере 30:1, по меньшей мере 35:1 или по меньшей мере 40:1. Согласно другим аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, характеризуются отношением специфичности связывания соответствующего эпитопа SNAP-25 по сравнению со связыванием SNAP-25, на карбоксильном конце которого отсутствует остаток P1 разрезаемой связи в сайте расщепления BoNT/A, составляющим, например, по меньшей мере 2:1, по меньшей мере 3:1, по меньшей мере 4:1, по меньшей мере 5:1, по меньшей мере 6:1, по меньшей мере 7:1, по меньшей мере 8:1, по меньшей мере 9:1, по меньшей мере 10:1, по меньшей мере 15:1, по меньшей мере 20:1, по меньшей мере 25:1, по меньшей мере 30:1, по меньшей мере 35:1 или по меньшей мере 40:1. Согласно другим аспектам настоящего варианта реализации, анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, характеризуются отношением специфичности связывания соответствующего эпитопа SNAP-25 по сравнению со связыванием SNAP-25, содержащего интактную разрезаемую связь P1-P1' в сайте расщепления BoNT/A, составляющим, например, по меньшей мере 2:1, по меньшей мере 3:1, по меньшей мере 4:1, по меньшей мере 5:1, по меньшей мере 6:1, по меньшей мере 7:1, по меньшей мере 8:1, по меньшей мере 9:1, по меньшей мере 10:1, по меньшей мере 15:1, по меньшей мере 20:1, по меньшей мере 25:1, по меньшей мере 30:1, по меньшей мере 35:1 или по меньшей мере 40:1.

[073] Авидность связывания, также известная как функциональная аффинность, относится к суммарной общей силе функционального связывания антигена мультивалентным антителом. Молекулы антитела могут иметь более одного участка связывания (например, 2 в случае IgG, 10 в случае IgM), и многие антигены содержат более одного антигенного участка. В то время как авидность антитела зависит от аффинностей связывания индивидуальных участков связывания антитела, авидность связывания превышает аффинность связывания, т.к. для полной диссоциации антитела от антигена необходим одновременный разрыв всех взаимодействий антитело-антиген. Предполагается, что анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, способны избирательно связываться всеми без исключения эпитопами, соответствующими данным антителам.

[074] Таким образом, согласно одному варианту реализации, анти-SNAP-25 антитела представляют собой анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Согласно аспектам настоящего варианта реализации, анти-SNAP-25 антитела представляют собой анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится глутамин, или анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится лизин. Согласно другим аспектам настоящего варианта реализации, анти-SNAP-25 антитела представляют собой анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1, соответствующий глутамину 197 из SEQ ID NO: 5, или анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1, соответствующий лизину 204 из SEQ ID NO: 16. Согласно другим аспектам настоящего варианта реализации, анти-SNAP-25 антитела представляют собой анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится последовательность аминокислот из SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45 или SEQ ID NO: 46.

[075] Часть аспектов настоящего описания включает иммунологический способ детектирования активности эндопептидаз с измененной нацеленностью. Иммунологические способы, описанные в настоящей заявке, можно оценивать с помощью нескольких параметров, включая, например, погрешность, разброс результатов, предел детектирования (ПД), пределы количественного измерения (ПКИ), диапазон, специфичность, избирательность, линейность, надежность и пригодность системы. Погрешность способа является мерой точности аналитического метода или близости соответствия между измеренным значением и значением, которое принято в качестве действительного значения или опорного значения. Разброс результатов способа представляет собой степень соответствия между результатами индивидуальных тестов, повторно проведенных на многократных пробах, взятых из гомогенного образца. В связи с этим, рассеяние результатов является оценкой 1) изменчивости в пределах одного теста; 2) изменчивости в пределах одного дня (повторяемости); и 3) изменчивости между разными днями (внутрилабораторной погрешности); и 4) межлабораторной изменчивости (воспроизводимости). Коэффициент вариации (CV%) является количественным показателем разброса результатов, выраженным относительно наблюдаемого или теоретического среднего значения.

[076] Иммунологический способ, описанный в настоящей заявке, должен быть способен детектировать присутствие комплекса антитело α-SNAP-25-антиген, включающего SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, с учетом фона. Предел детектирования (ПД) способа относится к концентрации анализируемого вещества, которое вызывает появление сигнала, значительно отличающегося от отрицательного контроля или холостой пробы и соответствующего наименьшей концентрации анализируемого вещества, которую можно отличить от фона.

[077] Таким образом, согласно одному варианту реализации, иммунологический способ, описанный в настоящей заявке, способен детектировать ПД эндопептидаз с измененной нацеленностью в количестве, которое значительно отличается от отрицательного контроля или холостой пробы. Согласно одному аспекту настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПД, например, 10 нг или менее, 9 нг или менее, 8 нг или менее, 7 нг или менее, 6 нг или менее, 5 нг или менее, 4 нг или менее, 3 нг или менее, 2 нг или менее, 1 нг или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПД, например, 900 пг или менее, 800 пг или менее, 700 пг или менее, 600 пг или менее, 500 пг или менее, 400 пг или менее, 300 пг или менее, 200 пг или менее, 100 пг или менее эндопептидазы с измененной нацеленностью. Согласно дальнейшим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПД, например, 90 пг или менее, 80 пг или менее, 70 пг или менее, 60 пг или менее, 50 пг или менее, 40 пг или менее, 30 пг или менее, 20 пг или менее, 10 пг или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПД, например, 9 пг или менее, 8 пг или менее, 7 пг или менее, 6 пг или менее, 5 пг или менее, 4 пг или менее, 3 пг или менее, 2 пг или менее, 1 пг или менее эндопептидазы нацеленностьюс измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПД, например, 0,9 пг или менее, 0,8 пг или менее, 0,7 пг или менее, 0,6 пг или менее, 0,5 пг или менее, 0,4 пг или менее, 0,3 пг или менее, 0,2 пг или менее, 0,1 пг или менее эндопептидазы с измененной нацеленностью.

[078] Согласно другому аспекту настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПД, например, 100 нМ или менее, 90 нМ или менее, 80 нМ или менее, 70 нМ или менее, 60 нМ или менее, 50 нМ или менее, 40 нМ или менее, 30 нМ или менее, 20 нМ или менее, 10 нМ или менее, 9 нМ или менее, 8 нМ или менее, 7 нМ или менее, 6 нМ или менее, 5 нМ или менее, 4 нМ или менее, 3 нМ или менее, 2 нМ или менее или 1 нМ или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПД, например, 900 пМ или менее, 800 пМ или менее, 700 пМ или менее, 600 пМ или менее, 500 пМ или менее, 400 пМ или менее, 300 пМ или менее, 200 пМ или менее или 100 пМ или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПД, например, 100 пМ или менее, 90 пМ или менее, 80 пМ или менее, 70 пМ или менее, 60 пМ или менее, 50 пМ или менее, 40 пМ или менее, 30 пМ или менее, 20 пМ или менее или 10 пМ или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПД, например, 10 пМ или менее эндопептидазы с измененной нацеленностью, 9 пМ или менее, 8 пМ или менее, 7 пМ или менее, 6 пМ или менее, 5 пМ или менее, 4 пМ или менее, 3 пМ или менее, 2 пМ или менее или 1 пМ или менее эндопептидазы с измененной нацеленностью.

[079] Пределы количественного измерения (ПКИ) представляют собой наименьшие и наибольшие концентрации анализируемого вещества в образце или препарате, которые можно измерить с допустимым уровнем погрешности и разброса результатов. Нижний предел количественного измерения относится к наименьшей дозе, которую метод детектирования способен единообразно измерять на уровне фона. Верхний предел количественного измерения представляет собой наибольшую дозу, которую метод детектирования способен единообразно измерять до наступления насыщения сигнала. Линейный диапазон способа представляет собой область между нижним и верхним пределом количественного измерения. Линейный диапазон вычисляют путем вычитания нижнего предела количественного измерения из верхнего предела количественного измерения. В настоящей заявке термин "отношение сигнала к шуму для нижней асимптоты" относится к сигналу, детектируемому данным способом на нижнем пределе детектирования, деленному на фоновый сигнал. В настоящей заявке термин "отношение сигнала к шуму для верхней асимптоты" относится к сигналу, детектируемому данным способом на верхнем пределе детектирования, деленному на фоновый сигнал.

[080] Таким образом, согласно одному варианту реализации, иммунологический способ, описанный в настоящей заявке, способен детектировать ПКИ эндопептидазы с измененной нацеленностью в количестве, которое значительно отличается от отрицательного контроля или холостой пробы. Согласно одному аспекту настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПКИ, например, 10 нг или менее, 9 нг или менее, 8 нг или менее, 7 нг или менее, 6 нг или менее, 5 нг или менее, 4 нг или менее, 3 нг или менее, 2 нг или менее, 1 нг или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПКИ, например, 900 пг или менее, 800 пг или менее, 700 пг или менее, 600 пг или менее, 500 пг или менее, 400 пг или менее, 300 пг или менее, 200 пг или менее, 100 пг или менее эндопептидазы с измененной нацеленностью. Согласно дальнейшим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПКИ, например, 90 пг или менее, 80 пг или менее, 70 пг или менее, 60 пг или менее, 50 пг или менее, 40 пг или менее, 30 пг или менее, 20 пг или менее, 10 пг или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПКИ, например, 9 пг или менее, 8 пг или менее, 7 пг или менее, 6 пг или менее, 5 пг или менее, 4 пг или менее, 3 пг или менее, 2 пг или менее, 1 пг или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПКИ, например, 0,9 пг или менее, 0,8 пг или менее, 0,7 пг или менее, 0,6 пг или менее, 0,5 пг или менее, 0,4 пг или менее, 0,3 пг или менее, 0,2 пг или менее, 0,1 пг или менее эндопептидазы с измененной нацеленностью.

[081] Согласно другому аспекту настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПКИ, например, 100 нМ или менее, 90 нМ или менее, 80 нМ или менее, 70 нМ или менее, 60 нМ или менее, 50 нМ или менее, 40 нМ или менее, 30 нМ или менее, 20 нМ или менее, 10 нМ или менее, 9 нМ или менее, 8 нМ или менее, 7 нМ или менее, 6 нМ или менее, 5 нМ или менее, 4 нМ или менее, 3 нМ или менее, 2 нМ или менее или 1 нМ или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПКИ, например, 900 пМ или менее, 800 пМ или менее, 700 пМ или менее, 600 пМ или менее, 500 пМ или менее, 400 пМ или менее, 300 пМ или менее, 200 пМ или менее или 100 пМ или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПКИ, например, 100 пМ или менее, 90 пМ или менее, 80 пМ или менее, 70 пМ или менее, 60 пМ или менее, 50 пМ или менее, 40 пМ или менее, 30 пМ или менее, 20 пМ или менее или 10 пМ или менее эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется ПКИ, например, 10 пМ или менее эндопептидазы с измененной нацеленностью, 9 пМ или менее, 8 пМ или менее, 7 пМ или менее, 6 пМ или менее, 5 пМ или менее, 4 пМ или менее, 3 пМ или менее, 2 пМ или менее или 1 пМ или менее эндопептидазы с измененной нацеленностью.

[082] В иммунологическом тесте, подходящем для применения в практическом аспекте описанных способов, должен наблюдаться разброс результатов, не превышающий 50%. Согласно аспектам настоящего варианта реализации, в иммунологическом тесте наблюдается разброс результатов, не превышающий 50%, не превышающий 40%, не превышающий 30% или не превышающий 20%. Согласно другим аспектам настоящего варианта реализации, в иммунологическом тесте наблюдается разброс результатов, не превышающий 15%, не превышающий 10% или не превышающий 5%. Согласно другим аспектам настоящего варианта реализации, в иммунологическом тесте наблюдается разброс результатов, не превышающий 4%, не превышающий 3%, не превышающий 2% или не превышающий 1%.

[083] Иммунологический тест, подходящий для применения в осуществлении описанных способов, должен иметь точность по меньшей мере 50%. Согласно аспектам настоящего варианта реализации, иммунологический тест имеет точность по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70% или по меньшей мере 80%. Согласно другим аспектам настоящего варианта реализации, иммунологический тест имеет точность по меньшей мере 85%, по меньшей мере 90% или по меньшей мере 95%. Согласно другим аспектам настоящего варианта реализации, иммунологический тест имеет точность по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98% или по меньшей мере 99%.

[084] Иммунологический способ, описанный в настоящей заявке, должен характеризоваться статистически значимым отношением сигнала к шуму для нижней асимптоты и статистически значимым отношением сигнала к шуму для верхней асимптоты. Согласно аспектам настоящего варианта реализации, иммунологический способ, описанный в настоящей заявке, характеризуется отношением сигнала к шуму для нижней асимптоты, составляющим, например, по меньшей мере 3:1, по меньшей мере 4:1, по меньшей мере 5:1, по меньшей мере 6:1, по меньшей мере 7:1, по меньшей мере 8:1, по меньшей мере 9:1, по меньшей мере 10:1, по меньшей мере 15:1 или по меньшей мере 20:1. Согласно другим аспектам настоящего варианта реализации, иммунологический способ характеризуется отношением сигнала к шуму для верхней асимптоты, составляющим, например, по меньшей мере 10:1, по меньшей мере 15:1, по меньшей мере 20:1, по меньшей мере 25:1, по меньшей мере 30:1, по меньшей мере 35:1, по меньшей мере 40:1, по меньшей мере 45:1, по меньшей мере 50:1, по меньшей мере 60:1, по меньшей мере 70:1, по меньшей мере 80:1, по меньшей мере 90:1 или по меньшей мере 100:1, по меньшей мере 150:1, по меньшей мере 200:1, по меньшей мере 250:1, по меньшей мере 300:1, по меньшей мере 350:1, по меньшей мере 400:1, по меньшей мере 450:1, по меньшей мере 500:1, по меньшей мере 550:1 или по меньшей мере 600:1.

[085] Специфичность способа определяет способность способа измерять представляющее интерес анализируемое вещество, за исключением других сопутствующих компонентов, таких как, например, частично активное или неактивное анализируемое вещество. Селективность способа описывает способность аналитического метода различать различные вещества в образце. Линейность способа соответствует его способности давать результаты, которые напрямую, или с помощью однозначно определенного математического преобразования, пропорциональны концентрации анализируемого вещества в образце. Таким образом, согласно одному варианту реализации, иммунологический способ, описанный в настоящей заявке, способен отличать полностью активную эндопептидазу с измененной нацеленностью от частично активной эндопептидазы с измененной нацеленностью, обладающей, например, 70% или менее, 60% или менее, 50% или менее, 40% или менее, 30% или менее, 20% или менее или 10% или менее активности полностью активной эндопептидазы с измененной нацеленностью.

[086] Надежность способа представляет собой воспроизводимость результатов теста, полученных для идентичных образцов при нормальных (но изменяющихся) условиях теста. Устойчивость процедуры является мерой ее способности оставаться невосприимчивой в отношении небольших, но намеренных изменений параметров способа и представляет собой показатель его надежности при нормальном использовании. Таким образом, в то время как надежность оценивает неизбежные изменения, устойчивость оценивает намеренные изменения. Типичные параметры, оцениваемые с помощью показателей надежности и устойчивости, включают эффекты замораживания/оттаивания, времени инкубации, температуры инкубации, долговечности реагента, приготовления образца, хранения образца, числа клеточных пассажей, партии эндопептидазы с измененной нацеленностью, изменчивости между очистками и изменчивости между реакциями расщепления. Параметры устойчивости для клеточных тестов включают банк клеток (начало, середина и конец замораживания), уровень клеточного пассажа, плотность высева клеток, плотность маточного раствора клеток (количество дней в культуре), возраст клеток во флаконе (время ожидания до высева), время инкубации, различия между планшетами, чрезмерные количества сыворотки и источник реагентов. Пригодность системы данного способа определяет эксплуатационные качества теста во времени, включая эксплуатационные качества реагентов и инструментов, путем анализа эталонного стандарта или эталонной молекулы. Пригодность системы в руководстве FDA выделена в том отношении, что оборудование, электроника, эксплуатационные качества теста и образцы для анализа составляют единую систему. Пригодность системы можно оценить путем анализа на параллелизм, который заключается в том, что при построении графика зависимости ответа от логарифма дозы кривые графиков серийных разведении эталона и серийных разведении образцов должны быть параллельны.

[087] Часть аспектов настоящего описания относится к клетке из стабильной клеточной линии. В настоящей заявке термин "клетка" относится к любой эукариотической клетке, чувствительной к активности эндопептидаз с измененной нацеленностью, или любой эукариотической клетке, которая способна поглощать эндопептидазы с измененной нацеленностью. Термин "клетка" охватывает клетки из множества организмов, такие как, например, клетки мышей, крыс, свиней, крупного рогатого скота, лошадей, приматов и человека; из множества типов клеток, таких как, например, нервные и не относящиеся к нервным; и клетки, которые могут быть изолированы из гетерогенной популяции клеток, ткани или организма (целого или их части). В настоящей заявке термин "стабильная клеточная линия" является синонимом терминов "иммортализованная клеточная линия" или "трансформированная клеточная линия" и относится к культуре клеток, отобранных для неограниченного деления из популяции клеток, полученной из организма, ткани или органа-источника. По определению, стабильная клеточная линия не включает клеточную культуру первичных клеток. В настоящей заявке термин "первичные клетки" включает клетки, собранные непосредственно из свежих тканей или органов и не обладающие потенциалом неограниченного деления. Стабильная клеточная линия может включать гетерогенную популяцию клеток или однородную популяцию клеток. Стабильная клеточная линия, полученная из единственной клетки, называется клональной клеточной линией. Стабильная клеточная линия может представлять собой линию клеток, которые эндогенно экспрессируют все компоненты, необходимые для функционирования всего клеточного механизма, посредством которого эндопептидаза с измененной нацеленностью протеолитически расщепляет субстрат SNAP-25 и который включает связывание эндопептидазы с измененной нацеленностью с соответствующим рецептором, интернализацию комплекса эндопептидаза/рецептор, транслокацию легкой цепи эндопептидазы с измененной нацеленностью из внутриклеточного пузырька в цитоплазму и протеолитическое расщепление SNAP-25. В качестве альтернативы, стабильная клеточная линия может представлять собой линию клеток, в которые из внешнего источника был введен по меньшей мере один компонент, необходимый для полного функционирования клеточного механизма, посредством которого эндопептидаза с измененной нацеленностью протеолитически расщепляет субстрат SNAP-25 и который включает связывание эндопептидазы с измененной нацеленностью с соответствующим рецептором, интернализацию комплекса эндопептидаза/рецептор, транслокацию легкой цепи эндопептидазы с измененной нацеленностью из внутриклеточного пузырька в цитоплазму и протеолитическое расщепление SNAP-25. Клетки такой стабильной клеточной линии, также называемой генетически модифицированной клеточной линией, могут, например, экспрессировать экзогенную эндопептидазу с измененной нацеленностью, такую как, например, экзогенный ORL1, экзогенный DOR, экзогенный KOR, экзогенный MOR, экзогенный рецептор Галанина 1, экзогенный рецептор Галанина 2, экзогенный рецептор Галанина 3 или любую их комбинацию.

[088] Часть аспектов настоящей заявки включает клетку из стабильной клональной клеточной линии, чувствительную к активности эндопептидаз с измененной нацеленностью. В настоящей заявке термин "клетка(ки), чувствительные к активности эндопептидаз с измененной нацеленностью", "клетка(ки), чувствительные к активности эндопептидаз с измененной нацеленностью с помощью эндопептидаз с измененной нацеленностью" или "клетка(ки) из стабильной клональной клеточной линии, чувствительные к активности эндопептидаз с измененной нацеленностью с помощью эндопептидаз с измененной нацеленностью" относятся к клетке(кам), в которых может полностью функционировать клеточный механизм, посредством которого эндопептидаза с измененной нацеленностью протеолитически расщепляет субстрат SNAP-25, что приводит к ингибированию экзоцитоза, и который включает связывание эндопептидазы с измененной нацеленностью с соответствующим рецептором, интернализацию комплекса эндопептидаза/рецептор, транслокацию цепи эндопептидазы с измененной нацеленностью, обеспечивающей ее активность, из внутриклеточного пузырька в цитоплазму и протеолитическое расщепление SNAP-25. По определению, клетка(ки), чувствительная(ые) к активности эндопептидаз с измененной нацеленностью, должна(ы) экспрессировать, или быть сконструирована(ы) с обеспечением экспрессии, по меньшей мере один рецептор эндопептидазы с измененной нацеленностью и по меньшей мере один субстрат SNAP-25. В настоящей заявке термины "клетка(ки), способная поглощать эндопептидазы с измененной нацеленностью" или "клетка(ки), включающая стабильную клональную клеточную линию, которая может поглощать эндопептидазы с измененной нацеленностью" относятся к клеткам, в которых может полностью функционировать клеточный механизм, посредством которого эндопептидаза с измененной нацеленностью протеолитически расщепляет субстрат SNAP-25, тем самым ингибируя экзоцитоз, и который включает связывание эндопептидазы с измененной нацеленностью с соответствующим рецептором, интернализацию комплекса эндопептидаза/рецептор, транслокацию легкой цепи эндопептидазы с измененной нацеленностью из внутриклеточного пузырька в цитоплазму и протеолитическое расщепление SNAP-25. По определению, клетка(ки), способная поглощать эндопептидазы с измененной нацеленностью, должна экспрессировать, или быть сконструирована с обеспечением экспрессии, по меньшей мере один рецептор эндопептидазы с измененной нацеленностью и по меньшей мере один субстрат SNAP-25.

[089] Таким образом, согласно одному варианту реализации, клетки из стабильной клональной клеточной линии чувствительны к активности эндопептидаз с измененной нацеленностью. Согласно некоторым аспектам этого варианта реализации, клетки из стабильной клональной клеточной линии чувствительны к активности эндопептидаз с измененной нацеленностью при концентрации эндопептидазы с измененной нацеленностью, например, около 100 нМ или ниже, около 90 нМ или ниже, около 80 нМ или ниже, около 70 нМ или ниже, около 60 нМ или ниже, около 50 нМ или ниже, около 40 нМ или ниже, около 30 нМ или ниже, около 20 нМ или ниже или около 10 нМ или ниже. Согласно другим аспектам, клетки из стабильной клональной клеточной линии чувствительны к активности эндопептидаз с измененной нацеленностью при концентрации эндопептидазы с измененной нацеленностью, например, около 9 нМ или ниже, около 8 нМ или ниже, около 7 нМ или ниже, около 6 нМ или ниже, около 5 нМ или ниже, около 4 нМ или ниже, около 3 нМ или ниже, около 2 нМ или ниже или около 1 нМ или ниже. Согласно прочим аспектам, клетки из стабильной клональной клеточной линии чувствительны к активности эндопептидаз с измененной нацеленностью при концентрации эндопептидазы с измененной нацеленностью, например, около 0,9 нМ или ниже, около 0,8 нМ или ниже, около 0,7 нМ или ниже, около 0,6 нМ или ниже, около 0,5 нМ или ниже, около 0,4 нМ или ниже, около 0,3 нМ или ниже, около 0,2 нМ или около 0,1 нМ или ниже. В настоящей заявке термин "около" или "приблизительно" при количественной характеристике упоминаемого объекта, числа, процента или термина относится к диапазону плюс или минус десять процентов указанного значения количественной характеристики этого объекта, процента, параметра или термина.

[090] Согласно другому варианту реализации, клетки, включающие стабильную клональную клеточную линию, способны поглощать эндопептидазы с измененной нацеленностью. Согласно аспектам этого варианта реализации, клетки, включающие стабильную клональную клеточную линию, способны поглощать, например, около 100 нМ или меньше, около 90 нМ или меньше, около 80 нМ или меньше, около 70 нМ или меньше, около 60 нМ или меньше, около 50 нМ или меньше, около 40 нМ или меньше, около 30 нМ или меньше, около 20 нМ или меньше, около 10 нМ или меньше эндопептидазы с измененной нацеленностью. Согласно другим аспектам, клетки, включающие стабильную клональную клеточную линию, обладают способностью поглощать около 9 нМ или меньше, около 8 нМ или меньше, около 7 нМ или меньше, около 6 нМ или меньше, около 5 нМ или меньше, около 4 нМ или меньше, около 3 нМ или меньше, около 2 нМ или меньше или около 1 нМ или меньше эндопептидазы с измененной нацеленностью. Согласно другим аспектам, клетки, включающие стабильную клональную клеточную линию, обладают способностью поглощать около 0,9 нМ или меньше, около 0,8 нМ или меньше, около 0,7 нМ или меньше, около 0,6 нМ или меньше, около 0,5 нМ или меньше, около 0,4 нМ или меньше, около 0,3 нМ или меньше, около 0,2 нМ или меньше или около 0,1 нМ или меньше эндопептидазы с измененной нацеленностью.

[091] Часть аспектов настоящего описания относится к клеткам из стабильной клеточной линии, демонстрирующим избирательное связывание эндопептидаз с измененной нацеленностью, описанных в настоящей заявке. В настоящей заявке термин "избирательно связывается" или "избирательное связывание" в отношении эндопептидаз с измененной нацеленностью относится к исключительному связыванию эндопептидазы с измененной нацеленностью с указанным рецептором-мишенью, такому, что эндопептидаза с измененной нацеленностью существенным образом не связывается с рецепторами, которые не являются мишенями. Степень, с которой клетки из стабильной клеточной линии демонстрируют избирательное связывание эндопептидаз с измененной нацеленностью, можно измерить с помощью степени, с которой эти клетки демонстрируют неизбирательное поглощение молекул, у которых отсутствует нацеливающий домен эндопептидаз с измененной нацеленностью. Одним из способов оценки неизбирательного поглощения молекул, у которых отсутствует нацеливающий домен эндопептидаз с измененной нацеленностью, является измерение неизбирательного поглощения фрагмента LHN. Фрагмент LHN содержит транслокационный домен токсина клостридий и ферментативный домен токсина клостридий, но не содержит какого-либо нацеливающего домена. Неограничивающие примеры фрагментов LHN включают фрагмент LHN/A, фрагмент LHN/В, фрагмент LHN/C, фрагмент LHN/D, фрагмент LHN/E, фрагмент LHN/F и фрагмент LHN/G. Примером фрагмента LHN/A является SEQ ID NO: 146, который кодируется молекулой полинуклеотида SEQ ID NO: 147.

[092] Таким образом, согласно одному варианту реализации, клетки из стабильной клеточной линии демонстрируют избирательное связывание эндопептидаз с измененной нацеленностью. Согласно аспектам настоящего варианта реализации, клетки из стабильной клеточной линии демонстрируют избирательное связывание эндопептидазы с измененной нацеленностью, которая соответствует, например, по меньшей мере 75% общей активности, выявленной в тесте, по меньшей мере 80% общей активности, выявленной в тесте, по меньшей мере 85% общей активности, выявленной в тесте, по меньшей мере 90% общей активности, выявленной в тесте, или по меньшей мере 95% общей активности, выявленной в тесте. Согласно другим аспектам настоящего варианта реализации, клетки из стабильной клеточной линии демонстрируют избирательное связывание эндопептидазы с измененной нацеленностью, которая соответствует, например, приблизительно от 75% до 100% общей активности, выявленной в тесте, приблизительно от 80% до 100% общей активности, выявленной в тесте, приблизительно от 85% до 100% общей активности, выявленной в тесте, приблизительно от 90% до 100% общей активности, выявленной в тесте.

[093] Согласно другому варианту реализации, клетки из стабильной клеточной линии демонстрируют минимальное неизбирательное поглощение фрагмента LHN. Согласно аспектам настоящего варианта реализации, клетки из стабильной клеточной линии демонстрируют неизбирательное поглощение фрагмента LHN, которое составляет, например, не более 25% общего поглощения, выявленного в тесте, не более 20% общего поглощения, выявленного в тесте, не более 15% общего поглощения, выявленного в тесте, не более 10% общего поглощения, выявленного в тесте, или не более 5% общего поглощения, выявленного в тесте. Согласно другим аспектам настоящего варианта реализации, клетки из стабильной клеточной линии демонстрируют неизбирательное поглощение фрагмента LHN, которое составляет, например, приблизительно от 0% до 25% общего поглощения, выявленного в тесте, приблизительно от 0% до 20% общего поглощения, выявленного в тесте, приблизительно от 0% до 15% общего поглощения, выявленного в тесте, приблизительно от 0% до 10% общего поглощения, выявленного в тесте, или приблизительно от 0% до 5% общего поглощения, выявленного в тесте.

[094] Согласно еще одному варианту реализации, клетки из стабильной клеточной линии демонстрируют минимальное неизбирательное поглощение фрагмента LHN/A. Согласно аспектам настоящего варианта реализации, клетки из стабильной клеточной линии демонстрируют неизбирательное поглощение фрагмента LHN/A, которое составляет, например, не более 25% общего поглощения, выявленного в тесте, не более 20% общего поглощения, выявленного в тесте, не более 15% общего поглощения, выявленного в тесте, не более 10% общего поглощения, выявленного в тесте, или не более 5% общего поглощения, выявленного в тесте. Согласно другим аспектам настоящего варианта реализации, клетки из стабильной клеточной линии демонстрируют неизбирательное поглощение фрагмента LHN/A, которое составляет, например, приблизительно от 0% до 25% общего поглощения, выявленного в тесте, приблизительно от 0% до 20% общего поглощения, выявленного в тесте, приблизительно от 0% до 15% общего поглощения, выявленного в тесте, приблизительно от 0% до 10% общего поглощения, выявленного в тесте, или приблизительно от 0% до 5% общего поглощения, выявленного в тесте.

[095] Часть аспектов настоящего описания относится к клеткам из стабильной клеточной линии, экспонирующим достаточное число рецепторных участков связывания на плазматической мембране, что обеспечивает чувствительное и избирательное связывание эндопептидаз с измененной нацеленностью. В тесте связывания с равновесным насыщением измеряют полное и неспецифическое связывание лиганда при различных концентрациях. Равновесная константа диссоциации (Kd) лиганда и максимальное число рецепторных участков связывания, Bmax, можно вычислить на основании данных по специфическому связыванию с использованием нелинейного регрессионного анализа. Специфическое связывание вычисляют путем вычитания неспецифического связывания лиганда из наблюдаемого общего связывания. Kd представляет собой концентрацию лиганда, необходимую для достижения половины максимального значения связывания, и измеряется в единицах молярной концентрации. Bmax представляет собой максимальное число участков связывания, присутствующих на плазматической мембране, и измеряется в единицах пмоль/мг, пмоль/клетка, фмоль/клетка или сайты/клетка.

[096] Таким образом, согласно одному варианту реализации, клетки из стабильной клеточной линии экспонируют достаточное число рецепторных сайтов связывания на плазматической мембране, что обеспечивает чувствительное и избирательное связывание эндопептидаз с измененной нацеленностью. Согласно аспектам настоящего варианта реализации, клетки из стабильной клеточной линии демонстрируют значение Bmax, составляющее, например, по меньшей мере 0,1 фмоль/клетку, по меньшей мере 0,2 фмоль/клетку, по меньшей мере 0,3 фмоль/клетку, по меньшей мере 0,4 фмоль/клетку, по меньшей мере 0,5 фмоль/клетку, по меньшей мере 0,6 фмоль/клетку, по меньшей мере 0,7 фмоль/клетку, по меньшей мере 0,8 фмоль/клетку, по меньшей мере 0,9 фмоль/клетку или по меньшей мере 1,0 фмоль/клетку для направления лиганда эндопептидазы с измененной нацеленностью. Согласно другим аспектам настоящего варианта реализации, клетки из стабильной клеточной линии демонстрируют значение Bmax, составляющее, например, по меньшей мере 1 фмоль/клетку, по меньшей мере 2 фмоль/клетку, по меньшей мере 3 фмоль/клетку, по меньшей мере 4 фмоль/клетку, по меньшей мере 5 фмоль/клетку, по меньшей мере 6 фмоль/клетку, по меньшей мере 7 фмоль/клетку, по меньшей мере 8 фмоль/клетку, по меньшей мере 9 фмоль/клетку или по меньшей мере 10 фмоль/клетку для направления лиганда эндопептидазы с измененной нацеленностью.

[097] Часть аспектов настоящего описания включает клетки из стабильной клональной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, которые более стабильны, чем клетки из родительской клеточной линии, из которой была получена клональная клеточная линия. В настоящей заявке термин "стабильный" относится к клеткам из стабильной клональной клеточной линии, которые после определенного количества пассажей демонстрируют относительную EC50, чувствительность, эффективность, четко выраженную верхнюю асимптоту и/или четко выраженную кривую доза-эффект активности эндопептидазы с измененной нацеленностью, сходные со значениями относительной EC50, чувствительности, эффективности, четко выраженной верхней асимптоты и/или четко выраженной кривой доза-эффект, демонстрируемыми клетками из родительской клеточной линии, из которой была получена клональная клеточная линия, после равного или близкого количества пассажей, причем в обоих тестах используются идентичные условия и идентичные эндопептидазы с измененной нацеленностью.

[098] Таким образом, согласно одному варианту реализации, клетки из стабильной клональной клеточной линии более стабильны, чем клетки из родительской клеточной линии, из которой была получена клональная клеточная линия. Согласно одному аспекту этого варианта реализации, клетки из стабильной клональной клеточной линии более стабильны, чем родительская клеточная линия SK-N-DZ. Согласно другим аспектам этого варианта реализации, клетки из стабильной клональной клеточной линии более стабильны, чем родительская клеточная линия SK-N-DZ ATCC CRL-2149. Согласно другим аспектам этого варианта реализации, клетки из стабильной клональной клеточной линии более стабильны в течение, например, по меньшей мере еще 5 пассажей, по меньшей мере еще 10 пассажей, по меньшей мере еще 15 пассажей, по меньшей мере еще 20 пассажей, по меньшей мере еще 25 пассажей или по меньшей мере еще 30 пассажей по сравнению с клетками из родительской клеточной линии, из которой была получена клональная клеточная линия. Согласно другим аспектам этого варианта реализации, клетки из стабильной клональной клеточной линии более стабильны в течение, например, по меньшей мере еще 5 пассажей, по меньшей мере еще 10 пассажей, по меньшей мере еще 15 пассажей, по меньшей мере еще 20 пассажей, по меньшей мере еще 25 пассажей или по меньшей мере еще 30 пассажей по сравнению с клетками из родительской клеточной линии, из которой была получена клональная клеточная линия.

[099] Часть аспектов настоящего описания включает клетки из стабильной клональной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, которые стабильны в течение множества клеточных пассажей. В настоящей заявке термин "стабильный" относится к клеткам из стабильной клональной клеточной линии, которые после определенного количества пассажей демонстрируют относительную EC50, чувствительность, эффективность, четко выраженную верхнюю асимптоту и/или четко выраженную кривую доза-эффект активности эндопептидазы с измененной нацеленностью, сходные со значениями относительной EC50, чувствительности, эффективности, четко выраженной верхней асимптоты и/или четко выраженной кривой доза-эффект, демонстрируемыми клетками из той же самой стабильной клональной клеточной линии, но из предыдущего пассажа или пассажей, причем в обоих тестах используются идентичные условия и идентичные эндопептидазы с измененной нацеленностью.

[0100] Клетки из стабильной клеточной линии, описанные в настоящей заявке, способны демонстрировать устойчивую чувствительность к активности эндопептидаз с измененной нацеленностью в течение множества клеточных пассажей. В настоящей заявке термин "чувствительность к активности эндопептидаз с измененной нацеленностью" относится к самой низкой дозе, которая может быть стабильно измерена в тесте и которая превышает уровень сигнала, измеряемого в необработанном контроле, или фонового сигнала.

[0101] Таким образом, согласно одному варианту реализации, клетки из стабильной клональной клеточной линии демонстрируют чувствительность к активности эндопептидаз с измененной нацеленностью для любых данных пассажей, которая составляет, например, 100 нМ или ниже, около 80 нМ или ниже, около 70 нМ или ниже, около 60 нМ или ниже, около 50 нМ или ниже, около 40 нМ или ниже, около 30 нМ или ниже, около 20 нМ или ниже, около 10 нМ или ниже, около 1 нМ или ниже, около 0,9 нМ или ниже, около 0,8 нМ или ниже, около 0,7 нМ или ниже, около 0,6 нМ или ниже, около 0,5 нМ или ниже, около 0,4 нМ или ниже, около 0,3 нМ или ниже, около 0,2 нМ или ниже или около 0,1 нМ или ниже. Согласно аспектам настоящего варианта реализации, клетки из стабильной клональной клеточной линии демонстрируют чувствительность к активности эндопептидаз с измененной нацеленностью для любых данных пассажей, которая составляет, например, приблизительно от 0,01 нМ до 100 нМ, приблизительно от 0,01 нМ до 75 нМ, приблизительно от 0,01 нМ до 50 нМ, приблизительно от 0,01 нМ до 25 нМ, приблизительно от 0,01 нМ до 20 нМ, приблизительно от 0,01 нМ до 15 нМ, приблизительно от 0,01 нМ до 10 нМ, приблизительно от 0,01 нМ до 5 нМ, приблизительно от 0,001 нМ до 100 нМ, приблизительно от 0,001 нМ до 75 нМ, приблизительно от 0,001 нМ до 50 нМ, приблизительно от 0,001 нМ до 25 нМ, приблизительно от 0,001 нМ до 20 нМ, приблизительно от 0,001 нМ до 15 нМ, приблизительно от 0,001 нМ до 10 нМ или приблизительно от 0,001 нМ до 5 нМ.

[0102] Согласно другому варианту реализации, клетки из стабильной клональной клеточной линии демонстрируют чувствительность к активности эндопептидаз с измененной нацеленностью, которая составляет около 100 нМ или ниже, около 75 нМ или ниже, около 50 нМ или ниже, около 25 нМ или ниже, около 20 нМ или ниже, около 15 нМ или ниже, около 10 нМ или ниже или около 1 нМ или ниже, в течение, например, 5 или более клеточных пассажей, 10 или более клеточных пассажей, 15 или более клеточных пассажей, 20 или более клеточных пассажей, 25 или более клеточных пассажей, 30 или более клеточных пассажей, 35 или более клеточных пассажей, 40 или более клеточных пассажей, 45 или более клеточных пассажей или 50 или более клеточных пассажей. Согласно другим аспектам настоящего варианта реализации, клетки из стабильной клональной клеточной линии демонстрируют чувствительность к активности эндопептидаз с измененной нацеленностью, которая составляет около 100 нМ или ниже, около 75 нМ или ниже, около 50 нМ или ниже, около 25 нМ или ниже, около 20 нМ или ниже, около 15 нМ или ниже, около 10 нМ или ниже или около 1 нМ или ниже, в течение, например, приблизительно от 15 до 60 пассажей, приблизительно от 20 до 60 пассажей, приблизительно от 25 до 60 пассажей, приблизительно от 30 до 60 пассажей, приблизительно от 35 до 60 пассажей, приблизительно от 40 до 60 пассажей, приблизительно от 45 до 60 пассажей, приблизительно от 50 до 60 пассажей, приблизительно от 15 до 50 пассажей, приблизительно от 20 до 50 пассажей, приблизительно от 25 до 50 пассажей, приблизительно от 30 до 50 пассажей, приблизительно от 35 до 50 пассажей, приблизительно от 40 до 50 пассажей, приблизительно от 15 до 40 пассажей, приблизительно от 20 до 40 пассажей, приблизительно от 25 до 40 пассажей или приблизительно от 30 до 40 пассажей.

[0103] Клетки из стабильной клеточной линии, описанные в настоящей заявке, способны демонстрировать устойчивую относительную эффективность поглощения эндопептидаз с измененной нацеленностью или активность эндопептидаз с измененной нацеленностью в течение множества клеточных пассажей. В настоящей заявке термин "относительная эффективность" относится к степени совпадения верхней асимптоты активности эндопептидаз с измененной нацеленностью, детектированной в текущем тесте, с верхней асимптотой активности эндопептидаз с измененной нацеленностью в эталонном стандарте, эталонной молекуле или эталонном числе пассажей, используемом в данном тесте. В настоящей заявке термин "отношение сигнала к шуму для верхней асимптоты" относится к сигналу, детектированному в тесте на верхнем пределе детектирования, деленному на сигнал, детектированный в необработанном контроле, или фоновый сигнал. Верхний предел детектирования представляет собой наивысшую дозу, которая может быть устойчиво измерена в тесте до наступления насыщения сигнала.

[0104] Таким образом, согласно одному варианту реализации, клетки из стабильной клеточной линии, описанные в настоящей заявке, способны демонстрировать четко выраженную верхнюю асимптоту в течение множества клеточных пассажей и поддерживать отношение сигнала к шуму, которое устойчиво и адекватно для теста. Согласно аспектам данного варианта реализации, клетки из стабильной клеточной линии, описанные в настоящей заявке, должны обладать четко выраженным отношением сигнала к шуму для верхней асимптоты активности эндопептидаз с измененной нацеленностью, составляющим, например, по меньшей мере 3:1, по меньшей мере 4:1, по меньшей мере 5:1, по меньшей мере 6:1, по меньшей мере 7:1, по меньшей мере 8:1, по меньшей мере 9:1, по меньшей мере 10:1, по меньшей мере 15:1, по меньшей мере 20:1, по меньшей мере 25:1, по меньшей мере 30:1, по меньшей мере 35:1, по меньшей мере 40:1, по меньшей мере 45:1, по меньшей мере 50:1, по меньшей мере 60:1, по меньшей мере 70:1, по меньшей мере 80:1, по меньшей мере 90:1 или по меньшей мере 100:1, по меньшей мере 150:1, по меньшей мере 200:1, по меньшей мере 250:1, по меньшей мере 300:1, по меньшей мере 350:1, по меньшей мере 400:1, по меньшей мере 450:1, по меньшей мере 500:1, по меньшей мере 550:1 или по меньшей мере 600:1, в течение, например, 5 или более клеточных пассажей, 10 или более клеточных пассажей, 15 или более клеточных пассажей, 20 или более клеточных пассажей, 25 или более клеточных пассажей, 30 или более клеточных пассажей, 35 или более клеточных пассажей, 40 или более клеточных пассажей, 45 или более клеточных пассажей, или 50 или более клеточных пассажей. Согласно другим аспектам настоящего варианта реализации, клетки из стабильной клеточной линии, описанные в настоящей заявке, должны обладать четко выраженным отношением сигнала к шуму для верхней асимптоты активности эндопептидаз с измененной нацеленностью, составляющим, например, по меньшей мере 3:1, по меньшей мере 4:1, по меньшей мере 5:1, по меньшей мере 6:1, по меньшей мере 7:1, по меньшей мере 8:1, по меньшей мере 9:1, по меньшей мере 10:1, по меньшей мере 15:1, по меньшей мере 20:1, по меньшей мере 25:1, по меньшей мере 30:1, по меньшей мере 35:1, по меньшей мере 40:1, по меньшей мере 45:1, по меньшей мере 50:1, по меньшей мере 60:1, по меньшей мере 70:1, по меньшей мере 80:1, по меньшей мере 90:1 или по меньшей мере 100:1, по меньшей мере 150:1, по меньшей мере 200:1, по меньшей мере 250:1, по меньшей мере 300:1, по меньшей мере 350:1, по меньшей мере 400:1, по меньшей мере 450:1, по меньшей мере 500:1, по меньшей мере 550:1 или по меньшей мере 600:1, в течение, например, приблизительно от 15 до 60 пассажей, приблизительно от 20 до 60 пассажей, приблизительно от 25 до 60 пассажей, приблизительно от 30 до 60 пассажей, приблизительно от 35 до 60 пассажей, приблизительно от 40 до 60 пассажей, приблизительно от 45 до 60 пассажей, приблизительно от 50 до 60 пассажей, приблизительно от 15 до 50 пассажей, приблизительно от 20 до 50 пассажей, приблизительно от 25 до 50 пассажей, приблизительно от 30 до 50 пассажей, приблизительно от 35 до 50 пассажей, приблизительно от 40 до 50 пассажей, приблизительно от 15 до 40 пассажей, приблизительно от 20 до 40 пассажей, приблизительно от 25 до 40 пассажей или приблизительно от 30 до 40 пассажей.

[0105] Клетки из стабильной клеточной линии, описанные в настоящей заявке, способны демонстрировать четко выраженную кривую доза-эффект для активности эндопептидаз с измененной нацеленностью в течение множества клеточных пассажей. В настоящей заявке термин "кривая доза-эффект" относится к степени соответствия исходных данных выбранной статистической модели для данного теста. В качестве неограничивающего примера можно привести сигмоидальную кривую с логистическим подбором на основе четырех параметров, которая представляет собой кривую доза-эффект для экспериментов по анализу ферментативной активности, таких как, например, тест на активность. В качестве другого неограничивающего примера можно привести кривую насыщения для связывания лиганда с одним сайтом, которая представляет собой кривую доза-эффект для экспериментов по связыванию лиганда/антитела.

[0106] Таким образом, согласно одному варианту реализации, клетки из стабильной клеточной линии, описанные в настоящей заявке, демонстрируют четко выраженную кривую доза-эффект для активности эндопептидаз с измененной нацеленностью в течение множества клеточных пассажей. Согласно аспектам настоящего варианта реализации, клетки из стабильной клеточной линии, описанные в настоящей заявке, демонстрируют четко выраженную кривую доза-эффект для активности эндопептидаз с измененной нацеленностью в течение, например, 5 или более клеточных пассажей, 10 или более клеточных пассажей, 15 или более клеточных пассажей, 20 или более клеточных пассажей, 25 или более клеточных пассажей, 30 или более клеточных пассажей, 35 или более клеточных пассажей, 40 или более клеточных пассажей, 45 или более клеточных пассажей или 50 или более клеточных пассажей. Согласно другим аспектам настоящего варианта реализации, клетки из стабильной клеточной линии, описанные в настоящей заявке, демонстрируют четко выраженную кривую доза-эффект для активности эндопептидаз с измененной нацеленностью в течение, например, приблизительно от 15 до 60 пассажей, приблизительно от 20 до 60 пассажей, приблизительно от 25 до 60 пассажей, приблизительно от 30 до 60 пассажей, приблизительно от 35 до 60 пассажей, приблизительно от 40 до 60 пассажей, приблизительно от 45 до 60 пассажей, приблизительно от 50 до 60 пассажей, приблизительно от 15 до 50 пассажей, приблизительно от 20 до 50 пассажей, приблизительно от 25 до 50 пассажей, приблизительно от 30 до 50 пассажей, приблизительно от 35 до 50 пассажей, приблизительно от 40 до 50 пассажей, приблизительно от 15 до 40 пассажей, приблизительно от 20 до 40 пассажей, приблизительно от 25 до 40 пассажей или приблизительно от 30 до 40 пассажей.

[0107] Клетки из стабильной клеточной линии, описанные в настоящей заявке, способны демонстрировать устойчивое относительное значение ЕС5о для активности эндопептидаз с измененной нацеленностью в течение множества клеточных пассажей. В настоящей заявке термин "относительная EC50" или "относительное значение EC50" относится к значению EC50 для активности эндопептидаз с измененной нацеленностью, нормированному относительно EC50, рассчитанной для эталонного стандарта, эталонной молекулы или эталонного числа пассажей, используемого в данном тесте.

[0108] Таким образом, согласно одному варианту реализации, клетки из стабильной клональной клеточной линии демонстрируют устойчивую относительную EC50 для активности эндопептидаз с измененной нацеленностью в течение множества клеточных пассажей. Согласно аспектам данного варианта реализации, клетки из стабильной клональной клеточной линии демонстрируют устойчивую относительную EC50 для активности эндопептидаз с измененной нацеленностью, которая, например, составляет около ±10%, около ±20%, около ±30%, около ±40%, около ±50%, около ±60%, около ±70% или около ±75% относительной EC50 для активности эндопептидаз с измененной нацеленностью в течение, например, 5 или более клеточных пассажей, 10 или более клеточных пассажей, 15 или более клеточных пассажей, 20 или более клеточных пассажей, 25 или более клеточных пассажей, 30 или более клеточных пассажей, 35 или более клеточных пассажей, 40 или более клеточных пассажей, 45 или более клеточных пассажей или 50 или более клеточных пассажей. Согласно другим аспектам данного варианта реализации, клетки из стабильной клональной клеточной линии демонстрируют относительную EC50 для активности эндопептидаз с измененной нацеленностью, которая, например, составляет приблизительно от ±10% до 75%, приблизительно от ±10% до 70%, приблизительно от ±10% до 60%, приблизительно от ±10% до 50%, приблизительно от ±10% до 40%, приблизительно от ±10% до 30% или приблизительно от ±10% до 20% относительной ECso для активности эндопептидаз с измененной нацеленностью в течение, например, 5 или более клеточных пассажей, 10 или более клеточных пассажей, 15 или более клеточных пассажей, 20 или более клеточных пассажей, 25 или более клеточных пассажей, 30 или более клеточных пассажей, 35 или более клеточных пассажей, 40 или более клеточных пассажей, 45 или более клеточных пассажей или 50 или более клеточных пассажей.

[0109] Часть аспектов настоящего описания включает эндопептидазы с измененной нацеленностью. В настоящей заявке термин "эндопептидазы с измененной нацеленностью" является синонимом " Белки-Модуляторы Направленного Везикулярного Экзоцитоза" или "TVEMP". Неограничивающие примеры эндопептидаз с измененной нацеленностью описаны, например, в Keith A. Foster et al., Closthdial Toxin Derivatives Able To Modify Peripheral Sensory Afferent Functions, патент США 5989545; Clifford С.Shone et al., Recombinant Toxin Fragments, патент США 6461617; Conrad P. Quinn et al., Methods and Compounds for the Treatment of Mucus Hypersecretion, патент США 6632440; Lance E. Steward et al., Methods And Compositions For The Treatment Of Pancreatitis, патент США 6843998; Stephan Donovan, Clostridial Toxin Derivatives and Methods For Treating Pain, публикация патента США 2002/0037833; Keith A. Foster et al., Inhibition of Secretion from Non-neural Cells, публикация патента США 2003/0180289; J. Oliver Dolly et al., Activatable Recombinant Neurotoxins, WO 2001/014570; Keith A. Foster et al., Re-targeted Toxin Conjugates, международная публикация патента WO 2005/023309; Lance E. Steward et al., Multivalent Closthdial Toxin Derivatives and Methods of Their Use, заявка на патент США №11/376696; Steward, L.E. et al., Modified Closthdial Toxins with Enhanced Translocation Capabilities and Altered Targeting Activity For Non-Clostridial Toxin Target Cells, заявка на патент США №11/776075; Dolly, J.O. et al., Activatable Clostridial Toxins, заявка на патент США №11/829475; Foster, K.A. et al., Fusion Proteins, публикация международной заявки WO 2006/059093; и Foster, K.A. et al., Non-Cytotoxic Protein Conjugates, международная публикация патента WO 2006/059105, каждый из которых полностью включен в настоящую заявку посредством ссылки. Неограничивающие примеры эндопептидаз с измененной нацеленностью включают SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 130 и SEQ ID NO: 131.

[0110] Таким образом, согласно одному варианту реализации, источником детектируемой активности эндопептидазы с измененной нацеленностью является эндопептидаза с измененной нацеленностью. Согласно аспектам данного варианта реализации, источником детектируемой активности эндопептидазы с измененной нацеленностью является эндопептидаза с измененной нацеленностью, описанная в Keith A. Foster et al., Closthdial Toxin Derivatives Able To Modify Peripheral Sensory Afferent Functions, патент США 5989545; Clifford С.Shone et al., Recombinant Toxin Fragments, патент США 6461617; Conrad P. Quinn et al., Methods and Compounds for the Treatment of Mucus Hypersecretion, патент США 6632440; Lance E. Steward et al., Methods And Compositions For The Treatment Of Pancreatitis, патент США 6843998; Stephan Donovan, Clostridial Toxin Derivatives and Methods For Treating Pain, публикация заявки на патент США 2002/0037833; Keith A. Foster et al., Inhibition of Secretion from Non-neural Cells, публикация заявки на патент США 2003/0180289; J. Oliver Dolly et al., Activatable Recombinant Neurotoxins, WO 2001/014570; Keith A. Foster et al., Re-targeted Toxin Conjugates, международная публикация патента WO 2005/023309; Lance E. Steward et al., Multivalent Clostridial Toxin Derivatives and Methods of Their Use, заявка на патент США №11/376696; Steward, L.E. et al., Modified Clostridial Toxins with Enhanced Translocation Capabilities and Altered Targeting Activity For Non-Closthdial Toxin Target Cells, заявка на патент США №11/776075; Dolly, J.O. et al., Activatable Clostridial Toxins, заявка на патент США №11/829475; Foster, K.A. et al., Fusion Proteins, международная публикация патента WO 2006/059093; и Foster, K.A. et al„ Non-Cytotoxic Protein Conjugates, публикация международной заявки WO 2006/059105, содержание каждого из которых полностью включено в настоящую заявку посредством ссылки. Согласно аспектам данного варианта реализации, эндопептидазы с измененной нацеленностью представляют собой SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 130 или SEQ ID NO: 131.

[0111] Согласно другому варианту реализации, источником детектируемой активности эндопептидазы с измененной нацеленностью является эндопептидаза с измененной нацеленностью, которая, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентична по последовательности аминокислот эндопептидазе с измененной нацеленностью, описанной в Keith A. Foster et al., Clostridial Toxin Derivatives Able To Modify Peripheral Sensory Afferent Functions, патент США 5989545; Clifford С.Shone et al., Recombinant Toxin Fragments, патент США 6461617; Conrad P. Quinn et al., Methods and Compounds for the Treatment of Mucus Hypersecretion, патент США 6632440; Lance E. Steward et al., Methods And Compositions For The Treatment Of Pancreatitis, патент США 6843998; Stephan Donovan, Clostridial Toxin Derivatives and Methods For Treating Pain, публикация патента США 2002/0037833; Keith A. Foster et al., Inhibition of Secretion from Non-neural Cells, публикация заявки на патент США 2003/0180289; J. Oliver Dolly et al., Activatable Recombinant Neurotoxins, WO 2001/014570; Keith A. Foster et al., Re-targeted Toxin Conjugates, публикация международной заявки WO 2005/023309; Lance E. Steward et al., Multivalent Clostridial Toxin Derivatives and Methods of Their Use, заявка на патент США №11/376696; Steward, L.E. et al., Modified Clostridial Toxins with Enhanced Translocation Capabilities and Altered Targeting Activity For Non-Closthdial Toxin Target Cells, заявка на патент США №11/776075; Dolly, J.O. et al., Activatable Clostridial Toxins, заявка на патент США №11/829475; Foster, K.A. et al., Fusion Proteins, публикация международной заявки WO 2006/059093; и Foster, K.A. et al., Non-Cytotoxic Protein Conjugates, публикация международной заявки WO 2006/059105, каждый из которых полностью включен в настоящую заявку посредством ссылки. Согласно другому варианту реализации, источником детектируемой активности эндопептидазы с измененной нацеленностью является эндопептидаза с измененной нацеленностью, которая, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентична по последовательности аминокислот эндопептидазе с измененной нацеленностью из SEQ ID N0: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 130 или SEQ ID NO: 131.

[0112] Согласно другим аспектам данного варианта реализации, источником детектируемой активности эндопептидазы с измененной нацеленностью является эндопептидаза с измененной нацеленностью, включающая не следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из эндопептидаз с измененной нацеленностью, описанных в Keith A. Foster et al., Clostndial Toxin Derivatives Able To Modify Peripheral Sensory Afferent Functions, патент США 5989545; Clifford С.Shone et al., Recombinant Toxin Fragments, патент США 6461617; Conrad P. Quinn et al., Methods and Compounds for the Treatment of Mucus Hypersecretion, патент США 6632440; Lance E. Steward et al., Methods And Compositions For The Treatment Of Pancreatitis, патент США 6843998; Stephan Donovan, Clostndial Toxin Derivatives and Methods For Treating Pain, публикация заявки на патент США 2002/0037833; Keith A. Foster et al., Inhibition of Secretion from Non-neural Cells, публикация заявки на патент США 2003/0180289; J. Oliver Dolly et al., Activatable Recombinant Neurotoxins, WO 2001/014570; Keith A. Foster et al., Re-targeted Toxin Conjugates, публикация международной заявки WO 2005/023309; Lance E. Steward et al., Multivalent Clostndial Toxin Derivatives and Methods of Their Use, заявка на патент США №11/376696; Steward, L.E. et al., Modified Clostndial Toxins with Enhanced Translocation Capabilities and Altered Targeting Activity For Non-Clostridial Toxin Target Cells, заявка на патент США №11/776,075; Dolly, J.O. et al., Activatable Clostndial Toxins, заявка на патент США №11/829,475; Foster, K.A. et al., Fusion Proteins, публикация международной заявки WO 2006/059093; и Foster, K.A. et al., Non-Cytotoxic Protein Conjugates, публикация международной заявки WO 2006/059105, содержание каждого из которых полностью включено в настоящую заявку посредством ссылки. Согласно другим аспектам данного варианта реализации, источником детектируемой активности эндопептидазы с измененной нацеленностью является эндопептидаза с измененной нацеленностью, включающая не следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из эндопептидаз с измененной нацеленностью, описанных в SEQ ID NO; 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 130 или SEQ ID NO: 131.

[0113] Согласно другим аспектам данного варианта реализации, источником детектируемой активности эндопептидазы с измененной нацеленностью является не встречающийся в природе вариант эндопептидазы с измененной нацеленностью, включающий следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из эндопептидаз с измененной нацеленностью, описанных в Keith A. Foster et al., Closthdial Toxin Derivatives Able To Modify Peripheral Sensory Afferent Functions, патент США 5989545; Clifford С.Shone et al., Recombinant Toxin Fragments, патент США 6461617; Conrad P. Quinn et al., Methods and Compounds for the Treatment of Mucus Hypersecretion, патент США 6632440; Lance E. Steward et al., Methods And Compositions For The Treatment Of Pancreatitis, патент США 6843998; Stephan Donovan, Closthdial Toxin Derivatives and Methods For Treating Pain, публикация патента США 2002/0037833; Keith A. Foster et al., Inhibition of Secretion from Non-neural Cells, публикация заявки на патент США 2003/0180289; J.Oliver Dolly et al., Activatable Recombinant Neurotoxins, WO 2001/014570; Keith A. Foster et al., Re-targeted Toxin Conjugates, международная публикация патента WO 2005/023309; Lance E. Steward et al., Multivalent Clostridial Toxin Derivatives and Methods of Their Use, заявка на патент США №11/376696; Steward, L.E. et al., Modified Clostridial Toxins with Enhanced Translocation Capabilities and Altered Targeting Activity For Non-Clostridial Toxin Target Cells, заявка на патент США №11/776075; Dolly, J.O. et al., Activatable Clostridial Toxins, заявка на патент США №11/829475; Foster, K.A. et al., Fusion Proteins, публикация международной заявки WO 2006/059093; и Foster, K.A. et al., Non-Cytotoxic Protein Conjugates, публикация международной заявки WO 2006/059105, содержание каждого из которых полностью включено в настоящую заявку посредством ссылки. Согласно другим аспектам данного варианта реализации, источником детектируемой активности эндопептидазы с измененной нацеленностью является не встречающийся в природе вариант эндопептидазы с измененной нацеленностью, включающий следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из эндопептидаз с измененной нацеленностью, описанных в SEQ ID N0: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 130 или SEQ ID NO: 131.

[0114] Согласно еще одному варианту реализации, источником детектируемой активности эндопептидазы с измененной нацеленностью является эндопептидаза с измененной опиоидной нацеленностью. Неограничивающие примеры эндопептидазы с измененной опиоидной нацеленностью, или опиоидно-TVEMP, описаны, например, в Keith A. Foster et al., Closthdial Toxin Derivatives Able To Modify Peripheral Sensory Afferent Functions, патент США 5989545; J. Oliver Dolly et al., Activatable Recombinant Neurotoxins, патент США 7132259; Stephan Donovan, Clostridial Toxin Derivatives and Methods For Treating Pain, патент США 7244437; Stephan Donovan, Closthdial Toxin Derivatives and Methods For Treating Pain, патент США 7413742; Stephan Donovan, Closthdial Toxin Derivatives and Methods For Treating Pain, патент США 7415338; Lance E. Steward et al., Multivalent Closthdial Toxin Derivatives and Methods of Their Use, патент США 7514088; Keith A. Foster, Fusion Proteins, публикация патента США 2008/0064092; Keith A. Foster, Fusion Proteins, публикация патента США 2009/0035822; Lance E. Steward et al., Multivalent Closthdial Toxin Derivatives and Methods of Their Use, публикация заявки на патент США 2009/0048431; Keith A. Foster, Non-Cytotoxic Protein Conjugates, публикация заявки на патент США 2009/0162341; Keith A. Foster et al., Retargeted Toxin Conjugates, публикация международной заявки WO 2005/023309; и Lance E. Steward, Modified Closthdial Toxins with Enhanced Translocation Capabilities and Altered Targeting Capabilities for Non-Closthdial Toxin Target Cells, публикация международной заявки WO 2008/008805; содержание каждого из которых полностью включено в настоящую заявку посредством ссылки.

[0115] Согласно еще одному варианту реализации, источником детектируемой активности эндопептидазы с измененной нацеленностью является эндопептидаза с измененной галаниновой нацеленностью. Неограничивающие примеры эндопептидаз с измененной галаниновой нацеленностью, или галанин-TVEMP, описаны, например, в Steward, L.E. et al., Modified Clostridial Toxins with Enhanced Translocation Capability and Enhanced Targeting Activity, заявка на патент США №11/776043 (11 июля 2007 г.); Steward, L.E. et al., Modified Clostridial Toxins with Enhanced Translocation Capabilities and Altered Targeting Activity For Clostridial Toxin Target Cells, заявка на патент США №11/776052 (11 июля 2007 г.); и Steward, L.E. et al., Modified Clostridial Toxins with Enhanced Translocation Capabilities and Altered Targeting Activity For Non-Clostridial Toxin Target Cells, заявка на патент США №11/776075 (11 июля 2007 г.), содержание каждого из которых полностью включено в настоящую заявку посредством ссылки.

[0116] Часть аспектов настоящего описания включает SNAP-25. В настоящей заявке термин "SNAP-25" относится к природному SNAP-25 или не встречающемуся в природе SNAP-25, который преимущественно расщепляется эндопептидазами с измененной нацеленностью. В настоящей заявке термин "преимущественно расщепляется" относится к скорости расщепления SNAP-25 эндопептидазами с измененной нацеленностью, которая по меньшей мере на порядок превышает скорость расщепления эндопептидазами с измененной нацеленностью какого-либо другого субстрата. Согласно аспектам данного варианта реализации, скорость расщепления SNAP-25 эндопептидазами с измененной нацеленностью превышает по меньшей мере на два порядка, по меньшей мере на три порядка, по меньшей мере на четыре порядка или по меньшей мере на пять порядков скорость расщепления эндопептидазами с измененной нацеленностью какого-либо другого субстрата.

[0117] В настоящей заявке термин "природный SNAP-25" относится к любому SNAP-25, образующемуся в результате природных процессов, включая, но не ограничиваясь ими, изоформы SNAP-25, образующиеся в результате посттрансляционной модификации, альтернативного сплайсинга транскрипта или спонтанной мутации, и подтипы SNAP-25. Природные SNAP-25 включают, но не ограничиваются, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24 или их варианты, у которых присутствуют замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24.

[0118] В настоящей заявке термин "не встречающийся в природе SNAP-25" относится к любому SNAP-25, структура которого была изменена при помощи деятельности человека, включая, но не ограничиваясь, SNAP-25, полученный с помощью генной инженерии с использованием случайного мутагенеза или рационального дизайна, и SNAP-25, полученный с помощью химического синтеза in vitro. Неограничивающие примеры не встречающихся в природе SNAP-25 описаны, например, в Steward, L.E. et al., FRET Protease Assays for Closthdial Toxins, патент США 7332567; Fernandez-Salas et al., Lipohilic Dye-based FRET Assays for Closthdial Toxin Activity, публикация заявки на патент США 2008/0160561, каждый из которых полностью включен в настоящую заявку посредством ссылки. Не встречающийся в природе SNAP-25 может содержать замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24.

[0119] Таким образом, согласно одному варианту реализации, SNAP-25 представляет собой природный SNAP-25. Согласно аспектам данного варианта реализации, SNAP-25 представляет собой изоформу SNAP-25 или подтип SNAP-25. Согласно аспектам данного варианта реализации, природный SNAP-25 представляет собой природный SNAP-25 из SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24. Согласно другим аспектам данного варианта реализации, SNAP-25 представляет собой природный SNAP-25, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24.

[0120] Согласно другому варианту реализации, SNAP-25 представляет собой не встречающийся в природе SNAP-25. Согласно другим аспектам данного варианта реализации, SNAP-25 представляет собой не встречающийся в природе SNAP-25, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 или SEQ ID NO: 4. Согласно другим аспектам данного варианта реализации, SNAP-25 представляет собой не встречающийся в природе SNAP-25, включающий не следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24. Согласно другим аспектам данного варианта реализации, SNAP-25 представляет собой не встречающийся в природе SNAP-25, включающий следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24.

[0121] SNAP-25 может представлять собой эндогенный SNAP-25 или экзогенный SNAP-25. В настоящей заявке термин "эндогенный SNAP-25" относится к SNAP-25, естественным образом присутствующему в клетке в силу того, что он естественным образом закодирован в геноме клетки, и таким образом, в клетке изначально экспрессируется SNAP-25, что снимает необходимость наличия внешнего источника SNAP-25 или внешнего источника генетического материала, кодирующего SNAP-25. Экспрессия эндогенного SNAP-25 может происходить с участием стимуляции со стороны окружающей среды, такой как, например, клеточная дифференцировка, или без него. По определению, эндогенным SNAP-25 может быть только природный SNAP-25 или его варианты. Например, в следующих стабильных клеточных линиях экспрессируется эндогенный SNAP-25: BE(2)-M17, Kelly, LA1-55n, N1E-115, N4TG3, N18, Neuro-2a, NG108-15, PC12, SH-SY5Y, SiMa, SK-N-DZ и SK-N-BE(2)-C.

[0122] В настоящей заявке термин "экзогенный SNAP-25" относится к SNAP-25, экспрессия которого в клетке достигается путем введения внешнего источника SNAP-25 или внешнего источника генетического материала, кодирующего SNAP-25, в результате деятельности человека. Экспрессия экзогенного SNAP-25 может происходить с участием стимуляции со стороны окружающей среды, такой как, например, клеточная дифференцировка, или без него. В качестве неограничивающего примера, клетки из стабильной клеточной линии могут экспрессировать экзогенный SNAP-25 в результате временной или стабильной трансфекции SNAP-25. В качестве другого неограничивающего примера, клетки из стабильной клеточной линии могут экспрессировать экзогенный SNAP-25 в результате трансфекции белка SNAP-25. Экзогенным SNAP-25 может быть природный SNAP-25 или его варианты, или не встречающийся в природе SNAP-25 или его варианты.

[0123] Таким образом, согласно одному варианту реализации, клетки из стабильной клеточной линии экспрессируют эндогенный SNAP-25. Согласно аспектам данного варианта реализации, эндогенный SNAP-25, экспрессируемый клетками из стабильной клеточной линии, представляет собой природный SNAP-25. Согласно другим аспектам данного варианта реализации, эндогенный SNAP-25, экспрессируемый клетками из стабильной клеточной линии, представляет собой SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24. Согласно другим аспектам данного варианта реализации, эндогенный SNAP-25, экспрессируемый клетками из стабильной клеточной линии, представляет собой природный SNAP-25, такой как, например, изоформа SNAP-25 или подтип SNAP-25. Согласно другим аспектам данного варианта реализации, эндогенный SNAP-25, экспрессируемый клетками из стабильной клеточной линии, представляет собой природный SNAP-25, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24.

[0124] Согласно другому варианту реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии экзогенного SNAP-25. Согласно одному аспекту данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природного SNAP-25. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природного SNAP-25 из SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природного SNAP-25, такого как, например, изоформа SNAP-25 или подтип SNAP-25. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природного SNAP-25, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24.

[0125] Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии не встречающегося в природе SNAP-25. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии не встречающегося в природе SNAP-25, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии не встречающегося в природе SNAP-25, включающего не следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии не встречающегося в природе SNAP-25, включающего следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 или SEQ ID NO: 24.

[0126] Тесты, выявляющие расщепление SNAP-25 после контакта с эндопептидазами с измененной нацеленностью, можно использовать для оценки наличия в клетке экспрессии эндогенного или экзогенного SNAP-25. В этих тестах образование продуктов расщепления SNAP-25 будет наблюдаться в клетках, экспрессирующих SNAP-25, после обработки эндопептидазами с измененной нацеленностью. Неограничивающие примеры конкретного анализа с помощью Вестерн блоттинга, а также подробно охарактеризованные реактивы, условия и протоколы можно найти у коммерческих поставщиков, которые включают, но не ограничиваются, Amersham Biosciences, Пискэтэуэй, Нью-Джерси; Bio-Rad Laboratories, Геркулес, Калифорния; Pierce Biotechnology, Inc., Рокфорд, Иллинойс; Promega Corporation, Мадисон, Висконсин, и Stratagene, Inc., Ла-Хойя, Калифорния. Следует понимать, что эти и подобные им тесты для расщепления SNAP-25 могут быть пригодны для идентификации клеток, экспрессирующих эндогенный или экзогенный SNAP-25.

[0127] В качестве неограничивающих примеров, анализ с помощью Вестерн блоттинга с использованием антител, распознающих продукт расщепления SNAP-25 или как расщепленные, так и нерасщепленные формы SNAP-25, можно использовать для анализа поглощения эндопептидаз с измененной нацеленностью. Примеры анти-SNAP-25 антител, пригодных для этих тестов, включают, но не ограничиваются, мышиные моноклональные анти-SNAP-25 антитела SMI-81 (Sternberger Monoclonals Inc., Лютервилль, Мэриленд), мышиные моноклональные анти-ЗМАР-25 антитела CI 71.1 (Synaptic Systems, Геттинген, Германия), мышиные моноклональные am-n-SNAP-25 антитела CI 71.2 (Synaptic Systems, Геттинген, Германия), мышиные моноклональные анти-SNAP-25 антитела SP12 (Abeam, Кембридж, Массачусетс), кроличью поликлональную антисыворотку α-SNAP-25 (Synaptic Systems, Геттинген, Германия), кроличью поликлональную антисыворотку α-SNAP-25 (Abeam, Кембридж, Массачусетс) и кроличью поликлональную антисыворотку α-SNAP-25 S9684 (Sigma, Сент-Луис, Миссури).

[0128] Часть аспектов настоящего описания включает рецептор эндопептидаз с измененной нацеленностью. В настоящей заявке термин "рецептор эндопептидаз с измененной нацеленностью" относится или к природному рецептору эндопептидаз с измененной нацеленностью или к не встречающемуся в природе рецептору эндопептидаз с измененной нацеленностью, который избирательно взаимодействует с эндопептидазами с измененной нацеленностью таким образом, что ответ на активность эндопептидаз с измененной нацеленностью усиливается. В настоящей заявке термин "избирательно взаимодействует" относится к такой равновесной константе диссоциации (KD) эндопептидазы с измененной нацеленностью и рецептора эндопептидазы с измененной нацеленностью, которая по меньшей мере на один порядок меньше подобной величины для эндопептидазы с измененной нацеленностью и любого другого рецептора клеточной поверхности. Равновесная константа диссоциации - это тип константы равновесия, которая измеряет способность комплекса эндопептидаза с измененной нацеленностью-рецептор эндопептидазы с измененной нацеленностью обратимо разделяться (диссоциировать) на составляющие его молекулы, а именно, эндопептидазу с измененной нацеленностью и рецептор эндопептидазы с измененной нацеленностью, и определяется как KD=Ka/Kd в состоянии равновесия. Константа ассоциации (Ка) определяется как Ka=[C]/[L][R], a константа диссоциации (Kd) определяется как Kd=[L][R]/[C], где [Ц равняется молярной концентрации эндопептидазы с измененной нацеленностью, [R] - молярная концентрация рецептора эндопептидазы с измененной нацеленностью, а [С] - молярная концентрация комплекса эндопептидаза с измененной нацеленностью-рецептор эндопептидазы с измененной нацеленностью, где концентрации всех компонентов отвечают состоянию равновесия системы. Чем меньше константа диссоциации, тем более прочно эндопептидаза с измененной нацеленностью связана со своим рецептором, или выше аффинность связывания между эндопептидазой с измененной нацеленностью и рецептором эндопептидазы с измененной нацеленностью. Согласно аспектам этого варианта реализации, константа диссоциации эндопептидазы с измененной нацеленностью и соответствующего рецептора, по меньшей мере на два, три, четыре или пять порядков меньше, чем константа диссоциации эндопептидазы с измененной нацеленностью и любого другого рецептора. Согласно другим аспектам этого варианта реализации, аффинность связывания эндопептидазы с измененной нацеленностью, которая избирательно взаимодействует с соответствующего рецептором, может иметь равновесную константу диссоциации (KD), например, 500 нМ или меньше, 400 нМ или меньше, 300 нМ или меньше, 200 нМ, или меньше, меньше 100 нМ, или еще меньше. Согласно другим аспектам этого варианта реализации, аффинность связывания эндопептидазы с измененной нацеленностью, которая избирательно взаимодействует с соответствующим рецептором, может иметь равновесную константу диссоциации (KD), например, 90 нМ или меньше, 80 нМ или меньше, 70 нМ или меньше, 60 нМ, 50 нМ или меньше, 40 нМ или меньше, 30 нМ или меньше, 20 нМ или меньше, меньше 10 нм, или еще меньше. В настоящей заявке термин "усиливает ответ на активность эндопептидазы с измененной нацеленностью", относится к способности рецептора эндопептидазы с измененной нацеленностью взаимодействовать с эндопептидазой с измененной нацеленностью, с формированием комплекса эндопептидаза/рецептор и последующей интернализацией этого комплекса в цитоплазму клетки.

[0129] В настоящей заявке термин "природный рецептор эндопептидаз с измененной нацеленностью" относится к любому рецептору эндопептидаз с измененной нацеленностью, образующемуся в результате природных процессов, включая, но не ограничиваясь, изоформы рецептора эндопептидаз с измененной нацеленностью, образующиеся в результате посттрансляционной модификации, альтернативного сплайсинга транскрипта или спонтанной мутации, и подтипы рецептора эндопептидаз с измененной нацеленностью. Природные рецепторы эндопептидаз с измененной нацеленностью включают, но не ограничиваются, природные опиоидные рецепторы, такие как опиоидоподобный рецептор 1 (ORL1), 5-опиоидный рецептор (DOR), µ-опиоидный рецептор (KOR) и δ-опиоидный рецептор (MOR), такие как описано в Christopher Evans et al., Opioid Receptor Genes, патент США 6265563; Christopher Evans et al., Methods of Screening Modulators of Opiod Receptor Activity, патент США 6432652; Christopher Evans et al., Opioid Receptors and Methods of Use, патент США 7282563; и Christopher Evans et al., Delta Opioid Receptor Proteins, публикация заявки на патент США 2008/0219925, каждый из которых полностью включен в настоящую заявку посредством ссылки. Другие примеры природных рецепторов эндопептидаз с измененной нацеленностью включают, но не ограничиваются, рецептор галанина 1, рецептор галанина 2 и рецептор галанина 3. В данной области техники известны природные опиоидные рецепторы из других видов позвоночных, таких как, например, приматы, коровы, собаки, мыши, крысы, куры и рыбы, и их можно использовать согласно аспектам настоящей заявки.

[0130] Природный ORL1 включает, но не ограничивается, SEQ ID NO: 25 и SEQ ID NO: 26 или их варианты, у которых присутствуют замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 25 или SEQ ID NO: 26. Природный DOR включает, но не ограничивается, SEQ ID NO: 27 и SEQ ID NO: 28 или их варианты, у которых присутствуют замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 27 или SEQ ID NO: 28. Природный KOR включает, но не ограничивается, SEQ ID NO: 29 и SEQ ID NO: 30 или их варианты, у которых присутствуют замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 29 или SEQ ID NO: 30. Природный MOR включает, но не ограничивается, SEQ ID NO: 31 или его варианты, у которых присутствуют замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 31.

[0131] Природный рецептор галанина 1 включает, но не ограничивается, SEQ ID NO: 136, SEQ ID NO: 137 и SEQ ID NO: 138 или его варианты, у которых присутствуют замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 136, SEQ ID NO: 137 или SEQ ID NO: 138. Природный рецептор галанина 2 включает, но не ограничивается, SEQ ID NO: 139 или его варианты, у которых присутствуют замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 139. Природный рецептор галанина 3 включает, но не ограничивается, SEQ ID NO: 140 или его варианты, у которых присутствуют замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 140.

[0132] В настоящей заявке термин "не встречающийся в природе вариант рецептора эндопептидаз с измененной нацеленностью" относится к любому рецептору эндопептидаз с измененной нацеленностью, полученному при помощи человеческих модификаций или построений, включая, но не ограничиваясь ими, рецептор эндопептидаз с измененной нацеленностью, полученный методами генной инженерии, с использованием случайного мутагенеза или рационального дизайна, и рецептор эндопептидаз с измененной нацеленностью, полученный химическим синтезом. Неограничивающие примеры не встречающихся в природе вариантов рецепторов эндопептидаз с измененной нацеленностью включают, например, консервативные варианты рецептора эндопептидаз с измененной нацеленностью, неконсервативные варианты рецептора эндопептидаз с измененной нацеленностью, химерные варианты рецептора эндопептидаз с измененной нацеленностью и активные фрагменты рецептора эндопептидаз с измененной нацеленностью.

[0133] В настоящей заявке термин "не встречающийся в природе рецептор эндопептидаз с измененной нацеленностью" относится к любому рецептору эндопептидаз с измененной нацеленностью, структура которого была изменена при помощи деятельности человека, включая, но не ограничиваясь, рецептор эндопептидаз с измененной нацеленностью, полученный с помощью генной инженерии с использованием случайного мутагенеза или рационального дизайна, и рецептор эндопептидаз с измененной нацеленностью, полученный с помощью химического синтеза in vitro. He встречающийся в природе рецептор эндопептидаз с измененной нацеленностью может содержать замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 25, SEQ ID NO: 26 SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140.

[0134] Таким образом, согласно одному варианту реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой природный рецептор эндопептидаз с измененной нацеленностью, такой как, например, ORL1, DOR, KOR или MOR. Согласно аспектам данного варианта реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой изоформу рецептора эндопептидаз с измененной нацеленностью или подтип рецептора эндопептидаз с измененной нацеленностью. Согласно аспектам данного варианта реализации, природный рецептор эндопептидаз с измененной нацеленностью представляет собой природный рецептор эндопептидаз с измененной нацеленностью из SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 или SEQ ID NO: 31. Согласно другим аспектам данного варианта реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой природный рецептор эндопептидаз с измененной нацеленностью, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 или SEQ ID NO: 31.

[0135] Согласно другому варианту реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой не встречающийся в природе рецептор эндопептидаз с измененной нацеленностью, такой как, например, генетически модифицированный ORL1, генетически модифицированный DOR, генетически модифицированный KOR или генетически модифицированный MOR. Согласно другим аспектам данного варианта реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой не встречающийся в природе рецептор эндопептидаз с измененной нацеленностью, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 или SEQ ID NO: 31. Согласно другим аспектам данного варианта реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой не встречающийся в природе рецептор эндопептидаз с измененной нацеленностью, включающий не следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 или SEQ ID NO: 31. Согласно другим аспектам данного варианта реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой не встречающийся в природе рецептор эндопептидаз с измененной нацеленностью, включающий следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 или SEQ ID NO: 31.

[0136] Согласно другому варианту реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой природный рецептор эндопептидаз с измененной нацеленностью, такой как, например, рецептор галанина 1, рецептор галанина 2 или рецептор галанина 3. Согласно аспектам данного варианта реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой изоформу рецептора эндопептидаз с измененной нацеленностью или подтип рецептора эндопептидаз с измененной нацеленностью. Согласно аспектам данного варианта реализации, природный рецептор эндопептидаз с измененной нацеленностью представляет собой природный рецептор эндопептидаз с измененной нацеленностью из SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140. Согласно другим аспектам данного варианта реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой природный рецептор эндопептидаз с измененной нацеленностью, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140.

[0137] Согласно другому варианту реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой не встречающийся в природе рецептор эндопептидаз с измененной нацеленностью, такой как, например, генетически модифицированный рецептор галанина 1, генетически модифицированный рецептор галанина 2 или генетически модифицированный рецептор галанина 3. Согласно другим аспектам данного варианта реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой не встречающийся в природе рецептор эндопептидаз с измененной нацеленностью, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140. Согласно другим аспектам данного варианта реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой не встречающийся в природе рецептор эндопептидаз с измененной нацеленностью, включающий не следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140. Согласно другим аспектам данного варианта реализации, рецептор эндопептидаз с измененной нацеленностью представляет собой не встречающийся в природе рецептор эндопептидаз с измененной нацеленностью, включающий следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140.

[0138] Рецептор эндопептидаз с измененной нацеленностью может быть эндогенным или экзогенным. В настоящей заявке термин "эндогенный рецептор эндопептидаз с измененной нацеленностью" относится к рецептору эндопептидаз с измененной нацеленностью, естественным образом присутствующему в клетке, потому что он естественным образом закодирован в геноме клетки, так, что в клетке изначально экспрессируется рецептор эндопептидаз с измененной нацеленностью без необходимости во внешнем источнике рецептора эндопептидаз с измененной нацеленностью или внешнем источнике генетического материала, кодирующего рецептор эндопептидаз с измененной нацеленностью. Экспрессия эндогенного рецептора эндопептидаз с измененной нацеленностью может происходить как при внешней стимуляции, так и без нее, как, например, при дифференцировке клетки или активации промотора. Например, следующие стабильные клеточные линии экспрессируют по меньшей мере один эндогенный рецептор эндопептидаз с измененной нацеленностью: AGN Р33, Neuro-2a, SiMa и SK-N-DZ. Эндогенный рецептор эндопептидаз с измененной нацеленностью может быть только природным рецептором эндопептидаз с измененной нацеленностью или его природными вариантами.

[0139] В настоящей заявке термин "экзогенный рецептор эндопептидаз с измененной нацеленностью" относится к рецептору эндопептидаз с измененной нацеленностью, экспрессируемому в клетке вследствие введения внешнего источника рецептора эндопептидаз с измененной нацеленностью или внешнего источника генетического материала, кодирующего рецептор эндопептидаз с измененной нацеленностью, вследствие деятельности человека. Экспрессия экзогенного рецептора эндопептидаз с измененной нацеленностью может происходить как при внешней стимуляции, так и без нее, как, например, при дифференцировке клетки или активации промотора. В качестве неограничивающих примеров, клетки стабильных клеточных линий могут экспрессировать один или несколько экзогенных рецепторов эндопептидаз с измененной нацеленностью вследствие временной или стабильной трансфекции молекулой полинукпеотида, кодирующего рецептор эндопептидаз с измененной нацеленностью, такой как, например, ORL1, DOR, KOR, MOR, рецептор галанина 1, рецептор галанина 2 или рецептор галанина 3. В качестве другого неограничивающего примера, клетки стабильных клеточных линий могут экспрессировать один или более экзогенных рецепторов эндопептидаз с измененной нацеленностью за счет белковой трансфекции рецепторов эндопептидаз с измененной нацеленностью, таких как, например, ORL1, DOR, KOR, MOR, рецептор галанина 1, рецептор галанина 2 или рецептор галанина 3. Экзогенный рецептор эндопептидаз с измененной нацеленностью может быть природным рецептором эндопептидаз с измененной нацеленностью или его природными вариантами, или не встречающимся в природе рецептором эндопептидаз с измененной нацеленностью или его вариантами, не встречающимися в природе.

[0140] Таким образом, согласно одному варианту реализации, клетки из стабильной клеточной линии экспрессируют эндогенный рецептор эндопептидаз с измененной нацеленностью. Согласно аспектам данного варианта реализации, эндогенный рецептор эндопептидаз с измененной нацеленностью, экспрессируемый клетками из стабильной клеточной линии, представляет собой природный рецептор эндопептидаз с измененной нацеленностью. Согласно другим аспектам данного варианта реализации, эндогенный рецептор эндопептидаз с измененной нацеленностью, экспрессируемый клетками из стабильной клеточной линии, представляет собой SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140. Согласно другим аспектам данного варианта реализации, эндогенный рецептор эндопептидаз с измененной нацеленностью, экспрессируемый клетками из стабильной клеточной линии, представляет собой природный рецептор эндопептидаз с измененной нацеленностью, такой как, например, изоформа рецептора эндопептидаз с измененной нацеленностью или подтип рецептора эндопептидаз с измененной нацеленностью. Согласно другим аспектам данного варианта реализации, эндогенный рецептор эндопептидаз с измененной нацеленностью, экспрессируемый клетками из стабильной клеточной линии, представляет собой природный рецептор эндопептидаз с измененной нацеленностью, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140.

[0141] Согласно другому варианту реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии экзогенного рецептора эндопептидаз с измененной нацеленностью. Согласно одному аспекту данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природного рецептора эндопептидаз с измененной нацеленностью. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природного рецептора эндопептидаз с измененной нацеленностью из SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO; 139 или SEQ ID NO: 140. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природного рецептора эндопептидаз с измененной нацеленностью, такого как, например, изоформа рецептора эндопептидаз с измененной нацеленностью или подтип рецептора эндопептидаз с измененной нацеленностью. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природного рецептора эндопептидаз с измененной нацеленностью, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID N0: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140.

[0142] Согласно другому аспекту настоящего варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии не встречающегося в природе рецептора эндопептидаз с измененной нацеленностью. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии не встречающегося в природе рецептора эндопептидаз с измененной нацеленностью, который, например, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90% или по меньшей мере на 95% идентичен по последовательности аминокислот SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии не встречающегося в природе рецептора эндопептидаз с измененной нацеленностью, включающего не следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии не встречающегося в природе рецептора эндопептидаз с измененной нацеленностью, включающего следующие подряд замены, делеции или инсерции, например, 1 или более, 2 или более, 3 или более, 4 или более, 5 или более, 6 или более, 7 или более, 8 или более, 9 или более, 10 или более, 20 или более, 30 или более, 40 или более, 50 или более или 100 или более аминокислот из SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139 или SEQ ID NO: 140.

[0143] Согласно другому варианту реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии экзогенных ORL1, DOR, KOR, MOR или любой их комбинации. Согласно аспектам этого варианта реализации, клетки стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природных ORL1, DOR, KOR, MOR или любой их комбинации. Согласно другим аспектам этого варианта реализации, клетки стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии не встречающихся в природе ORL1, DOR, KOR, MOR или любой их комбинации. Согласно другим аспектам этого варианта реализации, клетки стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природных или не встречающихся в природе ORL1, DOR, KOR, MOR или любой их комбинации.

[0144] Согласно еще одному варианту реализации, клетки из стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии экзогенных рецептора галанина 1, рецептора галанина 2, рецептора галанина 3 или любой их комбинации. Согласно аспектам этого варианта реализации, клетки стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природных рецептора галанина 1, рецептора галанина 2, рецептора галанина 3 или любой их комбинации. Согласно другим аспектам этого варианта реализации, клетки стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии не встречающихся в природе рецептора галанина 1, рецептора галанина 2, рецептора галанина 3 или любой их комбинации. Согласно другим аспектам этого варианта реализации, клетки стабильной клеточной линии временно или стабильно модифицированы с обеспечением экспрессии природных или не встречающихся в природе рецептора галанина 1, рецептора галанина 2, рецептора галанина 3 или любой их комбинации.

[0145] Клетки, в которых экспрессируются один или несколько эндогенных или экзогенных рецепторов эндопептидаз с измененной нацеленностью, можно идентифицировать обычными методами, включая прямые и косвенные тесты на поглощение эндопептидаз с измененной нацеленностью. Тесты, определяющие параметры связывания или поглощения эндопептидаз с измененной нацеленностью, можно использовать для оценки наличия в клетке экспрессии рецептора эндопептидаз с измененной нацеленностью. Такие тесты включают, но не ограничиваются, опыты по образованию поперечных межмолекулярных связей с использованием меченных эндопептидаз с измененной нацеленностью, таких как, например, [125I] эндопептидаза с измененной нацеленностью, см., например, Noriko Yokosawa et al., Binding of Closthdium botulinum type С neurotoxin to different neuroblastoma cell lines, 57(1) Infect. Immun. 272-277 (1989); Noriko Yokosawa et al„ Binding of botulinum type Cl, D and E neurotoxins to neuronal cell lines and synaptosomes, 29(2) Toxicon 261-264 (1991); и Tei-ichi Nishiki et al., Identification of protein receptor for Clostridium botulinum type В neurotoxin in rat brain synaptosomes, 269(14) J. Biol. Chem. 10498-10503 (1994). Другие неограничивающие примеры тестов включают иммуноцитохимические тесты для детектирования связывания эндопептидаз с измененной нацеленностью с использованием меченных или немеченых антител, см., например, Atsushi Nishikawa et al., The receptor and transporter for internalization of Clostridium botulinum type С progenitor toxin into HT-29 cells, 319(2) Biochem. Biophys. Res. Commun. 327-333 (2004), и тесты с использованием иммунопреципитации, см., например, Yukako Fujinaga et al., Molecular characterization of binding subcomponents of Clostridium botulinum type С progenitor toxin for intestinal epithelial cells and erythrocytes, 150(Pt 5) Microbiology 1529-1538 (2004), для детектирования связанных эндопептидаз с измененной нацеленностью с использованием меченных или немеченых антител. Антитела, пригодные для этих тестов, включают, но не ограничиваются перечисленными: антитела, отобранные против эндопептидаз с измененной нацеленностью, и/или антитела, отобранные против рецепторов эндопептидаз с измененной нацеленностью, таких как, например, ORL1, DOR, KOR, MOR, рецептор галанина 1, рецептор галанина 2 или рецептор галанина 3. Если антитела помечены, связывание молекулы можно детектировать различными средствами, включая анализ с помощью Вестерн блоттинга, прямое микроскопическое наблюдение клеточной локализации антитела, измерение количества связанного с клеткой или с субстратом антитела после этапа отмывки, проточную цитометрию, электрофорез или капиллярный электрофорез, с использованием методов, хорошо известных специалистам в данной области техники. Если антитела не помечены, можно использовать меченные вторичные антитела для косвенного детектирования связанной молекулы и проводить детектирование таким же образом, как и для меченных антител. Следует понимать, что эти и подобные им тесты для определения свойств или характеристик поглощения эндопептидаз с измененной нацеленностью могут быть пригодны для идентификации клеток, экспрессирующих эндогенные или экзогенные рецепторы эндопептидаз с измененной нацеленностью.

[0146] Тесты, определяющие высвобождение молекулы после контакта с эндопептидазами с измененной нацеленностью, можно также использовать для оценки того, экспрессируется ли в клетке один или несколько эндогенных или экзогенных рецепторов эндопептидаз с измененной нацеленностью. В этих тестах ингибирование высвобождения молекулы будет происходить в тех клетках, которые экспрессируют рецептор эндопептидаз с измененной нацеленностью, после обработки эндопептидазами с измененной нацеленностью. Широко известные тесты включают способы измерения ингибирования высвобождения радиоактивно меченного катехоламина из нейронов, такого как, например, высвобождение [3H] норадреналина или [3H] допамина, см., например, A Fassio et al., Evidence for calcium-dependent vesicular transmitter release insensitive to tetanus toxin and botulinum toxin type F, 90(3) Neuroscience 893-902 (1999); и Sara Stigliani et al., The sensitivity of catecholamine release to botulinum toxin C1 and E suggests selective targeting of vesicles set into the readily releasable pool, 85(2) J. Neurochem. 409-421 (2003), или способы измерения высвобождения катехоламина с помощью флуорометрических методов, см., например, Anton de Paiva et al., A role for the interchain disulfide or its participating thiols in the internalization of botulinum neurotoxin A revealed by a toxin derivative that binds to ecto-acceptors and inhibits transmitter release intracellularly, 268(28) J. Biol. Chem. 20838-20844 (1993); Gary W. Lawrence et al., Distinct exocytotic responses of intact and permeabilised chromaffin cells after cleavage of the 25-kDa synaptosomal-associated protein (SNAP-25) or synaptobrevin by botulinum toxin A or B, 236(3) Eur. J. Biochem. 877-886 (1996); и Patrick Foran et al., Botulinum neurotoxin C1 cleaves both syntaxin and SNAP-25 in intact and permeabilized chromaffin cells: correlation with its blockade of catecholamine release, 35(8) Biochemistry 2630-2636 (1996). Другие неограничивающие примеры включают тесты для измерения ингибирования высвобождения гормонов из эндокринных клеток, таких как, например, клетки передней доли гипофиза или клетки яичников. Следует понимать, что эти и подобные им тесты на высвобождение молекул могут быть пригодны для идентификации клеток, экспрессирующих эндогенные или экзогенные рецепторы эндопептидаз с измененной нацеленностью.

[0147] Тесты, которые позволяют детектировать расщепление субстрата SNAP-25 после его обработки эндопептидазами с измененной нацеленностью, можно также использовать для определения, экспрессирует ли клетка один или более эндогенных или экзогенных рецепторов эндопептидаз с измененной нацеленностью. В этих тестах наработка продукта расщепления SNAP-25 или исчезновение не модифицированного SNAP-25 детектируется в клетках, экспрессирующих рецептор эндопептидаз с измененной нацеленностью после обработки эндопептидазами с измененной нацеленностью. Неограничивающие примеры специфичного Вестерн блоттинга, так же как и хорошо охарактеризованные реактивы, условия и протоколы можно легко приобрести у коммерческих производителей, которые включают, но не ограничиваются перечисленными: Amersham Biosciences, Пискэтэуэй, Нью-Джерси; Bio-Rad Laboratories, Геркулес, Калифорния; Pierce Biotechnology, Inc., Рокфорд, Иллинойс; Promega Corporation, Мадисон, Висконсин, и Stratagene, Inc., Ла-Хойя, Калифорния. Следует понимать, что эти и подобное тесты на расщепление SNAP-25 можно использовать для идентификации клеток, экспрессирующих эндогенные или экзогенные рецепторы эндопептидаз с измененной нацеленностью.

[0148] В качестве неограничивающих примеров, Вестерн блоттинг с использованием антител, которые распознают продукт расщепления SNAP-25 или как и расщепленные, так и нерасщепленные формы SNAP-25, можно использовать, для оценки поглощения эндопептидаз с измененной нацеленностью. Примеры анти-SNAP-25 антител, используемых для этого теста, включают, но не ограничиваются перечисленными: мышиные моноклональные aHTH-SNAP-25 антитела SMI-81 (Sternberger Monoclonals Inc., Лютервиль, Мэриленд), мышиные моноклональные анти-SNAP-25 антитела Cl 71.1 (Synaptic Systems, Геттинген, Германия), мышиные моноклональные анти-SNAP-25 антитела Cl 71.2 (Synaptic Systems, Геттинген, Германия), мышиные моноклональные анти-SNAP-25 антитела SP12 (Abeam, Кембридж, Массачусетс), поликлональную сыворотку кролика α-SNAP-25 (Synaptic Systems, Геттинген, Германия), поликлональную сыворотку кролика α-SNAP-25 S9684 (Sigma, Сент-Луис, Миссури) и поликлональную сыворотку кролика α-SNAP-25 (Abeam, Кембридж, Массачусетс).

[0149] Согласно одному аспекту настоящей заявки предложены клетки, которые вследствие генетических манипуляций или рекомбинантной технологии приобрели способность экспрессировать эндогенный SNAP-25 и/или один или несколько экзогенных рецепторов эндопептидаз с измененной нацеленностью. Клетки, пригодные с обеспечением экспрессии эндогенного SNAP-25 и/или одного или более экзогенных рецепторов эндопептидаз с измененной нацеленностью вследствие генетических манипуляций или рекомбинантной технологии, включают нервные и не относящиеся к нервным клетки, которые могут или не могут экспрессировать эндогенный SNAP-25 и/или один или несколько эндогенных рецепторов эндопептидаз с измененной нацеленностью. Далее следует понимать, что такие генетически модифицированные или сконструированные при помощи рекомбинантной технологии клетки могут экспрессировать экзогенный SNAP-25 и один или несколько экзогенных рецепторов эндопептидаз с измененной нацеленностью под контролем конститутивного тканеспецифического и специфического для клетки или индуцибельного промоторного элемента, энхансерного элемента или их обоих. Следует понимать, что любая клетка является пригодной в том случае, если ее можно генетически модифицировать или применять к ней рекомбинантные технологии с целью экспрессии экзогенного SNAP-25 и/или одного или более экзогенных рецепторов эндопептидаз с измененной нацеленностью, и эта клетка способна подвергаться активности эндопептидаз с измененной нацеленностью.

[0150] Способы, пригодные для введения в клетку экзогенных молекул полинуклеотидов, кодирующих компоненты, необходимые для функционирования полного клеточного механизма, посредством которого эндопептидазы с измененной нацеленностью протеолитически расщепляют субстрат SNAP-25, такие как, например, SNAP-25, ORL1, DOR, KOR или MOR, включающие, без ограничения, химические способы, например, опосредуемый фосфатом кальция, опосредуемый диэтиламиноэтилдекстраном (ДЭАЭ), опосредуемый липидами, опосредуемый полиэтиленимином (ПЭИ), опосредуемый полилизином и опосредуемый полибреном; физически-опосредуемыми способами доставки, такими как, например, биолистическая доставка частицы, микроинъекция, слияние протопластов и электропорация; и опосредуемыми вирусом способами доставки, такими как, например, ретровирус-опосредуемая трансфекция, см., например, Introducing Cloned Genes into Cultured Mammalian Cells, pp.16.1-16.62 (Sambrook & Russell, eds., Molecular Cloning A Laboratory Manual, Vol.3, 3rd ed. 2001); Alessia Colosimo et al., Transfer and Expression of Foreign Genes in Mammalian Cells, 29(2) Biotechniques 314-318, 320-322, 324 (2000); Philip Washbourne & A. Kimberley McAllister, Techniques for Gene Transfer into Neurons, 12(5) Curr. Opin. Neurobiol. 566-573 (2002); и Current Protocols in Molecular Biology, John Wiley and Sons, pp 9.16.4-9.16.11 (2000), каждая из которых включена в настоящую заявку посредством ссылки. Специалисты в данной области техники понимают, что выбор определенного способа введения молекулы полинуклеотида в клетку частично зависит от того, стабильно или временно клетка будет содержать компонент, необходимый для функционирования всего клеточного механизма, посредством которого эндопептидазы с измененной нацеленностью протеолитически расщепляют субстрат SNAP-25. Ниже приведены неограничивающие примеры молекул полинуклеотидов, кодирующих компоненты, необходимые для функционирования всего клеточного механизма, посредством которого эндопептидазы с измененной нацеленностью протеолитически расщепляют субстрат SNAP-25: молекулы полинуклеотида ORL1 SEQ ID NO: 61 или SEQ ID NO: 62; молекулы полинуклеотида DOR SEQ ID NO: 63 или SEQ ID NO: 64; молекулы полинуклеотида KOR SEQ ID NO: 65 или SEQ ID NO: 66; и молекулы полинуклеотида MOR SEQ ID NO: 67; молекулы полинуклеотида рецептора галанина 1 SEQ ID NO: 141, SEQ ID NO: 142 или SEQ ID NO: 143, молекулы полинуклеотида рецептора галанина 2 SEQ ID NO: 144 или молекулы полинуклеотида рецептора галанина 3 SEQ ID NO: 145, или молекулы полинуклеотида SNAP-25 SEQ ID NO: 68 или SEQ ID NO: 69.

[0151] Химически опосредуемые способы доставки хорошо известны специалистам в данной области техники и описаны, например, в Martin Jordan & Florian Worm, Transfection of Adherent and Suspended Cells by Calcium Phosphate, 33(2) Methods 136-143 (2004); Chun Zhang et al., Polyethylenimine Strategies for Plasmid Delivery to Brain-Derived Cells, 33(2) Methods 144-150 (2004), каждая из которых включена в настоящую заявку посредством ссылки. Такие химически опосредуемые способы доставки можно выполнить при помощи стандартных процедур, которые доступны коммерчески, см., например, Набор для Трансфекции CellPhect (Amersham Biosciences, Пискэтэуэй, Нью-Джерси); Набор для Трансфекции клеток Млекопитающих, Фосфат кальция и декстран ДЭАЭ (Stratagene, Inc., Ла-Хойя, Калифорния); Реактив для Трансфекции Lipofectamine™ (Invitrogen, Inc., Карлсбад, Калифорния); Набор для Трансфекции ExGen 500 (Fermentas, Inc., Ганновер, Мэриленд), Наборы для Трансфекции SuperFect и Effectene (Qiagen, Inc., Валенсия, Калифорния).

[0152] Физически опосредуемые способы доставки хорошо известны специалистам в данной области техники и описаны, например, в Jeike E. Biewenga et al., Plasmid-Mediated Gene Transfer in Neurons using the Biolistics Technique, 71(1) J. Neurosci, Methods. 67-75 (1997); John O'Brien & Sarah C.R. Lummis, Biolistic and Diolistic Transfection: Using the Gene Gun to Deliver DNA and Lipophilic Dyes into Mammalian Cells, 33(2) Methods 121-125 (2004); M. Golzio et al., In Vitro and In Vivo Electric Field-Mediated Permeabilization, Gene Transfer, and Expression, 33(2) Methods 126-135 (2004); и Oliver Greschet al., New Non-Viral Method for Gene Transfer into Primary Cells, 33(2) Methods 151-163 (2004), каждая из которых включена в настоящую заявку посредством ссылки.

[0153] Опосредуемые вирусом способы доставки хорошо известны специалистам в данной области техники и описаны например, в Chooi M. Lai et al., Adenovirus and Adeno-Associated Virus Vectors, 21(12) DNA Cell Biol. 895-913 (2002); llya Frolov et al., Alphavirus-Based Expression Vectors: Strategies and Applications, 93(21) Proc. Natl. Acad. Sci. U.S.A. 11371-11377 (1996); Roland Wolkowicz et al., Lentiviral Vectors for the Delivery of DNA into Mammalian Cells, 246 Methods Mol. Biol. 391-411 (2004); A. Huser & C. Hofmann, Baculovirus Vectors: Novel Mammalian Cell Gene-Delivery Vehicles and Their Applications, 3(1) Am. J. Pharmacogenomics 53-63 (2003); Tiziana Tonini et al., Transient Production of Retroviral- and Lentiviral-Based Vectors for the Transduction of Mammalian Cells, 285 Methods Mol. Biol. 141-148 (2004); Manfred Gossen & Hermann Buj'ard, Tight Control of Gene Expression in Eukaryotic Cells by Tetracycline-Responsive Promoters, патент США №5464758; Hermann Bujard & Manfred Gossen, Methods for Regulating Gene Expression, патент США №5814618; David S. Hogness, Polynucleotides Encoding Insect Steroid Hormone Receptor Polypeptides and Cells Transformed With Same, патент США №5514578; David S. Hogness, Polynucleotide Encoding Insect Ecdysone Receptor, патент США №6245531; Elisabetta Vegeto et al., Progesterone Receptor Having C. Terminal Hormone Binding Domain Truncations, патент США №5364791; Elisabetta Vegeto et al., Mutated Steroid Hormone Receptors, Methods for Their Use and Molecular Switch for Gene Therapy, патент США №5874534, содержание каждого из которых включено в настоящую заявку посредством ссылки. Такие опосредуемые вирусом способы доставки можно осуществить при помощи стандартных процедур, которые доступны коммерчески, см., например, Аденовирусная Экспрессионная Система ViraPower™ (Invitrogen, Inc., Карлсбад, Калифорния) и Руководство по Эксплуатации Аденовирусной Экспрессионной Системы ViraPower™ 25-0543 версия A, Invitrogen, Inc., (Jul. 15, 2002); Аденовирусная Экспрессионная Система AdEasy™ (Stratagene, Inc., Ла-Хойя, Калифорния) и Руководство по Эксплуатации Аденовирусной Экспрессионной Системы AdEasy™ 064004 т, Stratagene, Inc. Кроме того, такие вирусные системы доставки можно приготовить при помощи стандартных процедур, которые доступны коммерчески, см., например, Системы с обеспечением экспрессии генов BD™ Tet-Off и Tet-On (BD Biosciences-Clonetech, Пало-Альто, Калифорния) и Руководство пользователя к системе с обеспечением экспрессии генов BD™ Tet-Off и Tet-On, PT3001-1, BD Biosciences Clonetech, (14 марта 2003 г.), Система GeneSwitch™ (Invitrogen, Inc., Карлсбад, Калифорния) и Регулируемая мифепристоном Экспрессионная система GeneSwitch™ для клеток млекопитающих, версия D, 25-0313, Invitrogen, Inc., (4 ноября 2002 г.); Лентивирусная Экспрессионная система ViraPower™ (Invitrogen, Inc., Карлсбад, Калифорния) и Руководство по эксплуатации лентивирусной Экспрессионной системы ViraPower™ 25-0501, версия Е, Invitrogen, Inc., (8 декабря 2003 г.); и Ретровирусная индуцибельная система экспрессии для клеток млекопитающих Complete Control® (Stratagene, Ла-Хойя, Калифорния) и Руководство по эксплуатации к ретровирусной индуцибельной системе экспрессии для клеток млекопитающих Complete Control®, 064005e.

[0154] Таким образом, согласно одному варианту реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу, кодирующую компонент, необходимый для функционирования всего клеточного механизма, посредством которого эндопептидазы с измененной нацеленностью протеолитически расщепляют субстрат SNAP-25. Согласно другому варианту реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу, кодирующую ряд компонентов, необходимых для функционирования всего клеточного механизма, посредством которого эндопептидазы с измененной нацеленностью протеолитически расщепляют субстрат SNAP-25. Согласно аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу, кодирующую ORL1, DOR, KOR, MOR или SNAP-25. Согласно аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу SEQ ID NO: 61 или SEQ ID NO: 62, кодирующую ORL1. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу SEQ ID NO: 63 или SEQ ID NO: 64, кодирующую DOR. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу SEQ ID NO: 65 или SEQ ID NO: 66, кодирующую KOR. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу SEQ ID NO: 67, кодирующую MOR.

[0155] Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу SEQ ID NO: 141, SEQ ID NO: 142 или SEQ ID NO: 143, кодирующую рецептор галанина 1. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу SEQ ID NO: 144, кодирующую рецептор галанина 2. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу SEQ ID NO: 145, кодирующую рецептор галанина 3. Согласно дальнейшим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, временно содержат полинуклеотидную молекулу SEQ ID NO: 68 или SEQ ID NO: 69, кодирующую SNAP-25.

[0156] Согласно другому варианту реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу, кодирующую компонент, необходимый для функционирования всего клеточного механизма, посредством которого эндопептидазы с измененной нацеленностью протеолитически расщепляют субстрат SNAP-25. Согласно другому варианту реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу, кодирующую ряд компонентов, необходимых для функционирования всего клеточного механизма, посредством которого эндопептидазы с измененной нацеленностью протеолитически расщепляют субстрат SNAP-25. Согласно аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу, кодирующую ORL1, DOR, KOR, MOR или SNAP-25. Согласно аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу SEQ ID NO: 61 или SEQ ID NO: 62, кодирующую ORL1. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу SEQ ID NO: 63 или SEQ ID NO: 64, кодирующую DOR. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу SEQ ID NO: 65 или SEQ ID NO: 66, кодирующую KOR. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу SEQ ID NO: 67, кодирующую MOR.

[0157] Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу SEQ ID NO: 141, SEQ ID NO: 142 или SEQ ID NO: 143, кодирующую рецептор галанина 1. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу SEQ ID NO: 144, кодирующую рецептор галанина 2. Согласно другим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу SEQ ID NO: 145, кодирующую рецептор галанина 3. Согласно дальнейшим аспектам данного варианта реализации, клетки из стабильной клеточной линии, чувствительной к активности эндопептидаз с измененной нацеленностью, стабильно содержат полинуклеотидную молекулу SEQ ID NO: 68 или SEQ ID NO: 69, кодирующую SNAP-25.

[0158] Как отмечалось выше, экзогенный компонент, необходимый для функционирования полного клеточного механизма, посредством которого эндопептидаза с измененной нацеленностью протеолитически расщепляет субстраты SNAP-25, например, такие как SNAP-25, ORL1, DOR, KOR, MOR, рецептор галанина 1, рецептор галанина 2 или рецептор галанина 3, описанные в настоящей заявке, может быть введен в клетку. Можно использовать любой или все способы, используемые для введения такого экзогенного компонента с помощью средства доставки в клеточные популяции, при условии, что данный способ временно вводит экзогенный компонент, описанный в данной заявке по меньшей мере в 50% клеток данной клеточной популяции. Таким образом аспекты этого варианта реализации могут включать популяции клеток, в которых, например, по меньшей мере 50%, 60%, 70%, 80%, или 90% данной популяции клеток временно содержат экзогенный компонент, необходимый для функционирования полного клеточного механизма, посредством которого эндопептидаза с измененной нацеленностью протеолитически расщепляет субстраты SNAP-25, такие как, например, SNAP-25, ORL1, DOR, KOR, MOR, рецептор галанина 1, рецептор галанина 2 или рецептор галанина 3, описанные в настоящем описании. В настоящей заявке, термин "средство доставки" относится к любой молекуле, которая позволяет или увеличивает поглощение клеткой ковалентно связанного, не ковалентного связанного, или иным образом ассоциированного с этой молекулой полипептида. Таким образом термин "средство доставки" охватывает, без ограничения, белки, пептиды, пептидомиметики, маленькие молекулы, молекулы полинуклеотидов, липосомы, липиды, вирусы, ретровирусы и клетки, которые, без ограничений, транспортируют ковалентно или не ковалентно связанные молекулы к клеточной мембране, цитоплазме клетки или к ядру. Далее предполагается, что термин "средство доставки" охватывает молекулы, которые поглощаются клеткой по любому механизму, включая средства доставки, которые функционируют через эндоцитоз, опосредуемый рецептором, и которые независимы от эндоцитоза, опосредуемого рецептором.

[0159] Средство доставки может также быть препаратом, который обеспечивает или увеличивает поглощение клеткой ковалентно связанного компонента, такого как SNAP-25, ORL1, DOR, KOR, MOR, рецептор галанина 1, рецептор галанина 2 или рецептор галанина 3, например, за счет химического ковалентного связывания или созданных генетически гибридных белков. Способы, в которых средства доставки ковалентно связываются и способы использования таких средств описаны, например, в Steven F. Dowdy, Protein Transduction System and Methods of Use Thereof, международная публикация WO 00/34308; Gerard Chassaing & Alain Prochiantz, Peptides which can be Used as Vectors for the Intracellular Addressing of Active Molecules, патент США №6080724; Alan Frankel et al., Fusion Protein Comprising TAT-dehved Transport Moiert, патент США №5674980; Alan Frankel et al., TAT-derived Transport Polypeptide Conjugates, патент США №5747641; Alan Frankel et al., TAT-derived Transport Polypeptides and Fusion Proteins, патент США №5804604; Peter F. J. O'Hare et al., Use of Transport Proteins, патент США №6734167; Yao-Zhong Lin & Jack J. Hawiger, Method for Importing Biologically Active Molecules into Cells, патент США №5807746; Yao-Zhong Lin & Jack J. Hawiger, Method for Importing Biologically Active Molecules into Cells, патент США №6043339; Yao-Zhong Lin et al., Sequence and Method for Genetic Engineering of Proteins with Cell Membrane Translating Activity, патент США №6248558; Yao-Zhong Lin et al., Sequence and Method for Genetic Engineering of Proteins with Cell Membrane Translocating Activity, патент США №6432680; Jack J. Hawiger et al., Method for Importing Biologically Active Molecules into Cells, патент США №6495518; Yao-Zhong Lin et al., Sequence and Method for Genetic Engineering of Proteins with Cell Membrane Translocating Activity, патент США №6780843; Jonathan В, Rothbard & Paul AWender, Method and Composition for Enhancing Transport Across Biological Membranes, патент США №6306993; Jonathan B. Rothbard & Paul A Wender, Method and Composition for Enhancing Transport Across Biological Membranes, патент США №6495663; and Pamela В. Davis et al., Fusion Proteins for Protein Delivery, патент США №6287817, содержание каждого из которых включено в настоящую заявку посредством ссылки.

[0160] Средство доставки может также представлять собой средство, которое обеспечивает или увеличивает поглощение клеткой нековалентно связанного компонента, такого как SNAP-25, ORL1, DOR, KOR, MOR, рецептор галанина 1, рецептор галанина 2 или рецептор галанина 3. Способы, которые работают в отсутствие ковалентной связи, и способы использования таких средств, описаны, например, в Gilles Divita et al, Peptide-Mediated Transfection Agents and Methods of Use, патент США №6,841,535; Philip L Felgner and Oiivier Zeiphati, Intracellular Protein Delivery Compositions and Methods of Use, публикация патента США №2003/0008813; и Michael Karas, Intracellular Delivery of Small Molecules, Proteins and Nucleic Acids, публикация заявки на патент США №2004/0209797, содержание каждого из которых включено в настоящую заявку посредством ссылки. Такие средства доставки пептидов можно приготовить и использовать по стандартным процедурам, которые доступны коммерчески, см., например, Реактив CHARIOT™ (Active Motif, Карлсбад, Калифорния); Реактив BIO-PORTER® (Gene Therapy Systems, Inc., Сан Диего, Калифорния), Реактив для доставки белка BIO TREK™ (Stratagene, Ла-Хойя, Калифорния), и Реактив для белковой трансфекции PRO-JECT™ (Pierce Biotechnology Inc., Рокфорд, Иллинойс).

[0161] Часть аспектов настоящей заявки включает образец, содержащий эндопептидазы с измененной нацеленностью. В настоящей заявке термин "образец, содержащий эндопептидазы с измененной нацеленностью" относится к любому биологическому материалу, который содержит или потенциально содержит активные эндопептидазы с измененной нацеленностью. Согласно способу, описанному в настоящей заявке, можно тестировать различные образцы, включая, без ограничения, очищенные, частично очищенные или неочищенные эндопептидазы с измененной нацеленностью; рекомбинантные эндопептидазы с измененной нацеленностью, содержащие одну или две цепи, с природной или не встречающейся в природе последовательностью; рекомбинантные эндопептидазы с измененной нацеленностью, обладающие модифицированной протеазной нацеленностью; рекомбинантные эндопептидазы с измененной нацеленностью, обладающие измененной клеточной нацеленностью; массовые образцы эндопептидаз с измененной нацеленностью; составы на основе эндопептидаз с измененной нацеленностью; и клетки или необработанные, фракционированные или частично очищенные клеточные лизаты, источниками которых являются, например, бактерии, дрожжи, насекомые или млекопитающие; кровь, плазма или сыворотка; сырые, частично приготовленные, приготовленные или обработанные пищевые продукты; напитки; корма для животных; образцы почвы; образцы воды; прудовые донные отложения; лосьоны; косметика; и клинические препараты. Следует понимать, что термин "образец" включает образцы тканей, включая, без ограничения, образцы тканей млекопитающих, образцы тканей домашнего скота, такие как образцы тканей овец, коров и свиней; образцы тканей приматов; и образцы тканей человека. Такие образцы включают, без ограничения, желудочно-кишечные образцы, такие как желудочно-кишечные образцы, взятые у детей, и образцы тканей, полученные из раны. В качестве неограничивающих примеров, способ детектирования пикомолярных количеств активности эндопептидаз с измененной нацеленностью может быть пригоден для определения присутствия или активности эндопептидаз с измененной нацеленностью в образцах пищевых продуктов или напитков; для анализа образцов, взятых у человека или животных, например, контактировавших с эндопептидазами с измененной нацеленностью или демонстрирующих один или несколько симптомов ботулизма; для контроля за активностью при производстве и очистке массовых образцов эндопептидаз с измененной нацеленностью; для анализа состава на основе эндопептидаз с измененной нацеленностью, используемого для фармакологических или косметических целей; или для анализа сыворотки крови субъекта на присутствие или отсутствие нейтрализующих антител против эндопептидазы с измененной нацеленностью.

[0162] Таким образом, согласно одному варианту реализации, образцом, содержащим эндопептидазы с измененной нацеленностью, является образец, содержащий любые количества эндопептидаз с измененной нацеленностью. Согласно аспектам данного варианта реализации, образец, содержащий эндопептидазы с измененной нацеленностью, содержит приблизительно 100 нг или менее, приблизительно 10 нг или менее, приблизительно 1 нг или менее, приблизительно 100 пг или менее, приблизительно 10 пг или менее или приблизительно 1 пг или менее эндопептидаз с измененной нацеленностью. Согласно другим аспектам данного варианта реализации, образец, содержащий эндопептидазы с измененной нацеленностью, содержит приблизительно 1 мкМ или менее, приблизительно 100 нМ или менее, приблизительно 10 нМ или менее, приблизительно 1 нМ или менее, приблизительно 100 нМ или менее, приблизительно 10 нМ или менее, приблизительно 1 нМ или менее эндопептидаз с измененной нацеленностью.

[0163] Часть аспектов настоящей заявки включает выделение из обработанной клетки компонента SNAP-25, содержащего SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A. В настоящей заявке термин "компонент SNAP-25, содержащий SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A" относится к клеточному компоненту, содержащему продукт расщепления SNAP-25. Предполагается, что пригодным является любой способ, подходящий для обогащения или выделения компонента SNAP-25, включая, без ограничения, протоколы для лизирования клеток, протоколы для очистки на спин-колонках, иммунопреципитацию, аффинную очистку и хроматографию белков.

[0164] Часть аспектов настоящей заявки включает анти-SNAP-25 антитела, иммобилизованные на твердофазной подложке. В настоящей заявке термин "твердофазная подложка" является синонимом термина "твердая фаза" и относится к любой матрице, которую можно использовать для иммобилизации анти-SNAP-25 антител, описанных в настоящей заявке. Неограничивающие примеры твердофазных подложек включают, например, пробирку; чашку; колонку; палочки или "тест-полоски"; магнитные частицы, шарики или другую хроматографическую среду сферической или нитчатой формы, такую как, например, агароза, сефароза, силикагель или пластик; и листы или мембраны, такие как, например, нитроцеллюлоза или поливинилиденфторид (ПВДФ). Твердофазную подложку можно сконструировать с использованием разнообразных материалов, таких как, например, стекло, углерод, полистирол, поливинилхлорид, полипропилен, полиэтилен, декстран, нейлон, диазоцеллюлоза или крахмал. Выбранная твердофазная подложка может обладать физическими свойствами, которые позволяют легко отделять ее от растворимого или несвязанного материала и в целом позволяют отделять или иным образом удалять (например, с помощью отмывки, фильтрации, центрифугирования и т.д.) несвязанные материалы, такие как, например, избыточные реактивы, побочные продукты реакции или растворители, от компонента теста, связанного с твердофазной подложкой. Неограничивающие примеры изготовления и использования твердофазных подложек описаны, например, в Molecular Cloning, A Laboratory Manual, см. выше, (2001); и Current Protocols in Molecular Biology, см. выше, (2004), каждый из которых включен в настоящую заявку посредством ссылки.

[0165] Часть аспектов настоящей заявки включает детектирование присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, и продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Предполагается, что для осуществления на практике аспектов описанного иммунологического способа можно использовать любую систему детектирования при условии, что отношение сигнала к шуму позволяет в статистически значимой степени отличить сигнал комплекса антитело-антиген от фонового сигнала. Неограничивающие примеры иммунологических систем детектирования включают иммуноблот-анализ, такой как Вестерн блоттинг и дот-блоттинг, анализ с помощью иммунопреципитации, твердофазный иммуноферментный анализ (твердофазный ИФА) и "сэндвич"-метод твердофазного ИФА. Детектирование сигнала можно достигнуть с помощью использования авторадиографии с получением изображения или формированием изображения на люминесцентном фосфорном покрытии (AU), хемилюминесценции (CL), электрохемилюминесценции (ECL), биолюминесценции (BL), флюоресценции, резонансного переноса энергии, линейной поляризации, колориметрических методов или проточной цитометрии (FC). Описания иммунологических систем детектирования приведены, например, в Michael M.Rauhut, Chemiluminescence, In Kirk-Othmer Concise Encyclopedia of Chemical Technology (Ed. Grayson, 3rd ed, John Wiley and Sons, 1985); A.W.Knight, A Review of Recent Trends in Analytical Applications of Electrogenerated Chemiluminescence, Trends Anal. Chem. 18(1): 47-62 (1999); K.A.Fahnrich, et al., Recent Applications of Electrogenerated Chemiluminescence in Chemical Analysis, Talanta 54(4): 531-559 (2001); Commonly Used Techniques in Molecular Cloning, pp.A8.1-A8-55 (Sambrook & Russell, eds., Molecular Cloning A Laboratory Manual, Vol.3, 3rd ed. 2001); Detection Systems, pp.A9.1-A9-49 (Sambrook & Russell, eds., Molecular Cloning A Laboratory Manual, Vol.3, 3rd ed. 2001); Electrogenerated Chemiluminescence, (Ed. Alien J. Bard, Marcel Dekker, Inc., 2004), каждый из которых полностью включен в настоящую заявку посредством ссылки.

[0166] "Сэндвич"-метод твердофазного ИФА (или "сэндвич"-метод иммунологического анализа) представляет собой метод, основанный на двух антителах, которые связываются с различными эпитопами на антигене. Иммобилизованное, имеющее высокую специфичность связывания в отношении интересующего антигена, связано с твердой поверхностью. Затем добавляют антиген, после чего добавляют второе антитело, называемое детектирующим антителом. Детектирующее антитело связывается с эпитопом антигена, отличным от эпитопа, с которым связывается иммобилизованное антитело. Таким образом, антиген и два антитела, между которыми он находится, представляют собой "сэндвич". Аффинность связывания антител с антигеном обычно является главным фактором, определяющим чувствительность иммунологического анализа. С увеличением концентрации антигена увеличивается и количество детектирующих антител, что приводит к увеличению измеряемого ответа. Для количественного определения степени связывания можно использовать различные репортерные системы, такие как, например, фермент, связанный со вторичными антителами, и субстрат-репортер, где ферментативная реакция формирует показание детектируемого сигнала. Производимый сигнал пропорционален количеству антигена-мишени, присутствующему в образце. Субстрат-репортер, используемый для измерения событий связывания, определяет способ детектирования. Спектрофотометрический сканер планшетов используется для колориметрического детектирования. Были разработаны хемилюминесцентные и электрохемилюминесцентные субстраты, которые обеспечивают дальнейшее усиление сигнала, и получение изображения от таких субстратов можно проводить на люминесцентном сканере. Репортер также может быть приспособлен для флуоресцентного сканера таким образом, что ферментативный этап теста заменен флуорофором, и измерение сигнала можно проводить, используя флуоресцентный сканер. Реагенты и протоколы, необходимые для проведения «сэндвич”-метода твердофазного ИФА с усиленной хемилюминесценцией, коммерчески доступны, включая, без исключения, платформу MSD для электрохемилюминесцентного "сэндвич"-метода твердофазного ИФА (Meso Scale Discovery, Гейтерсбург, Мэриленд).

[0167] Таким образом, согласно одному варианту реализации, детектирование присутствия комплекса антитело-антиген, включающего анти-ЗМАР-25 антитела, которые избирательно связываются с эпитопом SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления ВоМТ/А, и продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A, можно проводить путем анализа с использованием иммуно-блоттинга, анализа с использованием иммунопреципитации, твердофазного ИФА или "сэндвич"-метода твердофазного ИФА. Согласно аспектам данного варианта реализации, детектирование проводят посредством анализов AU, CL, ECL или BL с использованием иммуно-блоттинга, анализов AU, CL, ECL, BL или FC с использованием иммунопреципитации, анализов AU, CL, ECL, BL или FC с использованием твердофазного ИФА или анализов AU, CL, ECL, BL или FC с использованием "сэндвич"-метода твердофазного ИФА.

[0168] Аспекты настоящего описания можно осуществлять в одноканальном или многоканальном режиме. Иммунологический способ детектирования активности эндопептидаз с измененной нацеленностью, осуществляемый в одноканальном режиме, детектирует лишь присутствие комплекса антитело-антиген, включающего анти-SNAP-25 антитела и продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Иммунологический способ детектирования активности эндопептидаз с измененной нацеленностью, осуществляемый в многоканальном режиме, одновременно детектирует присутствие двух или более комплексов антитело-антиген; один из которых представляет собой комплекс антитело-антиген, включающий анти-SNAP-25 антитела и продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A; a другой(ие) из которых представляет собой комплекс антитело-антиген, содержащий второй, третий, четвертый и т.д. белок, отличный от вышеупомянутого. Второй белок может использоваться, например, в качестве внутреннего контроля для минимизации изменчивости между пробами путем нормирования детектированного количества комплекса антитело/антиген Q-SNAP-25/SNAP-25 относительно количества комплекса антитело/антиген, детектированного для второго белка. В связи с этим, в качестве второго белка обычно используют белок, конститутивно экспрессируемый в клетке, такой как белок домашнего хозяйства. Неограничивающие примеры подходящего второго белка включают, например, глицеральдегид-3-фосфатдегидрогеназу (GAPDH), синтаксин, цитокины. Способы проведения иммунологических тестов в многоканальном режиме описаны, например, в U.В.Nielsen and В.Н.Geierstanger, Multiplexed Sandwich Assays in Microarray Format, J. Immunol. Methods. 290(1-2): 107-120 2004); R. Barry and M, Soloviev, Quantitative Protein Profiling using Antibody Arrays, Proteomics, 4(12): 3717-3726 (2004); M.M.Ling et al., Multiplexing Molecular Diagnostics and Immunoassays using Emerging Microarray Technologies, Expert Rev Mol Diagn. 7(1): 87-98 (2007); S.X.Leng et al., ELISA and Multiplex Technologies for Cytokine Measurement in Inflammation and Aging Research, J Gerontol A Biol Sci Med Sci. 63(8): 879-884 (2008), каждый из которых полностью включен в настоящую заявку посредством ссылки.

[0169] Таким образом, согласно одному варианту реализации, Иммунологический способ детектирования активности эндопептидаз с измененной нацеленностью проводится в одноканальном режиме путем детектирования присутствия лишь комплекса антитело-антиген, включающего анти-SNAP-25 антитела и продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A. Согласно другому варианту реализации, иммунологический способ детектирования активности эндопептидаз с измененной нацеленностью проводится в многоканальном режиме путем одновременного детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитела и продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, и по меньшей мере еще одного комплекса антитело-антиген, содержащего белок, отличный от SNAP-25, такой как, например, GAPDH или синтаксин.

[0170] Согласно части аспектов настоящей заявки предложен способ определения иммунной резистентности по отношению к эндопептидазе с измененной нацеленностью. В настоящей заявке термин "иммунная резистентность по отношению к эндопептидазе с измененной нацеленностью" означает млекопитающее, которое не демонстрирует полный ответ на терапию с помощью эндопептидазы с измененной нацеленностью или демонстрирует пониженный положительный эффект от терапии с помощью эндопептидазы с измененной нацеленностью, поскольку иммунный ответ данного животного, напрямую или косвенно, снижает эффективность такой терапии. В качестве неограничивающего примера сниженной эффективности можно привести присутствие у млекопитающего по меньшей мере одного вида нейтрализующих антител против эндопептидазы с измененной нацеленностью, которые связываются с эндопептидазой с измененной нацеленностью таким образом, что специфичность или активность этой эндопептидазы с измененной нацеленностью снижается или предотвращается. В настоящей заявке термин "терапия с помощью эндопептидазы с измененной нацеленностью" означает лечение, помощь, излечивание, выздоровление, реабилитацию или любые другие меры противодействия чему-либо нежелательному у млекопитающих, требующие нейромодуляции с использованием эндопептидазы с измененной нацеленностью, или введение млекопитающему одной или нескольких контролируемых доз лекарственного средства, препарата или смеси эндопептидазы с измененной нацеленностью, которая имеет лекарственный, терапевтический, лечебный, косметический, излечивающий или иной полезный эффект. Терапия с помощью эндопептидазы с измененной нацеленностью включает, без ограничения, использование любого ее природного или модифицированного фрагмента, в любом составе, в комбинации с любым носителем или активным ингредиентом и введение любым путем.

[0171] Согласно части аспектов настоящей заявки предложен тестируемый образец, полученный из организма млекопитающего, тестируемого на наличие или отсутствие нейтрализующих антител против эндопептидазы с измененной нацеленностью. В настоящей заявке термин "тестируемый образец" относится к любому биологическому материалу, который содержит или потенциально содержит по меньшей мере одно антитело против эндопептидазы с измененной нацеленностью. Антитело против эндопептидазы с измененной нацеленностью может являться нейтрализующим антителом против эндопептидазы с измененной нацеленностью или не нейтрализующим антителом против эндопептидазы с измененной нацеленностью. В настоящей заявке термин "нейтрализующие антитела против эндопептидазы с измененной нацеленностью" означает любое антитело против эндопептидазы с измененной нацеленностью, которое при физиологических условиях связывается с участком эндопептидазы с измененной нацеленностью таким образом, что снижает или предотвращает эффект эндопептидазы с измененной нацеленностью в терапии с помощью эндопептидазы с измененной нацеленностью. В настоящей заявке термин "не нейтрализующие антитела против эндопептидазы с измененной нацеленностью" означает любое антитело против эндопептидазы с измененной нацеленностью, которое при физиологических условиях связывается с участком эндопептидазы с измененной нацеленностью, но не предотвращает эффект эндопептидазы с измененной нацеленностью в терапии с помощью эндопептидазы с измененной нацеленностью. Предполагается, что все без исключения образцы, которые могут содержать антитела против эндопептидазы с измененной нацеленностью, можно использовать в данном способе, включая, без ограничения, кровь, плазму, сыворотку и лимфатическую жидкость. Кроме того, все без исключения организмы, способные производить антитела против эндопептидазы с измененной нацеленностью, могут служить источниками образцов, включая, но не ограничиваясь перечисленными: птицы и млекопитающие, включая мышей, крыс, коз, овец, лошадей, ослов, коров, приматов и человека. Неограничивающие примеры конкретных протоколов для сбора крови и приготовления сыворотки описаны, например, в Marjorie Schaub Di Lorenzo & Susan King Strasinger, blood collection in healthcare (F.A. Davis Company, 2001); и Diana Garza & Kathleen Becan-McBride, phlebotomy handbook: blood collection essentials (Prentice Hall, 6th ed„ 2002). Эти протоколы представляют собой обычные процедуры, хорошо известные специалистам в данной области техники и из соответствующих программ обучения. Тестируемый образец можно получить из организма до контакта с эндопептидазами с измененной нацеленностью, после однократной обработки эндопептидазами с измененной нацеленностью, после многократных обработок эндопептидазами с измененной нацеленностью, до наступления резистентности к терапии с помощью эндопептидаз с измененной нацеленностью или после наступления резистентности к терапии с использованием эндопептидаз с измененной нацеленностью.

[0172] Согласно части аспектов настоящей заявки предложен контрольный образец. В настоящей заявке термин "контрольный образец" означает любой образец, для которого известно присутствие или отсутствие тестируемого образца, и включает образцы как отрицательного, так и положительного контроля. В отношении нейтрализующих антител против эндопептидазы с измененной нацеленностью, образец отрицательного контроля можно получить от субъекта, который никогда не контактировал с эндопептидазой с измененной нацеленностью, и он может включать, без ограничения, образец от того же субъекта, у которого производится сбор тестируемого образца, но взятый до проведения терапии с помощью эндопептидазы с измененной нацеленностью; образец, взятый от другого субъекта, который никогда не контактировал с эндопептидазой с измененной нацеленностью; объединенный образец, взятый от нескольких разных субъектов, которые никогда не контактировали с ВоМТ/А. В отношении нейтрализующих антител против эндопептидазы с измененной нацеленностью, образец положительного контроля можно получить от субъекта, который демонстрирует иммунную резистентность к эндопептидазе с измененной нацеленностью, и он включает, без ограничения, субъекта, демонстрирующего положительный результат в тесте для пациентов; субъекта, демонстрирующего положительный результат в биотесте in vivo; и субъекта, демонстрирующего повышенный иммунитет, например, субъекта, вакцинированного эндопептидазой с измененной нацеленностью.

[0173] Кроме того, предполагается, что антитела против зндопептидазы с измененной нацеленностью можно очистить из образца. Антитела против эндопептидазы с измененной нацеленностью можно очистить из образца, используя множество процедур, включая, без ограничения, хроматографию с белком A/G и аффинную хроматографию. Неограничивающие примеры конкретных протоколов для очистки антител из образца описаны, например, в antibodies: A laboratory manual (Edward Harlow & David Lane, eds, Cold Spring Harbor Laboratory Press, 2nd ed. 1998); using antibodies: A laboratory manual: portable protocol No. I (Edward Harlow & David Lane, Cold Spring Harbor Laboratory Press, 1998); и molecular cloning, A laboratory manual, см. выше, (2001), которые включены в настоящую заявку посредством ссылки. Кроме того, неограничивающие примеры способов очистки антител, как и подробно охарактеризованных реагентов, условий и протоколов, можно легко получить от коммерческих поставщиков, включающих, без ограничения, Pierce Biotechnology, Inc., Рокфорд, Иллинойс; и Zymed Laboratories, Inc., Южный Сан-Франциско, Калифорния. Эти протоколы и стандартные процедуры хорошо известны специалистам в данной области техники.

[0174] Таким образом, согласно одному варианту реализации, образец включает кровь. Согласно одному аспекту настоящего варианта реализации, образец включает кровь мышей, кровь крыс, кровь коз, кровь овец, кровь лошадей, кровь ослов, кровь коров, кровь приматов или человеческую кровь. Согласно другому варианту реализации, образец включает плазму. Согласно одному аспекту настоящего варианта реализации, тестируемый образец включает плазму мышей, плазму крыс, плазму коз, плазму овец, плазму лошадей, плазму ослов, плазму коров, плазму приматов или человеческую плазму. Согласно другому варианту реализации, образец включает сыворотку. Согласно одному аспекту настоящего варианта реализации, образец включает сыворотку мышей, сыворотку крыс, сыворотку коз, сыворотку овец, сыворотку лошадей, сыворотку ослов, сыворотку коров, сыворотку приматов и человеческую сыворотку. Согласно другому варианту реализации, образец включает лимфатическую жидкость. Согласно одному аспекту настоящего варианта реализации, образец включает лимфатическую жидкость мышей, лимфатическую жидкость крыс, лимфатическую жидкость коз, лимфатическую жидкость овец, лимфатическую жидкость лошадей, лимфатическую жидкость ослов, лимфатическую жидкость коров, лимфатическую жидкость приматов или лимфатическую жидкость человека. Согласно еще одному варианту реализации, образец представляет собой тестируемый образец. Согласно еще одному варианту реализации, образец представляет собой контрольный образец. Согласно аспектам данного варианта реализации, контрольный образец представляет собой образец отрицательного контроля или образец положительного контроля.

[0175] Согласно части аспектов настоящей заявки предложено сравнение количества SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, детектируемого на этапе (г), с количеством SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, детектируемым на этапе (д). Согласно одному варианту реализации, количество продукта расщепления SNAP-25 в тестируемом образце больше, чем количество продукта расщепления SNAP-25 в контрольном образце. Согласно одному аспекту настоящего варианта реализации, большее количество продукта расщепления SNAP-25 в тестируемом образце по сравнению с образцом положительного контроля свидетельствует о снижении или отсутствии у млекопитающего иммунной резистентности по отношению к эндопептидазе с измененной нацеленностью. Согласно другому аспекту настоящего варианта реализации, равное количество продукта расщепления SNAP-25 в тестируемом образце по сравнению с образцом отрицательного контроля свидетельствует о снижении или отсутствии у млекопитающего иммунной резистентности по отношению к эндопептидазе с измененной нацеленностью. Согласно другому варианту реализации, количество продукта расщепления SNAP-25 в тестируемом образце меньше, чем количество продукта расщепления SNAP-25 в контрольном образце. Согласно одному аспекту настоящего варианта реализации, меньшее или равное количество продукта расщепления SNAP-25 в тестируемом образце по сравнению с образцом положительного контроля свидетельствует о повышении или присутствии у млекопитающего иммунной резистентности по отношению к эндопептидазе с измененной нацеленностью. Согласно другому аспекту настоящего варианта реализации, меньшее количество продукта расщепления SNAP-25 в тестируемом образце по сравнению с образцом отрицательного контроля свидетельствует о повышении или присутствии у млекопитающего иммунной резистентности по отношению к эндопептидазе с измененной нацеленностью.

[0176] Предполагается, что все без исключения условия теста, подходящие для детектирования присутствия в образце нейтрализующих антител против эндопептидазы с измененной нацеленностью, пригодны для способов, описанных в настоящей заявке, такие как, например, линейные условия теста и нелинейные условия теста. Согласно одному варианту реализации, условия теста являются линейными. Согласно одному аспекту настоящего варианта реализации, участвующее в тесте количество эндопептидазы с измененной нацеленностью избыточно. Согласно другому аспекту настоящего варианта реализации, участвующее в тесте количество эндопептидазы с измененной нацеленностью лимитирует скорость реакции. Согласно другому аспекту настоящего варианта реализации, участвующее в тесте количество тестируемого образца лимитирует скорость реакции.

[0177] Аспекты настоящей заявки можно также описать следующим образом:

1. Способ детектирования активности эндопептидаз с измененной нацеленностью, включающий этапы а) обработки клетки из стабильной клеточной линии образцом, содержащим эндопептидазу с измененной нацеленностью, причем клетка из стабильной клеточной линии чувствительна к активности эндопептидазы с измененной нацеленностью; б) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A; в) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, причем анти-SNAP-25 антитело связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; и г) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; при этом детектирование с использованием комплекса антитело-антиген является показателем активности эндопептидазы с измененной нацеленностью.

2. Способ детектирования активности эндопептидаз с измененной нацеленностью, включающий этапы а) обработки клетки из стабильной клеточной линии образцом, содержащим эндопептидазу с измененной нацеленностью, причем клетка из стабильной клеточной линии чувствительна к активности эндопептидазы с измененной нацеленностью; б) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A; в) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, иммобилизованнымина твердофазной подложке, причем анти-SNAP-25 антитело связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; и г) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; при этом детектирование с использованием комплекса антитело-антиген является показателем активности эндопептидазы с измененной нацеленностью.

3. Способ детектирования активности эндопептидаз с измененной нацеленностью, включающий этапы а) обработки клетки из стабильной клеточной линии образцом, содержащим эндопептидазу с измененной нацеленностью, причем клетка из стабильной клеточной линии чувствительна к активности эндопептидазы с измененной нацеленностью; б) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A; в) иммобилизации компонента SNAP-25 на твердофазной подложке; г) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, причем анти-SNAP-25 антитело связывает с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; и д) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; при этом детектирование с использованием комплекса антитело-антиген является показателем активности эндопептидазы с измененной нацеленностью.

4. Способ детектирования активности эндопептидаз с измененной нацеленностью, включающий этапы а) обработки клетки из стабильной клеточной линии образцом, содержащим эндопептидазу с измененной нацеленностью, причем клетка из стабильной клеточной линии обладает способностью к поглощению эндопептидазы с измененной нацеленностью; б) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A; в) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, причем анти-SNAP-25 антитело связывается с зпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; и г) детектирования присутствия комплекса антитело-антиген, включающего aHTH-SNAP-25 антитело и продукт расщепления SNAP-25; при этом детектирование с использованием комплекса антитело-антиген является показателем активности эндопептидазы с измененной нацеленностью.

5. Способ детектирования активности эндопептидаз с измененной нацеленностью, включающий этапы а) обработки клетки из стабильной клеточной линии образцом, содержащим эндопептидазу с измененной нацеленностью, причем клетка из стабильной клеточной линии обладает способностью к поглощению эндопептидазы с измененной нацеленностью; б) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A; в) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, иммобилизованным на твердофазной подложке, причем анти-SNAP-25 антитело связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; и г) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; при этом детектирование с использованием комплекса антитело-антиген является показателем активности эндопептидазы с измененной нацеленностью.

6. Способ детектирования активности эндопептидаз с измененной нацеленностью, включающий этапы а) обработки клетки из стабильной клеточной линии образцом, содержащим эндопептидазу с измененной нацеленностью, причем клетка из стабильной клеточной линии обладает способностью к поглощению эндопептидазы с измененной нацеленностью; б) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A; в) иммобилизации компонента SNAP-25 на твердофазной подложке; г) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, причем анти-SNAP-25 антитело связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; и д) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; при этом детектирование с использованием комплекса антитело-антиген является показателем активности эндопептидазы с измененной нацеленностью.

7. Способ определения иммунной резистентности млекопитающих по отношению к эндопептидазе с измененной нацеленностью, включающий этапы а) добавления эндопептидазы с измененной нацеленностью к тестируемому образцу, полученному из млекопитающего, тестируемого на наличие или отсутствие нейтрализующих антител против эндопептидазы с измененной нацеленностью; б) обработки клетки из стабильной клеточной линии тестируемым образцом, причем клетка из стабильной клеточной линии чувствительна к активности эндопептидазы с измененной нацеленностью; в) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A; г) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, причем анти-ЗМАР-25 антитело связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; д) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; e) повторения этапов 6-д с образцом для отрицательного контроля вместо тестируемого образца, причем образец для отрицательного контроля содержит эндопептидазу с измененной нацеленностью и сыворотку, в отношении которой известно, что она не содержит нейтрализующие антитела против эндопептидазы с измененной нацеленностью; ж) сравнения количества комплекса антитело-антиген, детектированного на этапе д, с количеством комплекса антитело-антиген, детектированным на этапе e, при этом детектирование меньшего количества комплекса антитело-антиген, детектированного на этапе д, по сравнению с количеством комплекса антитело-антиген, детектированным на этапе e, свидетельствует о присутствии нейтрализующих антител против эндопептидазы с измененной нацеленностью.

8. Способ определения иммунной резистентности млекопитающих по отношению к эндопептидазе с измененной нацеленностью, включающий этапы а) добавления эндопептидазы с измененной нацеленностью к тестируемому образцу, полученному из млекопитающего, тестируемого на наличие или отсутствие нейтрализующих антител против эндопептидазы с измененной нацеленностью; б) обработки клетки из стабильной клеточной линии тестируемым образцом, причем клетка из стабильной клеточной линии чувствительна к активности эндопептидазы с измененной нацеленностью; в) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A; г) осуществления контакта SNAP-25 с aHTH-SNAP-25 антителом, иммобилизованным на твердофазной подложке, причем анти-SNAP-25 антитело связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; д) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; e) повторения этапов 6-д с образцом для отрицательного контроля вместо тестируемого образца, причем образец для отрицательного контроля содержит эндопептидазу с измененной нацеленностью и сыворотку, в отношении которой известно, что она не содержит нейтрализующие антитела против эндопептидазы с измененной нацеленностью; ж) сравнения количества комплекса антитело-антиген, детектированного на этапе д, с количеством комплекса антитело-антиген, детектированным на этапе е, при этом детектирование меньшего количества комплекса антитело-антиген, детектированного на этапе д, по сравнению с количеством комплекса антитело-антиген, детектированным на этапе е, свидетельствует о присутствии нейтрализующих антител против эндопептидазы с измененной нацеленностью.

9. Способ определения иммунной резистентности млекопитающих по отношению к эндопептидазе с измененной нацеленностью, включающий этапы а) добавления эндопептидазы с измененной нацеленностью к тестируемому образцу, полученному из млекопитающего, тестируемого на наличие или отсутствие нейтрализующих антител против эндопептидазы с измененной нацеленностью; б) обработки клетки из стабильной клеточной линии тестируемым образцом, причем клетка из стабильной клеточной линии чувствительна к активности эндопептидазы с измененной нацеленностью; в) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток Pi разрезаемой связи в сайте расщепления BoNT/A; г) иммобилизации компонента SNAP-25 на твердофазной подложке; д) осуществления контакта SNAP-25 с анти-SNAP-25 антителом, причем анти-SNAP-25 антитело связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; е) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; ж) повторения этапов 6-е с образцом для отрицательного контроля вместо тестируемого образца, причем образец для отрицательного контроля содержит эндопептидазу с измененной нацеленностью и сыворотку, в отношении которой известно, что она не содержит нейтрализующие антитела против эндопептидазы с измененной нацеленностью; з) сравнения количества комплекса антитело-антиген, детектированного на этапе е, с количеством комплекса антитело-антиген, детектированным на этапе ж, при этом детектирование меньшего количества комплекса антитело-антиген, детектированного на этапе е, по сравнению с количеством комплекса антитело-антиген, детектированным на этапе ж, свидетельствует о присутствии нейтрализующих антител против эндопептидазы с измененной нацеленностью.

10. Способ определения иммунной резистентности млекопитающих по отношению к эндопептидазе с измененной нацеленностью, включающий этапы а) добавления эндопептидазы с измененной нацеленностью к тестируемому образцу, полученному из млекопитающего, тестируемого на наличие или отсутствие нейтрализующих антител против эндопептидазы с измененной нацеленностью; б) обработки клетки из стабильной клеточной линии тестируемым образцом, причем клетка из стабильной клеточной линии обладает способностью к поглощению эндопептидазы с измененной нацеленностью; в) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A; г) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, причем анти-SNAP-25 антитело связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; д) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; e) повторения этапов 6-д с образцом для отрицательного контроля вместо тестируемого образца, причем образец для отрицательного контроля содержит эндопептидазу с измененной нацеленностью и сыворотку, в отношении которой известно, что она не содержит нейтрализующие антитела против эндопептидазы с измененной нацеленностью; ж) сравнения количества комплекса антитело-антиген, детектированного на этапе д, с количеством комплекса антитело-антиген, детектированным на этапе e, при этом детектирование меньшего количества комплекса антитело-антиген, детектированного на этапе д, по сравнению с количеством комплекса антитело-антиген, детектированным на этапе e, свидетельствует о присутствии нейтрализующих антител против эндопептидазы с измененной нацеленностью.

11. Способ определения иммунной резистентности млекопитающих по отношению к эндопептидазе с измененной нацеленностью, включающий этапы а) добавления эндопептидазы с измененной нацеленностью к тестируемому образцу, полученному из млекопитающего, тестируемого на наличие или отсутствие нейтрализующих антител против эндопептидазы с измененной нацеленностью; б) обработки клетки из стабильной клеточной линии тестируемым образцом, причем клетка из стабильной клеточной линии обладает способностью к поглощению эндопептидазы с измененной нацеленностью; в) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A; г) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, иммобилизованным на твердофазной подложке, причем анти-SNAP-25 антитело связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; д) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; e) повторения этапов 6-д с образцом для отрицательного контроля вместо тестируемого образца, причем образец для отрицательного контроля содержит эндопептидазу с измененной нацеленностью и сыворотку, в отношении которой известно, что она не содержит нейтрализующие антитела против эндопептидазы с измененной нацеленностью; ж) сравнения количества комплекса антитело-антиген, детектированного на этапе д, с количеством комплекса антитело-антиген, детектированным на этапе e, при этом детектирование меньшего количества комплекса антитело-антиген, детектированного на этапе д, по сравнению с количеством комплекса антитело-антиген, детектированным на этапе e, свидетельствует о присутствии нейтрализующих антител против эндопептидазы с измененной нацеленностью.

12. Способ определения иммунной резистентности млекопитающих по отношению к эндопептидазе с измененной нацеленностью, включающий этапы а) добавления эндопептидазы с измененной нацеленностью к тестируемому образцу, полученному из млекопитающего, тестируемого на наличие или отсутствие нейтрализующих антител против эндопептидазы с измененной нацеленностью; б) обработки клетки из стабильной клеточной линии тестируемым образцом, причем клетка из стабильной клеточной линии обладает способностью к поглощению эндопептидазы с измененной нацеленностью; в) выделения из обработанных клеток компонента SNAP-25, содержащего продукт расщепления SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A; г) иммобилизации компонента SNAP-25 на твердофазной подложке; д) осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, причем анти-SNAP-25 антитело связывается с эпитопом SNAP-25, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25; e) детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25; ж) повторения этапов 6-е с образцом для отрицательного контроля вместо тестируемого образца, причем образец для отрицательного контроля содержит эндопептидазу с измененной нацеленностью и сыворотку, в отношении которой известно, что она не содержит нейтрализующие антитела против эндопептидазы с измененной нацеленностью; з) сравнения количества комплекса антитело-антиген, детектированного на этапе е, с количеством комплекса антитело-антиген, детектированным на этапе ж, при этом детектирование меньшего количества комплекса антитело-антиген, детектированного на этапе е, по сравнению с количеством комплекса антитело-антиген, детектированным на этапе ж, свидетельствует о присутствии нейтрализующих антител против эндопептидазы с измененной нацеленностью.

13. Способ по пп.1-3 и 7-9, отличающийся тем, что клетка чувствительна к активности эндопептидаз с измененной нацеленностью при концентрации эндопептидазы с измененной нацеленностью около 500 нМ или ниже, около 400 нМ или ниже, около 300 нМ или ниже, около 200 нМ или ниже, около 100 нМ или ниже.

14. Способ по пп.4-6 и 10-12, отличающийся тем, что клетка обладает способностью к поглощению эндопептидаз с измененной нацеленностью при концентрации эндопептидазы с измененной нацеленностью около 500 нМ или ниже, около 400 нМ или ниже, около 300 нМ или ниже, около 200 нМ или ниже, около 100 нМ или ниже.

15. Способ по пп.1-6, отличающийся тем, что образец содержит приблизительно 100 нг или менее, приблизительно 10 нг или менее, приблизительно 1 нг или менее, приблизительно 100 фг или менее, приблизительно 10 фг или менее или приблизительно 1 фг или менее эндопептидаз с измененной нацеленностью.

16. Способ по пп.1-6, отличающийся тем, что образец содержит приблизительно 100 нМ или менее, приблизительно 10 нМ или менее, приблизительно 1 нМ или менее, приблизительно 100 нМ или менее, приблизительно 10 нМ или менее, приблизительно 1 нМ или менее, приблизительно 0,5 нМ или менее или приблизительно 0,1 нМ или менее эндопептидаз с измененной нацеленностью.

17. Способ по пп.1-12, отличающийся тем, что присутствие комплекса антитело-антиген детектируют с помощью анализа с использованием иммуноблоттинга, анализа с использованием иммунопреципитации, твердофазного ИФА или "сэндвич"-метода твердофазного ИФА.

18. Способ по пп.1-12, отличающийся тем, что способ характеризуется отношением сигнала к шуму для нижней асимптоты, составляющим по меньшей мере 3:1, по меньшей мере 5:1, по меньшей мере 10:1, по меньшей мере 20:1, по меньшей мере 50:1 или по меньшей мере 100:1.

19. Способ по пп.1-12, отличающийся тем, что способ характеризуется отношением сигнала к шуму для верхней асимптоты, составляющим по меньшей мере 10:1, по меньшей мере 20:1, по меньшей мере 50:1, по меньшей мере 100:1, по меньшей мере 200:1, по меньшей мере 300:1, по меньшей мере 400:1, по меньшей мере 500:1 или по меньшей мере 600:1.

20. Способ по пп.1-12, отличающийся тем, что способ может детектировать активность ECso, например, по меньшей мере 100 нг, по меньшей мере 50 нг, по меньшей мере 10 нг, по меньшей мере 5 нг, по меньшей мере 100 пг, по меньшей мере 50 пг, по меньшей мере 10 пг, по меньшей мере 5 пг, по меньшей мере 100 фг, по меньшей мере 50 фг, по меньшей мере 10 фг или по меньшей мере 5 фг эндопептидаз с измененной нацеленностью.

21. Способ по пп.1-12, отличающийся тем, что способ может детектировать активность ECgo, например, по меньшей мере 10 нМ, по меньшей мере 5 нМ, по меньшей мере 100 нМ, по меньшей мере 50 нМ, по меньшей мере 10 нМ, по меньшей мере 5 нМ, по меньшей мере 1 нМ, по меньшей мере 0,5 нМ или по меньшей мере 0,1 нМ эндопептидаз с измененной нацеленностью.

22. Способ по пп.1-12, отличающийся тем, что способ характеризуется ПД, например, 10 пг или менее, 9 пг или менее, 8 пг или менее, 7 пг или менее, 6 пг или менее, 5 пг или менее, 4 пг или менее, 3 пг или менее, 2 пг или менее, 1 пг или менее эндопептидазы с измененной нацеленностью.

23. Способ по пп.1-12, отличающийся тем, что способ характеризуется ПД, например, 100 нМ или менее, 90 нМ или менее, 80 нМ или менее, 70 нМ или менее, 60 нМ или менее, 50 нМ или менее, 40 нМ или менее, 30 нМ или менее, 20 нМ или менее или 10 нМ или менее эндопептидазы с измененной нацеленностью.

24. Способ по пп.1-12, отличающийся тем, что способ характеризуется ПКИ, например, 10 пг или менее, 9 пг или менее, 8 пг или менее, 7 пг или менее, 6 пг или менее, 5 пг или менее, 4 пг или менее, 3 пг или менее, 2 пг или менее, 1 пг или менее эндопептидазы с измененной нацеленностью.

25. Способ по пп.1-12, отличающийся тем, что способ характеризуется ПКИ, например, 100 нМ или менее, 90 нМ или менее, 80 нМ или менее, 70 нМ или менее, 60 нМ или менее, 50 нМ или менее, 40 нМ или менее, 30 нМ или менее, 20 нМ или менее или 10 нМ или менее эндопептидазы с измененной нацеленностью.

26. Способ по пп.1-12, отличающийся тем, что способ может отличать полностью активную эндопептидазу с измененной нацеленностью от частично активной эндопептидазы с измененной нацеленностью, обладающей, например, 70% или менее, 60% или менее, 50% или менее, 40% или менее, 30% или менее, 20% или менее или 10% или менее активности полностью активной эндопептидазы с измененной нацеленностью А.

27. Способ по пп.1-12, отличающийся тем, что анти-SNAP-25 антитело связывается с эпитопом, на карбоксильном конце которого находится остаток P1 разрезаемой связи в сайте расщепления ВоМТ/А, из продукта расщепления SNAP-25.

28. Способ по п.27, отличающийся тем, что анти-SNAP-25 антитело характеризуется константой скорости ассоциации для эпитопа, на карбоксильном конце которого отсутствует глутамин разрезаемой связи в сайте расщепления BoNT/A, из продукта расщепления SNAP-25, составляющей менее 1×101 M-1 c-1; и при этом анти-SNAP-25 антитело характеризуется равновесной константой диссоциации для эпитопа, составляющей менее 0,450 нМ.

29. Способ по п.27, отличающийся тем, что изолированное анти-SNAP-25 антитело включает вариабельный домен тяжелой цепи, содержащий аминокислотные последовательности, выбранные из группы, состоящей из SEQ ID NO: 72, SEQ ID NO: 74 SEQ ID NO: 76, SEQ ID NO: 80 и SEQ ID NO: 82; и вариабельный домен легкой цепи, содержащий аминокислотные последовательности, выбранные из группы, состоящей из SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90 и SEQ ID NO: 92.

30. Способ по п.27, отличающийся тем, что изолированное анти-SNAP-25 антитело включает по меньшей мере CDR1 VH из SEQ ID NO: 93, CDR1 VH из SEQ ID NO: 94, CDR1 VH из SEQ ID NO: 95, CDR1 VH из SEQ ID NO: 118, CDR1 VH из of SEQ ID NO: 119 или CDR1 VH из of SEQ ID NO: 120.

32. Способ по п.27, отличающийся тем, что изолированное анти-SNAP-25 антитело включает по меньшей мере CDR2 VH из SEQ ID NO: 96, CDR2 VH из SEQ ID NO: 97, CDR2 VH из SEQ ID NO: 98, CDR2 VH из SEQ ID NO: 99, CDR2 VH из SEQ ID NO: 121, CDR2 VH из SEQ ID NO: 122 или CDR2 VH из SEQ ID NO: 123.

33. Способ по п.27, отличающийся тем, что изолированное анти-SNAP-25 антитело включает по меньшей мере CDR3 VH из SEQ ID NO: 100, CDR3 vh из SEQ ID NO: 101, CDR3VH из SEQ ID NO: 102 или CDR3VH из SEQ ID NO: 124.

34. Способ по п.27, отличающийся тем, что изолированное анти-SNAP-25 антитело включает по меньшей мере CDR1 VL из SEQ ID NO: 103, CDR1 VL из SEQ ID NO: 104, CDR1 VL из SEQ ID NO: 105, CDR1 VL из SEQ ID NO: 106, CDR1 VL из SEQ ID NO: 107, CDR1 VL из SEQ ID NO: 125, CDR1 VL из SEQ ID NO: 126, CDR1 VL из SEQ ID NO: 127, CDR1 VL из SEQ ID NO: 128 или CDR1 VL из SEQ ID NO: 129.

35. Способ по п.27, отличающийся тем, что изолированное анти-SNAP-25 антитело включает по меньшей мере CDR2 VL из SEQ ID NO: 108, CDR2 VL из SEQ ID NO: 109, CDR2 VL из SEQ ID NO: 110, CDR2 VL из SEQ ID NO: 111 или CDR2 VL из SEQ ID NO: 112.

36. Способ по п.27, отличающийся тем, что изолированное анти-SNAP-25 антитело включает по меньшей мере CDR3 VL из SEQ ID NO: 113, CDR3 VL из SEQ ID NO: 114, CDR3 VL из SEQ ID NO: 115, CDR3 VL из SEQ ID NO: 116 или CDR3 VL из SEQ ID NO: 117.

37. Способ по п.27, отличающийся тем, что изолированное анти-SNAP-25 антитело включает вариабельный домен тяжелой цепи, содержащий SEQ ID NO: 93, SEQ ID NO: 121 и SEQ ID NO: 100; и вариабельный домен легкой цепи, содержащий SEQ ID NO: 105, SEQ ID NO: 110 и SEQ ID NO: 115.

38. Способ по п.27, отличающийся тем, что изолированное анти-SNAP-25 антитело избирательно связывает эпитоп SNAP-25 из SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 147 или SEQ ID NO: 148.

39. Способ по п.27, отличающийся тем, что изолированное анти-SNAP-25 антитело избирательно связывает эпитоп SNAP-25 из SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 или SEQ ID NO: 44.

ПРИМЕРЫ

Пример 1

Скрининг экспрессии эндогенного рецептора эндопептидазы с измененной нацеленностью в клеточных линиях-кандидатах

[0178] Приведенный ниже пример демонстрирует, как проводить идентификацию стабильных клеточных линий, обладающих способностью к поглощению эндопептидаз с измененной нацеленностью, которая необходима для разработки клеточного теста на активность.

1. Культивация запасных культур клеточных линий-кандидатов

[0179] Для культивации клеточных линий, подходящую плотность клеток из тестируемой клеточной линии засевали во флаконы для культур тканей на 162 см2, содержащих 30 мл подходящей питательной среды (см. Таблицу 1), и выращивали в инкубаторе при 37°С и концентрации углекислого газа 5% или 10% до достижения клетками желаемой плотности.

Таблица 1.
Среды, используемые при скрининге клеточных линий
Клеточная линия Состав питательной среды с сывороткой
SiMa и клоны SiMa RPM11640, 10% эмбриональной бычьей сыворотки, 1% пенициллин-стрептомицин, 2 мМ L-глутамин
РС12 RPMI 1640, 5% термоинактивированной эмбриональной бычьей сыворотки, 10% лошадиной сыворотки, 2 мМ GlutaMAX™, 10 мМ HEPES, 1 мМ пирувата натрия, 1% пенициллин-стрептомицин
Таблица 1.
Среды, используемые при скрининге клеточных линии
Клеточная линия Состав питательной среды с сывороткой
N18 ND8/34 NG108-15 90% DMEM, 10% термоинактивированной эмбриональной бычьей сыворотки, 2 мМ глутамина, 2 мМ глюкозы
SK-N-DZ SK-N-F1 SK-N-SH 90% DMEM, 10% термоинактивированной эмбриональной бычьей сыворотки, 4 мМ глутамина, 4 мМ глюкозы, 0,1 мМ заменимых аминокислот, 1,5 г/л NaHCO3
ВЕ(2)-С SK-N-BE(2) SH-SY5Y ЕМЕМ(11090-081, Gibco), Ham's F12 (11765-054, Gibco), 10% термоинактивированной эмбриональной бычьей сыворотки, 2 мМ глутамина, 0,1 мМ заменимых аминокислот,
ND3, ND7, ND15 Среда DMEM с 2 мМ глутамина (Invitrogen, Cat #. 11885), 10% Эмбриональной Бычьей Сыворотки (Invitrogen, Cat#. 16140) и 1х антибиотик / фунгицид
Neuro-2a ЕМЕМ, 10% термоинактивированной эмбриональной бычьей сыворотки, 2 мМ глутамина, 0,1 мМ заменимых аминокислот, 1,5 г/л NaHCO3, 1 мМ пирувата натрия

2. Скрининг клеток, экспрессирующих рецептор-мишень на поверхности клетки

[0180] Проводили скрининг клеточных линий на присутствие желаемого рецептора-мишени, используя проточную цитометрию и/или тесты связывания лиганда. Хотя в приведенных ниже примерах реагенты использовали для идентификации опиоидного или опиоидоподобного рецептора в плазматической мембране, описанные ниже подходы можно применять для идентификации родственного рецептора для любой из эндопептидаз с измененной нацеленностью.

а. Идентификация клеточных линий с использованием проточной цитометрии

[0181] Для идентификации клеток, включающих стабильные клеточные линии, которые экспрессируют рецепторы-мишени для эндопептидазы с измененной нацеленностью на поверхности клетки, проводили анализ с помощью проточной цитометрии. Клетки из каждой клеточной линии-кандидата выращивали, как описано в Разделе 1, обрабатывали трипсином, промывали буфером для окрашивания, включающем 1 × ФБР и 0,5% BSA, и центрифугировали при 1200 об./мин. в течение 3 минут. Осажденные клетки ресуспендировали в буфере для окрашивания, и приблизительно 2,0×106 клеток переносили в новые пробирки, по две пробирки для каждого тестируемого рецептора. Для проведения скриминга на присутствие опиоидного или опиоидоподобного рецептора, в одну пробирку помещали приблизительно 2,0-5,0 мкл α-ORL-1 RA14133 (Neuromics, Эдина, Миннесота), кроличьих поликлональных антител α-DOR RA10101 (Neuromics, Эдина, Миннесота), кроличьих поликлональных анти-KOR RA10103 антител (Neuromics, Эдина, Миннесота) или кроличьих поликлональных анти-MOR RA10104 антител (Neuromics, Эдина, Миннесота) и инкубировали смесь при 4°С в течение 1 часа. Вторую пробирку инкубировали при 4°С в течение 1 часа в отсутствие каких-либо антител и использовали в качестве отрицательного контроля. После инкубации с антителами, 1,0 мл буфера для окрашивания добавляли к каждой пробирке и центрифугировали при 1200 об./мин. в течение 3 минут. Осадок клеток еще раз промывали 1,0 мл буфера для окрашивания. Осадок клеток ресуспендировали в 200 мкл буфера для окрашивания, к каждой пробирке добавляли 2,0 мкл козьих противокроличьих антител IgG FITC и инкубировали при 4°С в течение 1 часа в темноте. После инкубации со вторичными антителами, к каждой пробирке добавляли 1,0 мл буфера для окрашивания и центрифугировали при 1200 об./мин. в течение 3 минут. Осадок клеток еще раз промывали 1,0 мл буфера для окрашивания и ресуспендировали в 500 мкл буфера для окрашивания. Образец анализировали с помощью проточного цитометра, и представляли данные в виде наложения окрашивания с помощью антител против рецептора на окрашивание с помощью противокроличьих антител IgG FITC.

[0182] Результаты демонстрируют, что из протестированных клеточных линий ORL-1 экспрессировался на поверхности приблизительно 50% клеток, включающих стабильные клеточные линии SiMa, SiMa Р>33, клон Н10, ND7 и SK-N-DZ; экспрессировался на поверхности приблизительно от 25% до 50% клеток, включающих стабильные клеточные линии SH-SY5Y и ND15; и экспрессировался на поверхности менее чем приблизительно 25% клеток, включающих стабильные клеточные линии ND3, ND8, N18 и Neuro-2a (Таблица 2). Результаты также демонстрируют, что KOR экспрессировался на поверхности приблизительно 50% клеток, включающих стабильные клеточные линии SH-SY5Y и ND7; экспрессировался на поверхности приблизительно от 25% до 50% клеток, включающих стабильные клеточные линии клона H10 SiMa, SiMa P>33, ND15 и Neuro-2a; и экспрессировался на поверхности менее чем приблизительно 25% клеток, включающих стабильные клеточные линии ND3, ND8 и N18 (Таблица 2). Результаты также выявили, что MOR экспрессировался на поверхности приблизительно 50% клеток, включающих стабильные клеточные линии ND7, ND15 и SiMa Р>33; экспрессировался на поверхности приблизительно от 25% до 50% клеток, включающих стабильные клеточные линии SH-SY5Y, клон SiMa H10, ND8 и Neuro-2a; и экспрессировался на поверхности менее чем приблизительно 25% клеток, включающих стабильные клеточные линии ND3 и N18 (Таблица 2). Кроличьи поликлональные антитела α-DOR RA10101 оказались не способны функционировать должным образом и не позволили получить пригодные к использованию данные.

б. Идентификация клеточных линий с использованием связывания лиганда

[0183] Для идентификации клеток, включающих стабильные клеточные линии, которые экспрессируют рецепторы-мишени эндопептидаз с измененной нацеленностью на поверхности клетки, проводили анализ с помощью связывания лиганда. Клетки из тестируемых клеточных линий-кандидатов инкубировали в 96-луночных планшетах с черно-прозрачным дном в течение приблизительно 4 часов для стимуляции прикрепления клеток к поверхности. Для проведения скрининга на присутствие опиоидных или опиоидоподобных рецепторов, среду из каждой лунки удаляли аспирацией и заменяли 50 мкл раствора лиганда, содержащего 0 (необработанный контроль), 0,001 нМ, 0,01 нМ, 0,1 нМ или 1 нМ FAM-ноцицептина (Phoenix Pharmaceuticals, Inc. Берлингейм, Калифорния); или О (необработанный контроль), 0,001 нМ, 0,01 нМ, 0,1 нМ или 1 нМ FAM-динорфина A (Phoenix Pharmaceuticals, Inc, Берлингейм, Калифорния). Клетки инкубировали с раствором лиганда в течение 1 часа в инкубаторе при 37°С и 5% углекислого газа. Клетки промывали для удаления несвязавшегося лиганда путем трехкратной промывки клеток 100 мкл 1 × ФБР. Планшет сканировали на Typhoon (Ex 488 и Em 520 нм), а затем считывали на сканере для планшетов М5 (Ех 495 и Em 520 ни) для сигналов ОФЕ. Результаты демонстрируют, что клетки, включающие стабильные клеточные линии клона SiMa H10, SH-SY5Y и SK-N-DZ, связывали ноцицептин, тогда как клетки, включающие клон SiMa H10, связывали также и динорфин (Таблица 2).

Таблица 2.
Клеточные линии, экспрессирующие рецепторы-мишени на поверхности клеток
Рецептор-мишень Идентифицированные клеточные линии
Проточная цитометрия Связывание лиганда
Экспрессия более 50% Экспрессия от 25% до 50% Экспрессия менее 50% Ноцицептин Динорфин А
ORL-1 AGN Р33, SiMa, клон SiMa Н10, ND7, SK-N-DZ SH-SY5Y, ND15 ND3.ND8, N18, Neuro-2a Клон SiMa Н10, SH-SY5Y, SK-N-DZ -
Таблица 2.
Клеточные линии, экспрессирующие рецепторы-мишени на поверхности клеток
Рецептор-мишень Идентифицированные клеточные линии
Проточная цитометрия Связывание лиганда
Экспрессия более 50% Экспрессия от 25% до 50% Экспрессия менее 50% Ноцицептин Динорфин А
DOR Н.Д. Н.Д. Н.Д. Н.Д. Н.Д.
KOR SH-SY5Y, ND7 KnoHSiMaHIO, AGNP33,ND15, Neuro-2a ND3, ND8, N18 - Клон SiMa НЮ
MOR ND7,ND15, AGN РЗЗ SH-SY5Y, клон SiMaHIO, ND8, Neuro-2a ND3.N18 Н.Д. Н.Д.

[0184] Используя подобный подход, можно идентифицировать клеточные линии, включающие клетки, имеющие родственные рецепторы для других эндопептидаз с измененной нацеленностью, с помощью FAM-мечения нацеливающего домена для этих эндопептидаз и скрининга клеточных линий как описано выше.

3. Скрининг клеточных линий-кандидатов при воздействии единичной дозы эндопептидазы с измененной нацеленностью

[0185] Для определения способности клеточной линии поглощать молекулы соответствующей эндопептидазы с измененной нацеленностью, подходящую плотность клеток из запасной культуры тестируемой клеточной линии засевали в лунки 24-луночных планшетов для культур тканей, содержащих 1 мл соответствующей питательной среды с сывороткой (Таблица 1). Клетки выращивали в инкубаторе при 37°С и концентрации углекислого газа 5% до достижения клетками желаемой плотности (приблизительно 18-24 часа). Для оценки поглощения эндопептидазы с измененной опиоидной нацеленностью, питательную среду из каждой лунки удаляли аспирацией и заменяли 1) свежей питательной средой, не содержащей эндопептидазы с измененной опиоидной нацеленностью (необработанная клеточная линия), или 2) свежей питательной средой, содержащей 30 нМ эндопептидазы с измененной ноцицептиновой нацеленностью (Noc/A) или 100 нМ эндопептидазы с измененной динорфиновой нацеленностью (Dyn/A) (обработанная клеточная линия). После инкубации в течение ночи клетки промывали, удаляя аспирацией питательную среду и прополаскивая каждую лунку 200 мкл 1 × ФБР. Для сбора клеток удаляли аспирацией 1 × ФБР, клетки лизировали, добавляя 50 мкл 1 × ДСН буфера для загрузки, лизат переносили в новые пробирки и нагревали образцы при 95°С в течение 5 минут.

[0186] Для детектирования как нерасщепленного субстрата SNAP-25, так и продуктов расщепления SNAP-25, аликвоту от каждого собранного образца анализировали с помощью Вестерн-блот анализа. В ходе такого анализа 12 мкл аликвоты собранных образцов разделяли в полиакриламидном геле с MOPS с использованием готовых 12% Bis-Tris полиакриламидных блоков NuPAGE® Novex (Invitrogen Inc., Карлсбад, Калифорния) в денатурирующих восстанавливающих условиях. Разделенные пептиды переносили из геля на поливинилиденфторидные (ПВДФ) мембраны (Invitrogen Inc., Карлсбад, Калифорния) путем Вестерн-блоттинга с использованием аппарата для электрофоретического переноса полусухим способом TRANS-BLOT® SD (Bio-Rad Laboratories, Геркулес, Калифорния). ПВДФ мембраны блокировали путем инкубации при комнатной температуре в течение 2 часов в растворе, содержащем трис-буферный раствор (TBS) (25 мМ 2-амино-2-гидроксиметил-1,3-пропандиол соляная кислота (Трис-HCl) (pH 7,4), 137 мМ хлорид натрия, 2,7 мМ хлорид калия), 0,1% Tween-20® (полиоксиэтилен (20) сорбитан монолаурат), 2% бычий сывороточный альбумин (BSA), 5% обезжиренное сухое молоко. Блокированные мембраны инкубировали при 4°С в течение ночи в TBS, 0,1% Tween-20® (полиоксиэтилен (20) сорбитан монолаурат), 2% BSA, и 5% обезжиренном сухом молоке, содержащем 1) разведение 1:5,000 мышиных моноклональных aHTH-SNAP-25 антител в качестве первичных антител (SMI-81; Sternberger Monoclonals Inc., Лютервиль, Мэриленд); или 2) разведение 1:5000 иммунной сыворотки S9684 с поликлональными кроличьими анти-SNAP-25 антителами в качестве первичных антител (Sigma, Сент-Луис, Миссури). Как мышиные моноклональные, так и поликлональные кроличьи анти-SNAP-25 антитела могут узнавать как нерасщепленный субстрат SNAP-25, так и продукт расщепления SNAP-25, что позволяет оценивать общую экспрессию SNAP-25 в каждой клеточной линии и процент расщепленного SNAP-25 после обработки эндопептидазами с измененной нацеленностью в качестве параметра для оценки количества поглощения эндопептидаз с измененной нацеленностью. После связывания первичных антител блоты промывали три раза по 5 минут каждый раз в TBS, Tween-20® (полиоксиэтилен (20) сорбитан монолаурат). Промытые мембраны инкубировали при комнатной температуре в течение 2 часов в TBS, 0,1% Tween-20® (полиоксиэтилен (20) сорбитан монолаурат), 2% BSA, и 5% обезжиренном сухом молоке, содержащем 1) разведение 1:10000 поликлональных козьих противомышиных иммуноглобулинов G, тяжелых и легких цепей (IgG, H+L) антител, конъюгированных с пероксидазой хрена (Zymed, Южный Сан-Франциско, Калифорния) в качестве вторичных антител; или 2) разведение 1:10000 поликлональных козьих противокроличьих иммуноглобулинов G, тяжелых и легких цепей (IgG, H+L) антител, конъюгированных с пероксидазой хрена (Zymed, Южный Сан-Франциско, Калифорния) в качестве вторичных антител. После связывания вторичных антител блоты промывали три раза в течение 15 минут каждый раз в TBS, 0,1% Tween-20® (полиоксиэтилен (20) сорбитан монолаурат). Сигнал детектирования меченых продуктов SNAP-25 визуализировали с использованием системы для усиленного хемилюминесцентного детектирования ECL Plus™ Western Blot Detection System (GE Healthcare, Amersham Biosciences, Пискатауэй, Нью-Джерси), мембраны проявляли и проводили количественную оценку продуктов расщепления SNAP-25 с помощью устройства для анализа изображений Typhoon 9410 Variable Mode Imager и программы для анализа изображений (GE Healthcare, Amersham Biosciences, Пискатауэй, Нью-Джерси). Выбор размера пикселя (от 100 до 200 пикселей) и настройки напряжения ФЭУ (от 350 до 600, как правило, 400) зависели от конкретного блота.

[0187] На основании детектирования продукта расщепления SNAP-25, следующие клеточные линии демонстрировали поглощение 30 нМ Noc/A: BE(2)-C, N18TG2, Neuro-2a, SiMa, SK-N-BE(2)-C и SK-N-DZ (Таблица 3); в то время как следующие клеточные линии демонстрировали поглощение 100 нМ Dyn/A: N18TG2, Neuro-2a, PC12 и SiMa. Некоторые из этих чувствительных клеточных линий тестировали с более низкими дозами соединений и/или на полнодозовый ответ.

Таблица 3. Скрининг клеточных линий-кандидатов при воздействии единичной дозы эндопептидаз с измененной нацеленностью noc/а и dyn/a
Клеточная линия Описание Источник Поглощение 30 пМ Noc/A Поглощение 100 пМ Dyn/A
ВЕ(2)-С Нейробластома человека АТСС CRL-2268 Да НТ
N18TG2 Нейробластома мыши DSMZ ACC 103 Да Да
ND3 Нейробластома мыши/первичный неонатальный гибрид DRG крысы ЕС АСС 92090901 ДКО ДКО
ND7/23 Нейробластома мыши/ первичный гибрид DRG крысы ЕС АСС 92090903 Нет Нет
ND8 Нейробластома мыши/первичный неонатальный гибрид DRG крысы ЕС АСС 92090904 ДКО ДКО
Таблица 3.
Скрининг клеточных линий-кандидатов при воздействии единичной дозы эндопептидаз с измененной нацеленностью noc/а и dyn/a
Клеточная линия Описание Источник Поглощение 30 пМ Noc/A Поглощение 100 пМ Dyn/A
ND15 Нейробластома мыши/первичный неонатальный гибрид DRG крысы ЕС АСС 92090907 Нет Нет
Neuro-2a Нейробластома мыши ATCC CCL-131 Да Да
NG108-15 Нейробластома мыши/ гибрид глиомы крысы ЕС АСС 88112302 Нет HT
РС12 Феохромоцитома крысы ATCC CRL-1721 HT Да
SH-SY5Y Нейробластома человека АТСС CRL-2266 Нет HT
SiMa Нейробластома человека DSMZ ACC 164 Да Да
SK-N-BE(2)-С Нейробластома человека АТСС CRL-2271 Да HT
SK-N-DZ Нейробластома человека ATCC CRL-2149 Да HT
SK-N-F1 Нейробластома человека ATCC CRL-2142 Нет HT
SK-N-SH Нейробластома человека ЕС АСС 86012802 Нет HT
HT: He Тестировали.
ДКО (детектируемое количество отсутствует); В данной клеточной линии не было обнаружено детектируемое количество SNAP-25.

[0188] Используя подобный подход, можно оценивать поглощение эндопептидаз с измененной нацеленностью клеточными линиями, включающими клетки, имеющие родственные рецепторы для других эндопептидаз с измененной нацеленностью.

Пример II

Скрининг экспрессии эндогенного рецептора эндопептидазы с измененной нацеленностью в клональных клеточных линиях-кандидатах

1. Скрининг клональных клеточных линий-кандидатов, полученных из родительской клеточной линии SiMa, при воздействии единичной дозы эндопептидазы с измененной нацеленностью

[0189] Родственная заявка на патент на имя Zhu Hong et al., Ce// Lines Useful in Immuno-Based Botulinum Toxin Serotype A Activity Assays, заявка на патент США Серийный Номер: 61/160199, описывает клональные клеточные линии, полученные из родительской клеточной линии SiMa, которые использовали в тесте на активность BoNT/A, как описано в Ester Fernandez-Salas, et al., Immuno-Based Botulinum Toxin Serotype A Activity /Assays, заявка на патент США серийный номер: 12/403531, каждая из которых полностью включена в настоящую заявку посредством ссылки. Для определения, способны ли эти клональные клеточные линии к поглощению соответствующей эндопептидазы с измененной нацеленностью, каждую из них подвергали скринингу с помощью «сэндвич”-метода твердофазного ИФА с усиленной хемилгоминесценцией.

[0190] Для приготовления лизата, обработанного зндопептидазой с измененной нацеленностью, культуру с подходящей плотностью клеток из маточного раствора культуры проверяемой клеточной линии засевали на ночь в лунки 96-луночных планшетов для культур тканей, содержащих 100 мкл соответствующей питательной среды на основе сыворотки (Таблица 1). Питательные среды от засеянных клеток из каждой лунки удаляли аспирацией и заменяли свежей средой, содержащей 30 нМ эндопептидазы с измененной нацеленностью Noc/А или 80 нМ эндопептидазы с измененной нацеленностью Dyn/A. После 24-часовой инкубации клетки отмывали аспирацией питательной среды и ополаскивали каждую лунку 200 мкл 1 × ФБР. Для сбора клеток, 1 × ФБР удаляли аспирацией, клетки лизировали путем добавления в каждую лунку 30 мкл лизирующего буфера, содержащего 20 мМ Tris-HCl (pH 7,5), 150 мМ NaCl, 1 мМ ЭДТА, 1 мМ EGTA, 1% Тритон Х-100, и инкубировали планшет на встряхивателе с вращением при 500 об./мин. в течение 30 минут при 4°С. Для осаждения остатков клеток планшет центрифугировали при 4000 об./мин. в течение 20 минут при 4°С, после чего супернатант переносили в 96-луночный планшет, покрытый антителами для захвата для проведения этапа детекции.

[0191] Для приготовления раствора анти-SNAP-25197 антител для захвата, мышиные моноклональные анти-SNAP-25197 антитела, находящиеся в составе асцитной жидкости, полученной от гибридомной клеточной линии 2Е2А6 (Пример XI), очищали, используя стандартный протокол очистки с использованием белка А.

[0192] Для приготовления раствора детектирующих анти-SNAP-25 антител, поликлоналтные антитела кролика α-SNAP-25, S9684 (Sigma, Сент-Луис, Миссури) коньюгировали с реактивом для меченья - сложным эфиром рутений (II)-трис-бипиридин-(4-метисульфоната) и М-ГС (Meso Scale Discovery, Гейтерсбург, Мэриленд) согласно инструкциям изготовителя (Meso Scale Discovery, Гейтерсбург, Мэриленд). Реакцию конъюгации проводили путем добавления 30 мкл раствора для разведения MSD SULFO-TAG™, разведенного в дистиллированной воде, 200 мкл поликлональных анти-ЗМАР-25 антител в концентрации 2 мг/мл и инкубации реакционной смеси при комнатной температуре в течение 2 часов в темноте. Помеченные антитела очищали, используя стандартный протокол спин-колонок, и концентрацию белка определяли с использованием стандартного колориметрического теста на белок. Поглощающую способность конъюгатов анти-SNAP-25 антител/MSD SULFO-TAG™ измеряли с помощью спектрофотометра при 455 нм для определения концентрации в молях на литр. Раствор детектирующих антител хранили при 4°С до использования. Длительное хранение неиспользованных аликвот осуществляли при -20°С.

[0193] Для приготовления твердофазной подложки α-SNAP-25, содержащей анти-SNAP-25197 антитела для захвата, приблизительно 5 мкл соответствующего раствора моноклональных анти-SNAP-25197 антител (20 мкг/мл в 1 × ФБР) добавляли к каждой лунке 96-луночного планшета MSD High Bind, и раствор сушили на воздухе в биологически чистом помещении в течение 2-3 часов до испарения жидкости из раствора. Заблокированные планшеты запечатывали и хранили при 4°С до использования.

[0194] Для детектирования расщепленного продукта SNAP-25 ECL "сэндвич"-методом твердофазного ИФА лунки со связанными антителами для захвата блокировали, добавляя 150 мкл блокирующего буфера, содержащего 2% блокирующего реактива Amersham (GE Life Sciences, Пискэтэуэй, Нью-Джерси) и 10% козьей сыворотки (VWR, Уэст-Честер, Пенсильвания), и инкубируя при комнатной температуре в течение 2 часов. Блокирующий буфер удаляли аспирацией и к каждой лунке добавляли 25 мкл лизата клеток, обработанных эндопептидазой с измененной нацеленностью, и планшеты инкубировали при 4°С в течение ночи. Лунки планшета трехкратно промывали: удаляли аспирацией клеточный лизат и три раза ополаскивали каждую лунку 200 мкл 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После отмывки, в каждую лунку добавляли 25 мкл раствора детектирующих анти-SNAP-25 антител в концентрации 5 мкг/мл, содержащего 2% блокирующего реактива Amersham в 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат), запечатывали и инкубировали при комнатной температуре в течение 1 часа со встряхиванием. После инкубации с детектирующими анти-SNAP-25 антителами лунки трехкратно промывали 200 мкл 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После отмывки в каждую лунку добавляли 150 мкл 1 × буфера для считывания (Meso Scale Discovery, Гейтерсбург, Мэриленд) и анализировали планшеты, используя устройство для считывания изображений SECTOR™ Imager 6000 (Meso Scale Discovery, Гейтерсбург, Мэриленд). Исходные данные собирали, используя устройство для визуализации ECL.

[0195] Результаты демонстрируют, что родительская клеточная линия SiMa, как и клональная клеточная линия H10, показала существенное поглощение эндопептидазы с измененной нацеленностью Noc/A (Таблица 4). Кроме того, эти результаты показывают, что многие клеточные линии демонстрируют поглощение эндопептидазы с измененной нацеленностью Dyn/A (Таблица 4). Три клональных клеточных линии (1Е11, AF4, и DC4) продемонстрировали существенное поглощение зндопептидазы с измененной нацеленностью Dyn/A; одиннадцать клональных клеточных линий (1Е3, 2D2, 2D6, 3D8, 5С10, 5F3, ВВ10, BF8, CG8, CG10 и DE7) продемонстрировали умеренное поглощение эндопептидазы с измененной нацеленностью Dyn/A; и (3В8, 2 В9, СЕ6, YB8, 4С8, 2F5, АС9, CD6, DD10, YF5) продемонстрировали минимальное поглощение эндопептидазы с измененной нацеленностью Dyn/A. Некоторые из этих клеточных линий-кандидатов исследовали в тесте на полнодозовый ответ с соответствующей эндопептидазой с измененной нацеленностью.

Таблица 4.
Скрининг клональных клеточных линий-кандидатов при воздействии единичной дозы эндопептидаз с измененной нацеленностью Noc/A и Dyn/A
Клеточная Линия Поглощение 30 нМ Noc/A Поглощение 80 нМ Dyn/A
AGN Р33 +++ НТ
А10 - НТ
D11 - НТ
Н1 - -
НЮ +++ -
1D4 НТ -
2Е4 НТ -
3D5 НТ -
3G10 НТ -
4D3 НТ -
ВВ3 НТ -
СС11 НТ -
Таблица 4.
Скрининг клональных клеточных линий-кандидатов при воздействии единичной дозы эндопептидаз с измененной нацеленностью Noc/А и Dyn/A
Клеточная Линия Поглощение 30 нМ Noc/A Поглощение 80 нМ Dyn/A
DF5 НТ -
YB7 НТ -
ВЕЗ НТ -
4 В5 НТ -
2 В9 НТ +
2F5 НТ +
ЗВ8 НТ +
4С8 НТ +
АС9 НТ +
CD6 НТ +
СЕ6 НТ +
DD10 НТ +
YB8 НТ +
YF5 НТ +
1ЕЗ НТ ++
2D2 НТ ++
2D6 НТ ++
3D8 НТ ++
5С10 НТ ++
5F3 НТ ++
BF8 НТ ++
ВВ10 НТ ++
CG8 НТ ++
СОЮ НТ ++
DE7 НТ ++
1Е11 НТ +++
AF4 НТ +++
DC4 НТ +++
НТ: Не Тестировали
-: нет поглощения; +: минимальное поглощение; ++: умеренное поглощение; +++: существенное поглощение

2. Скрининг клеточных линий-кандидатов на полнодозовый ответ

[0196] Стабильные клеточные линии, идентифицированные выше, впоследствии оценивали, используя полнодозовый ответ на соответствующую эндопептидазу с измененной нацеленностью. Клетки из различных клеточных линий высевали в 96-луночные планшеты и подвергали воздействию различных концентраций Noc/A (0, 0,14 нМ, 0,4 нМ, 1,23 нМ, 3,7 нМ, 11,1 нМ, 33,3 нМ, и 100 нМ) или Dyn/А(0,017 нМ, 0,05 нМ, 0,15 нМ, 0,45 нМ, 1,4 нМ, 4,1 нМ, 12 нМ, 37 нМ, 111 нМ, 333 нМ, и 1000 нМ) в течение 24 часов. Среду, содержащую эндопептидазу с измененной нацеленностью, удаляли и заменяли новой полной средой. Планшеты инкубировали еще в течение 24 часов в атмосфере 5% CO2 при 37°С для расщепления SNAP-25. Клетки лизировали в буфере для лизиса (Таблица 5) и центрифугировали планшеты для удаления остатков клеток. Лизаты использовали в Вестерн-блоттинге или в "сэндвич”-методе твердофазного ИФА.

[0197] Для анализа с помощью Вестерн-блоттинга образцы тестировали как на наличие интактной SNAP-25, так и на наличие продуктов расщепления SNAP-25, как описано в Примере I.

[0198] Для "сэндвич"-метода твердофазного ИФА, планшеты для твердофазного ИФА, покрытые моноклональными антителами 2Е2А6, блокировали 150 мкл блокирующего буфера при комнатной температуре в течение 2 часов. После удаления блокирующего буфера, 25 мкл лизата клеток добавляли в каждую лунку, и планшеты инкубировали при 4°С в течение 2 часов. Планшеты трижды отмывали в ФБР-Т и в нижний угол лунок добавляли 25 мкл детектирующих антител α-SNAP25 pSb, маркированных сложным-эфиром SULFO-TAG N-ГС в концентрации 5 мкг/мл в 2% блокирующем реактиве в ФБР-Т. Планшеты запечатывали и встряхивали при комнатной температуре в течение 1 часа, после чего следовали три отмывки в ФБР-Т. После завершения отмывок, в каждую лунку добавляли 150 мкл 1х буфера для считывания, и планшет считывали в устройстве для считывания изображений SI6000. Для определения чувствительности каждой проверенной клеточной линии, для каждой клеточной линии вычисляли величину EC50. Значения для эндопептидазы с измененной нацеленностью Noc/A приведены в Таблице 5. Тесты на полнодозовый ответ на эндопептидазу с измененной нацеленностью Dyn/A выполняли только на PC 12 и клоне AF4. В обоих случаях тест не достигал верхней асимптоты, и вычислить ЕС50 было невозможно. Наиболее низкая доза, которая вызывала появление сигнала у клона AF4, составляла 12 нМ для обеих клеточных линий.

Table 5.
Скрининг клеточных линий-кандидатов при воздействии полной дозы эндопептидаз с измененной нацеленностью Noc/A и Dyn/A
Клеточная линия Описание Источник EC50 поглощения Noc/A EC50 поглощения Dyn/A
AGN Р33 Нейробластома человека - 5-10 нМ HT
ВЕ(2)-С Нейробластома человека АТСС CRL-2268 HT HT
N18TG2 Нейробластома мыши DSMZ ACC 103 HT HT
N18 Нейробластома мыши ЕС АСС 88112301 >100 нМ HT
ND3 Нейробластома мыши/первичный неонатальный гибрид DRG крысы ЕС АСС 92090901 ДКО HT
ND7/23 Нейробластома мыши/первичный гибрид DRG крысы ЕС АСС 92090903 >100нМ HT
ND8 Нейробластома мыши/первичный неонатальный гибрид DRG крысы ЕС АСС 92090904 ДКО HT
ND15 Нейробластома мыши/первичный неонатальный гибрид DRG крысы ЕС АСС 92090907 >100нМ HT
Neuro-2a Нейробластома мыши ATCC CCL-131 30 нМ HT
NG108-15 Нейробластома мыши/гибрид глиомы крысы ЕСАСС 88112302 HT HT
РС12 Феохромоцитома крысы АТСС CRL-1721 HT >1000 нМ
SH-SY5Y Нейробластома человека АТСС CRL-2266 HT HT
SiMa Нейробластома человека DSMZ ACC1 64 30 нМ HT
SiMa clone AF4 Нейробластома человека - HT >300 нМ
SiMa clone H1 Нейробластома человека - >100нМ HT
SiMa clone H10 Нейробластома человека - 20 нМ HT
SK-N-BE(2)-C Нейробластома человека АТСС CRL-2271 HT HT
SK-N-DZ Нейробластома человека АТСС CRL-2149 0,5-2 нМ HT
SK-N-F1 Нейробластома человека ATCC CRL-2142 >100нМ HT
SK-N-SH Нейробластома человека ЕСАСС 86012802 >100нМ HT
HT: He тестировали.
ДКО (детектируемое количество отсутствует): В данной клеточной линии не было обнаружено детектируемое количество SNAP-25.

[0199] Используя подобный подход, можно проводить скрининг и оценивать клональные клеточные линии, содержащие клетки, которые имеют родственные рецепторы для других эндопептидаз с измененной нацеленностью, на предмет поглощения эндопептидаз с измененной нацеленностью.

Пример III

Оценка влияния условий роста на поглощение эндопептидаз с измененной нацеленностью в клеточных линиях-кандидатах

[0200] Следующий пример иллюстрирует определение условий культивирования, роста и дифференцировки для стабильных клеточных линий, которые максимизируют поглощение эндопептидаз с измененной нацеленностью.

1. Эффекты клеточной дифференцировки и трофических факторов на поглощение эндопептидазы с измененной нацеленностью клеточными линиями-кандидатами

[0201] Для определения способности клеточной дифференцировки или присутствия трофических факторов в питательной среде улучшать поглощение эндопептидазы с измененной нацеленностью, клеточные линии, демонстрирующие существенное поглощение Noc/A, тестировали на питательных средах различного состава. Клеточную культуру подходящей плотности маточного раствора культуры SiMa P>30 исследуемых клеточных линий засевали в лунки 96-луночных планшетов для культур тканей, содержащие 100 мкл среды без сыворотки, содержащей RPMI1640, 1% Пенициллин-Стрептомицин, 2 мМ L-глютамин, и подкрепленной В27, и N2, или 100 мкл среды без сыворотки, содержащей RPMI1640, 1% Пенициллин-Стрептомицин, 2 мМ L-глютамин, подкрепленной В27, N2 и NGF (Фактор Роста Нервов, 100 нг/мл). Эти клетки растили в инкубаторе при 37°С в атмосфере 5% углекислого газа пока они не дифференцировались, что оценивали при помощи стандартных и рутинных морфологических критериев, таких как прекращение роста и вытяжение неврита (приблизительно 1-2 дня). В качестве контроля, клеточную культуру подходящей плотности из культуры маточного раствора исследуемой клеточной линии засевали в лунки 96-луночных планшетов для культур тканей, содержащие 100 мкл соответствующей питательной среды (Таблица 1) с NGF (100 нг/мл) или без него. Эти не дифференцированные контрольные клетки выращивали в инкубаторе при 37°С в атмосфере 5% углекислого газа до достижения желаемой плотности клеток(приблизительно 18-24 часа). Среду как от дифференцированных так и от не дифференцированных контрольных культур удаляли аспирацией из каждой лунки и заменяли новой средой, содержащей или 0 (необработанный образец) или различные концентрации Noc/А (0,14, 0,4, 1,23, 3,7, 11,1, 33,3, и 100 нМ). После обработки в течение 24 часов, клетки отмывали и инкубировали в течение еще 24 часов в среде без эндопептидазы с измененной нацеленностью, чтобы увеличить количество полученного SNAP-25197. Клетки отмывали и собирали для ECL «сэндвич»-метода ИФА как описано в Примере II.

[0202] Эффекты трофических факторов также тестировали на клеточной линии SK-N-DZ. Клетки SK-N-DZ высевали в 96-луночные планшеты, покрытые поли-D-лизином, в количестве 25000 клеток на лунку, в восьми различных средах SM (Таблица 6), и растили в течение 72 часов. Клетки обрабатывали в тех же самых восьми питательных средах эндопептидазой с измененной нацеленностью Noc/A в количествах 0, 0,3 нМ, 3 нМ, и 30 нМ. После 24-часовой обработки клетки отмывали и инкубировали в течение 24 часов в средах без эндопептидаз с измененной нацеленностью, чтобы увеличить количество получаемых продуктов расщепления SNAP-25197. Затем клетки отмывали и собирали для анализа с помощью Вестерн-блоттинга как описано в Примере I.

[0203] Дифференцировка не имела эффекта на поглощение Noc/A в клеточной линии SiMa>P30, в то время как она, кажется, улучшала поглощение в клеточной линии SK-N-DZ. Базальные среды имели существенный эффект на поглощение Noc/A в клеточной линии SK-N-DZ, эти среды с RPMI1640, содержащие трофические факторы N2 и В27, оказались лучшей комбинацией поглощения Noc/A. Наличие NGF в питательных средах, казалось, не улучшало поглощение в этих двух исследуемых клеточных линиях.

Таблица 6.
Эффекты трофических факторов и клеточной дифференцировки на поглощение Noc/A клеточными линиями-кандидатами
Недифференцированные Дифференцированные EC50 поглощения Noc/A
AGN Р33 SK-N-DZ
DMEM, 10% ЭБС - HT >30 нМ
DMEM, 10% ЭБС, N2, В27 - НТ 3 нМ
DMEM, 10% ЭБС, N2, В27, NGF - HT 3 нМ
DMEM, 10% ЭБС, N2, В27, РК - НТ >30 нМ
RPMI1640, 10% ЭБС - НТ 10 нМ
RPMI1640, 10% ЭБС, N2, В27 - 7,2 нМ 1 нМ
Таблица 6.
Эффекты трофических факторов и клеточной дифференцировки на поглощение Noc/А клеточными линиями-кандидатами
Недифференцированные Дифференцированные EC60 поглощения Noc/A
AGN P33 SK-N-DZ
RPM11640, 10% ЭБС, N2, В27, NGF - 9,1 нМ 1 нМ
RPM11640, 10% ЭБС, N2, В27, РК - НТ 10 нМ
- RPMI 1640, N2, В27 10,2 нМ 1 нМ
- RPMI 1640, N2, В27, NGF 9,8 нМ 0,6 нМ
NGF: Фактор Роста Нервов; РК: Ретиноевая Кислота
НТ: Не тестировали

[0204] Используя подобный подход, можно оценивать условия роста и дифференцировки для клональных клеточных линий, включающих клетки, которые имеют родственные рецепторы для других эндопептидаз с измененной нацеленностью.

Пример IV

Разработка стабильных клеточных линий, экспрессирующих экзогенные рецепторы эндопептидазы с измененной нацеленностью

[0205] Следующий пример иллюстрирует, создание стабильной клеточной линии, экспрессирующей экзогенный рецептор эндопептидазы с измененной нацеленностью.

1. Трансфекция рецептора-мишени в клетки, включающие клеточную линию-кандидата

[0206] Эндопептидаза с измененной нацеленностью Noc/A включает ноцицептиновый нацеливающий домен, который является природным лигандом рецептора, подобного рецептору к Опиоидам - 1 (ORL-1). Для получения экспрессионной конструкции включающей открытую рамку считывания для ORL-1, экспрессионную конструкцию pReceiver-M02/ORL-1 получили от GeneCopoeia (GeneCopoeia, Джермантаун, Мэриленд).

[0207] В качестве альтернативы, молекулу полинуклеотида, соответствующую аминокислотной последовательности ORL-1 (например, последовательность аминокислот SEQ ID NO: 25 или SEQ ID NO: 26), можно синтезировать, с помощью стандартных процедур (BlueHeron® Biotechnology, Бозелл, Вашингтон). Олигонуклеотиды длиной 20-50 пар оснований синтезируют, с помощью стандартного фосфорамидитного синтеза. Эти олигонуклеотиды гибридизуют в дуплексы, которые лигируют друг с другом, для получения полноразмерной молекулы полинуклеотида. Эту молекулу полинуклеотида клонируют, с помощью стандартных методов молекулярной биологии, в вектор pUCBHBI по сайту Smal, для получения pUCBHBI/ORL-1. Синтезированную молекулу полинуклеотида исследовали секвенированием с помощью Big Dye Terminator™ Chemistry 3.1 (Applied Biosystems, Фостер-Сити, Калифорния) и секвенатора ABI 3100 (Applied Biosystems, Фостер-Сити, Калифорния). При необходимости можно синтезировать молекулу полинуклеотида, основанную на последовательности аминокислот ORL-1, оптимизированную с обеспечением экспрессии (например, последовательности аминокислот SEQ ID NO: 25 или SEQ ID NO: 26), для улучшения экспрессии в штаммах Escherichia coll. Молекулу полинуклеотида, кодирующего ORL-1, можно изменить таким образом, чтобы 1) она содержала синонимичные кодоны, обычно присутствующие в собственных молекулах полинуклеотидов штаммов Escherichia coli; 2) она имела содержание G+C, более соответствующее среднему содержанию G+C собственных молекул полинуклеотидов из штаммов Escherichia coli; 3) уменьшить полимононуклеотидные области, находящиеся внутри молекулы полинуклеотида; и/или 4) устранить внутренние регуляторные или структурные сайты, присутствующие внутри молекулы полинуклеотида, см., например, Lance E. Steward et a/., Optimizing Expression of Active Botulinum Toxin Type А, публикация патента США 2008/0057575 (6 марта 2008); and Lance E. Steward et al., Optimizing Expression of Active Botulinum Toxin Type E, публикация патента США 2008/0138893 (12 июня 2008). Как только завершили оптимизацию последовательности, олигонуклеотиды длиной 20-50 пар оснований синтезировали с помощью стандартного фосфорамидитного синтеза. Эти олигонуклеотиды гибридизовали в дуплексы, и лигировали друг с другом, для образования полноразмерной молекулы полинуклеотида. Эту молекулу полинуклеотида клонировли, с помощью стандартных способов молекулярной биологии в вектор pUCBHBI по сайту Smal, для образования pUCBHBI/ORL-1. Синтезированнаую молекулу полинуклеотида исследовали секвенированием ДНК. При необходимости, можно произвести оптимизацию экспрессии для различных организмов, таких как, например, штаммы дрожжей, клеточные линии насекомых или млекопитающих, см., например, Steward, публикация патента США 2008/0057575, см. выше, (2008); и Steward, публикация патента США 2008/0138893, см. выше, (2008).

Экземпляры молекул полинуклеотидов, кодирующие ORL-1, включают SEQ ID NO: 61 и SEQ ID NO: 62.

[01] Для построения экспрессионной конструкции, кодирующей ORL-1, pUCBHBI/ORL-1 расщепляют эндонуклеазами рестрикции, которые 1) вырезают молекулу полинуклеотида, кодирующую открытую рамку считывания ORL-1; и 2) позволяют этой молекуле полинуклеотида функционально связаться с вектором pcDNA3 (Invitrogen, Inc., Карлсбад, Калифорния). Эту вставку субклонируют с помощью Т4 ДНК лигазы в вектор pcDNA3, который расщепляют соответствующими эндонуклеазами рестрикции, для получения pcDNA3/ORL-1. Смесь лигаз используют для трансформации электро-компетентных клеток E.coli BL21 (DE3) (Edge Biosystems, Гейтерсбург, Мэриленд) методом электропорации, и клетки высевают на чашки Лурия-Бертани (pH 7,0) с 1,5% агаром, содержащие 50 мкг/мл ампициллина, и поместят в инкубатор на 37°С для роста в течение ночи. Бактерии, содержащие экспрессионную конструкцию, идентифицируют как устойчивые к ампициллину колонии. Конструкции-кандидаты выделят, с помощью мини выделения плазмиды способом щелочного лизиса, и проанализируют картированием с помощью расщепления эндонуклеазами рестрикции, для определения наличия и ориентации вставки. Эта стратегия клонирования приведет к получению экспрессионной конструкции pcDNA3, включающей молекулу полинуклеотида, кодирующего ORL-1.

[0208] Эндопептидаза с измененной нацеленностью Dyn/A включает динорфиновый нацеливающий домен, который является природным лигандом к-опиоидного рецептора (KOR). Для получения экспрессионной конструкции, включающей открытую рамку считывания для ORL-1, экспрессионную конструкцию pReceiver-M02/KOR-1 получили от GeneCopoeia (GeneCopoeia, Джермантаун, Мэриленд). В качестве альтернативы, экспрессионные конструкции кодирующие KOR можно синтезировать и субклонировать для получения экспрессионной конструкции pcDNA3.1/KOR с помощью подхода, подобного описанному выше. Экземпляры аминокислотных последовательностей KOR включают SEQ ID NO: 29 и SEQ ID NO: 30; примеры молекул полинуклеотидов, кодирующих KOR, включают SEQ ID NO: 65 и SEQ ID NO: 66.

[0209] Подобные стратегии клонирования можно использовать, для создания экспрессионных конструкций, кодирующих другие рецепторы к эндопептидазам с измененной нацеленностью, таких как, например, pcDNA3.1/DOR или pcDNA3.1/MOR, pcDNA3.1/Galanin рецептор 1, pcDNA3.1/Galanin рецептор 2, или pcDNA3.1/Galanin рецептор 3. Примеры аминокислотных последовательностей DOR включают SEQ ID NO: 27 и SEQ ID NO: 28;

примеры аминокислотных последовательностей MOR включают SEQ ID NO: 31 примеры аминокислотных последовательностей рецептора Galanin 1 включают SEQ ID NO: 136, SEQ ID NO: 137, и SEQ ID NO: 138; примеры аминокислотных последовательностей рецептора Galanin 2 включают SEQ ID NO: 139; примеры аминокислотных последовательностей рецептора Galanin 3 включают SEQ ID NO: 140. Примеры молекул полинуклеотидов, кодирующих DOR, включают SEQ ID NO: 63 и SEQ ID NO: 64; примеры молекул полинуклеотидов, кодирующих MOR, включают SEQ ID NO: 67; примеры молекул полинуклеотидов, кодирующих рецептор Galanin 1, включают SEQ ID NO: 141, SEQ ID NO: 142, и SEQ ID NO: 143; примеры молекул полинуклеотидов, кодирующих рецептор Galanin 2, включают SEQ ID NO: 144; примеры молекул полинуклеотидов, кодирующих рецептор Galanin 3, включают SEQ ID NO: 145.

[0210] Для введения экспрессионной конструкции, кодирующей рецептор эндопептидазы с измененной нацеленностью, клеточные линии трансфицировали экспрессионной конструкцией, кодирующей рецептор эндопептидазы с измененной нацеленностью. Для трансфекции клеточной линии опиоидным или подобным опиоидному рецептором, клетки клеточной линии-кандидата плотностью 1×107 засевали в колбу Tiys. покрытую Коллагеном IV, и выращивали при 37°С в атмосфере 5% углекислого газа, пока клетки не достигали желаемой плотности. 4,2 мл раствора для трансфекции готовили путем добавления 4 мл Восстановленной Питательной среды OPTI-MEM на основе Сыворотки, содержащей 200 мкл LipofectAmine 2000 (Invitrogen, Карлсбад, Калифорния), инкубированного при комнатной температуре в течение 5 минут, к 4 мл Восстановленной Питательной среды OPTI-MEM на основе Сыворотки, содержащей 20 мкг pReceiver-M02/ORL-1 или 20 мкг pReceiver-M02/KOR-1. Эту трансфекцию инкубировали при комнатной температуре в течение приблизительно 20 минут. Среду заменяли на 8 мл новой среды без сыворотки и антибиотиков, и к клеткам добавляли раствора для трансфекции. Клетки растили в инкубаторе при 37°С в атмосфере 5% углекислого газа в течение приблизительно 16-18 часов. Среду для трансфекции заменяли новой средой, клетки растили в инкубаторе при 37°С в атмосфере 5% углекислого газа. Через 24 часа среду заменяли новой средой, содержащей антибиотик G418 в концентрации 1 мг/мл (селективная среда), и клетки инкубировали в течение 7 дней. Селективную среду заменяли каждую неделю в течение в общей сложности 4 недель (около 90% клеток погибли и были удалены во время еженедельных замен среды).

[0211] Клеточные линии-кандидаты, трансфицированные рецептором ORL-1, включали SiMa>РЗО, ND15, ND7, NG108-T15 и клеточные линии SK-N-DZ. Клеточные линии-кандидаты, трансфицированные рецептором KOR-1, включали SiMa, SiMa>P30, ND15, ND7, NG108-T15 и клеточные линии SK-N-DZ. Трансфицированные клетки NG108-T15 не перенесли селекции на G418.

2. Скрининг стабильно трансфицированных клеточных линий на единичную дозу и дозовый ответ с помощью молекул эндопептидаз с измененной нацеленностью

[0212] Клетки из трансфицированных и отобранных клеточных линий-кандидатов из предыдущего раздела засевали в 96-луночный, покрытый поли-D-лизином, или Коллагеном IV, планшет в количестве 1×105 клеток/лунку в среде RPMI1640, содержащей N2 и добавки В27, и NGF (50-100 нг/мл) и растили в течение 20±4 часов до обработки составом. Затем клетки, стабильно трансфицированные рецептором ORL-1, обрабатывали эндопептидазой с измененной нацеленностью Noc/A в концентрации 30 нМ в той же самой среде в течение 24±2 часов, за исключением клеточной линии SK-N-DZ, которую обрабатывали 10 нМ эндопептидазы с измененной нацеленностью. Клетки лизировали в 120 мкл лизирующего буфера, и 20 мкл лизата смешивали с 2 × ДСН буфером для анализа с помощью Вестерн-блоттинга, который проводили как описано в Примере I. Все линии клеток показали повышенное поглощение состава Noc/A с измененной нацеленностью, после трансфекции рецептором ORL-1 (Таблица 7).

Таблица 7.
Стабильно трансфицированные ORL-1 клеточные линии, протестированные с помощью эндопептидазы с измененной нацеленностью Noc/A
Клеточная линия Описание % расщепленного SNAP25 при 30 нМ
Нетрансфицированн ые Трансфицированные
AGN Р33 Нейробластома Человека 20% 40%
SK-N-DZ Нейробластома Человека 25% при 10 нМ 40% при 10 нМ
ND7 Нейробластома Мыши и гибрид клеток DRG крысы 10% 42%
ND15 Нейробластома Мыши и гибрид клеток DRG крысы 8% 20%
NG108-T15 Нейробластома мыши/гибрид глиомы крысы Клетки не выживают Клетки не выживают

[0213] Клетки из трансфицированных и отобранных клеточных линий-кандидатов из предыдущего раздела засевали в 96-луночный планшет, покрытый поли-О-лизином, или Коллагеном IV, в количестве 1×105 клеток/лунку в среде RPMI1640, содержащей 10% ЭБС и добавок N2 и В27 и растили в течение 20±4 часов до обработки составом. Клетки, стабильно трансфицированные рецептором KOR-1, обрабатывали эндопептидазой с измененной нацеленностью Dyn/A в концентрации 100 нМ в той же самой среде в течение 24±2 часов. Клетки лизировали в 120 мкл лизирующего буфера, и 20 мкл лизата смешивали с 2 × ДСН буфером для анализа с помощью Вестерн-блоттинга, который проводили как описано в Примере I. Все линии клеток показали увеличение поглощения состава Dyn/A с измененной нацеленностью после трансфекции человеческим рецептором KOR-1.

3. Селекция стабильно трансфицированных клональных клеточных линий, проявляющих высокую чувствительность, способом серийных разведении

[0214] Следующий пример иллюстрирует, как идентифицировать клональные клетки из стабильно трансфицированной стабильной клеточной линии, которые восприимчивы к действию эндопептидазы с измененной нацеленностью или имеют способность к поглощению эндопептидазы с измененной нацеленностью.

[0215] Для клонирования единственной клетки из отобранных клеток, описанных выше, использовался метод клонирования клеточной линии способом ограничивающего разведения. Клетки обрабатывали трипсином, считали, разводили до концентрации 0,5-1 клеток на 100 мкл, и высевали по 100 мкл на лунку на селективные среды в пяти 96-луночных планшетах покрытых поли-0-лизином. Клетки инкубировали более 2 недель, пока на дне лунок не сформировались колонии. Отмечали положительные колонии, происходящие из единственных клеток. Фотографии клонов делали с помощью камеры микроскопа. Клетки из лунок с единственным клоном выращивали в течение еще одной недели и переносили в 24-луночные планшеты спустя приблизительно через 4 недели от начала клонирования.

[0216] Главным критерием, используемым для отбора положительных клонов, являлся уровень расщепления SNAP-25 после обработки Noc/A или Dyn/A, который измеряли с помощью анализа методом Вестерн-блоттинга с антителами, которые распознают как интактный, так и расщепленный антиген SNAP-25. Клоны, сверхэкспрессирующие ORL-1, тестировали с 10 нМ, и 30 нМ эндопептидазы с измененной нацеленностью Noc/A в течение ночи, как только появлялось достаточное количество клеток (Таблица 8). Клоны, сверхэкспрессирующие KOR-1, тестировали со 100 нМ эндопептидазы с измененной нацеленностью Dyn/A, в течение ночи (Таблица 9). Кроме того, клоны, сверхэкспрессирующие KOR-1, тестировали при помощи теста связывания Динорфина, как описано в Примере I.

Таблица 8.
Скрининг на единичную дозу стабильно трансфицированных ORL-1 клональных клеточных линий-кандидатов с помощью эндопептидазы с измененной нацеленностью Noc/A
Клеточная линия Номер клона Поглощение при 10 нМ Noc/A Поглощение при 30 нМ Noc/A Повторный скрининг при 1 нМ (% расщепления)
AGN P33 1 + + 28%
AGN P33 2 ++ +++ 50%
AGN P33 3 + НТ
AGN P33 4 НО НО НТ
AGN P33 5 - + 31%
AGN P33 6 ++ +++ 60%
AGN P33 7 + + 14%
AGN P33 8 + + НТ
AGN P33 9 + + 38%
AGN P33 10 + ++ 29%
AGN P33 11 + + НТ
AGN P33 12 + + 27%
ND7 1С11 НТ ++ НТ
ND7 2F3 НТ - НТ
ND7 1D10 НТ - НТ
ND7 1F9 НТ - НТ
ND7 1G10 НТ - НТ
ND7 2D8 НТ - НТ
Таблица 8.
Скрининг на единичную дозу стабильно трансфицированных ORL-1 клональных клеточных линий-кандидатов с помощью эндопептидазы с измененной нацеленностью Noc/А
Клеточная линия Номер клона Поглощение при 10 нМ Noc/A Поглощение при 30 нМ Noc/A Повторный скринингпри 1 нМ (% расщепления)
ND7 2Е2 НТ - НТ
ND7 4 В7 НТ +++ НТ
ND7 3С11 НТ - НТ
ND7 3С3 НТ + НТ
ND7 3Е8 НТ - НТ
ND7 3Е11 НТ - НТ
ND7 2G3 НТ - НТ
ND7 4D5 НТ + НТ
ND7 4D8 НТ + НТ
ND7 4С8 НТ - НТ
ND7 4С9 НТ +++ НТ
ND7 4Е8 НТ + НТ
ND7 2Е6 НТ ++ НТ
ND7 4F4 НТ +++ НТ
ND7 5D6 НТ - НТ
ND7 5G3 НТ - НТ
ND7 4D5 НТ ++ НТ
ND15 1С10 НТ + НТ
ND15 1F10 НТ ++ НТ
ND15 2D8 НТ ++ НТ
ND15 2Е11 НТ - НТ
ND15 2F4 НТ ++ НТ
ND15 2F10 НТ ++ НТ
ND15 2F11 НТ - НТ
ND15 3С4 НТ + НТ
ND15 3С7 НТ ++ НТ
ND15 3Е8 НТ +++ НТ
ND15 4С8 НТ + НТ
ND15 4D8 НТ + НТ
SK-N-DZ №2 - - НТ
Таблица 8.
Скрининг на единичную дозу стабильно трансфицированных ORL-1 клональных клеточных линий-кандидатов с помощью эндопептидазы с измененной нацеленностью Noc/А
Клеточная линия Номер клона Поглощение при 10 нМ Noc/А Поглощение при 30 нМ NoC/А Повторный скрининг при 1 нМ (% расщепления)
SK-N-DZ №4 - - HT
SK-N-DZ №5 +++ ++ HT
SK-N-DZ №6 HT ++ HT
SK-N-DZ №7 + HT HT
SK-N-DZ №8 - HT HT
SK-N-DZ №9 + HT HT
SK-N-DZ №10 - HT HT
SK-N-DZ №11 + +++ HT
SK-N-DZ №12 - HT HT
SK-N-DZ №14 ++ HT HT
SK-N-DZ №16 - HT HT
SK-N-DZ №17 + +++ HT
SK-N-DZ №19 + +++ HT
SK-N-DZ №20 - HT HT
SK-N-DZ №23 HT ++ HT
SK-N-DZ №25 - HT HT
SK-N-DZ №26 - ++ HT
SK-N-DZ №27 + HT HT
SK-N-DZ №28 ++ + HT
SK-N-DZ №30 ++ HT HT
SK-N-DZ №31 - HT HT
SK-N-DZ №32 ++ ++ HT
SK-N-DZ №33 + HT HT
SK-N-DZ №34 +++ но HT
SK-N-DZ №35 + ++ HT
SK-N-DZ №36 - HT HT
Таблица 8.
Скрининг на единичную дозу стабильно трансфицированных ORL-1 клональных клеточных линий-кандидатов с помощью эндопептид измененной нацеленностью Noc/A
Клеточная линия Номер клона Поглощение при 10 нМ Noc/А Поглощение при 30 нМ Noc/A Повторный скринингпри 1 нМ (% расщепления)
SK-N-DZ №37 +++ ++ НТ
SK-N-DZ №42 - НТ НТ
SK-N-DZ №43 + ++ НТ
НО: Не Определено; НТ: Не Тестировали.
-: нет поглощения;+; минимальное поглощение;++: умеренное поглощение;+++: существенное поглощение
Таблица 9.
Скрининг на единичную дозу стабильно трансфицированных KOR-1 клональных клеточных линий-кандидатов с помощью эндопептидазы с измененной нацеленностью Dyn/A
Клеточная линия Номер клона Поглощение при 100 нМ Dyn/A Связывание при 100 нМ Dyn Отобраны для дальнейшего тестирования
SiMa 2 - - Нет
SiMa 6 + + Нет
SiMa 8 + + Нет
SiMa 12 +++ ++ Да
SiMa 14 ++ ++ Нет
SiMa 20 + ++ Нет
SiMa 25 ++ ++ Нет
AGN P33 1 +++ + Да
AGN P33 3 ++ + Нет
AGN P33 5 ++ + Да
AGN P33 6 ++ + Нет
AGN P33 7 +++ + Да
AGN P33 8 ++ + Да
AGN P33 9 +++ + Да
AGN P33 10 +++ + Да
AGN P33 11 ++ + Нет
AGN P33 12 +++ + Да
AGN P33 14 + + Нет
Таблица 9.
Скрининг на единичную дозу стабильно трансфицированных KOR-1 клональных клеточных линий-кандидатов с помощью эндопептидазы с измененной нацеленностью Dyn/A
Клеточная линия Номер клона Поглощение при 100 нМ Dyn/A Связывание при 100 нМ Dyn Отобраны для дальнейшего тестирования
AGN РЗЗ 16 ++ + Нет
AGN РЗЗ 17 +++ + Да
AGN РЗЗ 21 + ++ Нет
ND7 А1 + + Нет
ND7 А2 - - Нет
ND7 A3 - - Нет
ND7 А4 - - Нет
ND7 А5 - - Нет
ND7 А6 - - Нет
ND7 А7 - - Нет
ND7 А8 - - Нет
ND7 А9 - - Нет
ND7 А10 - - Нет
ND7 АН - - Нет
ND7 А12 +++ +++ Да
ND7 В1 - - Нет
ND7 В2 - - Нет
ND7 В3 - - Нет
ND7 В4 - - Нет
ND7 В5 + + Да
ND7 В6 - - Нет
ND7 В7 - - Нет
ND7 В8 - - Нет
ND7 В9 - - Нет
ND7 В10 - - Нет
ND7 В11 - - Нет
ND7 В12 - - Нет
ND7 С1 - - Нет
ND7 С2 - - Нет
ND7 С33 - - Нет
Таблица 9.
Скрининг на единичную дозу стабильно транссрицированных клональных клеточных линий-кандидатов с помощью эндопептидазы измененной нацеленностью Dyn/A
Клеточная линия Номер клона Поглощение при 100 нМ Dyn/A Связывание при 100 нМ Dyn Отобраны для дальнейшего тестирования
ND7 С4 - - Нет
ND7 С5 - - Нет
ND7 С6 + + Нет
ND7 С7 - - Нет
ND7 С8 - - Нет
ND7 С9 - - Нет
ND7 С10 - - Нет
ND7 С11 - - Нет
ND7 С12 - - Нет
ND7 D1 - - Нет
ND7 D2 - - Нет
ND7 D3 - - Нет
ND7 D4 - - Нет
ND7 D5 - - Нет
ND7 D6 ++ ++ Да
ND7 D7 ++ ++ Да
ND7 D8 - - Нет
ND7 D9 - - Нет
ND7 D10 - - Нет
ND7 D11 - - Нет
ND7 D12 - - Нет
ND7 Е1 - - Нет
ND7 Е2 - - Нет
ND7 Е3 - - Нет
ND7 Е4 - - Нет
ND7 Е5 - - Нет
Таблица 9.
Скрининг на единичную дозу стабильно трансфицированных KOR-1 клональных клеточных линий-кандидатов с помощью эндопептидазы с измененной нацеленностью Dyn/A
Клеточная линия Номер клона Поглощение при 100 нМ Dyn/A Связывание при 100 нМ Dyn Отобраны для дальнейшего тестирования
ND7 Е6 - - Нет
ND7 Е7 - - Нет
ND7 Е8 - - Нет
ND7 Е9 - - Нет
ND7 ЕЮ - - Нет
ND7 Е11 - - Нет
ND7 Е12 ++ ++ Да
ND7 F1 - - Нет
ND7 F2 - - Нет
ND7 F3 - - Нет
ND7 F4 - - Нет
ND15 А1 - - Нет
ND15 А2 - - Нет
ND15 A3 + - Нет
ND15 А4 + - Нет
ND15 А5 - - Нет
ND15 А6 ++ - Нет
ND15 А7 ++ - Нет
ND15 А8 ++ - Нет
ND15 А9 + - Нет
ND15 А10 + - Нет
ND15 АН - - Нет
ND15 А12 - - Нет
ND15 В1 - - Нет
ND15 В2 ++ - Нет
ND15 В3 - - Нет
ND15 В4 - - Нет
ND15 В5 +++ - Да
Таблица 9.
Скрининг на единичную дозу стабильно трансфицированных KOR-1 клональных клеточных линий-кандидатов с помощью эндопептидазы с измененной нацеленностью Dyn/A
Клеточная линия Номер клона Поглощение при 100 нМ Dyn/A Связывание при 100 нМ Dyn Отобраны для дальнейшего тестировани я
ND15 В6 + - Нет
ND15 В7 - - Нет
ND15 В8 - - Нет
ND15 В9 - - Нет
ND15 В10 - - Нет
ND15 В11 - - Нет
ND15 В12 - - Нет
ND15 С1 - - Нет
ND15 С2 +++ + Да
ND15 С3 - - Нет
ND15 С4 - - Нет
ND15 С5 + НТ Нет
ND15 С6 +++ НТ Да
SK-N-DZ №11 НТ НТ HO
НО: Не Определено; НТ: Не Тестировали.
-: нет поглощения; +: минимальное поглощение; ++: умеренное поглощение; +++: существенное поглощение

4. Скрининг стабильно трансфицированных клональных клеточных линий на дозовый ответ с помощью эндопептидазы с измененной нацеленностью

[0217] Стабильно трансфицированные клональные клеточные линии-кандидаты из раздела 3 показывающие существенное поглощение эндопептидазы с измененной нацеленностью Noc/A исследовали в тесте на полнодозовый ответ, для определения чувствительности к эндопептидазе с измененной нацеленностью Noc/A и ее и эффективности. Клетки засевали в 96-луночные, покрытые поли-D-лизином, или Коллагеном IV, планшеты в количестве 1×105 клеток/лунку в среде RPMI 1640, содержащей добавки N2, В27 и NGF (50-100 нг/мл) и выращивали 20±4 часов до обработки составом. Клетки из родительской клеточной линии AGN Р33 и клональной клеточной линии ND7 обрабатывали 0, 0,14 нМ, 0,4 нМ, 1,23 нМ, 3,7 нМ, 11,1 нМ, 33,3 нМ и 100 нМ Noc/A в той же самой среде в течение 24 часов плюс инкубировали 24 часа в среде без эндопептидазы с измененной нацеленностью, чтобы допустить расщепление SNAP-25. Клетки из родительской клеточной линии AGN РЗЗ также обрабатывали 0, 0,03 нМ, 0,08 нМ, 0,24 нМ, 0,74 нМ, 2,22 нМ, 6,67 нМ и 20 нМ Noc/А в той же самой среде в течение 24 часов плюс инкубировали 24 часа в среде без эндопептидазы с измененной нацеленностью, чтобы допустить расщепление SNAP-25. Среду удаляли, клетки отмывали и лизировали для исследования «сэндвич»-методом ИФА с усиленной хемилюминесценцией как детализировано в Примере II. Данные от родительской клеточной линии AGN Р33 и клональных клеточных линий, стабильно трансфицированных рецептором ORL-1, приведены в Таблице 10. Клоны №2 и №3 продемонстрировали лучшую чувствительность к эндопептидазе с измененной нацеленностью Noc/A и ее более высокую эффективность, чем родительская клеточная линия. Более того, увеличенная чувствительность новых клональных клеточных линий позволила использовать более низкие концентрации для дозового ответа, подтверждая, что новые клональные клеточные линии более чувствительны.

Таблица 10.
Сводная таблица значений отношения сигнала к шуму (С/Ш) и EC50 трех наиболее чувствительных клонов, сверхэкспрессирующих ORL-1 на фоне клеточной линии AGN Р33
Родительская линия Клон 2 Клон 6 Клон 8
Отношение С/Ш 0,03 нМ/ВК 41 26 1,8
Отношение С/Ш 20 нМ/ВК 259 522 33,1
Отношение С/Ш 0,14 нМ/ВК
Отношение С/Ш 10 нМ/ВК
EC50 (нМ) 6,8±1,1 0,6±0,1 0,7±0,07 0,3±0,2

[0218] Данные от родительских клеточных линий ND7 и клональных клеточных линий, стабильно трансфицированных рецептором ORL-1, приведены в Таблице 11. Все протестированные клоны продемонстрировали улучшенную чувствительность к эндопептидазе с измененной нацеленностью Noc/A и ее большую эффективность по сравнению с родительской клеточной линией ND7. Клоны 4 В7, 1Е6, и 1С11 оказались самыми чувствительными и имели значение EC50 ниже 10 пМ.

Таблица 11.
Сводная таблица значений отношения сигнала к шуму (С/Ш) и EC50 шести наиболее чувствительных клонов, сверхэкспрессирующих ORL-1 на фоне клеточной линии ND7
Родительская линия 1С11 4 В7 4С9 4F4 1Е6 3Е9
Отношение С/Ш 0,14нМ/ВК 1,7 9,3 11,1 5,3 3,6 5,8 5,1
Отношение С/Ш 100 нМ/ВК 53 217 243 126 169 123 121
EC50 (нМ) >50 8,6±2 5,7±0,5 33±11 24±5 6,7±1 >30 нМ

[0219] В таблице 12 приведены результаты, полученные от производства и тестирования клональных клеточных линий, сверхэкспрессирующих рецептор ORL-1 на фоне различных клеточных линий.

Таблица 12:
Обзор клональных клеточных линий, которые сверхэкспрессируют рецептор ORL-1 Человека, протестированных с помощью Noc/A
Исходная Клеточная Линия Вид Стабильные клеточные линии, протестированные с полной дозой Noc/A EC50 (нМ)
AGN Р33 Нейробластома человека Три 0,6-2,5
ND7 Нейробластома крысы и гибрид DRG Шесть 3,7-8
SK-N-DZ Нейробластома человека Нет (семь стабильных клонов отобраны для дальнейшего исследования) Н/п

Пример V

Получение клональных клеточных ли ни и из родительской клеточной линии SK-N-DZ

[0220] Следующий пример иллюстрирует идентификацию клеток клонов из родительской стабильной клеточной линии, которые восприимчивы к ингибированию экзоцитоза посредством эндопептидазы с измененной нацеленностью или имеют способность поглощать эндопептидазу с измененной нацеленностью.

1. Выделение клональных клеточных линий

[0221] Во время изучения клеточной линии SK-N-DZ мы обнаружили, что клетки, составляющие эту стабильную клеточную линию, содержали клетки по крайней мере пяти различных фенотипов. Для определения, отвечает ли какой либо из этих фенотипов клеток за восприимчивость этой клеточной линии к ингибированию экзоцитоза посредством эндопептидазы с измененной нацеленностью, проводили два различных скрининга способом ограничивающего разведения в результате чего получали одиночные колонии клеток каждого фенотипа.

[0222] Культуру клеток подходящей плотности из маточного раствора культуры SK-N-DZ выращивали в колбе Т175, покрытой Коллагеном IV, содержащей DMEM, 10% Эмбриональную Бычью Сыворотку (инактивированную высокой температурой), 0,1 мМ Не Незаменимых Аминокислот, 10 мМ HEPES, 1 мМ пируват натрия, 100 ед/мл Пенициллина, 100 мкг/мл Стрептомицина. После второго пересева клетки обрабатывали трипсином, для получения клеточной суспензии, и определяли концентрацию клеток. Приблизительно 4,0×106 клеток из этой суспензии переносили в пробирку на 50 мл и разделяли на одиночные клетки интенсивным пропусканием несколько раз через иглу размером 18,5, при помощи шприца на 10 мл. Клетки из этой разделенной одноклеточной суспензии разбавляли до концентрации 0,2×106 клеток/мл, добавлением 15 мл новой питательной среды, и 2,5 мкл этого разведения добавляли к 50 мл новой питательной среды, для получения концентрации 10 клеток/мл. 100 мкл питательной среды из этого заключительного разведенного маточного раствора культуры добавляли в каждую лунку 96-луночных планшетов, покрытых Коллагеном IV, и клетки выращивали в инкубаторе при 37°С в атмосфере 5% углекислого газа без встряхивания в течение четырех недель. Четыре 96-луночных планшета использовали для анализа. Через четыре недели каждую лунку исследовали под микроскопом для идентификации растущих единичных колоний, и в лунку к каждой найденной колонии добавляли 100 мкл новой питательной среды, клетки выращивали в инкубаторе при 37°С в атмосфере 5% углекислого газа без встряхивания в течение двух недель. Еще через две недели роста, растущие единичные колонии обрабатывали трипсином и переносили в новые 96-луночные планшеты для последующего роста. Как только колонии вырастали согласно визуальному наблюдению приблизительно до 1000 клеток, их обрабатывали трипсином, и каждую клеточную суспензию переносили в новую лунку 24-луночного, покрытого Коллагеном IV, планшета. Клетки выращивали в инкубаторе при 37°С в атмосфере 5% углекислого газа в новой питательной среде, пополняемой при необходимости каждые 2-3 дня. Клетки выращивали, пока культура не достигала приблизительно 60% смыкания или более, при котором их обрабатывали трипсином, и каждую клеточную суспензию переносили в покрытую Коллагеном IV колбу площадью 25 см2, на основании смыкания клеток в 24-луночном планшете. Клетки выращивали в инкубаторе при 37°С в атмосфере 5% углекислого газа в новой питательной среде, пополняемой каждые 2-3 дня, при необходимости. Как только клетки в колбе достигли смыкания 70-80%, их замораживали и хранили в жидком азоте до исследования на восприимчивость к ингибированию экзоцитоза эндопептидазой с измененной нацеленностью Noc/A. Из 384 колоний первоначально выделенных из обоих скринингов, на основе критериев жизнеспособности и роста, отобрали 24 клональных клеточных линии, их выращивали для последующих процедур скрининга. Из них выделили 12 быстро растущих клеточных линий.

2. Первичный скрининг чувствительности клеток из клональной клеточной линии к активности эндопептидазы с измененной нацеленностью с помощью эндопептидазы с измененной нацеленностью

[0223] Для определения, восприимчивы ли клетки из клональной клеточной линии к активности эндопептидазы с измененной нацеленностью Noc/A, первичный скрининг проводили, с помощью иммунологического способа определения активности эндопептидазы.

[0224] Тринадцать клонов SK-N-DZ (№3, №4, №5, №8, №9, №10, №13, №15, №16, №17, №18, №22, и №23) плюс родительские клетки SK-N-DZ высевали в 96-луночный планшет (число клеток на лунку неизвестно) в ЕМЕМ, 10% ЭБС, 1×В27, и 1×N2 и инкубировали в течение ночи. Клетки обрабатывали Noc/A в концентрации 1 нМ в течение 24 часов. Клетки лизировали в 100 мкл лизирующего буфера в течение 20 минут и центрифугировали при 4000 об./мин. в течение 20 минут. К 50 мкл лизата добавляли пятьдесят микролитров 2х ДСН буфера для образцов и нагревали до 95°С в течение 5 минут. Десять микролитров белковых образцов загружали на лунку 12% геля NuPage и производили анализ с помощью Вестерн-блоттинга как описано в Примере I. Оценка количества общего SNAP-25 и расщепленного SNAP-25 показала, что клоны №3, №8, №15, и №22 способны к поглощению Noc/A, по крайней мере, как родительские клетки. Обработка для теста на полнодозовый ответ и анализ при помощи «сэндвич»-методом ИФА с усиленной хемилюминесценцией проводились после того как количество клеток увеличили.

3. Вторичный скрининг на ответ клональных клеточных линий с помощью молекул эндопептидазы с измененной нацеленностью

[0225] Для определения, восприимчивы ли клетки из клональной клеточной линии к активности эндопептидазы с измененной нацеленностью Noc/А, проводили вторичный скрининг, с помощью иммунологического способа определения активности эндопептидазы.

[0226] Для дальнейшего сравнения этих клонированных клеточных линий SK-N-DZ, проводили ECL «сэндвич»-метода ИФА. Пять клонов (№3, №9, №15, №16, №22) плюс родительские клетки SK-N-DZ засевали в 96-луночные, покрытые поли-D-лизином, планшеты, по клеточной линии на планшет, в количестве 25000 клеток на лунку в среде, RPMI 1640 с 10% ЭБС, 1×В27, и 1×N2 (без NGF) и выращивали в течение выходных. Клетки обрабатывали Noc/А в дозах от 0 до 20 нМ (0, 0,03, 0,08, 0,24, 0,74, 2,22, 6,67, 20 нМ) в течение 24 часов. Количественно расщепленного SNAP-25197 определяли способом ECL ИФА как описано в Примере I.

[0227] В таблице 13 приведены значения ЕС50 и отношения сигнал-шум для пяти клонов и их родительской клеточной линии. По сравнению с родительской клеточной линией, клоны №16 и №22 демонстрировали сходные значения EC50 (~2 нМ), а три клона, названные №3, №9, и №15, демонстрировали меньшие значения EC50 (<1 нМ). Однако общий сигнал от расщепленного SNAP-25 был выше в клонах №3, №22 и родительских клетках. Клоны №9, №16, и №15 имели более низкий общий уровень сигнала по сравнению с остальными клеточными линиями.

Таблица 13.
Сводная таблица значений отношения сигнала к шуму (С/Ш) и EC50 пяти клонов, полученных из клеток SK-N-DZ с помощью клонирования путем ограничивающего разведения.
Родитель екая линия 3 9 19 16 22
Отношение С/Ш 0,03 нМ/ВК 2 3 2 2 2 3
Отношение С/Ш 20 нМ/ВК 19 27 12 8 14 20
EC50 (нМ) 2,6±1,5 0,8±0,07 0,7±0,04 0,6±0,1 2,2±0,8 1,9±0,6

[0228] Условия обработки Noc/А клонов SK-N-DZ оптимизировали, и проводили анализ сравнивающий клоны №3, №15, №22, и гетерогенную родительскую клеточную линию SK-N-DZ. В Таблице 14 показаны результаты сравнения и продемонстрировано, что оптимизация анализа сильно улучшила отношение сигнал-шум. Клоны №3 и №22 отбирали для дальнейшей разработки анализа, поскольку они обладают превосходной чувствительностью и эффективностью.

Таблица 14.
Сводная таблица значений отношения сигнала к шуму (С/Ш) и EC50 трех клонов, полученных из клеток SK-N-DZ с использование оптимизированных условий.
Родительская линия 3 15 22
Отношение С/Ш 0,03 нМ/ВК 15 8 5 10
Отношение С/Ш 20 нМ/ВК 107 89 33 60
EC50 (нМ) 0,6±0,2 0,9±0,2 0,6±0,1 0,4±0,09

Пример VI

Исследование и сравнение клональных клеточных линий по критерию поглощения эндопептидаз с измененной нацеленностью

[0229] Следующий пример иллюстрирует исследование и сравнение клональных клеточных линий, полученных либо из стабильных клеточных линий, включающих гетерогенную популяцию, либо с помощью трансфекции рецептора-мишени и последующего клонирования клеточной линии.

[0230] Для оценки специфичности или избирательности поглощения эндопептидаз с измененной нацеленностью проводили тесты на неспецифичное поглощение, используя эндопептидазу с измененной нацеленностью, у которой отсутствует нацеливающий домен. В случае эндопептидазы с измененной опиоидной нацеленностью клетки клона №6 клеточной линии AGN Р33 (включающие клетки, стабильно трансфицированные экспрессионной конструкцией, кодирующей рецептор ORL-1) и клональные клеточные линии №3 и №22 SK-N-DZ (включающие клетки, экспрессирующие эндогенный рецептор ORL-1) засевали по 150000 клеток на лунку 96-луночных планшетов, покрытых поли-D-лизином, в среду без сыворотки RPMI 1640, содержащую добавки N2 и В27 и NGF (50 нг/мл), и инкубировали в течение 20±4 часов при 37°С в инкубаторе с 5%-м содержанием CO2 перед этапом обработки соединениями. Клетки обрабатывали 8 дозами Noc/A в диапазоне 0-20 нМ или 0-40 нМ и/или восемью дозами LHN/A в диапазоне от 0 до 400 нМ или от 0 до 40 нМ в той же самой среде в течение 22 часов. Среду удаляли и клетки промывали, лизировали и центрифугировали для удаления остатков клеток при подготовке к тесту с помощью "сэндвич"-метода твердофазного ИФА. Планшет для ИФА с иммобилизованными моноклональными антителами 2Е2А6 блокировали в 150 мкл Блокирующего Буфера при комнатной температуре в течение 1 часа. После блокирования буфер удаляли, в каждую лунку добавляли 30 мкл лизата клеток и инкубировали планшет при 4°С в течение 2 часов. Планшеты трижды промывали ФБР-Т и в нижний угол лунок добавляли 30 мкл поликлональных детектирующих антител Q-SMAP25, маркированных сложным эфиром SULFO-TAG М-ГС, в концентрации 5 мкг/мл в 2% блокирующем реактиве в ФБР-Т. Планшет запечатывали и встряхивали при комнатной температуре в течение 1 часа, после чего следовали три отмывки в ФБР-Т. После завершения отмывок, в каждую лунку добавляли 150 мкл 1x буфера для считывания, и планшет считывали в устройстве для считывания изображений SI6000. Результаты по сравнению поглощения Noc/А относительно отрицательного контроля LHN/A приведены в Таблице 15 и Таблице 16. Эти результаты демонстрируют наличие четкого разделения между поглощением Noc/А и LHN/A в обеих клеточных линиях, что свидетельствует о специфичности поглощения Noc/А,

Таблица 15.
Неспецифическое поглощение у клона №3 SK-N-DZ. Приведены данные на основании четырех независимых экспериментов
нМ % неспецифического поглощения СОС (стандартная ошибка среднего)
0 2 0,5
1 6 0,5
2 8 0,5
5 10 1
15 19 0,9
44 33 1,5
133 65 2,4
400 93 2,3
Таблица 16.
Неспецифическое поглощение у клеток hORL-1 №6. Приведены данные на основании трех независимых экспериментов
нМ % неспецифического поглощения СОС (стандартная ошибка среднего)
0 1 0,2
1 2 0,2
2 3 0,6
5 3 0,3
15 8 1,3
44 12 1,9
133 22 3,0
400 32 3,0

[0231] В Таблице 17 обобщены результаты по исследованию и сравнению трех клеточных линий. Клональные клеточные линии №3 и №22 SK-N-DZ характеризуются чувствительностью, идентичной первичным eDRG, и отличным отношением сигнала к шуму, подходящим для создания надежного теста на эндопептидазу с измененной нацеленностью Noc/А. Клональная клеточная линия №6 AGN Р33 также является отличным кандидатом с низким неспецифическим поглощением и подходящей чувствительностью.

Таблица 17.
Показатель Клон 3 SK-N-DZ Клон 22 SK-N-DZ Клон 6 AGN P33 eDRG
Вид-источник клеточной линии Клональная человеческая Клональная человеческая Клональная человеческая Первичная крысы
Экспрессия клеточного рецептора Эндогенный человеческий ORL1 Эндогенный человеческий ORL1 Трансфицирова нный человеческий ORL1 Эндогенный крысиный ORL1
Динамический диапазон Ответ от дозы 0,03 до 20 нМ Ответ от дозы 0,03 до 20 нМ Ответ от дозы 0,04 до 40 нМ Ответ от дозы 0,17 до 20 нМ
Чувствительность (EC50) ЕС50=0,75±0,1 (N=10) ЕС50=0,8±0,2 (N=9) ЕС50=2,4±0,2 (N=21) ЕС50=0,8±0,15 (N=6)
ВЛНК 20 нМ 20 нМ 20 нМ 10-20 нМ
С/Ш ВЛНК/фон 98±15 (N=10) 86±17 (N=9) 385±32 (N=19) -300
С/Ш НЛНК/фон 12±2(N=11) 10±2 (N=9) 29±7 (N=18) Н/П
Специфичность по сравнению с LHN/A ≥2 log (N=4) ≥2 log (N=4) ≥2 log (N=3) Н/П
Экспрессия SNAP-25 Эндогенная Эндогенная Эндогенная Эндогенная
Конкуренция с ноцицептиновым вариантом Полная конкуренция (n=4) Полная конкуренция (n=4) Частичная конкуренция (n=4) Н/П
Ингибирование антителами против ноцицептина Полная конкуренция (n=4) Полная конкуренция (n=4) Полная конкуренция (n=4) Н/П
Ингибирование антителами анти-868 Частичная конкуренция (n=4) Частичная конкуренция (n=4) Частичная конкуренция (n=4) Н/П

[0232] Для оценки чувствительности поглощения эндопептидаз с измененной нацеленностью проводили тесты на насыщение связывания лиганда. Взаимодействие большинства лигандов с их участками связывания можно охарактеризовать в смысле аффинности связывания (Руководство по Тестам NIH). Вообще, высокая аффинность связывания подразумевает более длительное время нахождения лиганда в соответствующем сайте связывания рецептора, чем в случае низкой аффинности связывания. Константу диссоциации обычно используют для описания аффинности между лигандом (L) (таким как препарат) и белком (Р), т.е. степени прочности связывания лиганда с конкретным белком. В эксперименте по насыщению связывания в равновесии измеряют общее и неспецифическое связывание (НСС) при различных концентрациях радиоактивно меченного лиганда. Равновесную константу диссоциации или аффинность к радиоактивно меченному лиганду, Kd, и максимальное число участков связывания рецептора, Bmax, можно вычислить на основании специфического связывания (общее - НСС) с использованием нелинейного регрессионного анализа. Kd для специфического связывания можно вычислить, используя нелинейный регрессионный анализ гиперболической кривой связывания с одним участком (т.е. GraphPad Prism) как показано в приведенном ниже уравнении, где Bmax представляет собой максимальное число участков связывания (пмоль/мг или пмоль/клетку или участок/клетку), а Kd (нМ, пМ и т.д.) представляет собой концентрацию радиоактивно меченного лиганда, необходимую для достижения половины максимального уровня связывания:

[0233] Для теста с эндопептидазой с измененной опиоидной нацеленностью клетки из клеточной линии клона №6 AGN Р33 (включающей клетки, стабильно трансформированные экспрессионной конструкцией, кодирующей рецептор ORL-1), родительской клеточной линии SK-N-DZ и клональных клеточных линий SK-N-DZ №3, №15 и №22 (включающих клетки, которые экспрессируют эндогенный рецептор ORL-1) засевали по 200000 клеток на лунку в 48-луночные покрытые поли-D-лизином планшеты в среду без сыворотки RPMI 1640, содержащую добавки 1×N2 и 1×В27, и инкубировали в течение ночи при 37°С в инкубаторе с 5%-м CO2. Среду удаляли, и клетки вместе со 150 мкл буфера для связывания на основе Tris добавляли в лунки для оценки общего связывания, а 100 мкл буфера для связывания на основе Tris добавляли в лунку для оценки неспецифического связывания. В лунки для оценки неспецифического связывания добавляли около 50 мкл 4х конечной концентрации немеченого ноцицептина (2,5 мкМ для клеточных линий SK-N-DZ и 1 мкМ для клональной клеточной линии №6 AGN Р33), и 50 мкл 4х конечной концентрации 'Н-ноцицептина (0 нМ, 0,05 нМ, 0,1 нМ, 0,2 нМ, 0,4 нМ, 0,8 нМ, 1,6 нМ, 3,1 нМ, 6,3 нМ, 12,5 нМ, 25 нМ и 50 нМ для клеточных линий SK-N-DZ и 0, 0,01 нМ, 0,02 нМ, 0,039 нМ, 0,078 нМ, 0,156 нМ, 0,313 нМ, 0,625 нМ, 1,25 нМ, 2,5 нМ, 5,0 нМ и 10 нМ для клональной клеточной линии №6 AGN РЗЗ) добавляли как в лунки для оценки общего связывания, так и в лунки для оценки неспецифического связывания до конечного объема 200 мкл. После инкубации при 37°С в течение 30 минут лунки дважды промывали 0,5 мл холодного Буфера для Промывки. Клетки денатурировали в 200 мкл 2Н NaOH и переносили сцинтилляционные флаконы на 20 мл, содержащие 5 мл сцинтилляционной жидкости. Исходные данные использовали для построения кривых доза-эффект и вычисления Kd для каждого образца. Полученные исходные данные переносили в SigmaPlot v10.0 и использовали подбор Насыщения Одного Участка для построения кривых доза-эффект в категории уравнений Связывания Лиганда. Получали графические отчеты, которые содержали следующие параметры: R2 (коэффициент корреляции), Втах и Kj±SE (Коэффициент ± стандартная ошибка). Кривые общего связывания, специфического связывания и неспецифического связывания получали в тестах, выполненных на клетках клональных клеточных линий №3, №15 и №22 SK-N-DZ и клональной клеточной линии №6 AGN Р33. Клональные клеточные линии №3 и №22 SK-N-DZ демонстрировали зависимое от концентрации и насыщаемое связывание 3H-ноцицептина. В тех же самых экспериментальных условиях клональная клеточная линия №15 SK-N-DZ демонстрировала зависимый от дозы ответ на 3H-ноцицептин, но не достигала насыщения при самой высокой дозе 50 нМ. По сравнению с клеточными линиями SK-N-DZ, экспрессирующими эндогенный ORL-1, клетки из клональной клеточной линии №6 AGN Р33 демонстрировали значительно более высокую аффинность связывания с 3H-ноцицептином (самая высокая доза составляла 10 нМ по сравнению с 50 нМ для SK-N-DZ) при низком неспецифичном связывании.

[0234] Кривые насыщения связывания для клональных клеточных линий №3, №22 и №15 SK-N-DZ и клональной клеточной линии №6 AGN Р33 использовали для оценки значений Kd и Bmax из трех независимых экспериментов по связыванию для каждой клеточной линии, проведенных в три разные дня. Ранжированный порядок этих четырех клеточных линий таков: клональная клеточная линия №6 AGN Р33 (Ka=1,86 нМ и Bmax=2,9 фмоль/клетку) > клональная клеточная линия №3 SK-N-DZ (Kd=14 нМ и Bmax=0,6 фмоль/клетку) ≥ клональная клеточная линия №22 SK-N-DZ (Kd=17 нМ и Bmax = 0,6 фмоль/клетку) >> клональная клеточная линия №15 SK-N-DZ (Kd>50 нМ). Для получения данных доза-эффект с насыщением для клональной клеточной линии №15 SK-N-DZ необходимо использовать более высокий диапазон доз 3H-ноцицептина. Таблица 16 обобщает данные исследования участков специфического связывания ноцицептина в плазматической мембране стабильных клеточных линий, три из которых представляют собой клональные клеточные линии №3, №15 и №22 SK-N-DZ, а четвертая - клональную клеточную линию №6 AGN Р33. Данные показали следующее: 1) наличие у клональной клеточной линии №6 AGN Р33 участка связывания с высокой аффинностью и очень низким неспецифическим связыванием (Kd 1,8 нМ и Bmax 2,9 фмоль на клетку); 2) связывание ноцицептина может происходить на нативных клетках SK-N-DZ, экспрессирующих эндогенный рецептор; 3) клональная клеточная линия №6 AGN Р33 обладала аффинностью к ноцицептину, которая примерно в 10 раз превышала таковую у клеточных линий SK-N-DZ; 4) по наблюдениям в клеточном тесте на активность, клональные клеточные линии №3 и №22 SK-N-DZ (Ко 14-17 нМ, Bmax 0,6 фмоль на клетку) содержали больше рецепторных участков в пересчете на клетку, чем клональная клеточная линия №15 SK-N-DZ (не достигающая насыщения в том же самом диапазоне доз).

Таблица 18. Обзор тестов насыщения связывания 3H-ноцицептина на четырех ведущих клеточных линиях (n=3 независимых экспериментов)
Клеточные Линии Kd (нМ±CO) Bmax (фмоль/клетку)
SK-N-DZ №3 14±1,6 0,59
SK-N-DZ №15 >50 HO
SK-N-DZ №22 16,7±1,1 0,58
Клональная клеточная линия №6 AGN Р33 1,86±0,1 2,89

[0235] Для оценки чувствительности поглощения эндопептидаз с измененной нацеленностью, количество рецепторов эндопептидаз с измененной нацеленностью, экспрессируемых на уровне мРНК, оценивали с помощью ПЦР-РВ. Количество рецептора, экспрессируемого в клетках, является важным аспектом исследования клеточной линии, используемой для тестирования, и связано с чувствительностью к эндопептидазе с измененной нацеленностью. Количество экспрессируемого рецептора эндопептидазы с измененной нацеленностью может также являться инструментом для скрининга других потенциальных клеточных линий и исключения клеточных линий, которые не экспрессируют рецептор-мишень. Одним из методов для измерения экспрессии рецептора является определение количества мРНК рецептора эндопептидазы с измененной нацеленностью с использованием ПЦР в реальном времени (ПЦР-РВ).

[0236] Для исследования рецептора эндопептидазы с измененной опиоидной нацеленностью РНК выделяли из клеток нетрансфицированной родительской клеточной линии SiMa, клеток из клональной клеточной линии №6 AGN Р33, клеток из родительской клеточной линии SK-N-DZ и клеток из клональных клеточных линий №3 и №22 SK-N-DZ выращенных в среде без сыворотки или в среде с сывороткой. мРНК преобразовывали в кДНК, и ORL-1 амплифицировали и измеряли в реальном времени для определения относительного количества, присутствующего в каждой клеточной линии, используя следующие олигонуклеотидные праймеры для ORL-1: прямой 5'-CACTCGGCTGGTGCTGGTGG-3' (SEQ ID NO: 148) и обратный 5'-AATGGCCACGGCAGTCTCGC-3' (SEQ ID NO: 149). Количество ДНК определяли с использованием красителя SYBR® green, флуоресценция которого пропорциональна количеству двухцепочечной ДНК (ПЦР-продукта), присутствующему в реакции.

Логистическую кривую для каждой реакции строили, связывая количество флюоресценции с числом циклов. Чем быстрее реакция достигает линейной фазы кривой, тем больше кДНК рецептора ORL-1 присутствует в реакции. Контрольную реакцию ОТ, в которую не добавляли фермент, использовали для проверки наличия загрязнений. Поскольку в данной реакции отсутствует фермент ОТ, не будет происходить синтез кДНК. ПЦР-продукт не может быть синтезирован на матрице РНК, поэтому единственной возможностью появления кривой ПЦР в реакции -ОТ является загрязнение геномной ДНК. В реакциях -ОТ появление кривой ПЦР не наблюдалось, подтверждая минимальный уровень загрязнения геномной ДНК (данные не показаны). В Таблице 18 приведены клеточные линии и соответствующие им значения СТ. СТ представляет собой число циклов ПЦР, необходимое для того, чтобы сигнал соответствующей реакции ПЦР превысил заданный порог. Количество мРНК рецептора ORL-1 в клеточной линии можно сравнить с данными для других клеточных линий по соответствующим значениям СТ. Согласно значениям СТ, содержание мРНК ORL-1 в клетках из клональной клеточной линии №6 AGN Р33 значительно превышало таковое у клеток из родительской клеточной линии SiMa как на среде без сыворотки (Ср. СТ: 28,6 и 17,3), так и на среде с сывороткой (Ср. СТ: 26,1 и 16,5). Кроме того, отличия в количестве мРНК, полученной из клеток из 6 пассажа по сравнению с клетками из 16 пассажа клональной клеточной линии №6 AGN Р33, по-видимому, минимальны. Также, отличия значений СТ и кривых между родительской клеточной линией SK-N-DZ и клональными клеточными линиями №3 и №22 минимальны. Это заключение справедливо для клеток, выращенных на среде с сывороткой и на среде без сыворотки, и отражает сходство этих клеточных линий, наблюдаемое в клеточном тесте на активность Noc/A.

Таблица 19.
Средние значения СТ с обеспечением экспрессии ORL-1 в клеточных линиях
Среда Клеточная линия Среднее СТ
Среда без сыворотки Родительская SiMa р26 28,6
Клон №6 SiMa hORL-1 p6 17,3
Клон №6 SiMa hORL-1 p16 17,3
Полная среда Родительская SiMa р26 26,1
Клон №6 SiMa hORL-1 p6 16,4
Клон №6 SiMa hORL-1 p16 16,6
Среда без SK-N-DZ 26,3
Таблица 19.
Средние значения СТ с обеспечением экспрессии ORL-1 в клеточных линиях
Среда Клеточная линия Среднее СТ
сыворотки Клон №3 SK-N-DZ 25,9
Клон №22 SK-N-DZ 26,6
Полная среда SK-N-DZ 26,2
Клон №3 SK-N-DZ 25,8
Клон №22 SK-N-DZ 26,4

Пример VII

Получение моноклональных анти-SNAP-25 антител, которые выборочно связывают эпитоп SNAP-25, имеющий свободный карбокси-конец в остатке Pi разрезаемой связи в сайте расщепления токсином ВоМТ/А

[0237] Следующий пример иллюстрирует изготовление моноклональных aHTH-SNAP-25 антител, которые могут избирательно связывать эпитоп SNAP-25 с карбокси-концом в остатке P1 разрезаемой связи в сайте расщепления токсином BoNT/A.

1. Создание моноклональных aHmu-SNAP-25 антител

[0238] Для создания моноклональных aHTH-SNAP-25 антител, которые могут избирательно связывать SNAP-25 с карбокси-концом в остатке Pi разрезаемой связи в сайте расщепления токсином BoNT/A, авторы создали пептид с 13 остатками CDSNKTRIDEANQCOOH (SEQ ID NO: 38) в качестве антигена продукта расщепления SNAP-25. Этот пептид включает гибкую связующую область, N-концевой остаток Цистеинадля спряжения с KLH, аминокислоты 186-197 SNAP-25 человека (SEQ ID NO: 5) и карбоксилированный глютамин на С-конце (SEQ ID NO: 38). Генерация моноклональных антител к хорошо подобранным, уникальным последовательностям пептида обеспечивает контроль над нацеленностью эпитопа, позволяя идентификацию особой субпопуляции белка среди множества близких друг к другу изоформ. Поиски Blast показали, что у этого пептида есть высокая гомология только, со SNAP-25 и почти нет возможности перекрестной реактивности с другими белками в нервных клетках. Последовательность также тщательно исследовали, при помощи компьютерных алгоритмов, для определения индекса гидрофобности, вероятности поверхности белка, гибких областей, и вероятной вторичной структуры, после чего следовала надлежащая ориентация и представление выбранной последовательности пептида. Пептид синтезировали и коньюгировали с гемоцианином улитки (KLH), для увеличения иммуногенности. Шесть мышей Balb/c были иммунизированы этим пептидом, и после трех иммунизации, произведенных в течение приблизительно восьми недель, у мышей брали кровь для анализа. Крови позволяли свернуться, инкубируя ее при 4°С в течение 60 минут.Свернувшуюся кровь центрифугировали при 10000x g в 4°С в течение 10 минут для осадждения продуктов распада клеток. Образцы полученной сыворотки разделяли на аликвоты по 50 мкл и хранили в -20°С для дальнейшего использования.

[0239] Подобная стратегия, основанная на других антигенах SNAP-25, раскрытых в настоящем описании, используются, для получения моноклональных анти-SNAP-25 антител, которые могут избирательно связаться со SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A. Например, антиген SNAP-25 SEQ ID NO: 45 может коньюгировать с KLH вместо антигена SNAP-25 с SEQ ID NO: 38. В качестве другого примера можно привести аминокислоты 186-197 из SNAP-25 человека из антигена SNAP-25 SEQ ID NO: 38, которые могут быть заменены на SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 или SEQ ID NO: 44.

2. Скрининг на наличие моноклональных анти-SNAP-25 антител

[0240] Для определения наличие моноклональных анти-SNAP-25 антител, которые могут избирательно связываться с антигеном SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, выполняли сравнительный твердофазный ИФА и клеточный тест расщепления, с использованием извлеченной из мышей сыворотки. Для сравнительного твердофазного ИФА сконструировали два сшитых белка: BirA-HisTag®-SNAP-25134-197 с SEQ ID NO: 48 и BirA-HisTag®-SNAP-25134-206 с SEQ ID NO: 49. BirA-HisTag®-SNAP-25134-197 представлял собой пептид BirA из 16 аминокислот, биотинилированный в природных условиях, SEQ ID NO: 50, который с N-конца был связан с пептидом SNAP-25, включающим аминокислоты 134-197 из SEQ ID NO: 5. BirA-HisTag®-SNAP-25134-206 представлял собой биотинилированный в природных условиях пептид BirA из 16 аминокислот с SEQ ID NO: 50 связанный своим N-концом с пептидом SNAP-25, включающим аминокислоты 134-206 из SEQ ID NO: 5. BirA-HisTag®-SNAP-25134-197 и BirA-HisTag®-SNAP-25134-206 разводили в 1 × ФБР до концентрации 10 мкг/мл. BirA-HisTag®-SNAP-25134-197 и BirA-HisTag®-SNAP-25134-206 наносили на отдельные планшеты, добавляя приблизительно 100 мкл подходящего Раствора Субстрата и инкубируя пластины при комнатной температуре в течение одного часа. Отмытые планшеты инкубировали при 37°С в течение одного часа в 0,5% BSA в 1 × TBS, содержащем разведение от 1:10 до 1:100 содержащей антитела сыворотки, полученной от одной из шести иммунизированных мышей (Мышь 1, Мышь 2, Мышь 3, Мышь 4, Мышь 5, и Мышь 6). Планшеты, помеченные первичными антителами, отмывали четыре раза по 5 минут в 200 мкл TBS, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). Вымытые планшеты инкубировали в 37°С в течение 1 часа в 1 × TBS, содержащем, разведенные 1:10000, поликлональные козьи антитела против мышиного IgG, коньюгированные с пероксидазой Хрена (Pierce Biotechnology, Рокфорд, Иллинойс), в качестве вторичных антител. Планшеты, помеченные вторичными антителами, отмывали четыре раза в 200 мкл TBS, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). Хромогенное детектирование помеченных продуктов SNAP-25 производили с использованием набора субстратов ImmunoPure TMB (Pierce Biotechnology, Рокфорд, Иллинойс). Формирование желтой окраски на планшетах, покрытых BirA-HisTag®-SNAP-25134-197, но не на планшетах, покрытых BirA-HisTag®-SNAP-25134-206, указало на то, что анти-SNAP-25 антитела избирательно распознавали продукт расщепления SNAP-25197. В результате, авторы показали, что из шести мышей, использованных для иммунизации, три мыши (Мышь 2, Мышь 3, и Мышь 4) имели более высокие титры и большую специфичность к антигену SNAP-25, карбоксильный конец которого соответствует остатку Pi разрезаемой связи в сайте расщепления токсином BoNT/A.

[0241] Эти результаты подтверждили, при помощи исследования активности твердофазного ИФА с легкой цепью. Планшеты Reacti-Bind с 96 лунками, покрытые Стрептавидином (Pierce Biotechnology, Рокфорд, Иллинойс), готовили, добавляя приблизительно 100 мкл следующих Растворов Субстратов: Ряды А-С покрывали 100 мкл BirA-HisTag®-SNAP-25134-197 в двенадцати различных концентрациях; Ряды D-H покрывали 100 мкл BirA-HisTag®-SNAP-25134-206 в концентрации 10 мкг/мл. Планшеты отмывали путем отбора раствора субстрата водоструйным насосом и трехкратного ополаскивания каждой лунки 200 мкл TBS, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). Разбавления BoNT/A предварительно восстанавливали в 37°С в течение 20 минут в Инкубационном Буфере BoNT/A (50 мМ HEPES, pH 7,4, 1% эмбриональная бычья сыворотка, 10 мкМ ZnCl2, 10 мМ дитиотриэтол), 100 мкл предварительно восстановленного BoNT/A добавляли на покрытые субстратом планшеты и инкубировали при 37°С в течение 90 минут. Планшеты, обработанные BoNT/A, отмывали путем отбора Инкубационного Буфера ВоМТ/А водоструйным насосом и трехкратоного ополаскивания каждого планшета 200 мкл TBS, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). Отмытые планшеты инкубировали при 37°С в течение одного часа в 1 × TBS с 0,5% BSA, содержащем разведения проверяемой, содержащей антитела, сыворотки от 1:10 до 1:100. Планшеты, помеченные первичными антителами, отмывали четыре раза по 5 минут в 200 мкл TBS, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). Отмытые планшеты инкубировали при 37°С в течение 1 часа в 1 × TBS содержащем разведенные 1:10000 поликлональные козьи антитела против мышиного IgG, коньюгированные с пероксидазой Хрена (Pierce Biotechnology, Рокфорд, Иллинойс), в качестве вторичных антител. Планшеты, помеченные вторичными антителами отмывали четыре раза в 200 мкп TBS, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). Хромогенное детектирование помеченных продуктов SNAP-25 производили с использованием набора субстратов ImmunoPure TMB (Pierce Biotechnology, Рокфорд, Иллинойс). При исследовании сыворотки, содержащей антитела, полученной из всех шести иммунизированных мышей (Мышь 1, Мышь 2, Мышь 3, Мышь 4, Мышь 5, и Мышь 6), развитие желтого цвета, которое коррелировало с наличием продукта расщепления SNAP-25197, обнаружили в образцах, обработанных BoNT/A, но не в необработанных контрольных группах. Таким образом сравнительный анализ твердофазный ИФА показал, что среди мышей, использованных для иммунизации, у трех мышей (Мышь 2, Мышь 3, и Мышь 4) были более высокие титры и большая специфичность к антигену SNAP-25, карбоксильный конец которого соответствует остатку Pi разрезаемой связи в сайте расщепления токсином BoNT/A.

[0242] Для клеточного теста расщепления, клетки PCl2 подходящей плотности, высевали на планшеты для тканевых культур площадью 60 мм2, содержащие 3 мл подходящей питательной среды на основе сыворотки (Таблица 1). Клетки растили в инкубаторе при 37°С в атмосфере 5% углекислого газа до достижения подходящей плотности. 500 мкл раствора для трансфекции готовили, добавляя 250 мкл восстановленной питательной среды OPTI-МЕМ на основе сыворотки, содержащей 15 мкл LipofectAmine 2000 (Invitrogen Inc., Карлсбад, Калифорния), инкубированной при комнатной температуре в течение 5 минут, к 250 мкл восстановленной питательной среды OPTI-MEM на основе сыворотки, содержащей 10 мкг конструкции с обеспечением экспрессии (SEQ ID NO: 51) pQBl-25/GFP-BoNT/A-LC. Конструкция с обеспечением экспрессии pQBl-25/GFP-BoNT/A-LC состоит из экспрессионного вектора pQBI-25 (Qbiogene Inc., Карлсбад, Калифорния), промоторные элементы которого функционально связаны с полинуклеотидом, кодирующим GFP сшитый с легкой цепью BoNT/A SEQ ID NO: 52. Эту смесь для трансфекции инкубировали при комнатной температуре в течение приблизительно 20 минут. Питательные среды заменяли новыми неполными питательными средами, и к клеткам добавляли 500 мкл раствора для трансфекции. Затем их растили в инкубаторе при 37°С в атмосфере 5% углекислого газа в течение приблизительно 6-18 часов. Клетки отмывали и собирали как описано в Примере II. Для детектирования наличия расщепленного продукта SNAP-25197, аликвоту, взятую от каждого собранного образца, анализировали с помощью Вестерн блоттинга как описано в Примере II, за исключением того, что первичное антитело представляло собой разведенную 1:1000 сыворотку, содержащую антитело, а вторичные антитела представляли собой разведение 1:20000 мышиных антител α-IgG, коньюгированных с пероксидазой хрена (Pierce Biotechnology, Рокфорд, Иллинойс). Используя сыворотку, содержащую антитела, полученную из трех мышей (Мышь 2, Мышь 3, и Мышь 4), единственную окрашенную полосу, соответствующую продукту расщепления SNAP-25197, детектировали в образцах, обработанных BoNT/A, но но не в необработанных контрольных группах. Таким образом, клеточный тест расщепления показал, что из мышей, использованных для иммунизации, у трех (Мышь 2, Мышь 3, и Мышь 4) были более высокие титры и большая специфичность к антигену SNAP-25, карбоксильный конец которого соответствует остатку Pi разрезаемой связи в сайте расщепления токсином BoNT/A.

3. Получение гибридом

[0243] Для создания гибридом, производящих моноклональные анти-SNAP-25 антитела, которые могут селективно связываться с антигеном SNAP-25, карбоксильный конец которого соответствует остатку Р1 разрезаемой связи в сайте расщепления токсином BoNT/A, селезенку Мыши 2 извлекли через три дня, после заключительной "активаторной" иммунизации, клетки селезенки гибридизовали с клетками миеломы Р3-Х63 Ag8.653 с использованием стандартных протоколов гибридом. Эти клетки высевали на пять планшетов с 96-ю лунками, гибридов отбирали на питательной среде HAT. В течение 8-14 дней после слияния выполняли первый скрининг приблизительно 480 родительских клонов, с использованием сравнительного твердофазного ИФА с пептидами BirA-HisTag®-SNAP-25134-197 и BirA-HisTag®-SNAP-25134-206, нанесенными на два различных планшета. Сравнительный твердофазный ИФА обеспечило быстрый способ скрининга, для идентификации гибридом, производящих антитела, специфичные для продукта расщепления SNAP-25197. 18 лучших клонов подвергали дальнейшему скринингу, с использованием клеточного теста расщепления, описанного выше и иммунологического окрашивания клеток, трансфецированных LC/A. (Таблица 20).

Таблица 20.
Анализ супернатантов, содержащих моноклональные анти-5МАР-25 антитела
Клон Сравнительный твердофазный ИФА Тест в клетках
OD SNAP-25i97 OD SNAP-25206 Отношение 197/206 Отношени® 206/197 SNAP-25i97 SNAP-25206
1D3 1,805 0,225 8,02 0,13 +++ -
1F12 0,365 0,093 3,92 0,25 - -
1G10 0,590 0,137 4,31 0,23 ++ -
1Н1 0,335 0,121 2,77 0,36 - -
1Н8 0,310 0,302 1,03 0,97 + -
2С9 0,139 0,274 0,51 1,97 - -
2Е2 0,892 0,036 24,78 0,04 ++ -
2Е4 0,228 0,069 3,30 0,30 + -
2F11 1,095 1,781 0,61 1,63 - -
3С1 1,268 0,053 23,92 0,04 ++ -
3С2 0,809 0,052 15,56 0,06 ++ -
3Е1 0,086 0,155 0,55 1,80 0 -
3Е8 2,048 0,053 38,64 0,03 +++ --
3G2 0,053 0,158 0,34 2,98 - -
4D1 0,106 0,218 0,49 2,06 - -
4G6 0,061 0,159 0,38 2,61 - -
5А5 0,251 0,106 2,37 0,42 + -
5F11 0,243 0,061 3,98 0,25 - -

[0244] Клоны 1D3, 1G10, 2Е2, 3С1, 3С2, и ЗЕ8 повторно клонировали, путем ограничивающего разбавления, поскольку модифицированные питательные среды, полученные от этих клонов, включали анти-SNAP-25 антитела с избирательной нацеленностью связывания, имеющей отношение197/206 продукта расщепления SNAP-25197 к нерасщепленному субстрату SNAP-25206 по меньшей мере 4:1, и детектировали продукт расщепления SNAP-25197 в клеточном тесте расщепления и иммунологическом окрашивании клеток РС12, трансфецированных GFP-LC/A. Аналогично клоны 2С9, 2F11, 3G2, 4D1 и 4G6 повторно клонировали, путем ограничивающего разбавления, потому что модифицированные питательные среды, полученные от этих клонов, включали анти-SNAP-25 антитела с избирательной нацеленностью связывания, имеющей отношение2ое/197. по меньшей мере 1,5:1 нерасщепленного субстрата SNAP-25206 к продукту расщепления SNAP-25197, и детектировали нерасщепленный субстрат SNAP-25206, в клеточном тесте расщепления. Эти произошедшие от единственной клетки клоны, снова подвергали скринингу с использованием сравнительного твердофазного ИФА, клеточный тест расщепления и иммунологического окрашивания для подтверждения их сродства и специфичности, антитела изотипировали с использованием стандартных процедур. Асцитную жидкость получали от клонов 1D3B8 (IgM.k), 1G10A12 (IgGS.k), 2C9B10 (IgGS.k), 2Е2А6 (IgGS.k), 2F11B6 (IgM.k), 3C1A5 (IgG2a.k), и 3С3Е2 (lgG2a.k). Клон ЗЕ8 прекратил производить антитела во время процесса клонирования и не мог быть оценен.

4. Оценка специфичности связывания моноклинальных анти-SNAP-25 антител

[0245] Для оценки специфичности связывания моноклональных анти-SNAP-25 антител, которые могут избирательно связываться с антигеном SNAP-25, карбоксильный конец которого соответствует остатку Pi разрезаемой связи в сайте расщепления токсином BoNT/A, асцитную жидкость от клонов 1D3B8, 1G10A12, 2C9B10, 2Е2А6, 2F11B6, 3C1A5, и 3С3Е2 использовали для детектирования продуктов расщепления SNAP-25, при помощи клеточного теста активности, иммуноцитохимического и иммунопреципитационного анализа.

[0246] Для клеточного теста активности, специфичность связывания определяли путем анализа способности асцитной жидкости, содержащей анти-SNAP-25 антитела, детектировать нерасщепленный субстрат SNAP-25206 и продукты расщепления SNAP-25197 путем Вестерн блоттинга. Культуру клеток PCl2 подходящей плотности высевали на планшеты для тканевых культур площадью 60 мм2, содержащие 3 мл подходящей питательной среды на основе сыворотки, выращивали в инкубаторе при 37°С в атмосфере 5% углекислого газа, до подходящей плотности клеток, и трансфецировали как раствором для трансфекции без экспрессионной конструкции pQBI-25/GFP-BoNT/A-LC (не трансфецированные клетки), так и раствором для трансфекции, содержащим экспрессионную конструкцию pQBI-25/GFP-BoNT/A-LC (трансфецированные клетки), как описано выше. Клетки отмывали и собирали как описано в Примере I. Для детектирования присутствия как нерасщепленного субстрата SNAP-25206 так и продуктов расщепления SNAP-25197, из каждого образца отбирали аликвоту и анализировали Вестерн блоттингом как описано в Примере I, за исключением того, что первичные антитела представляли собой разведение 1:100 асцитной жидкости, содержащей моноклональные анти-ЗМАР-25 антитела, а вторичные антитела представляли собой разведение 1:20000 антител против IgG мыши, коньюгированных с пероксидазой хрена (Pierce Biotechnology, Рокфорд, Иллинойс). Кроме того, авторы проверили три коммерчески доступных моноклональных мышиных анти-SNAP-25 антител. Антитела SMI-81 (Sternberger Monoclonals Inc., Лютервиль, Мэриленд) a-SNAP-25, которые, как указывает изготовитель, детектируют как нерасщепленный субстрат SNAP-25206 так и продукт расщепления SNAP-25197, использовались в разведении 15000 согласно рекомендациям производителя. Антитела МС-6050 (Research & Diagnostic Antibodies, Лас-Вегас, Невада) a-SNAP-25, которые, как указывает изготовитель, детектируют как нерасщепленный субстрат SNAP-25206 так и продукт расщепления SNAP-25i97, использовался в разведении 1:100 согласно рекомендациям производителя. Антитела МС-6053 (Research & Diagnostic Antibodies, Лас-Вегас, Невада) α-SNAP-25, которые, как указывает изготовитель, детектируют только продукт расщепления SNAP-25197, использовался в разведении 1:100 согласно рекомендациям производителя.

[0247] В Таблице 21 приведены асцитные жидкости, содержащие анти-SNAP-25 антитела, которые детектировали только продукт расщепления SNAP-25197. Клеточный тест расщепления показал, что в асцитной жидкости, полученной от клонов 1D3B8, 2С9 В10, 2Е2А6, 3С1А5, и 3С3Е2, синтезируются моноклональные анти-SNAP-25 антитела, имеющие высокую специфичность связывания с продуктом расщепления SNAP-25197, что позволяет избирательное узнавание этого продукта расщепления относительно нерасщепленного субстрата SNAP-25206. Коммерческие антитела SMI-81 детектировали нерасщепленный субстрат SNAP-25206, но слабо распознавали продукт расщепления SNAP-25197 (Таблица 21). Удивительно, что коммерческие антитела МС-6050 детектировали только нерасщепленный субстрат SNAP-25206, и не смогли распознать продукт расщепления SNAP-25197 (Таблица 21). Еще более удивительно то, что коммерческие антитела МС-6050 детектировали только нерасщепленный субстрат SNAP-25206, и не могли распознать продукт расщепления SNAP-25197, даже при том, что изготовитель заявляет, что эти антитела селективно детектируют продукт расщепления SNAP-25197 (Таблица 21). Таким образом этот анализ показал что, в то время как 1D3B8, 2С9В10, 2Е2А6, 3С1А5, и 3С3Е2 проявляют подходящую избирательность для продукта расщепления SNAP-25197, 1G10A12 и 2F11B6 такой селективности не проявляют. Кроме того, коммерческие антитела SMI-81, МС-6050 и МС-6053 не являются подходящими для иммунологических методов, описанных в настоящей заявке, потому что они все не могут селективно детектировать продукт расщепления SNAP-25197.

[0248] Для иммуноцитохимического анализа, специфичность связывания определяли, анализируя способность асцитной жидкости, содержащей анти-SNAP-25 антитела, детектировать нерасщепленный субстрат SNAP-25206 и продукт расщепленная SNAP-25197 путем иммунологического окрашивания. См., например, Ester Fernandez-Salas et al., Plasma Membrane Localization Signals in the Light Chain of Botulinum Neurotoxin, Proc. Natl. Acad. Sci., U.S.A. 101(9): 3208-3213 (2004). Культуру клеток РС12 подходящей плотности высевали на планшеты, выращивали, и трансфецировали раствором для трансфекции, без экспрессионной конструкции pQBI-25/GFP-BoNT/A-LC (не трансфецированные клетки) или раствором для трансфекции, содержащим экспрессионную конструкцию pQBI-25/GFP-BoNT/A-LC (трансфецированные клетки), как описано выше. Клетки отмывали в 1 × ФБР и фиксировали в 5 мл PAF при комнатной температуре в течение 30 минут. Фиксированные клетки отмывали в фосфатном буферном солевом растворе, инкубировали в 5 мл 1 × ФБР, содержащим, 0,5% Triton® X-100 (эфир октилфенола и полиэтиленгликоли), отмывали в 1 × ФБР и увеличивали проницаемость их мембран в 5 мл метанола при -20°С в течение шести минут.Клетки с повышенной проницаемостью мембран блокировали в 5 мл 100 мМ глицина при комнатной температуре в течение 30 минут, отмывали в 1 × ФБР, и блокировали в 5 мл 0,5% BSA в 1 × ФБР при комнатной температуре в течение 30 минут. Заблокированные клетки отмывали в 1 × ФБР и инкубировали при комнатной температуре в течение двух часов в 0,5% BSA в 1 × ФБР, содержащем разведенную 1:10 асцитную жидкость от проверяемой клональной клеточной линии гибридомы. Клетки, обработанные первичными антителами, отмывали три раза по 5 минут в 1 × ФБР. Отмытые клетки инкубировали при комнатной температуре в течение 2 часов в 1 × ФБР, содержащем разведение 1:200 поликлональных козьих антител, коньюгированных с ALEXA® FLUOR 568 (Invitrogen Inc., Карлсбад, Калифорния), против тяжелых и легких цепей мышиного иммуноглобулина G (IgG, H+L), в качестве вторичных антител. Клетки, обработанные вторичными антителами, отмывали три раза по 5 минут в 1 × ФБР. Отмытые клетки готовили к микроскопическому исследованию, фиксируя их в средах для фиксирования VECTASHIELD® (Vector Laboratories, Берлингейм, Калифорния) и покрывая их покровными стеклами. Изображения, для определения сигнала, получали на конфокальном микроскопе Leica, используя подходящие параметры настройки лазера. Таблица 21 показывает, асцитные жидкости, содержащие анти-SNAP-25 антитела, которые специфически детектировали продукт расщепления SNAP-25197. Иммуноцитохимический анализ показал, что в асцитной жидкости, полученной от клонов 1D3B8, 2С9 В10, 2Е2А6, 3С1А5, и 3С3Е2, синтезируются моноклональные анти-SNAP-25 антитела, имеющие высокую специфичность связывания с продуктом расщепления SNAP-25197, что приводит к преимущественному распознаванию этого продукта расщепления по сравнению с нерасщепленным субстратом SNAP-25206.

[0249] Для анализа методом иммунопреципитации, специфичность связывания определяли, анализируя способность моноклональных aHTH-SNAP-25 антител, очищенных Белком A(HiTrap™ ВД Колонки с Белком A, GE Healthcare, Amersham, Пискэтэуэй, Нью-Джерси), преципитировать нерасщепленный субстрат SNAP-25206 и расщепленный продукт SNAP-25197. См. например главу 8 Storing and Purifying Antibodies, pp.309-311, Harlow & Lane, cm. выше., 1998а. Культуру клеток РС12 подходящей плотности высевали на планшеты, выращивали, и трансфецировали раствором для трансфекции, содержащим экспрессионную конструкцию pQBI-25/GFP (контрольные клетки; SEQ ID NO: 53) или раствором для трансфекции, содержащим экспрессионную конструкцию pQBI-25/GFP-BoNT/A-LC (экспериментальные клетки), как описано выше. Экспрессионная конструкция pQBI-25/GFP представляет собой экспрессионный вектор, промоторные элементы которого функционально связаны с полинуклеотидом, кодирующим GFP SEQ ID NO: 54. После инкубации в течение ночи клетки отмывали, отбирая питательную среду водоструйным насосом и ополаскивая каждую лунку 200 мкл 1 × ФБР. Для сборки клеток, ФБР удаляли водоструйным насосом, клетки лизировали добавлением литического буфера для иммунопреципитации, состоящего из 50 мМ HEPES, 150 мМ NaCl, 1,5 мМ MgCl2, 1 мМ EGDT, 10% глицерина, 1% Triton® Х-100 (эфир октилфенола и полиэтиленгликоли) и 1 × коктейля из ингибиторов протеаз COMPLETE™ (Roche Applied Biosciences, Индианаполис, Индиана), и инкубирования при 4~С в течение одного часа. Лизированные клетки центрифугировали при 3000 × g при 4°С в течение 10 минут, для удаления продуктов распада клеток, супернатант переносили в чистую пробирку и разводили до концентрации белка приблизительно 1 мг/мл. Примерно 5 мкг очищенных моноклональных антител добавляли к 0,5 мл разбавленного супернатанта и инкубировали при 4°С в течение двух часов. После инкубации с первичными антителами, к разбавленному супернатанту добавляли приблизительно 50 мкл иммобилизированного белка G (Pierce Biotechnology, Рокфорд, Иллинойс) и инкубировали при 4°С в течение одного часа. Проинкубированный супернатант отмывали три раза по 30 минут, добавлением 0,5 мл литического буфера для иммунопреципитации, центрифугированием при 300 × g в 4°С в течение одной минуты для осаждения гранул с иммобилизированным белком G, с последующим удалением супернатанта. После отмывки осадок повторно взвешивали в 30 мкл 1 × буфера для загрузки на основе ДСН, и полученный образец нагревали до 95°С в течение 5 минут. Для детектирования наличия как нерасщепленного субстрата SNAP-25206 так и расщепленного продукта SNAP-25197, аликвоты от каждого собранного образца анализировали Вестерн блоттингом как описано в Примере I, за исключением того, что первичные антитела были разведением 1:1000 поликлональной сыворотки анти-SNAP-25 антител (см. Пример V), а вторичные антитела были разведением 1:20000 антител кролика α-IgG, коньюгированных с пероксидазой хрена (Pierce Biotechnology, Рокфорд, Иллинойс). Таблица 21 указывает асцитную жидкость содержащую анти-SNAP-25 антитела, которая специфически осаждала продукт расщепления SNAP-25197 в процессе иммунопреципитации. Анализ методом иммунопреципитации показал, что в асцитной жидкости, полученной от клонов 2Е2А6 и 3С1А5, синтезируются моноклональные анти-SNAP-25 антитела, имеющие высокую специфичность связывания с продуктом распада SNAP-25197, что приводит к преимущественному распознаванию этого продукта распада по сравнению с нерасщепленным субстратом SNAP-25206.

Таблица 21ю
Анализ асцитной жидкости из клонов, содержащей моноклональные анти-SNAP-25 антитела
Клон Тест в клетках Иммуноцитохимический тест Иммунопреципитация
SNAP-25197 SNAP-25206 SNAP-25197 SNAP-25206 SNAP-25197 SNAP-25206
1D3B8 ++ - ++ - Не Тестировали Не Тестировали
1G10A12 ++ ++ Не Тестировали Не Тестировали Не Тестировали Не Тестировали
2С9 В10 ++ - ++ - Не Тестировали Не Тестировали
2Е2А6 ++ - ++ - ++ -
2F11B6 + + + + Не Тестировали Не Тестировали
ЗС1А5 ++ - ++ - ++ -
ЗСЗЕ2 + - Не Тестировали Не Тестировали Не Тестировали Не Тестировали
МС-6050 - + Не Тестировали Не Тестировали Не Тестировали Не Тестировали
МС-6053 - + Не Тестировали Не Тестировали Не Тестировали Не Тестировали
SMI-81 -/+ ++ Не Тестировали Не Тестировали Не Тестировали Не Тестировали

5. Оценка аффинности связывания моноклинальных aHmu-SNAP-25 антител

[0251] Для определения аффинности связывания моноклональных анти-SNAP-25 антител, проявляющих высокую специфичность связывания или к продукту расщепления SNAP-25197 или к нерасщепленному субстрату SNAP-25206, выполняли тест афинности связывания на инструменте BIAcore 3000, используя чипы с сенсорами на основе карбоксиметил декстрана (СМ5) (BIAcore, Inc., Пискэтэуэй, Нью-Джерси). Запуски проводились при 25°c с буфером HBS-EP, состоящим из 10 мМ HEPES (pH 7,4), 150 мМ хлорида натрия, 3 мМ ЭДТА, 0,005% (об.) сурфактанта P2O, при скорости потока 10 мкл/мин. Пептиды SNAP-25, состоящие из аминокислот 134-197 из SEQ ID NO: 5 (SNAP-25134-197) или аминокислот 134-206 из SEQ NO: 5 (SNAP-25134-206) ковалентно присоединяли к поверхности СМ5 сенсора чипа при помощи стандартного механизма сшивки с амином. Вкратце, чипы СМ5 активизировали инъекцией смеси 0,2 М 1-этил-3-(3-диметиламинопропил) карбодиимида и 0,05 М N-гидроксисукцимида в течение 7 минут; пептиды SNAP-25 в 10 мМ ацетате натрия (pH 4,0) вводили в течение 20 минут при скорости потока 10 мкл/мин; не прореагировавшие сложные эфиры сукцимида блокировали инъекцией 1 М этаноламин гидрохлорида pH 8,5 в течение 7 минут. Иммобилизация этого количества SNAP-25134-197 или SNAP-25134-206 на чипе отразилась в увеличении единиц ответа на 100-150 (около 0,10-0,15 нг/мм2). Образцы антител, состоящие из асцитной жидкости или очищенных моноклональных антител, полученных от клонов 1D3B8, 2С9 В10, 2Е2А6, 3С1А5, и 3С3Е2, также как и коммерчески доступных анти-SNAP-25 антител пропускали по поверхности чипов СМ5, так что время ассоциации составляло 10 минут, а время диссоциации - 20 минут. Поверхности восстанавливали между тестами путем инъекции 10 мМ Глицин-HCl (pH 2,5) в течение 1 минуты при скорости потока 15 мкл/мин. В программе BIAevaluation 3.0, кривые сенсограммы соответствовали кинетической модели связывания 1:1.

[0252] Результаты показали, что как 2Е2А6, так и 3С1А5 были очень специфичными к продукту расщепления SNAP-25197 по сравнению с нерасщепленным субстратом SNAP-25 (Таблица 22). По сравнению с аффинностью связывания МС-6050 и МС-6053, 1D3B6 имел в 10 раз большую равновесную константу диссоциации для продукта расщепления SNAP-25 (Таблица 22). Интересно, что у 2Е2А6 равновесная константа диссоциации, для продукта расщепления SNAP-25, была не на много ниже, чем у этих коммерческих антител (0,405 нМ против 0,497 и 0,508) (Таблица 22). Поскольку ни одно из этих коммерческих анти-SNAP-25 антител избирательно не распознавало продукт расщепления SNAP-25 (Таблица 21), равновесная константа диссоциации ниже, чем приблизительно 0,5 нМ, по-видимому, хотя бы отчасти, является важными условием, для достижения такой избирательности. Аналогично, при сравнении аффинностей связывания МС-6050 и МС-6053, 2Е2А6 имел по меньшей мере на порядок более медленную константу скорости обратной реакции/константу диссоциации (6,74×10-5 против 8,82×10-4 с-1 и 1,18×10-3 с-1) (Таблица 22). Это предполагает, что константа скорости обратной реакции/константа диссоциации, ниже приблизительно 8,82×10-4, по-видимому, хотя бы отчасти, является важным условием для достижения избирательного связывания продукта расщепления SNAP-25. Этот результат согласуется с данными о 1D3B8, которое имеет константу скорости обратной реакции/константу диссоциации 5,78×10-5 с-1 (Таблица 22).

Таблица 22. Анализ аффинности связывания моноклональных aH-ni-SNAP-25 антител
Параметр ППР 1D3B8 2Е2А6
SNAP-25197 SNAP-25206a SNAP-25197 SNAP-25206a
Ka (М-1 с-1) 1,06×106 - 1,70×106 (1,66×105) (-)
Kd (с-1) 5,78×10-5 - 1,53×10-4 (6,74×10-5) (-)
KD (нМ) 0,050 - 0,090 (0,405) (-)
Параметр ППР 3С1А5 2C9B10
SNAP-25197 SNAP-25206в SNAP-25197 SNAP-25206г
Ka (М-1 с-1) 2,17×105 - 1,15×104 -
Kd (с-1) 2,88×10-4 - 3,11×10-4 -
KD (нМ) 1,33 - 27,1 -
Параметр ППР МС-6050 МС-6053
SNAP-25197 SNAP-25206 SNAP-25197 SNAP-25206
Ka (М-1 с-1) 1,78×106 3,06×102 2,32×106 1,06×102
Kd (с-1) 8,82×10-4 6,07×10-3 1,18×10-3 2,56×10-5
KD (нМ) 0,497 19800 0,508 240
а При пропускании по поверхности сенсорных чипов СМ5 до 125 нМ моноклональных aHTH-SNAP-25 антител 1D3B8 после 10-минутного времени ассоциации, связывания не наблюдалось.
б При пропускании по поверхности сенсорных чипов СМ5 до 10 мкМ моноклональных aHTH-SNAP-25 антител 2Е2А6 после 10-минутного времени ассоциации, связывания не наблюдалось.
в При пропускании по поверхности сенсорных чипов СМ5 до 100 нМ моноклональных
анти-SNAP-25 антител 3С1А5 после 10-минутного времени ассоциации, связывания не наблюдалось.
г При пропускании по поверхности сенсорных чипов СМ5 до 100 нМ моноклональных анти-SNAP-25 антител 2С9 В10 после 10-минутного времени ассоциации, связывания не наблюдалось.

[0253] Для сравнения шести различных антител, константы скорости прямой реакции (ka) и обратной реакции (kd) для каждого из них нормировали, используя программное обеспечение BIA evaluation 4.1. Для констант скорости прямых реакций данные по отдельности обрезали, удаляя часть, отвечающую пику инъекции, и нормируя к масштабу от О до 100. Для сравнения констант скорости обратной реакции данные нормировали к точке прекращения/вершины инъекции. Этот анализ показал, что 2С9 В10 имел намного более медленную константу скорости прямой реакции, чем другие антитела (ФИГ.7А), и что у МС-6053 константа скорости обратной реакции (диссоциации) намного более быстрая чем у других антител (ФИГ.7В). Быстрая константа скорости обратной реакции МС-6053, указывает на то, что это антитело не будет удовлетворительно проявлять себя в методах, описанных в настоящей заявке, потому что этому антителу будет сложно оставаться связанным с антигеном субстрата во время стадий промывки.

6. Секвенирование эпитопа изолированных моноклональных анти-SNAP-25 антител

[0254] Для определения эпитопов изолированных моноклональных анти-SNAP-25 антител, которые могут избирательно связываться с антигеном SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, секвенировали молекулы полинуклеотидов, кодирующих вариабельную тяжелую (VH) и вариабельную легкую (VL), цепи моноклонального am-n-SNAP-25 антитела, полученного от гибридом 1D3B8, 2С9 В10, 2Е2А6, 3С1А5 и 3С3Е2. мРНК из каждой гибридомы выделяли и очищали, используя стандартные протоколы, подвергали обратной транскрипции для получения кДНК, используя в качестве антисмыслового праймера олигодезокситимидин или специфический для гена праймер (мышиный IgG1 CH и каппа CL). Для определения изотипа антитела, полученную кДНК амплифицировали методом ПЦР с использованием специфических мышиных и человеческих праймеров к постоянным доменам. Вырожденные праймеры VH и VL использовали, для амплификации вариабельных областей на матрице кДНК. Для 5'RACE гомопрлимерный дЦТФ хвост добавляли к 3' концу кДНК. Затем тяжелые и легкие цепи амплифицировали с олигодезоксигуанозином в качестве смыслового праймера и специфического для гена антисмыслового праймера (СН/KC). ПЦР продукты включали последовательность сигнального пептида, вариабельных и постоянных областей вплоть до антисмыслового праймера. ПЦР продукты очищали методом гель-электрофореза, для удаления маленьких фрагментов, и клонировали в вектор для клонирования по тупым концам или в вектор ТА для секвенирования. Пять независимых клонов для каждой цепи секвенировали, строили выравнивание для цепей VH и VL и определяли консенсусную последовательность. Методы, использованные для определения последовательности аминокислот для VH и VL описаны, например, в Roger A. Sabbadini, et al., Novel Bioactive Lipid Derivatives and Methods of Making and Using Same, публикация патента 2007/0281320; и Peter Amersdorfer, et al., Molecular Characterization ofMuhne Humoral Immune Response to Botulinum Neurotoxin Type A Binding Domain as Assessed by Using Phage Antibody Libraries, 65(9) Infect. Immun. 3743-3752, каждая из которых включена в настоящую заявку посредством ссылки. Кроме того, доступны коммерческие услуги по секвенированию вариабельной тяжелой (VH) и вариабельной легкой (VL) цепей антител и идентификации CDR области, см. например, Fusion Antibodies Ltd., Северная Ирландия. В одном случае, для домена VL 3C1A5, аминокислотную последовательность также определяли путем разделения антител, прошедших аффинную очистку, с помощью двухмерного электрофореза с высоким разрешением и последующего фингерпринт-анализа пептидных фрагментов на наноЖХ-ТМС после протеолитического расщепления.

[0255] Последовательности полинуклеотидов, составляющих цепи VH и VL моноклональных анти-SNAP-25 антител, полученных из гибридом, описанных настоящей заявке, следуют далее: 1D3B8 VH (SEQ ID NO: 71), 2C9B10 VH (SEQ ID NO: 73), 2E2A6 VH (SEQ ID NO: 75), 3C1A5 VH (SEQ ID NO: 77), 3C3E2 VH вариант 1 (SEQ ID NO: 79), 3C3E2 VH вариант 2 (SEQ ID NO: 81), 3C3E2 VH вариант 3 (SEQ ID NO: 132), 1D3B8VL(SEQ ID NO: 83), 2C9B10 VL (SEQ ID NO: 85), 2E2A6 VL (SEQ ID NO: 87), 3C1A5 VL (SEQ ID NO: 89), и 3C3E2 VL (SEQ ID NO: 91). Последовательность аминокислот, составляющих цепи VH и VL моноклональных анти-SNAP-25 антител, полученных из гибридом, раскрытых в настоящем описании, следуют далее: 1D3B8 VH (SEQ ID NO: 72), 2C9B10 VH (SEQ ID NO: 74), 2E2A6 VH (SEQ ID NO: 76), 3C1A5 VH (SEQ ID NO: 78), 3C3E2 VH вариант 1 (SEQ ID NO: 80), 3C3E2 VH вариант 2 (SEQ ID NO: 82); 3C3E2 VH вариант 2 (SEQ ID NO: 133), 1D3B8 VL (SEQ ID NO: 84), 2C9B10 VL (SEQ ID NO: 86), 2E2A6 VL (SEQ ID NO: 88), 3C1A5 VL (SEQ ID NO: 90), и 3C3E2 VL (SEQ ID NO: 92). Последовательность аминокислот, составляющих CDR области цепей VH и VL моноклональных анти-3МАР-25 антител, полученных из гибридомами 1D3B8, 2С9 В10, 2Е2А6, 3С1А5, и 3С3Е2, приведены в Таблице 23.

Таблица 23.
Последовательности CDR доменов VH и VL моноклональных анти-SNAP-25 антител
CDR Последовательность Детектирована в SEQ ID NO:
VH CDR 1 TFTDHSIH 2Е2А6 93
2С9В10
3С1А5
VH CDR 1 TFTNYVIH 3С3Е2 94
VH CDR1 IFTDHALH 1D3B8 95
VH CDR 2 YIFPGNGNIEYNDKFKG 2Е2А6 96
VH CDR 2 YLFPGNGNFEYNEKFKG 2С9В10 3С1А5 97
VH CDR 2 YINPYNDGSKYNEKFKG 3С3Е2 98
VH CDR 2 YIFPGNGNIEYNEKFKG 1D3B8 99
VH CDR 3 KRMGY 2Е2А6 3С1А5 100
VH CDR 3 KKMDY 2С9В10 1D3B8 101
VH CDR 3 ARMDY 3C3E2var1 102
VH CDR 3 ARMGY 3C3E2var2 134
VH CDR 3 ARHLANTYYYFDY 3C3E2var3 135
VL CDR1 RSSQSIVHSNGNTYLE 1D3B8 103
VL CDR1 RTTENIYSYFV 2С9 В10 104
VL CDR 1 KSSQSLLYTNGKTYLT 2Е2А6 105
VL CDR 1 KSSQSLLNTNGKTYLT 3С1А5 106
VL CDR1 RASQNIGNYLH 3С3Е2 107
VL CDR 2 KVSNRFS 1D3B8 108
VL CDR 2 NAKSLAE 2С9 В10 109
VL CDR 2 LVSELDS 2Е2А6 110
VL CDR 2 LVSKLDS ЗС1А5 111
VL CDR 2 YASQSIS ЗСЗЕ2 112
VL CDR 3 FQGSHVPPT 1D3B8 113
VL CDR 3 QHHYGTPYT 2С9 В10 114
VL CDR 3 LQSAHFPFT 2Е2А6 115
VL CDR 3 LQSSHFPFT 3С1А5 116
VL CDR 3 QQSDTWPLT 3С3Е2 117

[0256] Неограничивающие примеры последовательностей аминокислот, составляющих Варианты участка CDR цепи VH моноклональных анти-SNAP-25 антител, полученных из гибридом, описанных в настоящей заявке, включает варианты VH CDR1 SEQ ID NO: 118 для 1D3B8; вариант VH CDR1 SEQ ID NO: 119 для VH 2C9B10, 2E2A6 и 3С1А5; вариант VH CDR1 SEQ ID NO: 120 для VH 3С1А5 и 3С3Е2 вариант 3; вариант VH CDR2 SEQ ID NO: 121 для 1D3B8 и 2E2A6; вариант VH CDR2 SEQ ID NO; 122 для VH 2C9B10 и 3С1А5; вариант VH CDR2 SEQ ID NO: 123 для VH 3С1А5 и 3С3Е2 вариант 3; вариант VH CDR3 MDY для 1D3B8 и 2C9B10; вариант VH CDR3 MGY для VH 2E2A6 и 3С1А5; вариант VH CDR3 SEQ ID NO: 124 для VH 3С1А5 и 3С3Е2 вариант 3. Неограничивающие примеры последовательностей аминокислот, составляющих варианты области CDR VL цепи моноклональных анти-SNAP-25 антител, полученных из гибридом, описанных в настоящем описании, включает варианты VL CDR1 SEQ ID NO: 125 для 1D3B8; вариант VL CDR1 SEQ ID NO: 126 для 2C9B10; вариант VL CDR1 SEQ ID NO: 127 для 2E2A6; вариант VL CDR1 SEQ ID NO: 128 для 3С1А5; вариант VL CDR1 SEQ ID NO: 129 для 3С3Е2; вариант VL CDR2 KVS для 1D3B8; вариант VL CDR2 NAK для 2C9B10; вариант VL CDR2 LVS для 2E2A6; вариант VL CDR2 YAT для 3С1А5; и вариант VL CDR2 YAS для 3С3Е2.

Пример VIII

Разработка поликлональных анти-SNAP-25 антител, которые избирательно связывают эпитоп SNAP-25, карбоксильный конец которого соответствует остатку Р1 разрезаемой связи в сайте расщепления токсином BoNT/A

[0257] Следующий пример иллюстрирует получение поликлональных анти-SNAP-25 антител, которые могут избирательно связываться с эпитопом SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A.

[0258] Для получения поликлональных анти-SNAP-25 антител, которые могут избирательно связываться со SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, в качестве антигена продукта расщепления SNAP-25 создали пептид из 10 аминокислотных остатков CGGGRIDEANQ (SEQ ID NO: 46). Этот пептид включал остаток Цистеина на N-конце для спряжения с KLH, гибкий G-разделитель (GGG) связанный с аминокислотами 191-197 из SNAP-25 человека (SEQ ID NO: 5) и карбоксилированный глутамин на С-конце. Поиски Blast показали, что у этого пептида есть высокая гомология только со SNAP-25 и нет почти никакой возможности перекрестной реактивности с другими белками в нервных клетках. Последовательность также тщательно исследовали, используя компьютерные алгоритмы, для определения индекса гидрофобности, вероятности поверхности белка, гибких областей, и вероятной вторичной структуры, за чем следовала надлежащая ориентация и представление выбранной последовательности пептида. Пептид синтезировали и коньюгировали с гемоцианином улитки (KLH), для увеличения иммуногенности. Прежде, чем иммунизировать животных, не подвергавшихся воздействию кроликов анализировали методом Вестерн блоттинга с лизатами от клеточных линий-кандидатов, для идентификации животных, у которых отсутствовала иммунореактивность к белкам, присутствующим в этих лизатах. Двух подвергнутых предварительному скринингу кроликов иммунизировали этим пептидом, и после трех иммунизации произведенных в течение приблизительно восьми недель, из кроликов добывали кровь для анализа. Крови позволяли свернуться, инкубируя ее при 4°С в течение 60 минут. Свернувшуюся кровь центрифугировали при 10000 × g в 4°С в течение 10 минут для осаждения продуктов распада клеток. Образцы полученной сыворотки разделяли на аликвоты по 50 мкл и хранили при -20°С до дальнейшего использования.

[0259] Подобная стратегия, основанная на других антигенах SNAP-25, раскрытая в настоящем описании, используется для получения моноклональных анти-SNAP-25 антител, которые могут избирательно связываться со SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A. Например, SNAP-25 SEQ ID NO: 47 может быть коньюгирован с KLH вместо антигена SNAP-25 SEQ ID NO: 46. В качестве другого примера можно привести аминокислоты 191-197 из SNAP-25 человека из антигена SNAP-25 SEQ ID NO: 38 которые могут быть заменены на SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 или SEQ ID NO: 44.

2. Скрининг на наличие поликлональных анти-SNAP-25 антител

[0260] Для определения наличия поликлональных анти-SNAP-25 антител, которые могут избирательно связываться с антигеном SNAP-25, карбоксильный конец которого соответствует остатку Pi разрезаемой связи в сайте расщепления токсином BoNT/A, выполняли сравнительный твердофазный ИФА и клеточный тест расщепления, с использованием извлеченной из кролика сыворотки, как описано в Примере III. Сыворотка от обоих кроликов содержала поликлональные анти-SNAP-25 антитела, способные избирательно связываться с антигеном SNAP-25, карбоксильный конец которого соответствует остатку Р1 разрезаемой связи в сайте расщепления токсином ВоМТ/А. Поликлональные антитела кролика α-SNAP-25 назвали NTP 22 и NTP 23.

3. Очистка поликлональных анти-SNAP-25 антител

[0261] Для выделения поликлональных анти-SNAP-25 антител, которые могут избирательно связываться с антигеном SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, антитела NTP 22 и NTP 23 из сыворотки кролика выделяли, используя колонки для аффинной хроматографии, содержащие SNAP-25 антиген SEQ ID NO: 46.

4. Оценка специфичности связывания поликлональных анти-SNAP-25 антител

[0262] Для оценки специфичность связывания поликлональных анти-SNAP-25 антител, которые могут избирательно связываться с антигеном SNAP-25, карбоксильный конец которого соответствует остатку Pi разрезаемой связи в сайте расщепления токсином BoNT/A, использовали очищенные поликлональные анти-SNAP-25 антитела NTP 22 и NTP 23 для детектирования продукта расщепления, клеточного теста активности, иммуноцитохимии и иммунопреципитации как описано в Примере III. Клеточный тест расщепления, иммуноцитохимический анализ и анализ иммунопреципитации, показали, что поликлональные анти-SNAP-25 антитела NTP 22 и NTP 23 не реагируют с нерасщепленным антигеном SNAP-25. Таким образом как NTP 22 так и NTP 23 имеют высокую специфичность связывания с продуктом расщепления SNAP-25197, что приводит к преимущественному распознаванию этого продукта распада по сравнению с нерасщепленным субстратом SNAP-25206. Афинность к антигенам можно определить, используя ППР по методу BiAcore как описано в Примере III.

Пример IX Подготовка компонентов и условий для "сэндвич"-метода твердофазного ИФА

[0263] Следующий пример иллюстрирует идентификацию и подготовку компонентов и условий, необходимых для проведения тестов с помощью "сэндвич"-метода твердофазного ИФА, подходящего для использования в иммунологических способах детектирования активности эндопептидаз с измененной нацеленностью путем детектирования продукта расщепления SNAP-25 с использованием моноклональных анти-SNAP-25 антител, специфичных для SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A.

1. Приготовление клеточных лизатов из клеток, обработанных эндопептидазой с измененной нацеленностью

[0264] Для получения лизатов из клеток, обработанных эндопептидазой с измененной нацеленностью, для анализа, клеточную культуру подходящей плотности клеток из запасной культуры Neuro-2a засевали во флакон Т175, содержащий 50 мл среды без сыворотки, содержащей Минимальную Необходимую Среду, 2 мМ GlutaMAX™ I с солями Эрла, добавку 1×В27, добавку 1×N2, 0,1 мМ заменимых аминокислот, 10 мМ HEPES. Эти клетки инкубировали при 37°С в инкубаторе с содержанием углекислого газа 5% до наступления дифференцировки клеток, которую оценивали в соответствии со стандартными и обычными морфологическими критериями, такими как блокировка роста и вытягивание нейрита (приблизительно 2-3 дня). В качестве контроля, клеточную культуру подходящей плотности клеток из запасной культуры Neuro-2a засевали во флакон Т175, содержащий 50 мл соответствующей питательной среды (Таблица 1). Эти недифференцированные контрольные клетки выращивали при 37°С в инкубаторе с содержанием углекислого газа 5% до достижения 50%-й конфлюентности (приблизительно 18 часов). Среду из дифференцированной и контрольной недифференцированной культур удаляли аспирацией из каждой лунки и заменяли свежей средой, содержащей 0 (необработанный образец) или 10 нМ эндопептидазы с измененной нацеленностью. После инкубации в течение ночи клетки промывали и собирали путем лизиса в свежеприготовленном буфере для лизирования с Triton Х-100 (50 мМ HEPES, 150 мМ NaCl, 1,5 мМ MgCl2, 1 мМ EGTA, 1% Triton X-100) при 4°C в течение 30 минут с постоянным перемешиванием. Лизированные клетки центрифугировали при 4000 об./мин. в течение 20 минут при 4°C для удаления остатков клеток, используя настольную центрифугу. Концентрации белка в лизатах клеток измеряли методом Брэдфорда.

2. Приготовление и идентификация компонентов "сэндвич-метода твердофазного ИФА [0265] Для идентификации подходящей пары антитело для захвата-детектирующее антитело, с помощью «сэндвич”-метода твердофазного ИФА с усиленной хемилюминесценцией проводили анализ двадцати шести различных комбинаций пар антител для захвата и детектирующих антител, включающих одиннадцать различных антител для захвата a-SNAP-25 и семь различных детектирующих анти-ЗМАР-25 антител (Таблица 12). Используемые анти-ЗМАР-25 антитела представляли собой описанные в настоящей заявке мышиные моноклональные анти-SNAP-25 антитела 2Е2А6 и ЗС1А5, описанные в настоящей заявке мышиные моноклональные анти-SNAP-25 антитела SMI-81, МС-6050 и МС-6053, описанные в настоящей заявке кроличьи поликлональные анти-SNAP-25 антитела NTP 23, кроличьи поликлональные анти-SNAP-25 антитела S9684 (Sigma, Сент-Луис, Миссури), кроличьи поликлональные анти-SNAP-25 антитела Н-50 (Santa Cruz Biotechnology, Inc., Санта-Круз, Калифорния), козьи поликлональные анти-SNAP-25 антитела С-18 (Santa Cruz Biotechnology, Inc., Санта-Круз, Калифорния), козьи поликлональные анти-SNAP-25 антитела N-19 (Santa Cruz Biotechnology, Inc., Санта-Круз, Калифорния) и мышиные поликлональные анти-SNAP-25 антитела SP12 (Santa Cruz Biotechnology, Inc., Санта-Круз, Калифорния).

[0266] Для приготовления раствора антител для захвата, моноклональные aHTH-SNAP-25 антитела, содержащиеся в асцитной жидкости гибридомных клеточных линий 2Е2А6 и 3С1А5, как и моноклональные анти-SNAP-25 антитела МС-6050 и МС-6053, выделяли с помощью стандартного протокола очистки с использованием белка А. Все прочие анти-SNAP-25 антитела были приобретены в очищенном виде.

[0267] Для приготовления раствора детектирующих антител, соответствующие анти-SNAP-25 антитела конъюгировали с реактивом для мечения на основе сложного эфира рутений (II)-трис-бипиридин-(4-метисульфоната) и N-ГС (Meso Scale Discovery, Гейтерсбург, Мэриленд) согласно инструкциям изготовителя (Meso Scale Discovery, Гейтерсбург, Мэриленд). Реакцию конъюгации проводили путем добавления 30 мкл раствора для разведения MSD SULFO-TAG™, разведенного в дистиллированной воде, к 200 мкл поликлональных анти-SNAP-25 антител в концентрации 2 мг/мл и инкубации реакционной смеси при комнатной температуре в течение 2 часов в темноте. Помеченные антитела очищали, используя стандартный протокол с использованием спин-колонок, и концентрацию белка определяли с помощью стандартного колориметрического теста на белок. Поглощающую способность конъюгатов анти-SNAP-25 антител/MSD SULFO-TAG™ измеряли с помощью спектрофотометра при 455 нм для определения концентрации в молях на литр. Раствор детектирующих антител хранили при 4°С до использования.

[0268] Для приготовления твердофазной подложки, содержащей антитела для захвата, которые специфичны к продукту расщепления SNAP-25, приблизительно 5 мкл соответствующего раствора моноклональных анти-SNAP-25 антител (20 мкг/мл в 1 × ФБР) добавляли к каждой лунке 96-луночного планшета MSD High Bind, и раствор сушили на воздухе в биологически чистом помещении в течение 2-3 часов до испарения жидкости из раствора. Затем лунки с иммобилизованными антителами для захвата блокировали путем добавления в них 150 мкл блокирующего буфера, содержащего 2% Amersham Blocking Reagent (GE Life Sciences, Пискатауэй, Нью-Джерси) и 10% козьей сыворотки (VWR, Уэст-Честер, Пенсильвания) на 2 часа при комнатной температуре. Заблокированные планшеты запечатывали и хранили при 4°С до использования.

[0269] Для детектирования присутствия расщепленного продукта расщепления SNAP-25 ECL "сэндвич"-методом твердофазного ИФА, из лунок сохраненных планшетов удаляли аспирацией блокирующий буфер и к каждой лунке добавляли 25 мкл лизата клеток, обработанных эндопептидазой с измененной нацеленностью как описано выше, и планшеты инкубировали при 4°С в течение ночи. Лунки планшета трехкратно промывали, удаляя аспирацией клеточный лизат и три раза ополаскивая каждую лунку 200 мкл 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После отмывки, в каждую лунку добавляли 25 мкл раствора детектирующих антител в концентрации 5 мкг/мл, содержащего 2% блокирующего реактива Amersham в 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат), планшет запечатывали и инкубировали при комнатной температуре в течение 1 часа со встряхиванием. После инкубации с детектирующими антителами, лунки трехкратно промывали 200 мкл 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После промывки в каждую лунку добавляли 150 мкл 1 × буфера для считывания (Meso Scale Discovery, Гейтерсбург, Мэриленд) и анализировали планшеты, используя устройство для считывания изображений SECTOR™ Imager 6000 (Meso Scale Discovery, Гейтерсбург, Мэриленд). Вычисляли отношение сигнала, полученного при дозе 10 нМ для каждой пары антител, к сигналу, полученному при дозе 0 нМ для каждой пары антител (Таблица 24). Эти результаты показали, что среди двадцати шести различных комбинаций исследованных пар антител только у трех пар антител отношение сигнала к шуму было выше 10:1 для наиболее высокой протестированной дозы: Пара №1 (мышиное mAb 2E2A6 и кроличье pAb S9684), Пара №4 (мышиное mAb 3C1A5 и кроличье pAb S9684) и Пара №18 (кроличье pAb S9684 и мышиное mAb 2E2A6). Пара антител 1 была выбрана для дальнейшей разработки теста.

Таблица 24.
Скрининг комбинаций анти-SNAP-25 антител
№ пары антител Антитело для захвата Детектирующее антитело Цетектирование продукта расщепления SNAP-25 Детектирование нерасщепленного субстрата SNAP-25 Отношение сигнал/шум (10 нМ/0 нМ)
1 Мышиное mAb 2E2A6 Кроличье pAb S9684 Да Нет 26,6:1
2 Мышиное mAb 2E2A6 Козье pAb N-19 Да Нет 7,3:1
3 Мышиное mAb 2E2A6 Кроличье pAb Н-50 Да Нет 0,9:1
4 Мышиное mAb 3C1A5 Кроличье pAb S9684 Да Нет 12,1:1
5 Мышиное mAb 3C1A5 Козье pAb N-19 Да Нет 1,9:1
6 Мышиное mAb 3C1A5 Кроличье pAb Н-50 Да Нет 0,9:1
7 КозьерАЬС-18 Кроличье pAb S9684 Нет Нет 0,8:1
8 Козье pAb C-18 Козье pAb N-19 Нет Нет 0,9:1
9 Козье pAbC-18 Кроличье pAb Н-50 Нет Нет 0,9:1
10 Кроличье pAb H-50 Мышиное mAb 2E2A6 Да Нет 0,9:1
11 Кроличье pAb H-50 КозьерАЬС-18 Нет Нет 1,0:1
12 Козье pAb N-19 Мышиное mAb 2E2A6 Да Нет 0,9:1
13 Козье pAb N-19 Козье pAb C-18 Нет Нет 1,1:1
14 Кроличье pAb NTP23 Козье pAbN-19 Да Нет 1,2:1
15 Кроличье pAb NTP23 Козье pAb C-18 Нет Нет 1,1:1
16 Кроличье pAb NTP23 Мышиное pAb SP12 Да Нет 1,3:1
17 Кроличье pAb NTP23 Кроличье pAb Н-50 Да Нет 1,1:1
18 Кроличье pAb S9684 Мышиное mAb 2E2A6 Да Нет 21,3:1
19 Кроличье рАЬ S9684 КозьерАЬС-18 Нет Нет 0,7:1
20 Кроличье рАЬ S9684 Мышиное mAb SMI-81 Да Да 1,2:1
21 Мышиное mAb SMI-81 Кроличье pAb S9684 Да Да 1,1:1
22 Мышиное mAb SMI-81 Козье pAb N-19 Да Да 1,0:1
23 Мышиное mAb SMI-81 КозьерАЬС-18 Нет Нет 0,8:1
24 Мышиное pAb SP12 Козье pAb С-18 Нет Нет 1,0:1
25 Мышиное mAb MC-6050 Кроличье pAb S9684 Да Да 5,0:1
26 Мышиное mAb MC-6053 Кроличье pAb S9684 Да Да 7,1:1

Пример X

Иммунологический способ детектирования эндопептидаз с измененной нацеленностью, обладающих ферментативной активностью легкой цепи BoNT/A, с помощью «сэндвич"-метод а твердофазного ИФА с усиленной хемилюминесценцией

[0270] Следующий пример иллюстрирует иммунологические способы детектирования активности эндопептидаз с измененной нацеленностью путем детектирования продукта расщепления SNAP-25 с использованием моноклональных анти-SNAP-25 антител, специфичных к продукту расщепления SNAP-25, карбоксильный конец которого соответствует остатку Pi разрезаемой связи в сайте расщепления токсином BoNT/A, с помощью «сэндвич"-метода твердофазного ИФА с усиленной хемилюминесценцией.

[0271] Для получения лизатов из клеток, обработанных эндопептидазой с измененной нацеленностью, обладающей ферментативной активностью легкой цепи BoNT/A, клеточную культуру подходящей плотности клеток из стабильной клеточной линии засевали в лунки 96-луночных планшетов для культур тканей, содержащих 100 мл соответствующей среды. Эти клетки инкубировали при 37°С в инкубаторе с содержанием углекислого газа 5% в течение 24 часов. Среду от клеток удаляли аспирацией из каждой лунки и заменяли свежей средой, содержащей 0 (необработанный образец) или одну из доз, определенных в эксперименте по ответу на дозы этой эндопептидазы с измененной нацеленностью. После инкубации в течение 24 часов клетки промывали и собирали.

[0272] Для приготовления раствора антител для захвата a-SNAP-25, моноклональные анти-SNAP-25 антитела, содержащиеся в асцитной жидкости гибридомной клеточной линии 2Е2А6, выделяли с помощью стандартного протокола очистки с использованием белка А. Для приготовления раствора детектирующих анти-SNAP-25 антител, кроличьи поликлональные анти-SNAP-25 антитела S9684 (Sigma, Сент-Луис, Миссури) конъюгировали с реактивом для мечения на основе сложного эфира рутений (11)-трис-бипиридин-(4-метисульфоната) и N-ГС (Meso Scale Discovery, Гейтерсбург, Мэриленд) согласно инструкциям изготовителя (Meso Scale Discovery, Гейтерсбург, Мэриленд). Реакцию конъюгации, очистку меченных анти-SNAP-25 антител, определение концентрации и хранение проводили как описано в Примере VI.

[0273] Для приготовления твердофазной подложки, содержащей антитела для захвата, которые специфичны к продукту расщепления SNAP-25, приблизительно 5 мкл раствора моноклональных анти-SNAP-25 антител 2Е2А6 (20 мкг/мл в 1 × ФБР) добавляли к каждой лунке 96-луночного планшета MSD High Bind, и раствор сушили на воздухе в биологически чистом помещении в течение 2-3 часов до испарения жидкости из раствора. Затем лунки с иммобилизованными антителами для захвата блокировали и использовали непосредственно для детектирования активности эндопептидазы с измененной нацеленностью.

[0274] Для детектирования присутствия расщепленного продукта SNAP-25 ECL "сэндвич"-методом твердофазного ИФА, из лунок сохраненных планшетов удаляли аспирацией блокирующий буфер и к каждой лунке добавляли 25 мкл лизата клеток, обработанных эндопептидазой с измененной нацеленностью, и планшеты инкубировали при 4°С в течение ночи. Лунки планшета трехкратно промывали, удаляя аспирацией клеточный лизат и три раза ополаскивая каждую лунку 200 мкл 1 х ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После отмывки, в каждую лунку добавляли 25 мкл раствора детектирующих антител в концентрации 5 мкг/мл, содержащего 2% блокирующего реактива Amersham в 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат), планшет запечатывали и инкубировали при комнатной температуре в течение 1 часа со встряхиванием. После инкубации с детектирующими антителами, лунки трехкратно промывали 200 мкл 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После промывки в каждую лунку добавляли 150 мкл 1 х буфера для считывания (Meso Scale Discovery, Гейтерсбург, Мэриленд) и анализировали планшеты, используя устройство для считывания изображений SECTOR™ Imager 6000 (Meso Scale Discovery, Гейтерсбург, Мэриленд). Собранные данные анализировали и вычисляли ECso как описано в Примере VI. Для эндопептидаз с измененной опиоидной нацеленностью эти результаты показали, что в среднем при ECso детектировали 1,0 нМ Noc/А (в диапазоне примерно от 0,3 нМ до 2,0 нМ) при отношении сигнала к шуму для нижней асимптоты примерно от 15:1 до 20:1 и отношении сигнала к шуму для верхней асимптоты примерно от 180:1 до 300:1.

Пример XI

Иммунологический способ детектирования активности эндопептидаз с измененной нацеленностью с помощью CL "сэндвич"-метода твердофазного ИФА

[0275] Следующий пример иллюстрирует иммунологические способы детектирования активности эндопептидаз с измененной нацеленностью путем детектирования продукта расщепления SNAP-25 с использованием моноклональных анти-SNAP-25 антител, специфичных к SNAP-25, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, с помощью CL "сэндвич"-метода твердофазного ИФА.

[0276] Лизат из клеток, обработанных эндопептидазой с измененной нацеленностью, и раствор антител для захвата α-SNAP-25 получали как описано в Примере VII.

[0277] Для приготовления раствора детектирующих анти-SNAP-25 антител, поликлональные анти-SNAP-25 антитела S9684 (Sigma, Сент-Луис, Миссури) конъюгировали с пероксидазой хрена (HRP) согласно инструкциям изготовителя (Pierce Biotechnology, Inc., Рокфорд, Иллинойс). Реакцию конъюгации проводили путем добавления 500 мкл поликлональных 3HTH-SNAP-25 антител в концентрации 1 мг/мл в пробирку, содержащую лиофилизированную активированную пероксидазу, смешивания компонентов и последующего добавления 10 мкл цианоборогидрида натрия. Эту реакционную смесь инкубировали при комнатной температуре в течение 1 часа под вытяжкой. После остановки реакции меченные антитела выделяли, используя стандартный протокол с использованием спин-колонок, и концентрацию белка определяли с помощью стандартного колориметрического теста на белок. Поглощающую способность конъюгатов поликлональных анти-SNAP-25 антител/HRP измеряли с помощью спектрофотометра при 455 нм для определения концентрации в молях на литр. Раствор детектирующих анти-SNAP-25 антител хранили при 4°С до использования.

[0278] Для приготовления твердофазной подложки, содержащей антитела для захвата а-SNAP-25, которые специфичны к продукту расщепления SNAP-25, приблизительно 100 мкл раствора моноклональных анти-SNAP-25 антител 2Е2А6 (1 мг/мл в 1 × ФБР) добавляли к каждой лунке 96-луночного белого планшета Greiner, планшеты инкубировали при 4°С в течение ночи и избыток раствора антител удаляли. Затем лунки с иммобилизованными антителами для захвата блокировали путем добавления в них 150 мкл блокирующего буфера, содержащего 2% Amersham Blocking Reagent (GE Life Sciences, Пискатауэй, Нью-Джерси) и 10% козьей сыворотки (VWR, Уэст-Честер, Пенсильвания) на 1 час при комнатной температуре. Блокирующий буфер удаляли и планшеты насухо промакивали с помощью бумажных полотенец путем переворачивания и постукивания. Затем лунки с иммобилизованными антителами для захвата блокировали и использовали непосредственно для детектирования активности эндопептидазы с измененной нацеленностью.

[0279] Для детектирования присутствия расщепленного продукта SNAP-25 с помощью CL "сэндвич"-метода твердофазного ИФА, к каждой лунке добавляли 50 мкл лизата клеток, обработанных эндопептидазой с измененной нацеленностью, планшеты запечатывали и инкубировали на встряхивателе со скоростью 500 об./мин. при 4°С от 2-4 до целой ночи. Лунки планшета трехкратно промывали, удаляя аспирацией клеточный лизат и три раза ополаскивая каждую лунку 200 мкл 1 × ФБР, 0,05% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После промывки, в каждую лунку добавляли 100 мкл раствора детектирующих поликлональных анти-SNAP-25 антител/HRP в концентрации 1 мг/мл, содержащего 2% блокирующего реактива Amersham в 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат), планшет запечатывали и инкубировали на встряхивателе со скоростью 650 об./мин. при комнатной температуре в течение 1 часа. После инкубации с детектирующими антителами, лунки трехкратно промывали 200 мкл 1 х ФБР, 0,05% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После промывки в каждую лунку добавляли 100 мкл смеси SuperSignal ELISA Pico 1:1 (Pierce Biotechnology, Inc., Рокфорд, Иллинойс) и анализировали планшеты, используя люминометр (Molecular Devices, Саннивейл, Калифорния) на 395 нм. Собранные данные анализировали и вычисляли EC50 как описано в Примере VI.

Пример XII

Иммунологический способ детектирования активности эндопептидаз с измененной нацеленностью с помощью многоканального «сэндвич"-метода твердофазного ИФА с усиленной хемилюминесценцией

[0280] Следующий пример иллюстрирует многоканальные иммунологические способы детектирования активности эндопептидаз с измененной нацеленностью путем детектирования продукта расщепления SNAP-25 с использованием моноклональных анти-SNAP-25 антител, специфичных к продукту расщепления SNAP-25, и второй пары антител к другому белку.

[0281] Тест на активность эндопептидазы с измененной нацеленностью можно провести с помощью многоканального «сэндвич"-метода твердофазного ИФА с усиленной хемилюминесценцией. Такой тест описан в родственной заявке на патент на имя Ester Fernandez-Salas, et al., Immuno-Based Botulinum Toxin Serotype A Activity Assays, заявка на патент США №12/403531, которая полностью включена в настоящую заявку посредством ссылки, и его можно использовать с клеточными линиями, эндопептидазами с измененной нацеленностью и соответствующими клеточными линиями, описанными в настоящей заявке.

Пример XIII Иммунологический способ детектирования активности эндопептидаз с измененной нацеленностью с помощью многоканального ЕС "сэндвич"-метода твердофазного ИФА

[0282] Следующий пример иллюстрирует многоканальные иммунологические способы детектирования активности эндопептидаз с измененной нацеленностью путем детектирования продукта расщепления SNAP-25 с использованием моноклональных анти-SNAP-25 антител, специфичных к продукту расщепления SNAP-25, и второй пары антител к другому белку.

[0283] Тест на активность эндопептидазы с измененной нацеленностью можно провести с помощью многоканального «сэндвич"-метода твердофазного ИФА с усиленной хемилюминесценцией. Такой тест описан в родственной заявке на патент на имя Ester Fernandez-Salas, et al., Immuno-Based Botulinum Toxin Serotype A Activity /Assays, заявка на патент США №12/403531, которая полностью включена в настоящую заявку посредством ссылки, и его можно использовать с клеточными линиями, эндопептидазами с измененной нацеленностью и соответствующими клеточными линиями, описанными в настоящей заявке.

Пример XIV

Иммунологический способ детектирования наномолярных количеств эндопептидаз с измененной нацеленностью

[0284] Следующий пример иллюстрирует осуществление иммунологических способов детектирования наномолярных количеств активности эндопептидаз с измененной нацеленностью.

1. Иммунологический способ детектирования эндопептидаз с измененной нацеленностью с помощью «сэндвич"-метода твердофазного ИФА с усиленной хемилюминесценцией

[0285] Для получения лизатов из клеток, обработанных эндопептидазой с измененной нацеленностью, приблизительно от 50000 до 150000 клеток из стабильной клеточной линии, подходящей для теста, засевали в лунки 96-луночных покрытых поли-D-лизином планшетов для культур тканей, содержащих 100 мл соответствующей среды (см. Примеры I и II). Эти клетки инкубировали при 37°С в инкубаторе с содержанием углекислого газа 5% в течение 24 часов. Среду от клеток удаляли аспирацией из каждой лунки и заменяли свежей средой, содержащей 0 (необработанный образец) или подходящую дозу в соответствии с ответом, как описано в настоящей заявке для каждой эндопептидазы с измененной нацеленностью. После инкубации в течение 24 часов клетки промывали и собирали, или инкубировали в течение дополнительных двух дней в отсутствие эндопептидазы с измененной нацеленностью перед сбором. Для сбора клеток, среду удаляли аспирацией, промывали 1 × ФБР и лизировали клетки путем добавления в каждую лунку 30 мкл лизирующего буфера, содержащего 50 мМ HEPES, 150 мМ NaCl, 1,5 мМ MgCl2, 1 мМ EGTA, 1% Triton Х-100, и инкубировали планшет на встряхивателе с вращением при 500 об./мин. в течение 30 минут при 4°С. Для осаждения остатков клеток планшет центрифугировали при 4000 об./мин. в течение 20 минут при 4°С, после чего супернатант переносили в 96-луночный планшет, покрытый антителами для захвата, для проведения этапа детекции.

[0286] Раствор антител для захвата α-SNAP-25, раствор детектирующих анти-SNAP-25 антител и твердофазную подложку, содержащую антитела для захвата, которые специфичны к расщепленному продукту SNAP-25, получали как описано в Примере VII.

[0287] Для детектирования присутствия расщепленного продукта SNAP-25 с помощью «сэндвич"-метода твердофазного ИФА с усиленной хемилюминесценцией, из сохраненных планшетов удаляли аспирацией блокирующий буфер, к каждой лунке добавляли 25-30 мкл лизата клеток, обработанных эндопептидазой с измененной нацеленностью, и планшеты инкубировали при 4°С в течение 2 или 24 часов. Лунки планшета трехкратно промывали, удаляя аспирацией клеточный лизат и три раза ополаскивая каждую лунку 200 мкл 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После промывки, в каждую лунку добавляли 25 мкл раствора детектирующих aHTn-SNAP-25 антител в концентрации 5 мкг/мл, содержащего 2% блокирующего реактива Amersham в 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат), планшет запечатывали и инкубировали при комнатной температуре в течение 1 часа со встряхиванием. После инкубации с детектирующими анти-SNAP-25 антителами, лунки трехкратно промывали 200 мкл 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После промывки планшеты обрабатывали, собранные данные анализировали и вычисляли EC50 как описано в Примере VI. Эти результаты показали, что в среднем при EC50 детектировали 1,0 нМ Noc/A у клеток из клональной клеточной линии №3 SK-N-DZ (в диапазоне примерно от 0,3 нМ до 2,0 нМ) при отношении сигнала к шуму для верхней асимптоты примерно от 20:1 до 300:1. Кроме того, в среднем при EC50 детектировали 3,7 нМ Noc/A у клеток из клональной клеточной линии №6 AGN Р33 (в диапазоне примерно от 2,0 нМ до 5,5 нМ) при отношении сигнала к шуму для верхней асимптоты примерно от 20:1 до 500:1. Для клеток SK12, специфичных для эндопептидазы с измененной нацеленностью, которая содержит лиганд динорфин А, в среднем при EC50 детектировали 8,4 нМ Dyn/A у клеток SK12 (в диапазоне примерно от 4,5 нМ до 10,0 нМ) при отношении сигнала к шуму для верхней асимптоты примерно от 10:1 до 20:1. Кроме того, в среднем при EC50 детектировали 8,8 нМ галанин-TVEMP у клеток из клональной клеточной линии №7 Neuro-2a (в диапазоне примерно от 5,0 нМ до 15,5 нМ) при отношении сигнала к шуму для верхней асимптоты примерно от 20:1 до 200:1. Этот способ можно также применять в многоканальном режиме как описано в Примере IX.

2. Иммунологический способ детектирования эндопептидаз с измененной нацеленностью с помощью CL "сэндвич"-метода твердофазного ИФА [0288] Лизат из клеток, обработанных эндопептидазой с измененной нацеленностью, и раствор антител для захвата α-SNAP-25 получали как описано в Примере VII. Раствор детектирующих анти-SNAP-25 антител и твердофазную подложку, содержащую антитела для захвата, которые специфичны к расщепленному продукту SNAP-25, получали как описано в Примере VIII.

[0289] Для детектирования присутствия расщепленного продукта SNAP-25 с помощью CL "сэндвич"-метода твердофазного ИФА, к каждой лунке добавляли 100 мкл лизата клеток, обработанных эндопептидазой с измененной нацеленностью, планшеты запечатывали и инкубировали на встряхивателе с вращением 500 об./мин. при 4°С в течение 2 часов или 24 часов. Лунки планшета трехкратно промывали, удаляя аспирацией клеточный лизат и три раза ополаскивая каждую лунку 200 мкл 1 × ФБР, 0,05% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После промывки, в каждую лунку добавляли 100 мкл раствора детектирующих поликлональных am-n-SNAP-25 антител/HRP в концентрации 1 мг/мл, содержащего 2% блокирующего реактива Amersham в 1 × ФБР, 0,1% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат), планшет запечатывали и инкубировали на встряхивателе с вращением 650 об./мин. при комнатной температуре в течение 1 часа. После инкубации с детектирующими антителами, лунки трехкратно промывали 200 мкл 1 × ФБР, 0,05% TWEEN-20® (полиоксиэтилен (20) сорбитан монолауреат). После промывки в каждую лунку добавляли 100 мкл смеси SuperSignai ELISA Pico 1:1 (Pierce Biotechnology, Inc., Рокфорд, Иллинойс) и анализировали планшеты, используя люминометр (Molecular Devices, Саннивейл, Калифорния) на 395 нм. Собранные данные анализировали и вычисляли EC50 как описано в Примере VI. Этот способ можно также применять в многоканальном режиме как описано в Примере IX.

Пример XV

Иммунологический способ детектирования нейтрализующих антител против эндопептидазы с измененной нацеленностью

[0290] Следующий пример иллюстрирует осуществление иммунологического способа, способного детектировать присутствие нейтрализующих анти-Noc/A антител.

[0291] В настоящее время Noc/А проходит оценку на предмет пригодности для лечения болезненных состояний, некоторые из которых являются хроническими. При повторном долгосрочном лечении с помощью Noc/А у пациента могут появиться нейтрализующие анти-Noc/A антитела к эндопептидазе с измененной нацеленностью, что приведет к иммунной резистентности. Нейтрализующие антитела Noc/А ингибируют активность эндопептидазы с измененной нацеленностью, блокируя поглощение эндопептидазы с измененной нацеленностью нейронными и прочими клетками-мишенями путем связывания с нацеливающим лигандным доменом и/или транслокационным доменом (HN) эндопептидазы с измененной нацеленностью. На сегодняшний день отсутствует утвержденный тест для определения присутствия нейтрализующих анти-Noc/А антител в крови пациента. Разработка клеточного теста для детектирования нейтрализующих антител у пациентов, проходящих лечение с помощью эндопептидаз с измененной нацеленностью, позволит повысить экономическую эффективность и экономию времени.

[0292] Для детектирования присутствия или отсутствия нейтрализующих анти-Noc/А антител можно использовать иммунологические способы определения активности эндопептидаз с измененной нацеленностью, описанные в настоящей заявке. Одним из таких способов является определение количества продукта расщепления SNAP-25, присутствующего после обработки различными концентрациями Noc/A, посредством детектирования с помощью Вестерн блоттинга, другим способом является детектирование с помощью «сэндвич"-метода твердофазного ИФА с усиленной хемилюминесценцией.

[0293] Для приготовления образца, содержащего нейтрализующие анти-Noc/A антитела, выделяли сыворотку из крови обезьяны, иммунизированной α-Noc/A, и получали из нее антитела с помощью аффинной очистки. Также проводили иммунизацию кроликов пептидом варианта ноцицептина, нацеливающего лиганда, который присутствует в молекуле Noc/A, собирали их сыворотку и выделяли антитела с помощью аффинной очистки (с использованием поликлональных антител против ноцицептина).

[0294] Для получения лизата из клеток, обработанных образцом, содержащим Noc/A, клетки из клональной клеточной линии №3 SK-N-DZ и клетки из клональной клеточной линии №6 AGN Р33 засевали в 96-луночные планшеты, покрытые поли-D-лизином, на 16-18 часов. Поликлональные антитела против ноцицептина в концентрации 0-3 мкг/мл разбавляли СБС RPMI (с добавками N2, В27 и NGF), содержащей 1 нМ Noc/A, и проводили предварительную инкубацию смеси при комнатной температуре в течение 1 часа. Затем растворы добавляли к клеткам и инкубировали в течение 24 ч перед проведением тестов по ECL-методу твердофазного ИФА. Данные антитела против варианта ноцицептина полностью блокировали поглощение 1 нМ Noc/A при концентрации 1 мкг/мл (>90% ингибирования) в обеих клеточных линиях. Обезьяньи поликлональные антитела против Noc/A также протестировали с этими клеточными линиями. Клетки засевали в 96-луночные планшеты, покрытые поли-D-лизином, по 100000 клеток на лунку в питательную среду RPMI, содержащую N2, В27 и NGF, на 24 часа. Поликлональные антитела против Noc/A в концентрации 0-20 мкг/мл разбавляли средой, содержащей 1 нМ Noc/A, и проводили предварительную инкубацию смеси при комнатной температуре в течение 1 часа. Затем смесь добавляли к клеткам и инкубировали в течение 24 ч перед проведением тестов по ECL-методу твердофазного ИФА. У клеточной линии SK-N-DZ наблюдали ингибирование до 60% при наивысших концентрациях поликлональных антител против Noc/A 6-20 мкг/мл и около 30% у клональной клеточной линии №6 AGN Р33. Это можно объяснить тем, что поликлональные антитела против Noc/A не специфичны по отношению к участку связывания и включают другие антитела, которые связываются с другими участками молекулы, достигая лишь частичного блокирования при исследованных концентрациях. Для достижения полного блокирования могут потребоваться более высокие концентрации.

[0295] Для детектирования присутствия расщепленного продукта SNAP-25 с помощью Вестерн блоттинга, из каждой лунки удаляли аспирацией питательную среду, клетки суспендировали в 50 мкл буфера для загрузки ДСН-ПААГ и нагревали образцы при 95°С в течение 5 минут. Аликвоты от каждого собранного образца анализировали Вестерн блоттингом как описано в Примере I, за исключением того, что собранные образцы разделяли на ДСН-ПААГ, используя 12% гели Criterion на 26 лунок (Bio-Rad Laboratories, Геркулес, Калифорния), и в качестве первичных антител использовали кроличьи поликлональные анти-SNAP-25 антитела197 (см. Пример V). Результаты позволили идентифицировать наименьшую концентрацию эндопептидазы с измененной нацеленностью, которая приводит к появлению детектируемой полоски на Вестерн блоте, соответствующей продукту расщепления SNAP-25.

[0296] Для детектирования присутствия расщепленного продукта SNAP-25 с помощью «сэндвич"-метода твердофазного ИФА с усиленной хемилюминесценцией, из каждой лунки удаляли среду и лизировали клетки как описано в Примере VI. Раствор антител для захвата α-SNAP-25, раствор детектирующих анти-SNAP-25 антител и твердофазную подложку а-SNAP-25 получали как описано в Примере VIII. Супернатанты наносили на твердофазную подложку α-SNAP-25 и тест по ECL "сэндвич"-методу твердофазного ИФА проводили в соответствии с подробным описанием из Примера VI. Собранные данные анализировали и вычисляли EC50 как описано в Примере VI, за исключением того, что EC50 представляла собой разведение сыворотки, необходимое для ингибирования активности эндопептидазы с измененной нацеленностью до 1/2 ее максимального значения, а отношение максимального сигнала (SignalMax) к минимальному сигналу (SignalMin) получали путем деления интенсивности сигнала от продукта расщепления SNAP-25, полученного при наибольшем разведении антител, на интенсивность сигнала, полученного при наименьшем разведении антител.

[0297] Результаты продемонстрировали возможность детектирования присутствия нейтрализующих анти-Noc/A антител в сыворотке обезьяны и антител против варианта ноцицептина у кролика. Активность молекул Noc/A, проинкубированных с антителами, прошедшими аффинную очистку из иммунизированного животного, снижалась по мере снижения степени разведения антител. Тот же самый тест проводили с соединениями Dyn/A и галанин-TVEMP с использованием клеточных линий, специфичных для каждого тестируемого соединения.

Пример XV

Разработка клеточного теста на эндопептидазу с измененной галаниновой нацеленностью

[0298] Следующий пример иллюстрирует идентификацию стабильных клеточных линий, обладающих способностью поглощать эндопептидазы с измененной нацеленностью, необходимых для разработки клеточного теста на активность.

1. Выращивание запасных культур клеточных линий-кандидатов

[0299] Для выращивания клеточных линий, культуру подходящей плотности клеток из тестируемой клеточной линии засевали во флаконы для культур тканей на 162 см2, содержащие 30 мл подходящей питательной среды (см. Таблицу 25), и инкубировали при 37°С в инкубаторе с содержанием углекислого газа 5% или 10% до достижения клетками желаемой плотности.

Таблица 25.
Сводная таблица всех клеточных линий и соответствующих им сред
Тип клеток; описание; источник Полная среда (ПС) Все от Invitrogen (если не указано иное) Среда без сыворотки (СБС) Все от Invitrogen (если не указано иное)
SiMa (Клеточная линия нейробластомы человека, DSMZ#ACC 164, Брауншвейг, Германия) SiMa H1 (клонированная клеточная линия из клеток SiMa) RPMI 1640 (90%) Эмбриональная бычья сыворотка (ЭБС, 10%) ЗАК (0,1 мМ), HEPES (10 мМ), Пируват натрия (1 мМ) Пенициллин (100 ед. на мл) Стрептомицин (100 мкг на мл), RPMI 1640(90%)ЗАК (0,1 мМ), HEPES (10 мМ), Пируват натрия (1 мМ) Пенициллин (100 ед. на мл) Стрептомицин (100 мкг на мл) Добавка N2 (1х) Добавка В27(1х)
Neuro-2a (Нейробластомы мыши: (АТСС#СС1131, Манассас, Вирджиния) МНС Эрла (90%) Эмбриональная бычья сыворотка 10%) ЗАК (0,1 мМ), HEPES (10 мМ),, Пируват натрия (1 мМ), Пенициллин (100 ед. на мл), Стрептомицин (100 мкг на мл) МНСЭ (90%)ЗАК (0,1 мМ), HEPES (10 мМ), Пируват натрия (1 мМ), Пенициллин (100 ед. на мл), Стрептомицин (100 мкг на мл)
PC-12 Феохромоцитома крысы (ATCC#CRL-1721) RPMI 1640 (90%) Диализированная ЭБС (5%) Сыворотка лошади (10%) HEPES (10 мМ) Пируват натрия (1 мМ) D-глюкоза (0,5%, Sigma) Пенициллин (100 ед. на мл); Стрептомицин (100 мкг на мл) Добавка N2 (1х) Среда для дифференцировки: RPMI 1640 (90%) HEPES (10 мМ) Пируват натрия (1 мМ) D-глюкоза (0,5%, Sigma) Пенициллин (100 ед. на мл); Стрептомицин (100 мкг на мл) Добавка N2 (1х) Альбумин бычьей сыворотки (0,2% вес./об.) МСР(50нгна мл, Promega)
Р19 Эмбриональная карцинома мыши МНС Alpha (90%) Эмбриональная телячья сыворотка (7,5%) МНС Alpha (90%) ЭБС (2,5%)
(ATCC#CRL-1825) ЭБС (2,5%) Пенициллин (100 ед. на мл); Стрептомицин (100 мкг на мл) Пенициллин (100 ед. на мл); Стрептомицин (100 мкг на мл)
ЗАК: заменимые аминокислоты, МНС: минимальная необходимая среда. МНСД: МНС Дульбекко. МНСЭ - МНС Эрла. Следует обратить внимание на то, что дифференцировку клеток PC-12 проводили в среде для дифференцировки, а не в СБС.

2. Скрининг коммерческих клеточных линий на чувствительность к соединениям галанин - TVEMP

[0300] Проводили скрининг коммерческих клеточных линий на чувствительность к соединениям галанин-TVEMP, измеряемую по расщеплению SNAP25 после обработки соответствующими соединениями. Для скрининга и тестирования использовали различные соединения галанин-TVEMP. Клетки PC-12, Neuro-2a, SiMa и Р19 засевали в среду без сыворотки на три дня или в ПС на один день. Эти дифференцированные и не подвергавшиеся обработке клетки обрабатывали в течение 18 часов галанин-TVEMP из серии А в концентрациях 0 и 75 нМ. Галанин-TVEMP из серии А продемонстрировал активность как в клетках PC-12, так и в клетках Neuro-2a, о чем судили по увеличению присутствия расщепленного SNAP25, и клетки Neuro-2a в дифференцированном состоянии более чувствительны к соединениям TVEMP с лигандом галанина, чем не подвергавшиеся обработке клетки. По критерию активности клеток, PC-12 находится на первом месте, за которыми следуют Neuro-2a, и наконец, клетки SiMa. Было необходимо определить, являлось ли поглощение специфичным для этих соединений с измененной галаниновой нацеленностью, и поэтому было важно протестировать эти клетки с другими соединениями, которые не содержат галанинового лиганда. Noc/A представляет собой соединение с измененной нацеленностью, которое содержит в качестве лиганда вариант ноцицептина, а также соединение LHN/A (отрицательный контроль), у которого отсутствует домен связывания. Поглощение LHN/A является неспецифичным и должно иметь значительно более низкую активность, чем поглощение соединения галанин-TVEMP, если клеточная линия обладает специфичным поглощением соединений с измененной нацеленностью. Как было показано ранее, соединение Noc/A специфически поглощается клетками SiMa, и это соединение использовалось в качестве базового уровня при тестировании клеточных линий. Подходящая клеточная линия должна обладать низким уровнем поглощения соединений LHN/A и Noc/A и высоким уровнем поглощения соединения галанин-TVEMP. Таблица 26 демонстрирует результаты этого эксперимента.

Таблица 26.
Скрининг клеток PC-12, Neuro-2a и SiMa в различных условиях с помощью галанин-TVEMP
Галанин-TVEMP из серии А Галанин-TVEMP из серии В LHN/A Noc/A
Конц. (мг/мл) 0,168 0,175 1,63 1,00
Значения EC50 (нМ) PC-12, не подвергавшиеся обработке 73,4±10,7 105,6±16,0 >200 72,9±26,9
SiMa, не подвергавшиеся обработке 138,6±43,9 133,8±24,2 >300 48,3±18,1
Neuro-2a, не подвергавшиеся обработке 122,4±15,7 116±17,5 >200 >150
SiMa, Диф ночь >400 >150 >400 16,1±11,9
Neuro-2a Диф 4 Д 34,5±7,5 39,7±5,6 105,9±44,3
SiMa, Диф 4 д 101,8±20,5 65,3±7,8 >150 88,7±23,3
Тестирование галанин-TVEMP из серий А и В и контролей LHN/A и Noc/A с различными клеточными линиями и условиями роста/дифференцировки. Сводная таблица демонстрирует подробную информацию о каждом протестированном соединении и значения EC50.

[0301] Результаты демонстрируют, что в протестированных клеточных линиях кривые или значения EC50 для галанин-TVEMP из серии А и галанин-TVEMP из серии В сходны с отрицательными контролями или более активны лишь в 1-2 раза. Эти данные подразумевают, что нативные клетки не обладают достаточной чувствительностью и их необходимо трансфицировать плазмидами, кодирующими белки-рецепторы галанина GalR1 или GalR2.

3. Стабильная трансфекция клеток PC-12, Neuro-2a и SiMa с помощью GaIR

[0302] За один день до трансфекции клетки высевали с плотностью 0,5×106 клеток/лунка в 6-луночные планшеты, покрытые коллагеном IV (Cat#354554: BD Biosciences) (SiMa, PC-12) или 6-луночные планшеты Costar (Cat# 3516: Corning) (Neuro-2a). Трансфекции проводили, разбавляя 12 мкл реагента Lipofectamine™ 2000 (Cat # 52758, Invitrogen) в 250 мкл среды с восстановленной сывороткой Opti-MEM® I (Cat# 3195, Invitrogen) и инкубировали при комнатной температуре в течение 5 минут. Четыре микрограмма плазмидной ДНК GaIR смешивали с 0,4 мкг вектора pAdVantage™ (1 мг на мл, Cat#E1711, Promega) в 250 мкл среды с восстановленной сывороткой Opti-MEM® I в течение 5 минут. После 5 минут инкубации разбавленный Lipofectamine™ 2000 и разбавленную плазмидную ДНК смешивали и инкубировали в течение еще 20 минут при комнатной температуре для образования комплекса. Тем временем клетки промывали OPTI-MEM®, и к каждой лунке добавляли 0,5 мл OPTI-MEM®. После 20-минутной инкубации, 0,5 мл, содержащих комплексы разбавленного Lipofectamine™ 2000 и разбавленной плазмидной ДНК, осторожно добавляли к лункам с клетками в 0,5 мл OPTI-MEM®. Планшет инкубировали при 37°С в течение 5 часов, а затем добавляли 1 мл полной среды. На следующий день среду заменяли питательной средой на 48 часов. На 4 день, после того, как клетки восстанавливались после трансфекции, питательную среду заменяли свежей питательной средой, содержащей Geneticin® (Cat #10131: Invitrogen) в концентрации 0,5 мг на мл (разбавление 1:100), и инкубировали в течение еще 3 дней. На 7 день после трансфекции клетки переносили в покрытый коллагеном IV флакон на 75 см (Cat# 35423: BD Biosciences), содержащий питательную среду и генетицин (0,5 мг на мл, разбавление 1:100). После этого переноса приблизительно 90% клеток гибли и их удаляли при смене среды. Питательную среду, содержащую генетицин (0,5 мг на мл, разбавление 1:100), заменяли каждые два дня до дня 21.

[0303] Для отбора стабильных клеток, способных поглощать соединения галанин-TVEMP, использовали параметры для скрининга на клоны, которые производили наибольший процент расщепления SNAP25 при обработке галанин-TVEMP в ECL "сэндвич"-методе твердофазного ИФА с использованием планшетов с иммобилизированными моноклональными антителами 2Е2А6 для захвата и поликлональных сульфомеченных детектирующих антител SNAP25 (Sigma Cat # S9684). Значения EC50 в Таблице 27 показывают, что галанин-TVEMP из серии D демонстрирует поглощение, по меньшей мере 10-кратно превышающее показатель в отрицательном контроле, для клеток SiMa и Neuro-2a, трансфицированных GalR1 и GalR2, и лишь 2-4-кратно превышающее показатель в отрицательном контроле для трансфицированных клеток PC-12. Поскольку трансфицированные клетки PC-12, по-видимому, характеризуются более низкой чувствительностью и нацеленностью по сравнению с клетками SiMa и Neuro-2a, их не клонировали. Кроме того, поскольку 1-16-мерный галаниновый лиганд в составе соединений галанин-TVEMP связывается с рецептором GALR1 с большей аффинностью, чем с GALR2, клонировали только клетки, трансфицированные GALR1. Фигура также показывает, что галанин-TVEMP из серий С и D демонстрируют поглощение, 9-10-кратно превышающее показатели как для 1-Нм/А, так и для соединения с измененной ноцицептиновой нацеленностью ноцицептин-TVEMP, в Neuro-2a GalR1.

Таблица 27.
Тест стабильно трансфицированных, но неклональных популяций SiMa, Neuro-2a и РС12, трансфицированных рецепторами GalR1 или GalR2
Галанин-TVEMP С Галанин-TVEMP D LHN/A Ноцицептин - TVEMP
Конц. (мг/мл) 1,260 0,303 1,46 1,00
EC50 Значения (нМ) SiMa GalR1 36,2±8,6 >300
SiMa GalR2 26,6±6,7 >300
PC-12 GalR1 64,1+19,5 202,7
PC-12 GalR2 >150 >300
Neuro-2a GalR1 32,2±3,3 40,8±6,0 >300 >300
Neuro-2a GalR2 35,2±3,1 46,0±6,1 >300 >300

[0304] Неклональные отобранные популяции не подходят для использования на регулярной основе, потому что они содержат смесь клеток, экспрессирующих разные уровни рецептора, и эти популяции могут изменяться со временем. Для получения стабильных клеточных линий, образовавшихся из единичных клеток, начали клонирование с помощью разведении. На 21 день трансфицированные клетки трипсинизировали, разделяли с помощью иглы и подсчитывали. Оставшиеся трансфицированные клеточные линии замораживали для использования в будущем. Клетки последовательно разводили до плотности 10 клеток на мл в питательной среде, содержащей генетицин (0,5 мг на мл, разбавление 1:100). Клетки засевали в 2×96-луночные планшеты, покрытые коллагеном IV (SiMa, PC-12), или в 2×96-луночные планшеты Costar (Neuro-2a) по 100 мкл в лунку для достижения плотности 1 клетка на лунку. Планшеты возвращали в инкубатор и оставляли нетронутыми в течение двух недель для образования колоний. После двух недель (35 день), лунки тщательно проверяли на присутствие единичных колоний, образовавшихся на дне лунок (всю лунку тщательно проверяли на наличие множественных колоний). При обнаружении лунки с единственной группой клеток, всю эту лунку тщательно исследовали, чтобы удостовериться, что присутствовала одна и только одна группа клеток. Эту единственную группу фотографировали. Если присутствовали какие-либо сомнения о наличии дополнительных групп, такую лунку не отбирали. На 36 день отобранные клоны отделяли с помощью TrypLE и добавляли 0,5 мл полной среды, содержащей генетицин (0,5 мг на мл, разбавление 1:100), для остановки реакции трипсинизации. Весь объем переносили в 6-луночные планшеты, а затем разбавляли дополнительными 3,0 мл полной среды, содержащей генетицин (0,5 мг на мл, разбавление 1:100). Клоны культивировали до достижения 90%-й конфлюентности, затем снова трипсинизировали и переносили во флаконы на 75 см, покрытые коллагеном IV, или флаконы Costar с 10,0 мл полной среды, содержащей генетицин (0,5 мг на мл, разбавление 1:100). По достижении 90%-й конфлюентности клетки использовали для заполнения трех криопробирок для хранения в замороженном виде или для скрининга в тесте с твердофазным ИФА на соединения с измененной галаниновой нацеленностью.

[0305] Эталонное соединение галанин-TVEMP из серии С использовали для проверки этих клонов с помощью двух исполнителей, проводящих независимые тесты. Клоны SiMa GalR1 росли медленно и были в это время недоступны для тестирования. К счастью, клоны Neuro-2а росли быстрее, и в скором времени достаточные количества 8 из 12 клонов были доступны для тестирования. Эти клональные клетки Neuro-2a GalR1 тестировали с полным диапазоном доз соединений галанин-TVEMP (0-300 нМ), и результаты тестирования девяти из этих клонов приведены ниже. Оставшиеся четыре клона росли очень медленно и не были протестированы. Отобранные, но неклональные родительские клетки высевали наряду с клонами, чтобы использовать их в качестве точки отсчета. В Таблице 28 представлена активность каждого из восьми клонов вместе с отобранным неклональными клетками Neuro-2a GalR1 при тестировании с соединением галанин-TVEMP. Из восьми протестированных клонов только клоны №4, 7 и 12 показали хорошее поглощение соединения галанин-TVEMP с приемлемыми значениями EC50. Клоны №1, 3 и 10 Neuro-2a GalR1 не поглощали соединение галанин-TVEMP, в то время как клоны №5, 11 и 13 вместе с неклональной популяцией демонстрировали очень высокие значения EC50, и эти клетки исключили из дальнейшего тестирования.

Таблица 28.
Результаты скрининга клонов Neuro-2a GalR1, полученных из единичных клеток, с помощью галанин-TVEMP из серии С
ЕС50 ± Станд. ошибка (нМ)
Планшет Тип клеток Исполнитель 1 Исполнитель 2
1 N2A Неклональные 82,1±9,6 92,0±10,8
1 N2A GALR1 Клон №1 >300 >300
1 N2A GALR1 Клон №3 >300 >300
1 N2A GALR1 Клон №4 39,7±3,4 39,4±6,6
N2A Неклональные 211,2±167,7 116,0±26,8
2 N2A GALR1 Клон №5 202,6±82,9 113,0±18,1
2 N2A GALR1 Клон №7 23,1±3,3 15,5±1,8
2 N2A GALR1 Клон №10 >300 >300
3 N2A GALR1 Клон №7 20,3±1,6 38,0±6,3
3 N2A GALR1 Клон №11 270,0±243 247,0±101
3 N2A GALR1 Клон №12 43,2±5,2 57,5±14,3
3 N2A GALR1 Клон №13 144,1±143 184,7±15,6

4. Исследование экспрессии GalR1 в клональных клеточных линиях

[0306] Скрининг клонов показал, что только клоны №4,7 и 12 были более чувствительны, чем неклональные клетки. Из этих 3 клонов, как и из нетрансфицированных родительских и стабильно трансфицированных неклональных клеток Neuro-2a, выделяли матричную РНК (мРНК) для исследования с помощью ПЦР-РВ с использованием условий ПЦР-РВ, описанных в Примере V, и праймеров, описанных в Таблице 29.

Таблица 29.
Праймеры, специфичные для GALR1 и GALR2
Название Последовательность SEQ ID NO:
GALR1 fwd 5”CCCCATCATGTCATCCACCT 3' 150
GALR1 rev 5'ATGGGGTTCACCGAGGAGTT 3' 151
GALR2 fwd 5'CATCGTGGCGGTGCTTTT 3' 152
GALR2 rev 5'AGCGGGAAGCGACCAAAC 3' 153

[0307] Результаты в Таблице 30 демонстрируют, что у трансфицированных неклональных клеток и клонов количество мРНК GALR1 намного больше, чем у родительских клеток. Клеточный скрининг с помощью галанин-TVEMP показал, что клон №7 являлся самым чувствительным к галанин-TVEMP. Также было показано, что клон №7 содержал наибольшее количество мРНК GALR1 согласно Таблице 30. Значения СТ для клона 7 Neuro-2a GalR1 (Neuro-2a №7) были самыми низкими, а за ними следовали значения для клона 4 и затем для клона 12. Неклональные клетки, протестированные на тот момент времени, демонстрировали значения СТ, близкие к значениям для клона 12, однако эти клетки содержали постоянно меняющиеся популяции клеток с варьирующими концентрациями рецептора GalR1 и поэтому не считались хорошей популяцией для дальнейшей работы. Из трех клонов с низкими значениями ECso, клон №12 Neuro-2a GalR1 (Neuro-2a №12) характеризовался наибольшей скоростью роста, а за ним следовали клон №7 Neuro-2a и наконец, клон №4 Neuro-2a. В дополнение к медленной скорости роста, клон №4 Neuro-2a не тестировали в дальнейшем, потому что чувствительность клона №7 Neuro-2a было намного лучше, чем у клона №4.

Таблица 30.
Высокие отличия уровней мРНК GALR1 между трансфицированными клональными клетками Neuro-2a и трансфицированными неклональными и родительскими клетками.
Клеточная линия Родительская Неклональная Клон 4 Клон 7 Клон 12
Средн. СТ 32,0 21,7 20,8 19,3 21,6
кратность разницы уровней мРНК 1,0 1269,5 2418,7 6793,8 1332,6

5. Сравнение чувствительности и специфичности клонов Ns 7 и 12 Neuro-2a к соединениям галанин-TVEMP

[0308] Два клона параллельно протестировали с целью идентификации наиболее чувствительного и специфичного из них, чтобы можно было уверенно собирать данные от клона с лучшими характеристиками. Таблица 31 демонстрирует результаты этих двух клонов при обработке галанин-TVEMP из серии С и LHN/A для исследования соответственно чувствительности и избирательности. Оба клона показывали высокие значения отношения сигнала к шуму. Клон №7 Neuro-2a продемонстрировал EC50 5,5 нМ, в то время как EC50 для клона №12 Neuro-2a составляло 68,4 нМ. Клон №12 Neuro-2a необходимо тестировать в диапазоне доз 0-300 нМ, в то время как клон №7 Neuro-2a можно тестировать в диапазоне доз 0-30 нМ для достижения плато при наибольшей используемой концентрации. Оба клона показывали хорошее разделение между LHN/A и галанин-TVEMP из серии С. Клон №12 Neuro-2a демонстрировал некоторое неспецифическое поглощение при высоких концентрациях, в то время как клон №7 Neuro-2a не демонстрировал его. Как явствует из приведенных в таблице результатов, диапазон для тестирования с помощью клеток Neuro-2a №7 в 10 раз ниже, чем диапазон для клеток Neuro-2a №12, что приводит к использованию в 10 раз меньшего количества соединения с Neuro-2a №7, чем с Neuro-2a №12. Neuro-2a №7 в 8 раз более селективен, чем клон №12 Neuro-2a при использовании LHN/A для сравнения. Отношение сигнала к шуму составляло более 100 для обоих клонов, однако для разработки клеточного теста на активность достаточно значения отношения, равного 10. EC50 для клона №7 Neuro-2a составляла 5,5 нМ и была примерно в 12 раз ниже, чем EC50 для Neuro-2a №12, которая составляла 68,4 нМ. Более низкий диапазон доз для тестирования, 24-кратная избирательность по сравнению с LHN/А, высокое значение отношения сигнала к шуму, превосходная чувствительность, приводящая к низкому значению EC50 и низкому количеству белка, необходимому для каждого теста - все эти характеристики говорили о том, что клон №7 Neuro-2a являлся предпочтительным клоном для разработки клеточного теста на активность, используемого для определения отношений активности соединений галанин-TVEMP.

Таблица 31. Сравнение характеристик клонов №7 и №12 Neuro-2a
Neuro-2a №7 Neuro-2a №12
Диапазон 0-30 нМ 0-300 нМ
Избирательность 24-кратная 3-кратная
Отношение сигнала к шуму 190 547
Процент максимального сигнала LHN/A по сравнению с максимальным сигналом гал-TVEMP 4,3% 37,6%
EC50 5,5 нМ 68,4 нМ
Необходимое количество белка ~1 мкг ~10 мкг
Neuro-2a №7 и №12 обрабатывали галанин-TVEMP из серии С и 1-Нм/А в течение 16 часов в ПС. Активность детектировали с помощью ECL-метода твердофазного ИФА.

Пример XVI

Получение клональных клеточных линий, сверхэкспрессирующих рецептор KOR-1 для поглощения эндопептидазы с измененной нацеленностью динорфин А

[0309] Следующий пример описывает исследование и сравнение нескольких клональных клеточных линий, полученных из стабильной клеточной линии путем ее трансфекции рецептором-мишенью и последующего клонирования этой клеточной линии. Данный конкретный пример относится к идентификации и исследованию клональных клеточных линий, трансфицированных hKOR-1, которые были впервые описаны в Примере III, Таблице 9.

[0310] Четыре клона AGN P33-KOR (клоны номер 8, 9, 10 и 12 из Таблицы 9 в Примере III) отобрали и протестировали с Dyn/A на полнодозовый ответ при 0-150 нМ. В то же самое время, два клона SiMa-KOR (клоны номер 12 и 16 из Таблицы 9 в Примере III) отобрали и протестировали с Dyn/A на полнодозовый ответ при 0-150 нМ. В этом эксперименте клоны 8, 9 и 12 AGN P33-KOR продемонстрировали очень низкое поглощение и поэтому их исключили из дальнейшего исследования; клон 10 AGN P33-KOR продемонстрировал хороший уровень поглощения и для него получили значение EC50, составляющее 30,3 нМ. Два протестированные клона SiMa-KOR показали хороший уровень поглощения, и для клона 16 получили значение EC50, составляющее 26,6 нМ, а для клона 12 получили значение ECso, составляющее 11,8 нМ. Затем эти три клона протестировали на чувствительность и избирательность путем сравнения поглощения соединения-мишени Dyn/A с отрицательным контролем LHN/A, у которого отсутствует нацеливающий лиганд, и с контролем Noc/A. Сравнение трех клонов и родительских клеток SiMa с помощью полнодозового ответа при 0-150 нМ приведено в Таблице 32.

Таблица 32
Клеточная линия EC50 Dyn/A (нМ) EC50 LHN/A (нМ) EC50 Noc/A (нМ)
Родительская SiMa >100 >100 5,4
Клон 10 AGN P33-KOR 9,7 >150 9,4
Клон 16 SiMa-KOR 10,6 >100 1,6
Клон 12 SiMa-KOR 4,65 >150 19,7

[0311] Наблюдалось заметное увеличение поглощения Dyn/A у клонов, трансфицированных KOR-1, при обработке Dyn/A, в то время как родительские клетки SiMa демонстрировали минимальное поглощение этого соединения (уровень поглощения был сходен с таковым в отрицательном контроле LHN/A). Во всех клеточных линиях, включая родительские клетки SiMa, присутствовало некоторое количество Noc/A. Это не было удивительно, поскольку поглощение Noc/A в клетках SiMa наблюдали при разработке теста для этого соединения с измененной нацеленностью. Более того, поглощение Noc/A было наилучшим в клеточной линии AGN РЗЗ, которая была получена специально для этой эндопептидазы с измененной нацеленностью. Отличие между поглощением Noc/A и поглощением соединения Dyn/A было больше в клональных клетках клона 12 SiMa-KOR (SK12). На всех кривых активность отрицательного контроля, l.hn/a, была минимальна, демонстрируя, что в отсутствие связывающего домена специфическое поглощение в этих клеточных линиях отсутствует, и наиболее низким было поглощение в клетках SK12, показывая, что поглощение соединения Dyn/A является высоко специфичным. На основании этих результатов клон SK12 отобрали для будущей оптимизации и исследования.

[0312] Исследования по оптимизации проводили с клетками SK12 для разработки надежного, специфичного и чувствительного теста. Было исследовано несколько параметров, включая среду для засева и плотности засева, среду для обработки и время обработки. Обобщение данных, полученных при оптимизации, приведено в Таблице 33.

Таблица 33
Использованная среда Клетки/лунка
засев обработка Время обработки 25000 50000 75000 100000 150000
полная полная 6 ч + на ночь 51,3 76 13,4 9,2 Н/П
полная полная 16 ч 21,3 19,0 4,96 4,64 Н/П
полная полная 16 ч Н/П Н/П Н/П 2,1 15,3
без сыворотки без сыворотки 16 ч Н/П Н/П Н/П 9,0 12,1
полная без сыворотки 16 ч Н/П 10,3 5,4 8,97 8,38
полная полная 16 ч Н/П 7,7 4,86 13,72 11,26
без сыворотки без сыворотки 16 ч Н/П 11,2 8,5 8,4 9,2

[0313] Таблица В показывает, что клетки, засеянные с плотностью 100000 клеток на лунку в ПС и обработанные соединениями в ПС, демонстрировали большую изменчивость значений EC50 от одного эксперимента к другому (4,6; 1,2 и 13,72 нМ), в то время как клетки, засеянные с плотностью 100000 клеток на лунку в СБС и обработанные соединениями, разбавленными СБС, демонстрировали лучшие кривые и единообразные значения EC50 (9,0 и 8,4 нМ). В будущем, клетки следует засевать с плотностью 100000 клеток на лунку в СБС и обрабатывать соединениями также в СБС.

[0314] Клетки SK12, засеянные в покрытые поли-D-лизином планшеты с плотностью 100000 клеток на лунку в СБС на 24 часа с последующей обработкой в СБС в течение 16 часов, демонстрировали минимальное значение EC50 8,4+/-1,1 нМ и отношению сигнала к шуму, составлявшее 12. Оба эти значения являются приемлемыми для будущего использования этих клеток в КТА.

Исследование клеток SK12 в тесте насыщения связывания

[0315] Тест насыщения связывания, используемый здесь, был подробно описан в Примере V. Исследования по насыщению связывания проводили с использованием 3H-дипренорфина, который является антагонистом KOR-1, для оценки связывания. Общее, специфическое и неспецифическое связывание измеряли в нескольких экспериментах. Кривая насыщения связывания 3H-дипренорфина с рецептором была построена на основании двух независимых экспериментов. Неспецифическое связывание, по-видимому, составляло около 25%, а 75% приходилось на специфическое связывание молекулы с рецептором. Аффинность молекулы к рецептору соответствовала 6,5 нМ. Значение Втах говорило о том, что на клетках SK12 присутствует 23 фмоль рецепторов KOR-1 на клетку.

[0316] Если не указано обратное, все числа, выражающие количества компонентов, свойства, такие как молекулярная масса, условия реакции, и т.д. используемые в заявке и формуле изобретения, должны пониматься как дополненные термином "приблизительно" во всех случаях. Соответственно, если не указано обратное, численные параметры, приведенные в описании и приложенной формуле изобретения, являются приближениями, которые могут измениться в зависимости от желаемых свойств данного изобретения, которые необходимо получить. По крайней мере, и не в качестве попытки ограничить применение доктрины эквивалентов к объему формулы изобретения, каждый численный параметр следует рассматривать с учетом приведенных значащих разрядов с применением обычных методов округления. Несмотря на то, что численные диапазоны и параметры, задающие широкий объем изобретения, являются приближениями, численные данные, указанные в определенных примерах, приведены настолько точно насколько это возможно. Любое численное значение, однако, изначально содержит определенные ошибки, обязательно следующие из стандартного отклонения, обнаруживаемого в соответствующих экспериментальных измерениях.

[0317] Существительные и подобные обозначения, используемые в контексте описания изобретения (особенно в контексте приведенной ниже формулы изобретения), следует рассматривать как охватывающие и единственное, и множественное число, если не указано обратное или из контекста явно не следует обратное. Перечисление диапазонов величин используется исключительно в качестве удобного указания на каждую отдельную величину как находящуюся в пределах диапазона. Если в данном описании не указано обратное, каждое отдельное значение считается упомянутым в данном документе. Все методы, описанные здесь, могут быть осуществлены в любом подходящем порядке, если в описании не указано иное или обратное не следует явно из контекста. Использование любого из примеров, или типового выражения (например, "такой как") приведенное здесь, направлено на лучшее освещение изобретения и не накладывает ограничений на область применения изобретения, если явно не указано обратное. Язык, применяемый в описании, не следует понимать как необходимый элемент, важный для реализации изобретения.

[0318] Группы альтернативных элементов или вариантов реализации изобретения, раскрытого здесь, не следует рассматривать как ограничения. Каждый член группы может быть упомянут и заявлен индивидуально или в любой комбинации с другими членами группы или другими элементами, приведенными в настоящем описании. Ожидается, что один или более членов группы могут быть включены в, или удалены из группы из соображений удобства и/или патентоспособности. Когда происходит такое включение или удаление, описание следует рассматривать как содержащее измененную группу, таким образом дополняя письменное описание всех групп Маркуша, используемых в приложенной формуле изобретения.

[0319] В заявке описаны некоторые варианты реализации этого изобретения, включая лучший способ, известный авторам изобретения. Конечно, модификации описанных вариантов реализации станут очевидными специалистам в этой области техники после прочтения предшествующего описания. Автор изобретения ожидает, что квалифицированные специалисты смогут надлежащим образом использовать такие варианты, и авторы изобретения предполагают, что изобретение может быть осуществлено иначе, чем описано здесь. Соответственно, в соответствии с действующим законодательством, настоящее изобретение включает все модификации и эквиваленты объекта, описанного в формуле изобретения, прилагающейся к этому документу. Более того любая комбинация вышеописанных элементов во всех возможных их вариациях относится к изобретению, если в данном документе не указано обратное или из контекста явным образом не следует иное.

[0320] Определенные варианты реализации, раскрытые здесь, могут быть далее ограничены в формуле изобретения при помощи выражения "состоящий из" или "по существу состоящий из". При использовании в формуле изобретения, в представлении сведений или добавлении в качестве поправки, выражение "состоящий из" исключает любой элемент, шаг или компонент, не указанный в формуле изобретения. Выражение "состоящий по существу из" ограничивает объем формулы изобретения указанными материалами или шагами и теми, которые не оказывает влияния на основную(ые) или новую(ые) характеристику(и). Охарактеризованные таким образом варианты реализации изобретения неотъемлемо или явным образом описаны и приведены в настоящем описании.

[0321] Далее, в описании сделаны многочисленные библиографические ссылки на патенты и печатные работы. Каждый цитируемый выше источник и печатная работа включены в настоящую заявку посредством ссылки.

[0322] В завершение, нужно понимать, что варианты реализации изобретения, раскрытые здесь, проиллюстрированы на основе принципов, лежащих в основе данного изобретения. В рамках этого изобретения могут быть использованы другие модификации. Таким образом, в качестве примера, но не ограничения, альтернативные конфигурации данного изобретения могут быть использованы в соответствии с сущностью данного изобретения. Соответственно, данное изобретение не ограничено только тем, что продемонстрировано и описано в настоящем описании.

1. Способ детектирования активности эндопептидаз с измененной нацеленностью, включающий этапы:
а. обработки клетки из стабильной клеточной линии образцом, содержащим эндопептидазу с измененной нацеленностью, причем указанная клетка из стабильной клеточной линии чувствительна к активности указанной эндопептидазы с измененной нацеленностью при концентрации эндопептидазы с измененной нацеленностью около 500 пМ или ниже;
б. выделения из обработанной клетки компонента SNAP-25, содержащего продукт расщепления SNAP-25197, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A;
в. осуществления контакта компонента SNAP-25 с анти-SNAP-25 антителом, иммобилизованным на твердофазной подложке,
при этом анти-SNAP-25 антитело связывается с эпитопом SNAP-25197, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A, и характеризуется константой скорости ассоциации для интактного SNAP-25, составляющей менее 1×101 М-1 с-1 и равновесной константой диссоциации для эпитопа, составляющей менее 0,450 нМ;
г. детектирования присутствия комплекса антитело-антиген, включающего анти-SNAP-25 антитело и продукт расщепления SNAP-25197, карбоксильный конец которого соответствует остатку P1 разрезаемой связи в сайте расщепления токсином BoNT/A,
при этом детектирование продукта расщепления SNAP-25197 с помощью указанного комплекса антитело-антиген является показателем того, что эндопептидаза с измененной нацеленностью активна.

2. Способ по п.1, отличающийся тем, что присутствие комплекса антитело-антиген детектируют с использованием ′′сэндвич′′-метода твердофазного ИФА.

3. Способ по п.1, отличающийся тем, что способ характеризуется отношением сигнала к шуму для нижней асимптоты, составляющим по меньшей мере 3:1, и отношением сигнала к шуму для верхней асимптоты, составляющим по меньшей мере 10:1.

4. Способ по п.1, отличающийся тем, что образец содержит не более 100 пМ эндопептидазы с измененной нацеленностью.

5. Способ по п.1, отличающийся тем, что клетка из стабильной клеточной линии чувствительна к ингибированию экзоцитоза эндопептидазой с измененной нацеленностью при концентрации эндопептидазы с измененной нацеленностью около 100 пМ или ниже.

6. Способ по п.1, отличающийся тем, что способ осуществляют в одноканальном режиме или многоканальном режиме.



 

Похожие патенты:

Группа изобретений относится к анализу жидких образцов. Представлен способ анализа по меньшей мере двух аналитов в жидком образце, указанный способ содержит стадии: a) предоставление подложки, где по меньшей мере два различных типа связывающих молекул иммобилизованы на подложке и где каждый тип связывающих молекул обладает специфической аффинностью к аналиту, b) приведение образца в контакт с указанными связывающими молекулами, c) по меньшей мере для одного аналита, подлежащего анализу: осуществление контакта между связывающими молекулами и меченой обнаруживаемой молекулой со специфической аффинностью к аналиту, и по меньшей мере для одного другого аналита, подлежащего анализу: осуществление контакта между связывающими молекулами и меченым вариантом аналита, и d) измерение обнаружимого сигнала от меченой обнаруживаемой молекулы и меченого аналита на подложке, где концентрация меченого аналита подобрана в соответствии с концентрацией аналита в образце.

Группа изобретений относится к способу восстановления антигена в образце ткани, фиксированной формальдегидом, и к набору, использующемуся в данном способе. Способ включает инкубирование образца ткани, фиксированной формальдегидом, в первом растворе для восстановления антигена при температуре выше 90°C.
Изобретение относится к области молекулярной биологии и биохимии. Устройство состоит из источника света, излучение от которого направлено на прозрачную подложку с иммобилизованными на ее поверхности олигонуклеотидами и расположенной под ней системой детекции интенсивности света, прошедшего через подложку.

Группа изобретений относится к области медицины, а именно к лабораторной диагностике. Планшет для образцов содержит одну или более лунок, имеющих основание и одно или более гнезд, выполненных в основании и имеющих углубление с сужающейся частью, а также гранулы или микросферы реагента, введенные в углубления.

Группа изобретений относится к устройству и способу детектирования и/или количественного определения молекул в образце слюны и предназначена для определения аналитов в слюне.

Группа изобретений относится к способу измерения тропонина I в образце. Для этого предоставляют образец.

Группа изобретений относится к определению количества целевого компонента в образце, при котором магнитные частицы могут специфично связываться с контактной поверхностью.
Изобретение относится к медицине, в частности к клинической лабораторной диагностике, иммунохимии, и касается диагностики вируса простого герпеса первого типа методом твердофазного иммуноферментного анализа.

Изобретение относится к биологии и медицине, а именно - к качественной и/или количественной индикации аналитов. Устройство для сбора аналита из раствора путем концентрирования его на магнитных частицах включает в себя проточную камеру, состоящую из верхнего и нижнего каналов, содержащих электроды для создания электрического поля, перпендикулярного потоку жидкости в проточном канале из полупроницаемой диализной мембраны, размещенном между верхним и нижним каналами, концентратор магнитного поля и магнит для создания магнитного момента в концентраторе.

Группа изобретений относится к медицине, а именно к лабораторной диагностике, и может быть использована для выполнения анализа кластеров. Анализ содержит следующие этапы: a) предоставляют суспензию из суперпарамагнитных частиц в жидкости, предназначенной для анализа, при этом суперпарамагнитные частицы покрыты биологически активным агентом; b) обеспечивают для частиц возможность формировать кластеры частиц с аналитами, присутствующими в жидкости; c) применяют вращающееся магнитное поле (В), имеющее угловую частоту, обеспечивающую вращение магнитным полем только кластеров, имеющих размер, меньший или равный заданному размеру, и d) детектируют вращающиеся кластеры.
Изобретение относится к области медицинской микробиологии и касается способа определения активации плазминогена бактериями. Способ включает внесение протамина сульфата в подготовленный супернатант, инкубацию полученной смеси, осаждение клеток центрифугированием, инкубацию супернатанта с протамин сульфатом, осаждение белка и регистрацию активации плазминогена бактериями по количеству отщепившегося аргинина, содержание которого определяют методом Сакагуши по окрашиванию проб в красный цвет.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения функциональной активности компонента C3 комплемента человека.

Изобретение относится к области молекулярной биологии и генетики. Предложен способ качественного и количественного анализа липидов, прочносвязанных с геномной ДНК, включающий стадии выделения из клеток геномной ДНК, связанной с липидами, детергентным способом, гидролиза ДНК гидролизующим ферментом, выделения липидов в смеси хлороформ-метанол-вода при 37˚С, выпаривания растворителя, стабилизации липидов 2,6-ди-трет-бутил-п-крезолом, смешивания липидов с TMSH, хроматографии с помощью газового хроматографа с последующей масс-спектрометрией.

Изобретение относится к медицинской иммунологии, а именно к способам определения функциональной активности компонентов комплемента в сыворотке крови человека при диагностике ряда заболеваний и в биологических препаратах.
Изобретение относится к медицине, а именно к онкологии. .
Изобретение относится к области биохимии и биотехнологии. .

Изобретение относится к биотехнологии, а именно к модуляторам пути передачи сигнала HGF/c-met. .

Изобретение относится к области биотехнологии, конкретно к способу идентификации -секретазы и ее ингибиторов, и может быть использовано в медицине при поиске активных соединений для лечения болезни Альцгеймера.

Изобретение относится к биотехнологии. .

Изобретение относится к области биотехнологии. Описан способ диагностики in vitro нейродегенеративного заболевания у индивидуума. Способ предусматривает определение уровня двухцепочечной РНК-зависимой протеинкиназы (PKR) в образце цереброспинальной жидкости индивидуума. На основании уровня PKR делают вывод, страдает ли индивидуум нейродегенеративным заболеванием. Изобретение может быть использовано в медицине. 7 з.п. ф-лы, 11 ил., 8 табл., 3 пр.
Наверх