Антитела к erbb3



Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3
Антитела к erbb3

 


Владельцы патента RU 2568051:

АВЕО ФАРМАСЬЮТИКАЛЗ, ИНК. (US)

Изобретение относится к биотехнологии. Описано антитело или его антигенсвязывающий фрагмент, которое связывает ErB3 человека. Раскрыт способ ингибирования или уменьшения пролиферации опухолевых клеток, а также способ уменьшения роста опухоли, способ получения пептида и способ лечения рака. Описаны векторы экспрессии, выделенные нуклеиновые кислоты, кодирующие вариабельные области описанного антитела и клетки-хозяева. Антитела можно использовать для лечения заболеваний и расстройств, связанных с пролиферацией клеток, в том числе определенных злокачественных опухолей, связанных с активацией ErbB3/Her3. 16 н. и 18 з.п. ф-лы, 30 ил., 22 табл., 18 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

[0001] Данная заявка заявляет право и приоритет предварительной заявки на патент с серийным номером 61/322712, поданной 9 апреля 2010 г., полное содержание которой включено в данный документ посредством ссылки.

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

[0002] Областью настоящего изобретения является молекулярная биология, иммунология и онкология. Более конкретно, областью являются гуманизированные антитела, которые связывают ErbB3/HER3 человека.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

[0003] HER3/c-ErbB3 (называемый в данном документе ErbB3) является членом семейства рецепторов эпидермального фактора роста (EGFR). ErbB3 связывает нейрегулин/херегулин (NRG/HRG). Рецепторы в семействе EGFR представляют собой одиночные трансмембранные рецепторы с внутриклеточным тирозинкиназным доменом. Тогда как другие члены семейства EGFR, т.е. EGFR/HER1/ErbB1, Her2/ErbB2 и HER4/ErbB4, обладают тирозинкиназной активностью, ErbB3 обладает слабой или не имеет тирозинкиназной активности, и таким образом является "киназно-мертвым".

[0004] Внеклеточный домен (ECD) в семействе EGFR состоит из четырех доменов. Домены 1 и 3 (также известные как домены L1 и L2) ответственны за связывание лигандов. Богатые цистеином домены 2 и 4 (также известные как домены С1 и С2) вовлекаются в димеризацию с рецепторами-партнерами. После связывания лиганда ECD претерпевает конформационные изменения. Взаимодействие доменов 2 и 4, поддерживающее ограниченную (неактивную) конформацию рецептора, ослабляется, и устанавливается растянутая (активная) конформация. Растянутая конформация способствует димеризации с другими рецепторами-партнерами. Her2/ErbB2 является единственным исключением из этого общего правила, т.е. Her2-ECD конститутивно находится в растянутой конформации. На сегодняшний день не определен лиганд для Неr2.

[0005] Поскольку ErbB3 не обладает собственной киназной активностью, он должен димеризоваться с другим рецептором с активной тирозинкиназой, чтобы активироваться путем фосфорилирования тирозина. Димеризация может произойти между двумя различными рецепторами (гетеродимеризация), например ErbB3 и EGFR/HER1/ErbB1, Her2/ErbB2 или HER4/ErbB4. Недавно было также показано, что ErbB3 димеризуется с MET. После ассоциации с другим тирозинкиназным рецептором, ErbB3 активируется путем фосфорилирования по меньшей мере девяти остатков тирозина во внутриклеточном домене ErbB3, а затем быстро ассоциируется с адаптерами или молекулами нисходящего сигнального пути. Шесть фосфорилированных остатков тирозина ErbB3 ассоциируют непосредственно с р85-субъединицей фосфатидилинозитол-3-киназы (PIK3), что приводит к активации пути выживания клеток, который контролируется осью PI3K/Akt. Конститутивная активация ErbB3 путем нерегулируемой димеризации и/или нерегулируемого фосфорилирования ErbB3 может приводить к некоторым злокачественным опухолям.

[0006] Сверхэкспрессия ErbB3 связывается с плохим прогнозом при различных карциномах (например, раке молочной железы, яичника, предстательной железы, толстой кишки, поджелудочной железы, желудка, а также головы и шеи). Сверхэкспрессия ErbB3 также коррелирует с метастазами, от местных до удаленных, при раке легких, желудка и толстой кишки, а также костной инвазией при раке предстательной железы (Sithanandam et al., 2008, CANCER GENE THERAPY 15: 413). Сверхэкспрессию ErbB3 связали с устойчивостью к нескольким видам лечения рака, в том числе лечению ингибиторами тирозинкиназы EGFR при немелкоклеточном раке легких (NSCLC) и раке головы и шеи, лечению ингибитором Her2 злокачественных опухолей молочной желез и лечению лучевой терапией при злокачественных опухолях поджелудочной железы. Кроме того, сверхэкспрессию NRG, лиганда для ErbB3, также связали с устойчивостью к лечению ингибиторами тирозинкиназы EGFR. Chen et al. описывают применение моноклональных антител к ErbB3, которые ингибируют действие NRG, и демонстрируют активность ингибирвания роста в отношении клеток рака молочной железы и яичников (Chen et al., 1996, J. BIOL. CHEM. 271: 7620).

[0007] Существует потребность в улучшенных антителах к ErbB3, которые можно применять в качестве терапевтических средств.

КРАТКОЕ ОПИСАНИЕ

[0008] Настоящее изобретение основано на открытии семейства антител, которые специфически связывают ErbB3 человека. Антитела содержат сайты связывания ErbB3, основанные на CDR, которые специфически связывают ErbB3 человека. При использовании в качестве терапевтических средств, антитела разрабатывают, например, гуманизируют, для того, чтобы уменьшить или исключить иммунный ответ при введении пациенту-человеку.

[0009] Антитела, раскрытые в данном документе, предотвращают или ингибируют активацию ErbB3 человека. В некоторых вариантах осуществления антитела предотвращают связывание ErbB3 с лигандом, например, NRG/HRG, тем самым нейтрализуют биологическую активность ErbB3. В других вариантах осуществления антитела к ErbB3 ингибируют димеризацию ErbB3, тем самым нейтрализуют биологическую активность ErbB3. Антитела, раскрытые в данном документе, можно применять для ингибирования пролиферации опухолевых клеток in vitro или in vivo. При введении пациенту-человеку с раком (или животной модели, такой как мышиной модели) антитела ингибируют или уменьшают рост опухоли у пациента-человека (или животной модели).

[0010] Эти и другие аспекты и преимущества изобретения иллюстрируются следующими фигурами, подробным описанием и формулой изобретения. Используемое в данном документе "включая" означает без ограничения, а приведенные примеры не являются неограничивающими.

ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

[0011] Настоящее изобретение может быть более полно понято со ссылкой на следующие графические материалы.

[0012] ФИГ.1 (известный уровень техники) представляет собой схематическое изображение типичного антитела.

[0013] ФИГ.2 представляет собой схематическую диаграмму, показывающую аминокислотную последовательность полной вариабельной области тяжелой цепи иммуноглобулина антител, обозначенных как 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05. Аминокислотные последовательности для каждого антитела выравнены друг относительно друга, и гипервариабельные участки (CDR) (определение по Kabat), CDR1, CDR2 и CDR3, обозначены в рамках. Последовательности за пределами рамок представляют собой каркасные (FR) последовательности.

[0014] ФИГ.3 представляет собой схематическую диаграмму, показывающую последовательности CDR1, CDR2 и CDR3 (определение по Kabat) для каждой из последовательностей вариабельной области тяжелой цепи иммуноглобулина на фиг.2.

[0015] ФИГ.4 представляет собой схематическую диаграмму, показывающую аминокислотную последовательность полной вариабельной области легкой цепи иммуноглобулина антител 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05. Аминокислотные последовательности для каждого антитела выравнены друг относительно друга, и последовательности CDR1, CDR2 и CDR3 (определение по Kabat) обозначены в рамках. Последовательности за пределами рамок представляют собой каркасные (FR) последовательности.

[0016] ФИГ.5 представляет собой схематическую диаграмму, показывающую последовательности CDR1, CDR2 и CDR3 (определение по Kabat) для каждой из последовательностей вариабельной области легкой цепи иммуноглобулина на фиг.4.

[0017] ФИГ.6А и 6В представляют собой графики, обобщающие результаты эксперимента по измерению активности нейтрализации для антител отрицательного контроля (мышиный IgG (Δ)) и моноклональных антител к ErbB3: 04D01 (■), 12А07 (○), 18Н02 (◊), 22А02 (●) и 24С05 (□) в отношении ингибирования связывания NRG1-β1 с hErbB3 (ФИГ.6А) и по измерению усиленного связывания NRG1-β1 с rhErbB3 с помощью антитела mAb 09D03 к ErbB3 (▲) и 11G01 (*) (ФИГ.6В).

[0018] ФИГ.7 представляет собой график, обобщающий результаты эксперимента по измерению активности нейтрализации для антител отрицательного контроля (мышиный IgG) и моноклональных антител к ErbB3: 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 в отношении ингибирования связывания NRG1-α1 с rhErbB3.

[0019] ФИГ.8 представляет собой график, обобщающий результаты эксперимента по измерению распознавания на клеточной поверхности антителами к ErbB3 химерного белка Her2/3d2, экспрессированного на поверхности клеток СНО.

[0020] ФИГ.9 представляет собой график, обобщающий результаты эксперимента по измерению анти-пролиферативной активности для антител отрицательного контроля IgG (мышиный IgG (Δ)) и моноклональных антител к ErbB3: 04D01 (■), 09D03 (▼), 11G01 (♦), 12А07 (○), 18Н02 (◊), 22А02 (●) и 24С05 (□) в клетках BaF/3, экспрессирующих Her2 и ErbB3, в присутствии NRG1-β1.

[0021] ФИГ.10 представляет собой график, обобщающий результаты эксперимента по измерению анти-пролиферативной активности для моноклональных антител к ErbB3: 04D01 (■), 09D03 (▼), 11G01 (♦), 12А07 (○), 18Н02 (◊), 22А02 (●) и 24С05 (□) в клетках MCF7 в присутствии NRG1-β1.

[0022] ФИГ.11 представляет собой график, обобщающий результаты эксперимента по измерению анти-пролиферативной активности для антител отрицательного контроля (мышиный IgG) и моноклональных антител к ErbB3: 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 в клетках SKBR-3, обработанных 5 г/мл антител, в присутствии сыворотки.

[0023] ФИГ.12 представляет собой график, обобщающий результаты эксперимента по измерению активности ингибирования для антител отрицательного контроля IgG и моноклональных антител к ErbB3: 04D01, 09D03,11G01, 12А07,18Н02, 22А02 и 24С05 при фосфорилировании ErbB3, индуцированном NRG, в клетках SKBR-3. Также показаны контроли в отсутствие антитела/отсутствие лиганда и отсутствие антитела.

[0024] ФИГ.13А и 13В представляют собой графики, представляющие результаты эксперимента по измерению активности ингибирования для моноклональных антител к ErbB3: 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 при фосфорилировании Akt в ответ на NRG1-β1 в клетках MCF7 (ФИГ.13А) и в клетках DU145 (ФИГ.13В), определяемой с помощью ELISA. Также показаны контроли в отсутствие антитела/отсутствие лиганда и отсутствие антитела.

[0025] ФИГ.14 представляет собой график, обобщающий результаты эксперимента по измерению ингибирующей активности в отношении опухоли для моноклональных антител к ErbB3: 04D01 (Δ), 09D03 (*), 11G01 (□), 12А07 (▲), 18Н02 (●), 22А02 (■), 24С05 (○) и IgG-контроля человека (--■--), при дозе 20 мг/кг на ксенотрансплантатной модели опухоли поджелудочной железы ВхРС3 у SCID-мышей СВ17 (растворитель (контроль), PBS (♦)).

[0026] ФИГ.15 представляет собой схематическую диаграмму, показывающую аминокислотные последовательности полной вариабельной области тяжелой цепи 24С05 и полных вариабельных областей гуманизированных тяжелых цепей, обозначенных как Sh24C05 Hv3-7, Sh24C05 Hv3-11, Sh24C05 Hv3-11 N62S, Sh24C05 Hv3-21, Sh24C05 Hv3-23, Sh24C05 Hv3-30 и Hu24C05 HvA. Аминокислотные последовательности для каждой вариабельной области тяжелой цепи выравнены друг относительно друга, и гипервариабельные участки (CDR) (определение по Kabat), CDR1, CDR2 и CDR3, обозначены в рамках. Последовательности за пределами рамок представляют собой каркасные (FR) последовательности.

[0027] ФИГ.16 представляет собой схематическую диаграмму, показывающую аминокислотные последовательности полной вариабельной области легкой цепи 24С05 и полных вариабельных областей гуманизированных легких цепей, обозначенных как Sh24C05 Kv1-9, Sh24C05 Kv1-16, Sh24C05 Kv1-17, Sh24C05 Kv1-33, Sh24C05 Kv1-39 и Hu24C05 KvA. Аминокислотные последовательности для каждого вариабельной области легкой цепи выравнены друг относительно друга, и последовательности CDR1, CDR2 и CDR3 (определение по Kabat) обозначены в рамках. Последовательности за пределами рамок представляют собой каркасные (FR) последовательности.

[0028] ФИГ.17 представляет собой сенсограммы Biacore, представляющие результаты эксперимента по измерению кинетических значений для моноклональных антител к ErbB3: Sh24C05-31 N62S-IgG1, Ab#6, U1-53 и U1-59.

[0029] ФИГ.18А представляет собой график, обобщающий результаты эксперимента по измерению активности нейтрализации для антител отрицательного контроля (IgG человека (□)) и моноклональных антител к ErbB3: Sh24C05-25 N62S-IgG1 (▲), Sh24C05-25 N62S-IgG2 (Δ), Sh24C05-31 N62S-IgG1 (●) и Sh24C05-31 N62S-IgG2 (○). ФИГ.18В представляет собой график, обобщающий результаты эксперимента по измерению активности нейтрализации для IgG человека (□) и моноклональных антител к ErbB3 Ab#6 IgG2 (▼), U1-53 (◊) и U1-59 (■).

[0030] ФИГ.19А представляет собой график, обобщающий результаты эксперимента по измерению активности ингибирования для антител отрицательного контроля (IgG человека (□)) и моноклональных антител к ErbB3: Sh24C05-25 N62S-IgG1 (▲), Sh24C05-25 N62S-IgG2 (Δ), Sh24C05-31 N62S-IgG1 (●) и Sh24C05-31 N62S-IgG2 (○) в клетках BaF/3, экспрессирующих Her2 и ErbB3, в присутствии NRG1-β1. ФИГ.19В представляет собой график, обобщающий результаты эксперимента по измерению ингибирующей активности для IgG человека (○) и моноклональных антител к ErbB3: Sh24C05-31 N62S-IgG1 (●), Ab#6 IgG2 (▼), U1-53 (◊) и U1-59 (■) в клетках BaF/3, экспрессирующих Her2 и ErbB3, в присутствии NRG1-β1.

[0031] ФИГ.20 представляет собой график, обобщающий результаты эксперимента по измерению активности ингибирования для антител отрицательного контроля (IgG человека) и моноклональных антител к ErbB3: Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 и Sh24C05-31 N62S-IgG2 при устойчивом фосфорилировании ErbB3 в растущих клетках SKBR-3.

[0032] ФИГ. 21 представляет собой график, обобщающий результаты эксперимента по измерению разрушения рецептора ErbB3 с помощью антител отрицательного контроля (IgG человека) и моноклональных антител к ErbB3: Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 и Sh24C05-31 N62S-IgG2 в растущих клетках SKBR-3.

[0033] ФИГ.22 представляет собой график, обобщающий результаты эксперимента по измерению активности ингибирования в отношении опухоли для IgG человека, IgG мыши или моноклональных антител к ErbB3 при дозе 2 мг/кг на ксенотрансплантатной модели опухоли поджелудочной железы ВхРС3 у SCID-мышей СВ17 (мышиные 24С05 (Δ), Sh24C05-31 N62S IgG1 (●), Sh24C05-31 N62S IgG2 (♦), Sh24C05-25 N62S IgG1 (▲), Sh24C05-25 N62S IgG2 (■), растворитель (контроль) (a), IgG мыши (х) и IgG человека (◊)).

[0034] ФИГ.23А представляет собой график, обобщающий результаты эксперимента по измерению активности ингибирования в отношении опухоли для IgG мыши или моноклональных антител к ErbB3 при дозе 5 мг/кг на ксенотрансплантатной модели немелкоклеточного рака легкого Calu-3 у голых мышей NCR (растворитель (контроль) (□), IgG мыши (х), Sh24C05-31 N62S IgG1 (▲), Ab#6 IgG2 (●) и U1-59 (■)).

[0035] ФИГ.23В представляет собой график, обобщающий результаты эксперимента по измерению активности ингибирования в отношении опухоли для IgG мыши или моноклональных антител к ErbB3 при дозе 10 мг/кг на ксенотрансплантатной модели немелкоклеточного рака легкого Calu-3 у голых мышей NCR (растворитель (контроль) (□), IgG мыши (х), Sh24C05-31 N62S IgG1 (▲), Ab#6 IgG2 (●) и U1-59 (■)).

[0036] ФИГ.23С представляет собой график, обобщающий результаты эксперимента по измерению активности ингибирования в отношении опухоли для IgG мыши или моноклональных антител к ErbB3 при дозе 20 мг/кг на ксенотрансплантатной модели немелкоклеточного рака легкого Calu-3 у голых мышей NCR (растворитель (контроль) (□), IgG мыши (х), Sh24C05-31 N62S IgG1 (▲), Ab#6 IgG2 (●) и U1-59 (■)).

[0037] ФИГ.24 представляет собой график, обобщающий результаты эксперимента по измерению активности ингибирования в отношении опухоли для IgG человека, мыши или моноклональных антител к ErbB3 в MDA-MB-453 на ксенотрансплантатной модели рака молочной железы у SCID-мышей NOD (растворитель (контроль) (□), IgG человека (х), Sh24C05-31 N62S IgG1 при дозе 5 мг/кг (◊), Sh24C05-31 N62S IgG1 при дозе 10 мг/кг (Δ), Sh24C05-31 N62S IgG1 при дозе 20 мг/кг (▲), Ab#6 IgG2 при дозе 10 мг/кг (●) и U1-59 при дозе 10 мг/кг (■)).

ПОДРОБНОЕ ОПИСАНИЕ

[0038] Антитела к ErbB3, раскрытые в данном документе, основаны на антиген-связывающих сайтах определенных моноклональных антител, отобранных за их способность нейтрализовать биологическую активность полипептидов ErbB3 человека. Антитела содержат последовательности CDR вариабельных областей иммуноглобулина, которые определяют связывающий сайт для ErbB3. В некоторых вариантах осуществления антитела предотвращают связывание ErbB3 с лигандом, например, NRG/HRG, тем самым нейтрализуя биологическую активность ErbB3. В других вариантах осуществления антитела к ErbB3 ингибируют димеризацию ErbB3, тем самым нейтрализуя биологическую активность ErbB3. В других вариантах осуществления антитела к ErbB3 ингибируют фосфорилирование ErbB3 и нисходящий сигнальный путь.

[0039] В связи с нейтрализующей активностью этих антител они пригодны для ингибирования роста и/или пролиферации определенных раковых клеток и опухолей. Антитела можно разрабатывать так, чтобы минимизировать или устранить иммунный ответ при введении пациенту-человеку. В некоторых вариантах осуществления антитела сливают или конъюгируют с другими фрагментами, такими как детектирумые метки или эффекторные молекулы, такие как низкомолекулярных токсинов.

I. Антитела, которые связывают ErbB3

[0040] В некоторых вариантах осуществления антитело включает: (а) вариабельную область тяжелой цепи иммуноглобулина, содержащую структуру CDRH1-CDRH2-CDRH3 и (b) вариабельную область легкой цепи иммуноглобулина, где вариабельная область тяжелой цепи и вариабельная область легкой цепи вместе определяют единый связывающий сайт для связывания ErbB3 человека. CDRm включает аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 5 (04D01), SEQ ID NO: 15 (09D03), SEQ ID NO: 25 (11G01), SEQ ID NO: 34 (12A07), SEQ ID NO: 41 (18H02), SEQ ID NO: 51 (22A02), SEQ ID NO: 57 (24C05) и SEQ ID NO: 75 (24C05); CDRH2 включает аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 6 (04D01), SEQ ID NO: 16 (09D03), SEQ ID NO: 26 (11G01), SEQ ID NO: 35 (12A07), SEQ ID NO: 42 (18H02), SEQ ID NO: 52 (22A02), SEQ ID NO: 58 (24C05) и SEQ ID NO: 148 (Sh24C05 Hv3-11 N62S), и CDRH3 включает аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 7 (04D01), SEQ ID NO: 17 (09D03), SEQ ID NO: 27 (11G01), SEQ ID NO: 36 (12A07, 22A02), SEQ ID NO: 43 (18H02) и SEQ ID NO: 59 (24C05). Всюду в описании за конкретным SEQ ID NO. следует в скобках антитело, которое дало начало этой последовательности. Например, "SEQ ID NO: 5 (04D01)" означает, что SEQ ID NO: 5 происходит от антитела 04D01.

[0041] В некоторых вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, содержащий аминокислотную последовательность SEQ ID NO: 5 (04D01), CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 6 (04D01), и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 7 (04D01).

[0042] В некоторых вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, который содержит аминокислотную последовательность SEQ ID NO: 15 (09D03), CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 16 (09D03), и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 17 (09D03).

[0043] В некоторых вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, который содержит аминокислотную последовательность SEQ ID NO: 25 (11G01), CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 26 (11G01), и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 27 (11G01).

[0044] В некоторых вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, который содержит аминокислотную последовательность SEQ ID NO: 34 (12А07), CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 35 (12А07), и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 36 (12А07, 22А02).

[0045] В некоторых вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, который содержит аминокислотную последовательность SEQ ID NO: 41 (18Н02), CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 42 (18Н02), и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 43 (18Н02).

[0046] В некоторых вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, который содержит аминокислотную последовательность SEQ ID NO: 51 (22А02), CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 52 (22А02), и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 36 (12А07, 22А02).

[0047] В некоторых вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, который содержит аминокислотную последовательность SEQ ID NO: 57 (24С05) или SEQ ID NO: 75 (24C05), CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 58 (24С05), и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 59 (24С05).

[0048] В некоторых вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, который содержит аминокислотную последовательность SEQ ID NO: 57 (24С05), CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 58 (24C05), и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 59 (24C05).

[0049] В других вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, который содержит аминокислотную последовательность SEQ ID NO: 75 (24C05), CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 58 (24C05), и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 59 (24C05).

[0050] В определенных вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, который содержит аминокислотную последовательность SEQ ID NO: 57 (24C05) или SEQ ID NO: 75 (24C05), CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 148 (Sh24C05 Hv3-11 N62S), и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 59 (24C05).

[0051] Предпочтительно, последовательности CDRH1, CDRH2 и CDRH3 помещаются между FR иммуноглобулина человека или гуманизированными FR иммуноглобулина. Антитело может представлять собой интактное антитело или антиген-связывающий фрагмент антитела.

[0052] В некоторых вариантах осуществления антитело содержит (а) вариабельную область легкой цепи иммуноглобулина, включающую структуру CDRL1-CDRL2-CDRL3, и (b) вариабельную область тяжелой цепи иммуноглобулина, где вариабельная область легкой цепи IgG и вариабельная область тяжелой цепи IgG совместно определяют единый связывающий сайт для связывания ErbB3 человека. CDRL1 содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 8 (04D01, 12А07, 22А02), SEQ ID NO: 18 (09D03), SEQ ID NO: 28 (11G01), SEQ ID NO: 44 (18H02) и SEQ ID NO: 60 (24C05); CDRL2 содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 9 (04D01, 11G01, 12А07, 22А02), SEQ ID NO: 19 (09D03), SEQ ID NO: 45 (18H02) и SEQ ID NO: 61 (24C05); и CDRL3 содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 10 (04D01, 12А07, 22А02), SEQ ID NO: 20 (09D03), SEQ ID NO: 29 (11G01), SEQ ID NO: 46 (18H02) и SEQ ID NO: 62 (24C05).

[0053] В некоторых вариантах осуществления антитело содержит вариабельную область легкой цепи иммуноглобулина, включающую: CDRL1, который содержит аминокислотную последовательность SEQ ID NO: 8 (04D01, 12А07, 22А02); CDRL2, который содержит аминокислотную последовательность SEQ ID NO: 9 (04D01, 11G01, 12А07, 22А02); и CDRL3, который содержит аминокислотную последовательность SEQ ID NO: 10 (04D01, 12А07, 22А02).

[0054] В некоторых вариантах осуществления антитело содержит вариабельную область легкой цепи иммуноглобулина, содержащую: CDRL1, который содержит аминокислотную последовательность SEQ ID NO: 18 (09D03); CDRL2, который содержит аминокислотную последовательность SEQ ID NO: 19 (09D03); и CDRL3, который содержит аминокислотную последовательность SEQ ID NO: 20 (09D03).

[0055] В некоторых вариантах осуществления антитело содержит вариабельную область легкой цепи иммуноглобулина, содержащую: CDRL1, который содержит аминокислотную последовательность SEQ ID NO: 28 (11G01); CDRL2, который содержит аминокислотную последовательность SEQ ID NO: 9 (04D01, 11G01, 12А07, 22А02); и CDRL3, который содержит аминокислотную последовательность SEQ ID NO: 29 (11G01).

[0056] В некоторых вариантах осуществления антитело содержит вариабельную область легкой цепи иммуноглобулина, содержащую: CDRL1, который содержит аминокислотную последовательность SEQ ID NO: 44 (18Н02); CDRL2, который содержит аминокислотную последовательность SEQ ID NO: 45 (18Н02); и CDRL3, который содержит аминокислотную последовательность SEQ ID NO: 46 (18Н02).

[0057] В одном варианте осуществления антитело содержит вариабельную область легкой цепи иммуноглобулина, содержащую: CDRL1, который содержит аминокислотную последовательность SEQ ID NO: 60 (24С05); CDRL2, который содержит аминокислотную последовательность SEQ ID NO: 61 (24С05); и CDRL3, который содержит аминокислотную последовательность SEQ ID NO: 62 (24С05).

[0058] Предпочтительно, последовательности CDRL1, CDRL2, и CDRL3 помещаются между FR иммуноглобулина человека или гуманизированными FR иммуноглобулина. Антитело может представлять собой интактное антитело или антиген-связывающий фрагмент антитела.

[0059] В некоторых вариантах осуществления антитело включает: (а) вариабельную область тяжелой цепи IgG, содержащую структуру CDRH1-CDRH2-CDRH3 и (b) вариабельную область легкой цепи IgG, содержащую структуру CDRL1-CDRL2-CDRL3, где вариабельная область тяжелой цепи IgG и вариабельная область легкой цепи IgG совместно определяют единый связывающий сайт для связывания ErbB3 человека. CDRH1 является аминокислотной последовательностью, выбранной из группы, состоящей из SEQ IDNO: 5 (04D01), SEQ ID NO: 15 (09D03), SEQ ID NO: 25 (11G01), SEQ ID NO: 34 (12A07), SEQ ID NO: 41 (18H02), SEQ ID NO: 51 (22A02), SEQ ID NO: 57 (24C05) и SEQ ID NO: 75 (24C05); CDRH2 является аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 6 (04D01), SEQ ID NO: 16 (09D03), SEQ ID NO: 26 (11G01), SEQ ID NO: 35 (12A07), SEQ ID NO: 42 (18H02), SEQ ID NO: 52 (22A02), SEQ ID NO: 58 (24C05) и SEQ ID NO: 148 (Sh24C05 Hv3-11 N62S); и CDRH3 является аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 7 (04D01), SEQ ID NO: 17 (09D03), SEQ ID NO: 27 (11G01), SEQ ID NO: 36 (12A07, 22A02), SEQ ID NO: 43 (18H02) и SEQ ID NO: 59 (24C05). CDRL1 является аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 8 (04D01, 12A07, 22A02), SEQ ID NO: 18 (09D03), SEQ ID NO: 28 (11G01), SEQ ID NO: 44 (18H02) и SEQ ID NO: 60 (24C05); CDRb2 является аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 9 (04D01, 11G01, 12A07, 22A02), SEQ ID NO: 19 (09D03), SEQ ID NO: 45 (18H02) и SEQ ID NO: 61 (24C05); и CDRL2 является аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 10 (04D01, 12A07, 22A02), SEQ ID NO: 20 (09D03), SEQ ID NO: 29 (11G01), SEQ ID NO: 46 (18H02) и SEQ ID NO: 62 (24C05).

[0060] В других вариантах осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, выбранную из группы, состоящей из SEQ ID NO: 2 (04D01), SEQ ID NO: 12 (09D03), SEQ ID NO: 22 (11G01), SEQ ID NO: 31 (12A07), SEQ ID NO: 38 (18H02), SEQ ID NO: 48 (22A02), SEQ ID NO: 54 (24C05) и SEQ ID NO: 154 (Sh24C05 Hv3-11 N62S), и вариабельную область легкой цепи иммуноглобулина, выбранную из группы, состоящей из SEQ ID NO: 4 (04D01), SEQ ID NO: 14 (09D03), SEQ ID NO: 24 (11G01), SEQ ID NO: 33 (12A07), SEQ ID NO: 40 (18H02), SEQ ID NO: 50 (22A02), SEQ ID NO: 56 (24C05), SEQ ID NO: 166 (Sh24C05 Kv1-16) и SEQ ID NO: 168 (Sh24C05 Kv1-17).

[0061] В другом варианте осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 2 (04D01), и вариабельную область легкой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 4 (04D01).

[0062] В другом варианте осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 12 (09D03), и вариабельную область легкой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 14 (09D03).

[0063] В другом варианте осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 22 (11G01), и вариабельную область легкой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 24 (11G01).

[0064] В другом варианте осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 31 (12А07), и вариабельную область легкой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 33 (12А07).

[0065] В другом варианте осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 38 (18Н02), и вариабельную область легкой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 40 (18Н02).

[0066] В другом варианте осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 48 (22А02), и вариабельную область легкой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 50 (22А02).

[0067] В другом варианте осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 54 (24С05), и вариабельную область легкой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 56 (24С05).

[0068] В другом варианте осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 154 (Sh24C05 Hv3-11 N62S), и вариабельную область легкой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 166 (Sh24C05 Kv1-16).

[0069] В другом варианте осуществления антитело содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 154 (Sh24C05 Hv3-11 N62S), и вариабельную область легкой цепи иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 168 (Sh24C05 Kv1-17).

[0070] В других вариантах осуществления антитело содержит (i) тяжелую цепь иммуноглобулина, выбранную из группы, состоящей из SEQ ID NO: 109 (04D01), SEQ ID NO: 113 (09D03), SEQ ID NO: 117 (11G01), SEQ ID NO: 121 (12А07), SEQ ID NO: 125 (18Н02), SEQ ID NO: 129 (22A07), SEQ ID NO: 133 (24C05), SEQ ID NO: 190 (Sh24C05 Hv3-11 N62S IgG1) и SEQ ID NO: 192 (Sh24C05 Hv3-11 N62S IgG2), и (ii) легкую цепь иммуноглобулина, выбранную из группы, состоящей из SEQ ID NO: 111 (04D01), SEQ ID NO: 115 (09D03), SEQ ID NO: 119 (11G01), SEQ ID NO: 123 (12A07), SEQ ID NO: 127 (18Н02), SEQ ID NO: 131 (22A07), SEQ ID NO: 135 (24C05), SEQ ID NO: 204 (Sh24C05 Kv1-16 kappa) и SEQ ID NO: 206 (Sh24C05 Kv1-17 kappa).

[0071] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 109 (04D01), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 111 (04D01).

[0072] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 113 (09D03), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 115 (09D03).

[0073] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 117 (11G01), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 119 (11G01).

[0074] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 121 (12A07), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ IDNO: 123 (12A07).

[0075] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 125 (18Н02), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 127 (18Н02).

[0076] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 129 (22А02), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 131 (22А02).

[0077] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 133 (24С05), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 135 (24С05).

[0078] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 190 (Sh24C05 Hv3-11 N62S IgG1), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 204 (Sh24C05 Kv1-16 kappa).

[0079] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 192 (Sh24C05 Hv3-11 N62S IgG2), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 204 (Sh24C05 Kv1-16 kappa).

[0080] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 190 (Sh24C05 Hv3-11 N62S IgG1), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 206 (Sh24C05 Kv1-17 kappa).

[0081] В другом варианте осуществления антитело содержит тяжелую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 192 (Sh24C05 Hv3-11 N62S IgG2), и легкую цепь иммуноглобулина, содержащую аминокислотную последовательность SEQ ID NO: 206 (Sh24C05 Kv1-17 kappa).

[0082] Как употребляется в данном документе, если не указано иное, выражение "антитело" означает интактное антитело (например, интактное моноклональное антитело), или антиген-связывающий фрагмент антитела (например, антиген-связывающий фрагмент моноклонального антитела), в том числе интактное антитело или антиген-связывающий фрагмент, который был изменен, разработан или химически конъюгирован. Примеры антител, которые были изменены или разработаны, включают химерные антитела, гуманизированные антитела и мультиспецифичные антитела (например, биспецифичные антитела). Примеры антиген-связывающих фрагментов включают Fab, Fab', (Fab')2, Fv, одноцепочечные антитела (например, ScFv), минитела и диатела. Примером химически конъюгированного антитела является антитело, конъюгированное с фрагментом-токсином.

[0083] На фигуре 1 показано схематическое изображение интактного моноклонального антитела, которое содержит четыре полипептидные цепи. Две из полипептидных цепей называются тяжелыми цепями иммуноглобулина (Н-цепи), и две из полипептидных цепей называются легкими цепями иммуноглобулина (L-цепи). Тяжелые и легкие цепи иммуноглобулина соединяются межцепочечными дисульфидными связями. Тяжелые цепи иммуноглобулина связаны межцепочечными дисульфидными связями. Легкая цепь состоит из одной вариабельной области (VL на ФИГ.1) и одной константной области (CL на ФИГ.1). Тяжелая цепь состоит из одной вариабельной области (VH на ФИГ.1) и по меньшей мере трех константных областей (CH1, CH2 и СН3 на ФИГ.1). Вариабельные области определяют специфичность антитела.

[0084] Каждая вариабельная область содержит три гипервариабельных участка, известные как определяющие комплементарность участки (CDR), фланкированные четырьмя относительно консервативными областями, известными как каркасные области (FR). Три CDR, называемые CDR1, CDR2 и CDR3, способствуют связывающей специфичности антитела.

[0085] В некоторых вариантах осуществления выделенное антитело, которое связывает ErbB3 человека, содержит вариабельную область тяжелой цепи иммуноглобулина, содержащую аминокислотную последовательность, которая по меньшей мере на 70%, 75%, 80%, 85%, 90%, 95%, 98% или на 99% идентична последовательности всей вариабельной области или каркасной области SEQ ID NO: 2 (04D01), SEQ ID NO: 12 (09D03), SEQ ID NO: 22 (11G01), SEQ ID NO: 31 (12A07), SEQ ID NO: 38 (18H02), SEQ ID NO: 48 (22A02), SEQ ID NO: 54 (24C05) и SEQ ID NO: 154 (Sh24C05 Hv3-11 N62S).

[0086] В некоторых вариантах осуществления выделенное антитело, которое связывает ErbB3 человека, содержит вариабельную область легкой цепи иммуноглобулина, содержащую аминокислотную последовательность, которая по меньшей мере на 70%, 75%, 80%, 85%, 90%, 95%, 98% или на 99% идентична последовательности всей вариабельной области или каркасной области SEQ ID NO: 4 (04D01), SEQ ID NO: 14 (09D03), SEQ ID NO: 24 (11G01), SEQ ID NO: 33 (12A07), SEQ ID NO: 40 (18H02), SEQ ID NO: 50 (22A02), SEQ ID NO: 56 (24C05), SEQ ID NO: 166 (Sh24C05 Kv1-16) и SEQ ID NO: 168 (Sh24C05 Kv1-17).

[0087] В каждом из вышеизложенных вариантов осуществления в данном документе предполагается, что последовательности вариабельной области тяжелой цепи иммуноглобулина и/или последовательности вариабельной области легкой цепи, которые вместе связывают ErbB3 человека, могут содержать аминокислотные изменения (например, по меньшей мере 1, 2, 3, 4, 5 или 10 аминокислотных замен, делеций или добавлений) в каркасных областях вариабельных областей тяжелой и/или легкой цепи.

[0088] В некоторых вариантах осуществления выделенное антитело связывает hErbB3 с KD из 350 пМ, 300 пМ, 250 пМ, 200 пМ, 150 пМ, 100 пМ, 75 пМ, 50 пМ, 20 пМ, 10 пМ или ниже. Если не указано иное, значения KD определяются способами поверхностного плазмонного резонанса. Способы поверхностного плазмонного резонанса можно осуществлять с использованием условий, описанных, например, в примерах 3 и 12, где измерения осуществляли при температуре 25°С и 37°С, соответственно.

[0089] В некоторых вариантах осуществления антитела ингибируют связывание hErbB3 с NRG1-β1. Например, антитела могут иметь IC50 (концентрация из расчета 50% максимального ингибирования) около 5 нМ, 2 нМ или меньше, при анализе с использованием протоколов, описанных в примерах 4 и 13.

II. Получение антител

[0090] Способы получения антител, раскрытые в данном документе, известны в настоящем уровне техники. Например, молекулы ДНК, кодирующие вариабельные области легкой цепи и вариабельные области тяжелой цепи, можно синтезировать химически с использованием информации о последовательности, приведенной в данном документе. Синтетические молекулы ДНК можно пришивать к другим соответствующими нуклеотидными последовательностями, в том числе, например, последовательностям, кодирующим константную область, и последовательностям контроля экспрессии, для получения обычных конструктов экспрессии генов, кодирующих требуемые антитела. Производство определенных генных конструктов является стандартным для данной области. Кроме того, последовательности, представленные в данном документе, можно клонированы из гибридом обычными методиками гибридизации или методиками полимеразной цепной реакции (ПЦР) с использованием синтетических зондов нуклеиновых кислот, последовательности которых основываются на информации о последовательности, представленной в настоящем документе, или информации о последовательности предшествующего уровня техники относительно генов, кодирующих тяжелые и легкие цепи антител мыши в клетках гибридом.

[0091] Нуклеиновые кислоты, кодирующие антитела, описанные в данном документе, можно внедрять (пришивать) в векторы экспрессии, которые можно вводить в клетки-хозяева с помощью обычных методик трансфекции или трансформации. Иллюстративными клетками-хозяевами являются клетки Е.coli, клетки яичника китайского хомячка (СНО), клетки HeLa, клетки почки новорожденного хомячка (ВНК), клетки почек обезьян (COS), клетки человеческой гепатоцеллюлярной карциномы (например, Нер G2) и клетки миеломы, которые в других случаях не производят белок IgG. Трансформированные клетки-хозяева можно выращивать в условиях, которые позволяют клеткам-хозяевам экспрессировать гены, которые кодируют вариабельные области легкой и/или тяжелой цепи иммуноглобулина.

[0092] Условия специфической экспрессии и очистки будут меняться в зависимости от задействованной системы экспрессии. Например, если ген должен быть экспрессирован в Е.coli, его сначала клонируют в вектор экспрессии путем размещения разработанного гена ниже подходящего бактериального промотора, например, Trp или Тас, и прокариотической сигнальной последовательности. Экспрессированный выделенный белок накапливается в плотных телах или включениях, и может быть собран после разрушения клеток френч-прессом или ультразвуком. Плотные тела затем солюбилизуют, и белки подвергаются рефолдингу и расщеплению способами, известными в данной области.

[0093] Если ДНК-конструкт, кодирующий антитело, раскрытое данном документе, должен экспрессироваться в эукариотических клетках-хозяевах, например клетках СНО, то сначала его встраивают в вектор экспрессии, содержащий подходящий эукариотический промотор, сигнал секреции, энхансеры IgG и различные интроны. Такой вектор экспрессии факультативно содержит последовательности, кодирующие полностью или частично константную область, что позволяет экспрессировать, полностью или частично, тяжелую и/или легкую цепи. В некоторых вариантах осуществления один вектор экспрессии содержит вариабельные области и тяжелых и легких цепей, которые требуется экспрессировать.

[0094] Генный конструкт можно вводить в эукариотические клетки-хозяева с использованием обычных методик. Клетки-хозяева экспрессируют VL- или VH-фрагменты, VL-VH-гетеродимеры, VH-VL или VL-VH одноцепочечные полипептиды, полные тяжелые или легкие цепи иммуноглобулинов, или их части, причем каждый из них можно присоединять к фрагменту, имеющему другую функцию (например, цитотоксичность). В некоторых вариантах осуществления клетку-хозяина трансфицируют одним вектором, экспрессирующим полипептид, экспрессирующий полностью или частично тяжелую цепь (например, вариабельную область тяжелой цепи) или легкую цепь (например, вариабельную область легкой цепи). В других вариантах осуществления клетку-хозяина трансфицируют одним вектором, кодирующим (a) полипептид, содержащий вариабельную область тяжелой цепи и полипептид, содержащий вариабельную область легкой цепи, или (b) всю тяжелую цепь иммуноглобулина и всю легкую цепь иммуноглобулина. В еще одних вариантах осуществления клетку-хозяина котрансфицируют более чем одним вектором экспрессии (например, один вектор экспрессии экспрессирует полипептид, включающий полностью или частично тяжелую цепь или вариабельную область тяжелой цепи, а другой вектор экспрессии экспрессирует полипептид, включающий полностью или частично, легкую цепь или вариабельную область легкой цепи).

[0095] Способ получения полипептида, содержащего вариабельную область тяжелой цепи иммуноглобулина, или полипептида, содержащего вариабельную область легкой цепи иммуноглобулина, может включать выращивание клетки-хозяина, трансфицированной вектором экспрессии, при условиях, которые допускают экспрессию полипептида, содержащего вариабельную область тяжелой цепи иммуноглобулина, или полипептида, содержащего вариабельную область легкой цепи иммуноглобулина. Полипептид, содержащий вариабельную область тяжелой цепи иммуноглобулина, или полипептид, содержащий вариабельную область легкой цепи иммуноглобулина, потом можно очищать с помощью методов, хорошо известных в данной области, например, аффинных маркеров, таких как глутатион-S-трансфераза (GST) и гистидиновых маркеров.

[0096] Способ получения моноклонального антитела, которое связывает ErbB3 человека, или антиген-связывающего фрагмента антитела может включать выращивание клетки-хозяина, трансфицированной: (a) вектором экспрессии, который кодирует полностью или частично тяжелую цепь иммуноглобулина, и отдельный вектор экспрессии, кодирующий полностью или частично легкую цепь иммуноглобулина, или (b) одним вектором экспрессии, который кодирует обе цепи (например, полные или частичные цепи), при условиях, которые допускают экспрессию обоих цепей. Интактное антитело (или антиген-связывающий фрагмент) можно собирать и очищать с помощью методов, хорошо известных в данной области, например, белка А, белка G, аффинных маркеров, таких как глутатион-S-трансфераза (GST) и гистидиновые маркеры. В пределах обычной практики в данной области экспрессировать тяжелую цепь и легкую цепь из одного вектора экспрессии или из двух отдельных векторов экспрессии.

III. Модификации антител

[0097] Способы уменьшения или исключения антигенности антител и фрагментов антител известны в уровне техники. Если антитела следует вводить человеку, антитела предпочтительно "гуманизируют" для уменьшения или исключения антигенности у людей. Предпочтительно гуманизированное антитело имеет такую же или практически такую же аффинность к антигену, как негуманизированное антитело мыши, из которого оно было получено.

[0098] В одном из подходов гуманизации создаются химерные белки, в которых константные области иммуноглобулина мыши замещают на константные области иммуноглобулина человека. См., например, Morrison et al., 1984, proc. nat. acad. Sci. 81: 6851-6855, Neuberger et al., 1984, nature 312: 604-608; патенты США №№.6893625 (Robinson); 5500362 (Robinson) и 4816567 (Cabilly).

[0100] В подходе, известном как пересадка CDR, CDR вариабельных областей легкой и тяжелой цепей пересаживают в каркасы от другого вида. Например, мышиные CDR можно пересаживать в человеческие FR. В некоторых вариантах осуществления CDR вариабельных областей легкой и тяжелой цепи антитела к ErbB3 пересаживают на FR человека или на консенсусные FR человека. Чтобы создать консенсусные FR человека, FR из нескольких аминокислотных последовательностей тяжелой цепи или легкой цепи человека выравнивают для определения консенсусной аминокислотной последовательности. Пересадки CDR описаны в патентах США №№7022500 (Queen); 6982321 (Winter); 6180370 (Queen); 6054297 (Carter); 5693762 (Queen); 5859205 (Adair); 5693761 (Queen); 5565332 (Hoogenboom); 5585089 (Queen); 5530101 (Queen); Jones et al. (1986) nature 321: 522-525; Riechmann et al. (1988) nature 332: 323-327; Verhoeyen et al. (1988) science 239: 1534-1536 и Winter (1998) FEBS lett 430: 92-94.

[0101] В подходе, называемом "SUPERHUMANIZATION™", последовательности CDR человека выбирают из генов зародышевой линии человека на основе структурного сходства CDR человека с таковыми антитела мыши, которое будут гуманизировать. См., например, патент США №6881557 (Foote) и Tan et al., 2002, J. Immunol 169: 1119-1125.

[0102] Другие способы снижения иммуногенности включают "реконструирование", "гиперхимеризацию" и "облицовку/изменение поверхности". См., например, Vaswami et al., 1998, ANNALS OF ALLERGY, ASTHMA, & IMMUNOL. 81: 105; Roguska et al., 1996, PROT. ENGINEER 9: 895-904 и патент США №6072035 (Hardman). В подходе облицовки/изменения поверхности поверхностно доступные аминокислотные остатки в антителе мыши замещают аминокислотными остатками, которые чаще обнаруживают в тех же положениях в антителе человека. Этот тип изменения поверхности антител описывается, например, в патенте США №5639641 (Pedersen).

[0103] Другой подход для преобразования антител мыши в форму, пригодную для медицинского применения на людях, известен как ACTIVMAB™ технология (Vaccinex, Inc, Рочестер, Нью-Йорк), которая включает в себя вектор, основанный на вирусе коровьей оспы, для экспрессии антител в клетках млекопитающих. Как утверждается, при этом производятся высокие уровни комбинаторного разнообразия тяжелых и легких IgG цепей. См., например, патенты США №6706477 (Zauderer), 6800442 (Zauderer) и 6872518 (Zauderer).

[0104] Другим подходом для преобразования антитела мыши в форму, пригодную для применения на людях, является технология, которую коммерчески применяет на практике KaloBios Pharmaceuticals, Inc (Пало-Альто, Калифорния). Эта технология включает в себя использование собственной библиотеки "акцепторов" человека для получения "эпитоп-сфокусированной" библиотеки для отбора антител.

[0105] Другим подходом для модифицирования антитела мыши в форму, пригодную для медицинского применения на людях, является технология HUMAN ENGINEERING™, которую коммерчески применяет на практике ХОМА (US) LLC. См., например, РСТ публикацию №WO 93/11794 и патенты США №№5766886, 5770196, 5821123 и 5869619.

[0106] Любой подходящий подход, в том числе любой из вышеперечисленных подходов, можно использовать для снижения или исключения иммуногенности для человека антитела, раскрытого в данном документе.

[0107] Способы получения мультиспецифичных антител известны в настоящем уровне техники. Мультиспецифичные антитела включают биспецифичные антитела. Биспецифичные антитела представляют собой антитела, которые имеют связывающие специфичности в отношении по меньшей мере двух различных эпитопов. Иллюстративные биспецифические антитела связываются с двумя различными эпитопами интересующего антигена. Биспецифичные антитела можно получать в виде антител полной длины или фрагментов антитела (например, F(ab')2 биспецифичные антитела и диатела), как описывается, например, в Milstein et al., NATURE 305: 537-539 (1983), WO 93/08829, Traunecker et al., EMBO J., 10: 3655-3659 (1991), WO 94/04690, Suresh et al., METHODS IN ENZYMOLOGY, 121: 210 (1986), WO 96/27011, Brennan et al., SCIENCE, 229: 81 (1985), Shalaby et al., J. EXP. MED., 175: 217-225 (1992), Kostelny et al., J. IMMUNOL., 148(5): 1547-1553 (1992), Hollinger et al., PNAS, 90: 6444-6448, Gruber et al., J. IMMUNOL., 152: 5368 (1994), Wu et al., NAT. BIOTECHNOL., 25(11): 1290-1297, патентной публикации США №2007/0071675 и Bostrom et al., SCIENCE 323: 1640-1644 (2009).

[0108] В некоторых вариантах осуществления антитело конъюгируют с эффекторным средством, таким как низкомолекулярный токсин или радионуклид, с использованием стандартной in vitro конъюгационной химии. Если эффекторное средство представляет собой полипептид, антитело можно химически конъюгировать с эффектором или присоединять к эффектору в виде слитого белка. Конструирование слитых белков находится в пределах обычной практики в данной области.

IV. Применение антител

[0109] Антитела, раскрытые в данном документе, можно применять для лечения различных форм рака, например рака молочной железы, яичника, предстательной железы, шейки матки, прямой кишки, легкого (например, немелкоклеточного рака легкого), поджелудочной железы, желудка, кожи, почки, головы и шеи и невриномы. Раковые клетки подвергают воздействию терапевтически эффективного количества антитела, чтобы ингибировать или уменьшить пролиферацию раковых клеток. В некоторых вариантах осуществления антитела ингибируют пролиферацию раковых клеток по меньшей мере на 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% или 100%.

[0110] В некоторых вариантах осуществления антитело ингибирует или снижает пролиферацию опухолевой клетки путем ингибирования связывания ErbB3 человека с лигандом ErbB3, например, нейрегулином/херегулином, особенно NRGβ1/NRG1-β1/NRGβ1/HRGβ1 и NRGα1/NRG1-α1/NRGα1/HRGα1. Антитело можно применять в способе для ингибирования роста опухоли у пациента-человека. Данный способ включает введение пациенту терапевтически эффективного количества антитела.

[0111] Злокачественные опухоли, связанные со сверхэкспрессией и/или активацией ErbB3, включают рак молочной железы, рак яичника, рак предстательной железы, рак шейки матки, рак легкого (например, немелкоклеточный рак легкого), некоторые формы рака головного мозга (например, невринома), меланомы, злокачественные опухоли кожи, почек и желудочно-кишечного тракта (например, толстой кишки, поджелудочной железы, желудка, головы и шеи).

[0112] Используемые в данном документе "лечить", "терапия" и "лечение" означают лечение заболевания у млекопитающего, например, у человека. Это включает в себя: (a) ингибирование заболевания, то есть, купирование его развития, и (b) облегчение заболевания, т.е. вызывание регрессии болезненного состояния, и (c) лечение заболевания.

[0113] Как правило, терапевтически эффективное количество активного компонента находится в пределах от 0,1 мг/кг до 100 мг/кг, например, от 1 мг/кг до 100 мг/кг, от 1 мг/кг до 10 мг/кг. Вводимое количество будет зависеть от таких переменных, как тип и степень заболевания или симптома, который подвергается лечению, общего состояния 5 здоровья пациента, in vivo эффективности антитела, фармацевтического состава и пути введения. Начальная дозировка может повышаться за пределы верхнего уровня для того, чтобы быстро достичь желаемого уровня в крови или ткани. Кроме того, начальная дозировка может быть меньше оптимума, а суточную дозировку можно постепенно увеличивать в течение курса лечения. Дозировку для человека можно оптимизировать, например, в стандартном исследовании с увеличением дозы Фазы I, разработанном для серии опытов от 0,5 мг/кг до 20 мг/кг. Частота доз может варьировать в зависимости от таких факторов, как путь введения, размер дозировки и болезнь, подлежащая лечению. Иллюстративные частоты доз составляют раз в день, раз в неделю и раз в две недели. Предпочтительным путем введения является парентеральный, например внутривенная инфузия. Составление препаратов, основанных на моноклональных антителах, находится в пределах традиционной практики в данной области. В некоторых вариантах осуществления моноклональное антитело является лиофилизированным и восстанавливается в забуференном физиологическом растворе во время введения.

[0114] Для терапевтического применения антитело предпочтительно сочетают с фармацевтически приемлемым носителем. Как используется в данном документе, "фармацевтически приемлемый носитель" означает буферы, носители и наполнители, пригодные для применения в контакте с тканями людей и животных без излишней токсичности, раздражения, аллергической реакции или другой проблемы или осложнения, соизмеримого с разумным соотношением польза/риск. Носитель(и) должен быть "приемлемым" в смысле быть совместимым с другими ингредиентами составов и не быть вредным для реципиента. Фармацевтически приемлемые носители включают буферы, растворители, дисперсионные среды, покрытия, изотонические и замедляющие абсорбцию средства и т.п., которые совместимы с фармацевтическим введением. Применение таких сред и средств для фармацевтически активных веществ известно в уровне техники.

[0115] Фармацевтические композиции, содержащие антитела, раскрытые в данном документе, могут быть представлены в форме единицы дозирования и могут быть получены любым подходящим способом. Фармацевтическая композиция должна быть составлена таким образом, чтобы быть совместимой с предполагаемым путем ее введения. Примерами путей введения являются внутривенное (в/в), внутрикожное, ингаляционное, трансдермальное, местное, трансмукозальное и ректальное введение. Предпочтительным способом введения моноклональных антител является в/в инфузия. Применимые композиции можно получать способами, хорошо известными в фармацевтической области. Например, см. Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990). Компоненты состава, предназначенные для парентерального введения, включают стерильный разбавитель, такой как вода для инъекций, физиологический раствор, жирные масла, полиэтиленгликоли, глицерин, пропиленгликоль или другие синтетические растворители; антибактериальные средства, такие как бензиловый спирт или метилпарабены; антиоксиданты, такие как аскорбиновая кислота или бисульфит натрия; хелатообразующие средства, такие как EDTA; буферы, такие как ацетатные, цитратные или фосфатные, и средства для регулирования тоничности, такие как хлорид натрия или декстроза.

[0116] Подходящие носители для внутривенного введения включают физиологический раствор, бактериостатическую воду, Cremophor ELTM (BASF, Парсиппани, Нью-Джерси) или фосфатно-солевой буфер (PBS). Носитель должен быть стабильным при условиях производства и хранения и должен быть защищен от микроорганизмов. Носитель может быть растворителем или дисперсионной средой, содержащей, например, воду, этанол, полиол (например, глицерин, пропиленгликоль и жидкий полиэтиленгликоль) и их подходящие смеси.

[0117] Фармацевтические составы предпочтительно являются стерильными. Стерилизация может выполняться, например, путем фильтрации через стерильные фильтрационные мембраны. Если композицию лиофилизируют, фильтрационную стерилизацию можно проводить до или после лиофилизации и восстановления.

ПРИМЕРЫ

[0118] Следующие примеры являются только иллюстративными и не предназначены для ограничения объема или содержания изобретения любым образом.

Пример 1 - Получение моноклональных антител к hErbB3

[0119] Иммунизации, слияния и первичные скрининги были проведены в Maine Biotechnology Services Inc., следуя протоколу повторной иммунизации с использованием множественных сайтов (RIMMS). Трех мышей AJ и трех мышей Balb/c иммунизировали рекомбинантным ErbB3/Fc человека (R&D Systems, № по кат. 348-RB). Осуществляли две серии иммунизации как с расщепленным rhErbB3 (иммунизация А), так и с расщепленным rhErbB3, поперечно сшитым с его лигандом, рекомбинантным доменом NRG1-β1/HRG1-β1-EGF человека (R&D Systems, № по кат. 396-НВ) (иммунизация В). Две мыши AJ на иммунизацию с сыворотками, демонстрирующими высокую активность антител к ErbB3 согласно твердофазному иммуноферментному анализу (ELISA), были выбраны для последующего слияния. Селезенки и лимфатические узлы собирали от соответствующих мышей. Затем собирали В-клетки и сливали с клетками миеломной линии. Продукты слияния разводили серийно в сорока 96-луночных планшетах почти до полной клональности. Проводили скрининг всего 5280 супернатантов от полученных в результате слияний в отношении связывания с рекомбинантным rhErbB3/Fc с использованием ELISA. Проводили скрининг тех же супернатантов также в отношении их связывания с ErbB3 человека, сверхэкспрессированного в клетках СНО (путем анализа электрохемилюминесценции Mesoscale). Триста супернатантов, идентифицированные как содержащие антитела против ErbB3, дополнительно характеризовали путем биохимических и клеточных анализов in vitro, как указано ниже. Была выбрана панель гибридом, и гибридомы субклонировали и размножали. Гибридомные клеточные линии переносили в BioXCell (ранее Bio-Express) для экспрессии антител и очистки путем аффинной хроматографии на смоле с белком G при стандартных условиях.

[0120] Моноклональное антитело 04D01 к hErbB3 было создано на основе иммунизации А, описанной выше. Моноклональные антитела 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 к hErbB3 были созданы на основе иммунизации В, описанной выше.

Пример 2 - Анализ последовательностей моноклональных антител к hErbB3

[0121] Изотип легкой цепи и изотип тяжелой цепи каждого моноклонального антитела в примере 1 определяли с использованием IsoStrip™ Mouse Monoclonal Antibody Isotyping Kit в соответствии с инструкциями производителя (Roche Applied Science). Было определено, что все антитела являются легкой каппа-цепью и тяжелой цепью IgG1 или IgG2b IgG.

[0122] Вариабельные области тяжелой и легкой цепи моноклональных антител мыши секвенировали с использованием 5' RACE (быстрая амплификация концов кДНК). Общую РНК экстрагировали из каждой моноклональной линии клеток гибридомы с использованием RNeasy Miniprep kit в соответствии с инструкциями поставщика (Qiagen). Первая цепь кДНК полной длины, содержащая 5'-концы, была создана с использованием GeneRacer™ Kit (Invitrogen) или SMARTer™ RACE cDNA Amplification Kit (Clontech) в соответствии с инструкциями производителя с использованием случайных праймеров для 5' RACE.

[0123] Вариабельные области каппа- и тяжелых цепей (IgG1 или IgG2b) IgG амплифицировали с помощью ПЦР, с использованием KOD Hot Start Polymerase (Novagen) или Advantage 2 Polymerase Mix (Clontech) в соответствии с инструкциями производителя. Для амплификации 5'-концов кДНК, в сочетании с GeneRacer™ Kit использовали в качестве 5'-праймера GeneRacer™ 5'-праймер, 5'cgactggagcacgaggacactga 3' (SEQ ID NO: 136) (Invitrogen). Для амплификации 5'-концов кДНК, в сочетании с SMARTer™ RACE cDNA Amplification Kit использовали в качестве 5'-праймера Universal Primer Mix A primer (Clontech), смесь 5'CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT 3' (SEQ ID NO: 137) и 5'CTAATACGACTCACTATAGGGC 3' (SEQ ID NO: 138). Вариабельные области тяжелой цепи амплифицировали с использованием вышеуказанных 5'-праймеров и 3'-праймера, специфичного к константной области IgG1, или 5'TATGCAAGGCTTACAACCACA 3' (SEQ ID NO: 139), или 5'GCCAGTGGATAGACAGATGGGGGTGTCG 3' (SEQ ID NO: 140). Последовательности IgG2b амплифицировали или с 5'AGGACAGGGGTTGATTGTTGA 3' (SEQ ID NO: 141), 5'GGCCAGTGGATAGACTGATGGGGGTGTTGT 3' (SEQ ID NO: 142), или 5'GGAGGAACCAGTTGTATCTCCACACCCA 3' (SEQ ID NO: 143). Вариабельные области каппа-цепи амплифицировали с вышеуказанными 5'-праймерами и 3'-праймером, специфичным к каппа-константной области, или 5'CTCATTCCTGTTGAAGCTCTTGACAAT 3' (SEQ ID NO: 144), или 5'CGACTGAGGCACCTCCAGATGTT 3' (SEQ ID NO: 145).

[0124] Отдельные продукты ПЦР выделяли с помощью электрофореза в агарозном геле и очищали с использованием Qiaquick Gel Purification kit в соответствии с инструкциями производителя (Qiagen). ПЦР-продукты впоследствии клонировали в плазмиду pCR®4Blunt с помощью Zero Blunt® TOPO® PCR Cloning Kit в соответствии с инструкциями производителя (Invitrogen) и трансформировали в бактерии DH5-a (Invitrogen) посредством стандартных методик молекулярной биологии. Плазмидную ДНК, изолированную из трансформированных бактериальных клонов, секвенировали с использованием М13 прямого (5'GTAAAACGACGGCCAGT 3') (SEQ ID NO: 146) и М13 обратного праймеров (5'CAGGAAACAGCTATGACC 3') (SEQ ID NO: 147) с помощью Beckman Genomics с использованием стандартных способов дидезокси-секвенирования ДНК для идентификации последовательности последовательностей вариабельной области. Последовательности анализировали с использованием программного обеспечения Vector NTI (Invitrogen) и программного обеспечения IMGT/V-Quest для идентификации и подтверждения последовательностей вариабельной области.

[0125] Последовательности нуклеиновых кислот, кодирующие, и последовательности белков, определяющие вариабельные области моноклональных антител мыши, кратко излагаются ниже (аминотерминальные сигнальные пептидные последовательности не показаны). Последовательности CDR (определение по Kabat) показаны жирным/подчеркнутым в последовательностях аминокислот.

[0126] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи антитела 04D01 (SEQ ID NO: 1)

[0127] Последовательность белка, определяющая вариабельную область тяжелой цепи антитела 04D01 (SEQ ID NO: 2)

[0128] Последовательность нуклеиновой кислоты, кодирующая вариабельную) область каппа-цепи антитела 04D01 (SEQ ID NO: 3)

[0129] Последовательность белка, определяющая вариабельную область каппа-цепи антитела 04D01 (SEQ ID NO: 4)

[0130] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи антитела 09D03 (SEQ ID NO: 11)

[0131] Последовательность белка, определяющая вариабельную область тяжелой цепи антитела 09D03 (SEO ID NO: 12)

[0132] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи антитела 09D03 (SEQ ID NO: 13)

[0133] Последовательность белка, определяющая вариабельную область каппа-цепи антитела 09D03 (SEQ ID NO: 14)

[0134] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи антитела 11G01 (SEQ ID NO: 21)

[0135] Последовательность белка, определяющая вариабельную область тяжелой цепи антитела 11G01 (SEQ ID NO: 22)

[0136] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи антитела 11G01 (SEQ ID NO: 23)

[0137] Последовательность белка, определяющая вариабельную область каппа-цепи антитела 11G01 (SEQ ID NO: 24)

[0138] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи антитела 12А07 (SEQ ID NO: 30)

[0139] Последовательность белка, определяющая вариабельную область тяжелой цепи антитела 12А07 (SEQ ID NO: 31)

[0140] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи антитела 12А07 (SEQ ID NO: 32)

[0141] Последовательность белка, определяющая вариабельную область каппа-цепи антитела 12А07 (SEQ ID NO: 33)

[0142] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи антитела 18Н02 (SEQ ID NO: 37)

[0143] Последовательность белка, определяющая вариабельную область тяжелой цепи антитела 18Н02 (SEQ ID NO: 38)

[0144] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи антитела 18Н02 (SEQ ID NO: 39)

[0145] Последовательность белка, определяющая вариабельную область каппа-цепи антитела 18H02 (SEQ ID NO: 40)

[0146] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи антитела 22А02 (SEQ ID NO: 47)

[0147] Последовательность белка, определяющая вариабельную область тяжелой цепи антитела 22А02 (SEQ ID NO: 48)

[0148] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи антитела 22А02 (SEQ ID NO: 49)

[0149] Последовательность белка, определяющая вариабельную область каппа-цепи антитела 22А02 (SEQ ID NO: 50)

[0150] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи антитела 24С05 (SEQ ID NO: 53)

[0151] Последовательность белка, определяющая вариабельную область тяжелой цепи антитела 24С05 (SEQ ID NO: 54)

[0152] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи антитела 24С05 (SEQ ID NO: 55)

[0153] Последовательность белка, определяющая вариабельную область каппа-цепи антитела 24С05 (SEQ ID NO: 56)

[0154] Последовательности аминокислот, определяющие вариабельные области тяжелой цепи иммуноглобулина для антител, полученных в примере 1, выравниваются на ФИГ.2. Аминотерминальные сигнальные пептидные последовательности (для правильной экспрессии/секреции) не показаны. CDR1, CDR2 и CDR3 (определение по Kabat) обозначены рамками. На ФИГ.3 показано выравнивание отдельных последовательностей CDR1, CDR2 и CDR3 для каждого антитела.

[0155] Последовательности аминокислот, определяющие вариабельные области легкой цепи иммуноглобулина для антител в примере 1, выравниваются на ФИГ.4. Аминотерминальные сигнальные пептидные последовательности (для правильной экспрессии/секреции) не показаны. CDR1, CDR2 и CDR3 обозначены рамками. На ФИГ.5 показано выравнивание отдельных последовательностей CDR1, CDR2 и CDR3 для каждого антитела.

[0156] Таблица 1 представляет собой карту соответствий, показывающую SEQ ID NO. каждой последовательности, описанной в данном примере.

Таблица 1
SEQ. ID NO. Нуклеиновая кислота или белок
1 Вариабельная область тяжелой цепи 04D01 - нуклеиновая кислота
2 Вариабельная область тяжелой цепи 04D01 - белок
3 Вариабельная область легкой (каппа) цепи 04D01 - нуклеиновая кислота
4 Вариабельная область легкой (каппа) цепи 04D01 - белок
5 CDR1 тяжелой цепи H04D01
6 CDR2 тяжелой цепи 04D01
7 CDR3 тяжелой цепи 04D01
8 CDR1 легкой (каппа) цепи 04D01
9 CDR2 легкой (каппа) цепи 04D01
10 CDR3 легкой (каппа) цепи 04D01
11 Вариабельная область тяжелой цепи 09D03 - нуклеиновая кислота
12 Вариабельная область тяжелой цепи 09D03 - белок
13 Вариабельная область легкой (каппа) цепи 09D03 - нуклеиновая кислота
14 Вариабельная область легкой (каппа) цепи 09D03 - белок
15 CDR1 тяжелой цепи 09D03
16 CDR2 тяжелой цепи 09D03
17 CDR3 тяжелой цепи 09D03
18 CDR1 легкой (каппа) цепи 09D03
19 09D03 CDR2 легкой (каппа) цепи
20 CDR3 легкой (каппа) цепи 09D03
21 Вариабельная область тяжелой цепи 11G01 - нуклеиновая кислота
22 Вариабельная область тяжелой цепи 11G01 - белок
23 Вариабельная область легкой (каппа) цепи 11G01 - нуклеиновая кислота
24 Вариабельная область легкой (каппа) цепи 11G01 - белок
25 CDR1 тяжелой цепи 11G01
26 CDR2 тяжелой цепи 11G01
27 CDR3 тяжелой цепи 11G01
28 CDR1 легкой (каппа) цепи 11G01
9 CDR2 легкой (каппа) цепи 11G01
Таблица 1 (Прод.)
SEQ. ID NO. Нуклеиновая кислота или белок
29 CDR3 легкой (каппа) цепи 11G01
30 Вариабельная область тяжелой цепи 12А07 - нуклеиновая кислота
31 Вариабельная область тяжелой цепи 12А07 - белок
32 Вариабельная область легкой (каппа) цепи 12А07 - нуклеиновая кислота
33 Вариабельная область легкой (каппа) цепи 12А07 - белок
34 CDR1 тяжелой цепи 12А07
35 CDR2 тяжелой цепи 12А07
36 CDR3 тяжелой цепи 12А07
8 CDR1 легкой (каппа) цепи 12А07
9 CDR2 легкой (каппа) цепи 12А07
10 CDR3 легкой (каппа) цепи 12А07
37 Вариабельная область тяжелой цепи 18Н02 - нуклеиновая кислота
38 Вариабельная область тяжелой цепи 18Н02 - белок
39 Вариабельная область легкой (каппа) цепи 18Н02 - нуклеиновая кислота
40 Вариабельная область легкой (каппа) цепи 18Н02 - белок
41 CDR1 тяжелой цепи 18Н02
42 CDR2 тяжелой цепи 18Н02
43 CDR3 тяжелой цепи 18Н02
44 CDR1 легкой (каппа) цепи 18Н02
45 CDR2 легкой (каппа) цепи 18Н02
46 CDR3 легкой (каппа) цепи 18Н02
47 Вариабельная область тяжелой цепи 22А02 - нуклеиновая кислота
48 Вариабельная область тяжелой цепи 22А02 - белок
49 Вариабельная область легкой (каппа) цепи 22А02 - нуклеиновая кислота
50 Вариабельная область легкой (каппа) цепи 22А02 - белок
51 CDR1 тяжелой цепи 22А02
52 CDR2 тяжелой цепи 22А02
36 CDR3 тяжелой цепи 22А02
8 CDR1 легкой (каппа) цепи 22А02
9 CDR2 легкой (каппа) цепи 22А02
Таблица 1 (Прод.)
SEQ. ID NO. Нуклеиновая кислота или белок
10 CDR3 легкой (каппа) цепи 22А02
53 Вариабельная область тяжелой цепи 24С05 - нуклеиновая кислота
54 Вариабельная область тяжелой цепи 24С05 - белок
55 Вариабельная область легкой (каппа) цепи 24С05 - нуклеиновая кислота
56 Вариабельная область легкой (каппа) цепи 24С05 - белок
57 CDR1 тяжелой цепи 24С05
58 CDR2 тяжелой цепи 24С05
59 CDR3 тяжелой цепи 24С05
60 CDR1 легкой (каппа) цепи 24С05
61 CDR2 легкой (каппа) цепи 24С05
62 CDR3 легкой (каппа) цепи 24С05

[0157] Последовательности CDR тяжелой цепи моноклонального антитела мыши (определения по Kabat, Chothia, и IMGT) показаны в таблице 2.

Таблица 2
Kabat:
CDR1 CDR 2 CDR3
04D01 SHWLH (SEQ ID NO: 5) VLDPSDFYSNYNQNFKG (SEQ ID NO: 6) GLLSGDYAMDY (SEQ ID NO: 7)
09D03 TFGLSVG (SEQ ID NO: 15) HIWWDDDKYYNPALKS (SEQ ID NO: 16) IGADALPFDY (SEQ ID NO: 17)
11G01 DHIIH (SEQ ID NO: 25) YIYPRDGYIKYNEKFKG (SEQ ID NO: 26) GYYYAMDY (SEQ ID NO: 27)
12А07 SYWMH (SEQ ID NO: 34) MIDPSDVYTNYNPKFKG (SEQ ID NO: 35) NYSGDY (SEQ ID NO: 36)
18Н02 TYGMS (SEQ ID NO: 41) WINTYSGVPTYADDFKG (SEQ ID NO: 42) GRDGYQVAWFAY (SEQ ID NO: 43)
22А02 NYWMH (SEQ ID NO: 51) MIDPSDSYTNYNPKFKG (SEQ ID NO: 52) NYSGDY (SEQ ID NO: 36)
Таблица 2 (Прод.)
Kabat
CDR1 CDR 2 CDR3
24С05 DYAMS (SEQ ID NO: 57) TISDGGTYTYYPDNVKG (SEQ ID NO: 58) EWGDYDGFDY (SEQ ID NO: 59)
Chothia
CDR 1 CDR2 CDR3
04D01 GYTFTSH (SEQ ID NO: 63) DPSDFY (SEQ ID NO: 64) GLLSGDYAMDY (SEQ ID NO: 7)
09D03 GFSLSTFGL (SEQ ID NO: 65) WWDDD (SEQ ID NO: 66) IGADALPFDY (SEQ ID NO: 17)
11G01 GYTFTDH (SEQ ID NO: 67) YPRDGY (SEQ ID NO: 68) GYYYAMDY (SEQ ID NO: 27)
12A07 GYTFSSY (SEQ ID NO: 69) DPSDVY (SEQ ID NO: 70) NYSGDY (SEQ ID NO: 36)
18H02 GYTFTTY (SEQ ID NO: 71) NTYSGV (SEQ ID NO: 72) GRDGYQVAWFAY (SEQ ID NO: 43)
22A02 GYTFTNY (SEQ ID NO: 73) DPSDSY (SEQ ID NO: 74) NYSGDY (SEQ ID NO: 36)
24С05 GFTFSDY (SEQ ID NO: 75) SDGGTY (SEQ ID NO: 76) EWGDYDGFDY (SEQ ID NO: 59)
IMGT
CDR1 CDR2 CDR 3
04D01 GYTFTSHW (SEQ ID NO: 77) LDPSDFYS (SEQ ID NO: 78) ARGLLSGDYAMDY (SEQ ID NO: 79)
09D03 GFSLSTFGLS (SEQ ID NO: 80) IWWDDDK (SEQ ID NO: 81) ARIGADALPFDY (SEQ ID NO: 82)
11G01 GYTFTDHI (SEQ ID NO: 83) IYPRDGYI (SEQ ID NO: 84) ARGYYYAMDY (SEQ ID NO: 85)
12A07 GYTFSSYW (SEQ ID NO: 86) IDPSDVYT (SEQ ID NO: 87) ARNYSGDY (SEQ ID NO: 88)
Таблица 2 (Прод.)
IMGT
CDR1 CDR2 CDR 3
18H02 GYTFTTYG (SEQ ID NO: 89) INTYSGVP (SEQ ID NO: 90) ARGRDGYQVAWFAY (SEQ ID NO: 91)
22A02 GYTFTNYW (SEQ ID NO: 92) IDPSDSYT (SEQ ID NO: 93) ARNYSGDY (SEQ ID NO: 88)
24C05 GFTFSDYA (SEQ ID NO: 94) ISDGGTYT (SEQ ID NO: 95) AREWGDYDGFDY (SEQ ID NO: 96)

[0158] Последовательности CDR легкой каппа-цепи моноклонального антитела мыши (определения по Kabat, Chothia, и IMGT) показаны в таблице 3.

Таблица 3
Kabat/Chothia
CDR 1 CDR 2 CDR 3
04D01 RSSQSIVHSNGNTYLE (SEQ ID NO: 8) KVSNRFS (SEQ ID NO: 9) FQGSYVPWT (SEQ ID NO: 10)
09D03 RSSKSLLHSNGNTYLY (SEQ ID NO: 18) RMSNLAS (SEQ ID NO: 19) MQHLEYPFT (SEQ ID NO: 20)
11G01 RSSQSIVHSIGNTYLE (SEQ ID NO: 28) KVSNRFS (SEQ ID NO: 9) FQGSHVPFT (SEQ ID NO: 29)
12А07 RSSQSIVHSNGNTYLE (SEQ ID NO: 8) KVSNRFS (SEQ ID NO: 9) FQGSYVPWT (SEQ ID NO: 10)
18H02 ITSTDIDDDMN (SEQ ID NO: 44) EGNTLRP (SEQ ID NO: 45) LQSDNLPYT (SEQ ID NO: 46)
22A02 RSSQSIVHSNGNTYLE (SEQ ID NO: 8) KVSNRFS (SEQ ID NO: 9) FQGSYVPWT (SEQ ID NO: 10)
24C05 RASQEISGYLS (SEQ ID NO: 60) AASTLDS (SEQ ID NO: 61) LQYDSYPYT (SEQ ID NO: 62)
Таблица 3 (Прод.)
IMGT
CDR1 CDR2 CDR3
04D01 QSIVHSNGNTY (SEQ ID NO: 97) KVS FQGSYVPWT (SEQ ID NO: 10)
09D03 KSLLHSNGNTY (SEQ ID NO: 98) RMS MQHLEYPFT (SEQ ID NO: 20)
11G01 QSIVHSIGNTY (SEQ ID NO: 99) KVS FQGSHVPFT (SEQ ID NO: 29)
12А07 QSIVHSNGNTY (SEQ ID NO: 97) KVS FQGSYVPWT (SEQ ID NO: 10)
18Н02 TDIDDD (SEQ ID NO: 100) EGN LQSDNLPYT (SEQ ID NO: 46)
22А02 QSIVHSNGNTY (SEQ ID NO: 97) KVS FQGSYVPWT (SEQ ID NO: 10)
24С05 QEISGY (SEQ ID NO: 101) AAS LQYDSYPYT (SEQ ID NO: 62)

[0159] В таблицах 2 и 3 самые длинные последовательности CDR для тяжелой цепи и легкой цепи иммуноглобулина выделены жирным.

[0160] Для создания полных последовательностей тяжелой или каппа-цепи антитела каждую вариабельную вышеуказанную последовательность комбинируют с ее соответствующей константной областью. Например, полная тяжелая цепь содержит тяжелую вариабельную последовательность, за которой следует константная последовательность тяжелой цепи IgG1 или IgG2b мыши, и полная каппа-цепь содержит 10 каппа-вариабельную последовательность, за которой следует константная последовательность легкой каппа-цепи мыши.

[0161] Последовательность нуклеиновой кислоты, кодирующая константную область тяжелой цепи IgG1 мыши (SEQ ID NO: 102)

[0162] Последовательность белка, определяющая константную область тяжелой цепи IgG1 мыши (SEQ ID NO: 103)

[0163] Последовательность нуклеиновой кислоты, кодирующая константную область тяжелой цепи IgG2b мыши (SEQ ID NO: 104)

[0164] Последовательность белка, определяющая константную область тяжелой цепи IgG2b мыши (SEQ ID NO: 105)

[0165] Последовательность нуклеиновой кислоты, кодирующая константную область легкой каппа-цепи мыши (SEQ ID NO: 106)

[0166] Последовательность белка, определяющая константную область легкой каппа-цепи мыши (SEQ ID NO: 107)

[0167] Следующие последовательности представляют действительные или предполагаемые последовательности полной длины тяжелой и легкой цепи (т.е. содержащие последовательности как вариабельной, так и константной областей) для каждого антитела, описанного в данном примере. Сигнальные последовательности для правильной секреции антител также включены на 5'-конце последовательностей ДНК или аминотерминальном конце последовательностей белка. Последовательности вариабельной области могут быть лигированы с последовательностями другой константной области для получения активных тяжелых и легких цепей IgG полной длины.

[0168] Последовательность нуклеиновой кислоты, кодирующая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 04D01 (SEQ ID NO: 108)

[0169] Последовательность белка, определяющая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 04D01 (SEQ ID NO: 109)

[0170] Последовательность нуклеиновой кислоты, кодирующая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 04D01 (SEQ ID NO: 110)

[0171] Последовательность белка, определяющая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 04D01 (SEQ ID NO: 111)

[0172] Последовательность нуклеиновой кислоты, кодирующая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG2b) 09D03 (SEQ ID NO: 112)

[0173] Последовательность белка, определяющая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG2b) 09D03 (SEQ ID NO: 113)

[0174] Последовательность нуклеиновой кислоты, кодирующая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 09D03 (SEQ ID NO: 114)

[0175] Последовательность белка, определяющая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 09D03 (SEQ ID NO: 115)

[0176] Последовательность нуклеиновой кислоты, кодирующая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 11G01 (SEQ ID NO: 116)

[0177] Последовательность белка, определяющая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 11G01 (SEQ ID NO: 117)

[0178] Последовательность нуклеиновой кислоты, кодирующая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 11G01 (SEQ ID NO: 118)

[0179] Последовательность белка, определяющая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 11G01 (SEQ ID NO: 119)

[0180] Последовательность нуклеиновой кислоты, кодирующая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 12A07 (SEQ ID NO: 120)

[0181] Последовательность белка, определяющая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 12A07 (SEQ ID NO: 121)

[0182] Последовательность нуклеиновой кислоты, кодирующая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 12A07 (SEQ ID NO: 122)

[0183] Последовательность белка, определяющая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 12А07 (SEQ ID NO: 123)

[0184] Последовательность нуклеиновой кислоты, кодирующая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 18H02 (SEQ ID NO: 124)

[0185] Последовательность белка, определяющая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 18H02 (SEQ ID NO: 125)

[0186] Последовательность нуклеиновой кислоты, кодирующая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 18H02 (SEQ ID NO: 126)

[0187] Последовательность белка, определяющая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 18H02 (SEQ ID NO: 127)

[0188] Последовательность нуклеиновой кислоты, кодирующая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 22A02 (SEQ ID NO: 128)

[0189] Последовательность белка, определяющая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 22A02 (SEQ ID NO: 129)

[0190] Последовательность нуклеиновой кислоты, кодирующая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 22A02 (SEQ ID NO: 130)

[0191] Последовательность белка, определяющая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 22А02 (SEQ ID NO: 131)

[0192] Последовательность нуклеиновой кислоты, кодирующая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 24C05 (SEQ ID NO: 132)

[0193] Последовательность белка, определяющая последовательность тяжелой цепи полной длины (вариабельную область тяжелой цепи и константную область IgG1) 24C05 (SEQ ID NO: 133)

[0194] Последовательность нуклеиновой кислоты, кодирующая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 24C05 (SEQ ID NO: 134)

[0195] Последовательность белка, определяющая последовательность легкой цепи полной длины (вариабельную область каппа-цепи и константную область) 24C05 (SEQ ID NO: 135)

[0196] Для удобства в таблице 4 приведена карта соответствий, показывающая соотношение между последовательностями полной длины антител, описанных в данном 5 примере, с таковыми, представленными в списке последовательностей.

Таблица 4
SEQ ID NO. Нуклеиновая кислота или белок
108 Тяжелая вариабельная 04D01 + константная IgG1 - нуклеиновая кислота
109 Тяжелая вариабельная 04D01 + константная IgG1 - белок
110 Каппа вариабельная 04D01 + константная - нуклеиновая кислота
111 Каппа вариабельная 04D01 + константная - белок
112 Тяжелая вариабельная 09D03 + константная IgG2b - нуклеиновая кислота
113 Тяжелая вариабельная 09D03 + константная IgG2b - белок
114 Каппа вариабельная 09D03 + константная - нуклеиновая кислота
Табл. 4 (прод.)
SEQ ID NO. Нуклеиновая кислота или белок
115 Каппа вариабельная 09D03 + константная - белок
116 Тяжелая вариабельная 11G01 + константная IgG1 - нуклеиновая кислота
117 Тяжелая вариабельная 11G01 + константная IgG1 - белок
118 Каппа вариабельная 11G01 + константная - нуклеиновая кислота
119 Каппа вариабельная 11G01 + константная - белок
120 Тяжелая вариабельная 12А07 + константная IgG1 - нуклеиновая кислота
121 Тяжелая вариабельная 12А07 + константная IgG1 - белок
122 Каппа вариабельная 12А07 + константная - нуклеиновая кислота
123 Каппа вариабельная 12А07 + константная - белок
124 Тяжелая вариабельная 18Н02 + константная IgG1 - нуклеиновая кислота
125 Тяжелая вариабельная 18Н02 + константная IgG1 - белок
126 Каппа вариабельная 18Н02 + константная - нуклеиновая кислота
127 Каппа вариабельная 18Н02 + константная - белок
128 Тяжелая вариабельная 22А02 + константная IgG1 - нуклеиновая кислота
129 Тяжелая вариабельная 22А02 + константная IgG1 - белок
130 Каппа вариабельная 22А02 + константная - нуклеиновая кислота
SEQ ID NO. Нуклеиновая кислота или белок
131 Каппа вариабельная 22А02 + константная - белок
132 Тяжелая вариабельная 24С05 + константная IgG1 - кислота
нуклеиновая
133 Тяжелая вариабельная 24С05 + константная IgG1 - белок
134 Каппа вариабельная 24С05 + константная - нуклеиновая
кислота
135 Каппа вариабельная 24С05 + константная - белок

Пример 3 - Связывающие аффинности

[0197] Связывающие аффинности и кинетику связывания моноклональных антител 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 с рекомбинантным человеческим ErbB3/Fc слитым белком (rhErbB3-Fc) измеряли с помощью поверхностного плазмонного резонанса с использованием прибора Biacore® Т 100 (Biacore).

[0198] Антитело кролика к IgG мыши (Biacore, № по кат. BR-1008-38) иммобилизировали на сенсорных чипах СМ4 с карбоксиметилированным декстраном (Biacore, № по кат. BR-1005-34) путем аминного связывания (BIAcore, № по кат. BR-1000-50) с использованием стандартного протокола связывания в соответствии с инструкциями поставщика. Анализы проводили при 25°С с использованием PBS (Invitrogen, № по кат. 14040-133), содержащего 0,05% сурфактанта Р20 (Biacore, № по кат. BR-1000-54) в качестве подвижного буфера.

[0199] Антитела захватывались в отдельные проточные ячейки при скорости потока 10 мкл/мин. Время впрыскивания варьировали для каждого антитела так, чтобы достичь Rmax между 30 и 60 RU. Буфер или rhErbB3-Fc, разведенный в подвижном буфере, впрыскивали последовательно над стандартной поверхностью (без захваченных антител) и активной поверхностью (тестируемые антитела) в течение 300 секунд при 60 мкл/мин. Фазу диссоциации контролировали в течение вплоть до 3600 секунд. Поверхность затем регенерировали путем двух 60-секундных впрыскиваний 10 м глицина-HCl, рН 1,7 (получен из глицина рН 1,5 (Biacore, № по кат. BR-1003-54) и рН 2,0 (Biacore, № по кат. BR-1003-55)) при скорости потока 60 мкл/мин. Протестированный диапазон концентраций rhErbB3-Fc составил от 0,125 нМ до 20 нМ.

[0200] Кинетические параметры определяли с использованием кинетической функции программного обеспечения BIAevaluation (Biacore) с вычитанием двойного контроля. Определяли кинетические параметры для каждого антитела, ka (константа скорости ассоциации), kd (константа скорости диссоциации) и KD (равновесная константа диссоциации). Кинетические значения моноклональных антител относительно rhErbB3-Fc при 25°С суммируются в таблице 5.

Таблица 5
Антитело ka (1/Ms) Стандартное отклонение kd (1/s) Стандартное отклонение KD (М) Стандартное отклонение n
04D01 3,8Е+05 3,ОЕ+04 9,3Е-05 1,9Е-05 2,5Е-10 5,6Е-11 5
09D03 2,7Е+05 3,2Е+04 2,0Е-05 1,2Е-05 8,0Е-11 5,5Е-11 3
11G01 2,7Е+05 9,2Е+04 2,2Е-05 9,6Е-06 9,1Е-11 5,5Е-11 4
12А07 6,2Е+05 8,1Е+04 1,9Е-04 1,0Е-04 3,0Е-10 1,4Е-10 3
18Н02 2,8Е+05 3,1Е+04 2,5Е-05 8,8Е-06 9,1Е-11 3,7Е-11 4
22А02 7,0Е+05 8,1Е+04 2,2Е-04 1,4Е-04 3,2Е-10 2,4Е-10 3
24С05 1,5Е+06 2,0Е+05 9,2Е-06 3,0Е-06 6,5Е-12 2,8Е-12 4

[0201] Данные в таблице 5 демонстрируют, что антитела связывают rhErbB3 с KD около 350 пМ или менее, 250 пМ или менее, 200 пМ или менее, 150 пМ или менее, 100 пМ или менее, 50 пМ или менее, или 10 пМ или менее.

Пример 4 - Активность нейтрализации

[0202] В этом примере антитела, полученные в примере 1, тестировали на способность ингибировать связывание rhErbB3 с NRG1-β1 и NRG1-α1. Антитела тестировали путем электрохемилюминесцентного анализа (ECL) в отношении ингибирования связывания hErbB3 с NRG1-β1. 96-лун очные стандартные планшеты для связывания МА2400 (Meso Scale Discovery, № по кат. L15XA-6) покрывали 50 мкл 0,5 мкг/мл rhErbB3/Fc (R&D systems, № по кат. 348-RB) в PBS (Invitrogen, № по кат. 14040-133) в течение ночи при 4°С без встряхивания. Эти планшеты впоследствии промывали три раза PBS + 0,1% Tween20 (Sigma P5927) и блокировали 200 мкл PBS, содержащим 5% BSA (Sera Care Life Sciences, № по кат. АР-4510-80), в течение 1,5 часа при комнатной температуре. После 3-х раз промывания планшетов PBS, в планшеты добавляли 25 мкл разведении антитела в течение еще одного часа при комнатной температуре со встряхиванием. Лиганд NRG1-β1 (R&D Systems, № по кат. 377-НВ, 26 кДа) добавляли в лунки в конечной концентрации 0,25 мкг/мл. Планшеты промывали три раза PBS и инкубировали с 25 мкл 1 мкг/мл биотинилированного антитела к NRG1-β1 человека (R&D systems, Кат. №BAF377), преинкубированного в течение одного часа с SULTO-TAG Streptavidin (Meso Scale Discovery, № по кат. R32AD-5), в течение часа при комнатной температуре со встряхиванием. Эти планшеты затем промывали три раза PBS, и в каждую лунку добавляли 150 мкл IX буфера для считывания (Meso Scale Discovery, № по кат. R92TC-1) перед тем, как планшеты анализировали на приборе Sector® Imager 2400 (Meso Scale Discovery).

[0203] Взаимодействие NRG1-β1 с ErbB3 ингибировалось антителами 04D01, 12А07, 18Н02, 22А02 и 24С05 (ФИГ.6А). Взаимодействие NRG1-β1 с rhErbB3 усиливалось антителом 09D03, а кроме того антителом 11G01 (ФИГ.6В).

[0204] Значения IC50 для антитела мыши к ErbB3 человека в отношении нейтрализации связывания NRG1-β1 с rhErbB3 для антител (т.е. 04D01, 12А07, 18Н02, 22А02 и 24С05) были вычислены и суммированы в табл.6.

Таблица 6
IC50 (нМ)
Антитело Среднее Стандартное отклонение n
04D01 0,2232 0,0711 4
12А07 0,2351 0,0530 4
18Н02 0,3460 0,0873 4
22А02 0,2418 0,0755 4
24С05 0,3367 0,0764 4

[0205] Результаты показывают, что антитела 04D01, 12А07, 18Н02, 22А02 и 24С05 эффективно нейтрализуют связывание NRG1-β1 с rhErbB3. Антитела 09D03 и 11G01 усиливали связывание hNRG1-β1 с hErbB3.

[0206] Антитела тестировали посредством анализа ECL в отношении ингибирования связывания hErbB3 со вторым лигандом ErbB3, NRG1-α1. Для анализа ингибирования связывания NRG1-α1 с rhErbB3 использовали тот же метод, что для NRG1-β1, за исключением следующих изменений: концентрации помещенных rhErbB3/Fc (R&D 4518-RB) и лиганда NRG1-α1 (Thermo Scientific, RP-317-P1AX) составляли 1 мкг/мл и 1,5 мкг/мл, соответственно.

[0207] Взаимодействие NRG1-α1 с rhErbB3 ингибировалось 11G01, 12А07, 18Н02, 22А02 и 24С05 IgG1 и усиливалось антителом 09D03 (ФИГ.7).

Пример 5 - Связывание с доменом II ErbB3

[0208] В этом примере антитела, полученные в примере 1, тестировали на связывание с доменом димеризации (домен 2) hErbB3-ECD. Домен 2 hErbB3 (118 аминокислот, позиция 210-327) клонировали на место домена 2 Her2 (119 аминокислот, позиция АА220-338) в рецептор Her2 полной длины. Гибридный конструкт Her2/3d2 клонировали в pLenti6.3 и упаковывали путем временной трансфекции клеток 293Т в лентивирус с использованием ViraPower™ Lentiviral Support Kit (Invitrogen, № по кат. K497000). CHO клетки инфицировали лентивирусом, экспрессирующим гибридный белок Her2/3d2. Связывание антител к ErbB3 гибридомных супернатантов с Her2/3d2 тестировали на этих генномодифицированных клетках CHO путем ECL с меченными серой антителами к антителам мыши. Данные о связывании гибридомных супернатантов с химерным белком Her2/3d2, экспрессированным на поверхности CHO клеток, суммируются на ФИГ.8. Эти результаты показывают, что антитела 09D03 и 11G01 связывались с доменом II ErbB3, АА210-327.

Пример 6 - Антипролиферативная активность

[0209] Данный пример описывает характеристику антител, полученных в примере 1, в отношении их способности ингибировать NRG1-β1-зависимую пролиферацию клеток. Антитела тестировали в клеточной системе BaF/3, разработанной для экспрессии как Her2, так и ErbB3 человека, и в клетках рака молочной железы MCF7 человека, которые в естественных условиях экспрессируют Her2 и ErbB3 и растут в ответ на стимуляцию NRG1-β1.

[0210] Клетки BaF/3 инфицировали двумя лентивирусами, разработанными для экспрессии Her2 человека или ErbB3 человека. Инфицированные клетки отбирали с использованием бластицидина (15 мкг/мл; Invitrogen, № по кат. R21001), и индивидуальные колонии выделяли и тестировали на экспрессию обоих рецепторов. Клоны, экспрессирующие Her2/ErbB3, поддерживали в культуре под бластицидиновым отбором с [80% средой RPMI 1640 (GIBCO, № по кат. 11875-093), 10% эмбриональной бычьей сывороткой (GIBCO, № по кат. 10438-026) и 10% кондиционированной клетками WEHI средой {90% среда Дульбекко, модифицированная по способу Исков (GIBCO, № по кат. 12440053), 10% эмбриональная бычья сыворотка (GIBCO, № по кат. 10438-026)+2 mM L-глутамина (GIBCO, № по кат. 25030-081)+0,0025 mM меркаптоэтанола (Invitrogen, № по кат. 21985-023)}]. Для скрининга в отношении антител, антагонистичных к ErbB3, клетки промывали PBS и выращивали в отсутствии бластицидина и кондиционированной WEHI среды. Анализы проводили в 96-луночном планшете (5000 клеток на лунку) в присутствии NRG1-β1 (100 нг/мл) и различных концентраций антител (0,018-5000 нг/мл в конечном объеме 100 мкл). МТТ-анализы (3-(4,5-диметилтиазол-2-ил)-2,5-дифенилтетразолия бромид) проводили через 3-4 дня после стимуляции NRG1-β1.

[0211] Пример дозозависимого ингибирования NRG1-β1-зависимой пролиферации клеток Her2/ErbB3-BaF/3 антителами мыши к ErbB3 человека показан на ФИГ.9. Данные по ингибированию NRG1-β1-зависимой пролиферации клеточной линии Her2/ErbB3-BaF/3 моноклональными антителами (т.е. 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05) суммированы в таблице 7.

Таблица 7
Her2/ErbB3-BaF/3, NRG1-β1-зависимая пролиферация
Антитело IC50 (нМ) - Среднее Стандартное отклонение n
04D01 0,373 0,061 3
09D03 1,395 0,268 3
11G01 1,934 0,116 3
12А07 0,854 0,059 3
18Н02 1,930 0,276 3
22А02 1,291 0,151 3
24С05 0,145 0,031 3

[0212] Результаты в таблице 7 показывают, что антитела 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 сильно ингибировали NRG1-β1-индуцированную пролиферацию клеток BaF/3, экспрессирующих Her2/ErbB3.

[0213] Клетки MCF7 (АТСС, № по кат. НТВ-22) содержали как рекомендовано АТСС. Клетки высевали по 5000 клеток на лунку в 96-луночный планшет. Клетки подвергали голоданию в течение ночи в отсутствие сыворотки. На следующий день к клеткам добавляли NRG1-β1 (40 нг/мл) и различные концентрации антител (12,8 пг/мл - 20 мкг/мл в 100 мкл конечного объема). МТТ-анализы (3-(4,5-Диметилтиазол-2-ил)-2,5-дифенилтетразолия бромид) проводили через 3-4 дня после стимуляции NRG1-β1.

[0214] Пример дозозависимого ингибирования NRG1-β1-зависимой пролиферации клеток MCF7 антителами мыши к ErbB3 человека показан на ФИГ.10. Данные по ингибированию NRG1-β1-зависимой пролиферации клеток MCF7 моноклональными антителами 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 суммированы в таблице 8.

Таблица 8
Клетки MCF7, NRG1-β1-зависимая пролиферация
Антитело IC50 (нМ) - среднее Стандартное отклонение n
04D01 0,47 0,23 3
09D03 2,28 0,60 3
11G01 1,98 1,34 3
12А07 0,74 0,48 3
18Н02 1,00 0,20 3
22А02 1,62 0,60 3
24С05 0,39 0,04 3

[0215] Результаты в таблице 8 демонстрируют, что антитела 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 сильно ингибировали NRG1-β1-индуцированную пролиферацию клеток MCF7.

[0216] Антитела, полученные в примере 1, также тестировали на их способность ингибировать пролиферацию экспрессирующих ErbB3 человеческих раковых клеток. Клетки рака молочной железы SKBR-3 сверхэкспрессируют Her2 и чувствительны к Her2-специфичным ингибиторным антителам.

[0217] Клетки SKBR-3 (АТСС, № по кат. НТВ-30) содержали как рекомендовано АТСС. Клетки высевали по 5000 клеток на лунку в 96-луночном планшете в присутствии 5 мкг/мл антител, но без экзогенного NRH1-β1. МТТ-анализы (3-(4,5-Диметилтиазол-2-ил)-2,5-дифенилтетразолия бромид) проводили через три дня культивирования.

[0218] Пример ингибирования пролиферации клеток SKBR-3 антителами мыши к ErbB3 человека показан на ФИГ.11. Результаты на ФИГ.11 показывают, что антитела 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 ингибировали пролиферацию клеток SKBR-3.

Пример 7 - Ингибирование нисходящего сигнального пути

[0219] Этот пример описывает характеристику антител, полученных в примере 1, в отношении их способности ингибировать NRG1-β1-зависимое фосфорилирование ErbB3 и нисходящей киназы Akt, как индикатор для активации PI3K. Эти антитела также тестировали на их способность ингибировать фосфорилирование в равновесном состоянии ErbB3 в и протеинкиназы Akt в экспоненциально растущих клетках.

[0220] Клетки рака молочной железы SKBR-3 и MCF7 и клетки рака предстательной железы DU145 содержали, как рекомендовано АТСС. Клетки подвергали голоданию в течение ночи при 0% FBS, обрабатывали в течение одного часа 5 мкг/мл антител с последующей стимуляцией NRG1-β1. Лизаты либо анализировали посредством ELISA с использованием набора Phospho-ErbB3 от R&D Systems (№ по кат. DYC1769) или набора Phospho-Akt ELISA от Cell Signaling (№ по кат. 7143).

[0221] Пример ингибирования индуцированного NRG1-β1 фосфорилирования ErbB3 в клетках SKBR-3 антителами мыши к ErbB3 человека показан на ФИГ.12. Результаты на ФИГ.12 продемонстрировали, что антитела 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 ингибировали по меньшей мере на 50% фосфорилирование ErbB3, индуцированное NRG1-β1 в клетках SKBR-3.

[0222] Пример ингибирования индуцированного NRG1-β1 фосфорилирования Akt в клетках MCF7 и DU145 антителами мыши к ErbB3 человека показан на ФИГ.13А и ФИГ.13В соответственно. Результаты на ФИГ.13А и 13В продемонстрировали, что антитела 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 ингибировали по меньшей мере на 80% фосфорилирование Akt в ответ на NRG1-β1 как в MCF7, так и DU145 клетках.

[0223] Способность антител к ErbB3 ингибировать состояние равновесного фосфорилирования ErbB3 и Akt в клетках рака молочной железы линии SKBR-3 и рака поджелудочной железы линии ВхРС3 тестировали, обрабатывая эти экспоненциально растущие клетки в течение часа в присутствии антител при 5 мкг/мл.

[0224] Вестерн-блот анализ этих экспериментов продемонстрировал, что антитела 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 ингибировали уровень равновесного состояния фосфорилирования Akt и ErbB3 как в клетках SKBR-3, так и клетках ВхРС3.

Пример 8 - Ингибирование индуцированного NRG1-β1 фосфорилирования EGFR

[0225] В этом примере антитела, полученные в примере 1, тестировали на их способность ингибировать NRG1-β1-зависимое фосфорилирование EGFR в линии NCI/ADR-RES клеток рака яичника. Клетки NCI/ADR-RES (DTP/DCTD NCI хранилище опухолей) подвергали голоданию в течение ночи в 0% FBS, предварительно обрабатывали антителом (5 мкг/мл) в течение одного часа с последующей стимуляцией NRG1-β1 (20 нг/мл) в течение 15 минут. Фосфорилирование EGFR на тирозине 1068 анализировали путем вестерн-блота. Результаты этого эксперимента продемонстрировали, что антитела 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 ингибировали фосфорилирование EGFR в ответ на NRG1-β1 в клетках NCI/ADR-RES.

Пример 9 - Ингибирование индуцированного EGF фосфорилирования ErbB3

[0226] В этом примере антитела, полученные в примере 1, тестировали на их способность ингибировать EGF-зависимое фосфорилирование ErbB3 в сверхэкспрессирующих EGFR эпидермоидных раковых клетках линии А431. Клетки А431 (АТСС, № по кат. CRL-1555) подвергали голоданию в течение ночи в 0% FBS, предварительно обрабатывали антителом (5 мкг/мл) в течение одного часа с последующей стимуляцией EGF (R&D Systems, № по кат. 236-EG) (50 нг/мл) в течение 15 минут. Фосфорилирование ErbB3 анализировали путем вестерн-блота. Результаты этого эксперимента продемонстрировали, что антитела 04D01, 09D03, 12А07, 18Н02, 22А02 и 24С05 в разной степени ингибировали фосфорилирование ErbB3 в ответ на EGF в клетках А431.

Пример 10 - Ингибирование индуцированного NRG1-β1 образования гетеродимера Her2/ErbB3

[0227] Этот пример описывает характеристику антител, полученных в примере 1, в отношении их способности ингибировать образование димера Her2/ErbB3 в ответ на NRG1-β1 в клетках SKBR-3. Клетки рака молочной железы SKBR-3 подвергали голоданию в течение ночи в 0% FBS, обрабатывали в течение одного часа 5 мкг/мл антитела с последующей стимуляцией NRG1-β1 (30 нг/мл, 30 мин). Лизаты иммунопреципитировали антителом к Her2 (R&D Systems, № по кат. BAF1129) и анализировали путем вестерн-блота с поликлональным антителом к ErbB3 (Santa Cruz, № по кат. SC285).

[0228] Результаты этого эксперимента продемонстрировали, что антитела 04D01, 09D03, 11G01, 12А07, 18Н02, 22А02 и 24С05 ингибировали индуцированное NRG1-β1 образование димера Her2/ErbB3 в клетках SKBR-3.

Пример 11 - Ингибирование роста ксенотрансплантата опухоли ВхРС3

[0229] Способность моноклональных антител мыши, полученных в примере 1, ингибировать рост опухоли тестировали в модели ксенотрансплантата ВхРС3 поджелудочной железы. Клетки ВхРС3 поджелудочной железы человека выращивали в культуре при 37°С в атмосфере, содержащей 5% CO2, с использованием среды RMPI, содержащей 10% эмбриональной бычьей сыворотки. Клетки ВхРС3 подкожно инокулировали в бок 8-недельных самок мышей СВ.17 SCID (Taconic Labs) по 10×106 клеток на мышь в 50% матригеле (BD Biosciences, № по кат. 356237). Измерения опухоли проводили два раза в неделю с использованием штангенциркуля. Объем опухоли рассчитывали с использованием формулы: ширина × ширина × длина/2. Когда опухоли достигали приблизительно 200 мм3, мышей рандомизировали в 9 групп по 10 мышей каждая. Одна группа получала PBS, а другая получала IgG-контроль (huIgG). Каждая из остальных восьми групп получала одно из антител 04D01, 09D03, 18Н02, 11G01, 24С05, 22А02 или 12А07. Все антитела давали дозами при 20 мг/кг массы тела два раза в неделю путем внутрибрюшинной инъекции в течение 6 недель. Объемы опухолей и массы тела мышей записывали два раза в неделю. Ингибирование роста опухоли анализировали путем ANOVA и выражали как процент ингибирования по сравнению с PBS-контролем.

[0230] Результаты на ФИГ.14 показывают, что антитело 24С05 ингибировало рост опухоли на 76% в этой модели (p<0,001). Антитела 04D01, 18Н02 и 11G01 также ингибировали рост опухоли в этой модели на 64%, 71% и 72% соответственно (p<0,001). Антитела 12А07 и 22А02 продемонстрировали наименьшую активность, т.е. почти 40% ингибирование роста опухоли, в то время как антитело 09D03 дало 60% ингибирование роста опухоли в этой модели.

Пример 12 - Гуманизация антител к ErbB3

А. Конструирование гуманизированных и химерных антител к ErbB3

[0231] Этот пример описывает гуманизацию антитела мыши, обозначенного 24С05, и характеристику получившихся в результате гуманизированных антител. Гуманизированные антитела к ErbB3 были разработаны с использованием способа SUPERHUMANIZATION™ (Arana Therapeutics Ltd. and Hwang, W.Y. et al. (2005) METHODS 36: 35-42) или способа пересадки CDR с обратными мутациями (некоторые остатки каркаса человека заменили на остатки мыши) (смотри, например, патенты США №№5530101; 5693761; 5693762; 5585089; 6180370; 7022500). За исключением тяжелой цепи CDR1, использовали определения CDR no Kabat для пересадки CDR на каркасы человека. Комбинацию определений по Kabat и Chothia использовали для пересадки тяжелого CDR1. Разработанные последовательности аминокислот были преобразованы в кодон-оптимизированные последовательности ДНК и синтезированы с помощью DNA2.0, Inc с включением (в следующем порядке): 5' рестрикционного сайта HindIII, консенсусной последовательности Козак, аминотерминальной сигнальной последовательности, гуманизированной вариабельной области, IgG1 человека или каппа-константной области, стоп-кодона и 3' рестрикционного сайта EcoRI. Дополнительно, одна гуманизированная тяжелая цепь, Sh24C05 Hv3-11 Heavy IgG1, была мутирована с использованием ПЦР с перекрывающимися праймерами для усиления гуманизации, приводящей к образованию Sh24C05 Hv3-11 N62S тяжелой цепи IgG1. Была также создана человеческая версия IgG2 тяжелой цепи Sh24C05 Hv3-11 N62S.

[0232] Гуманизированные в соответствии со способом SUPERHUMANIZATION™ цепи антител к ErbB3, как описано в данном документе, обозначаются с префиксом "Sh" перед именем цепи антитела. Цепи антител к ErbB3, гуманизированные способом пересадки CDR с обратными мутациями, как описано в данном документе, обозначаются с префиксом "Hu" перед именем цепи антитела.

[0233] Химерные (вариабельная область мыши и константная область человека) тяжелые 24С05 (IgG1 человека) и легкие (каппа человека) цепи также были сконструированы. Вариабельные области мыши были слиты с константной областью человека с использованием ПЦР с перекрывающимися праймерами, включая (в следующем порядке): 5' HindIII рестрикционный сайт, консенсусную последовательность Козак, аминотерминальную сигнальную последовательность, вариабельную область мыши, IgG1 человека или каппа-константную область, стоп-кодон и 3' сайт рестрикции EcoRI.

[0234] Гуманизированные и химерные тяжелые цепи субклонировали в рЕЕ6.4 (Lonza Biologies) с помощью сайтов HindIII и EcoRI с использованием In-Fusion™ PCR cloning (Clontech). Гуманизированные и химерные легкие каппа-цепи субклонировали в рЕЕ14.4 (Lonza Biologies) с помощью сайтов HindIII и EcoRI с использованием In-Fusion™ PCR cloning.

[0235] Цепи гуманизированных антител или цепи химерных антител временно трансфицировали в клетки 293Т для продукции антитела. Антитело либо очищали, либо использовали в супернатанте клеточной культуральной среды для последующего анализа in vitro. Связывание химерных и гуманизированных антител с ErbB3 человека измеряли, как описано ниже. Результаты суммируются в таблице 15.

[0236] Дополнительно, некоторые комбинации тяжелых и легких цепей гуманизированных антител стабильно экспрессировали в клетках CHOK1SV с использованием GS System™ (Lonza Biologies) для того, чтобы получить большие количества очищенных гуманизированных антител. Единый вектор экспрессии сконструировали путем объединения векторов на основе рЕЕ6.4 и рЕЕ14.4. Во-первых, рЕЕ6.4, содержащий кДНК гуманизированной тяжелой цепи полной длины, был расщеплен с помощью NotI и Sall, чтобы изолировать промотор HCMV-MIE + кДНК гуманизированной тяжелой цепи полной длины + SV40 поли-(А) фрагмент. Этот фрагмент был вставлен в вектор рЕЕ14.4, уже содержащий кДНК гуманизированной легкой цепи полной длины, с помощью сайтов NotI/Sall, создавая тем самым вектор экспрессии, который одновременно экспрессирует тяжелые и легкие цепи. Вектор комбинированной тяжелой и легкой цепи линеаризовали и трансфицирован в клетки CHOK1SV. Стабильные клоны отбирали в присутствии сульфоксимина метионина.

[0237] Каждая из возможных комбинаций вариабельных областей тяжелой цепи гуманизированного иммуноглобулина и легкой цепи иммуноглобулина изложена ниже в табл.9.

Таблица 9
Вариабельный участок легкой цепи Вариабельный участок тяжелой цепи
Hu24C05 KvA (SEQ ID NO:174) Hu24C05 HvA (SEQ ID NO: 162)
Hu24C05 KvA (SEQ ID NO:174) Sh24C05 Hv3-21 (SEQ ID NO: 156)
Hu24C05 KvA (SEQ ID NO:174) Sh24C05 Hv3-23 (SEQ ID NO: 158)
Hu24C05 KvA (SEQ ID NO:174) Sh24C05 Hv3-30 (SEQ ID NO: 160)
Hu24C05 KvA (SEQ ID NO:174) Sh24C05 Hv3-7 (SEQ ID NO: 150)
Hu24C05 KvA (SEQ ID NO:174) Sh24C05 Hv3-11 (SEQ ID NO: 152)
Hu24C05 KvA (SEQ ID NO:174) Sh24C05 Hv3-11 N62S (SEQ ID NO: 154)
Sh24C05 Kv1-16 (SEQ ID NO: 166) Hu24C05 HvA (SEQ ID NO: 162)
Sh24C05 Kv1-16 (SEQ ID NO: 166) Sh24C05 Hv3-21 (SEQ ID NO: 156)
Sh24C05 Kv1-16 (SEQ ID NO; 166) Sh24C05 Hv3-23 (SEQ ID NO: 158)
Sh24C05 Kv1-16 (SEQ ID NO: 166) Sh24C05 Hv3-30 (SEQ ID NO: 160)
Sh24C05 Kv1-16 (SEQ ID NO: 166) Sh24C05 Hv3-7 (SEQ ID NO: 150)
Sh24C05 Kv1-16 (SEQ ID NO: 166) Sh24C05 Hv3-11 (SEQ ID NO: 152)
Sh24C05 Kv1-16 (SEQ ID NO: 166) Sh24C05 Hv3-11 N62S (SEQ ID NO: 154)
Sh24C05 Kv1-17 (SEQ ID NO: 168) Hu24C05 HvA (SEQ ID NO: 162)
Sh24C05 Kv1-17 (SEQ ID NO: 168) Sh24C05 Hv3-21 (SEQ ID NO: 156)
Sh24C05 Kv1-17 (SEQ ID NO: 168) Sh24C05 Hv3-23 (SEQ ID NO: 158)
Sh24C05 Kv1-17 (SEQ ID NO: 168) Sh24C05 Hv3-30 (SEQ ID NO: 160)
Sh24C05 Kv1-17 (SEQ ID NO: 168) Sh24C05 Hv3-7 (SEQ ID NO: 150)
Sh24C05 Kv1-17 (SEQ ID NO: 168) Sh24C05 Hv3-11 (SEQ ID NO: 152)
Sh24C05 Kv1-17 (SEQ ID NO: 168) Sh24C05 Hv3-11 N62S (SEQ ID NO: 154)
Sh24C05 Kv1-33 (SEQ ID NO: 170) Hu24C05 HvA (SEQ ID NO: 162)
Sh24C05 Kv1-33 (SEQ ID NO: 170) Sh24C05 Hv3-21 (SEQ ID NO: 156)
Sh24C05 Kv1-33 (SEQ ID NO: 170) Sh24C05 Hv3-23 (SEQ ID NO: 158)
Sh24C05 Kv1-33 (SEQ ID NO: 170) Sh24C05 Hv3-30 (SEQ ID NO: 160)
Sh24C05 Kv1-33 (SEQ ID NO: 170) Sh24C05 Hv3-7 (SEQ ID NO: 150)
Sh24C05 Kv1-33 (SEQ ID NO: 170) Sh24C05 Hv3-11 (SEQ ID NO: 152)
Sh24C05 Kv1-33 (SEQ ID NO: 170) Sh24C05 Hv3-11 N62S (SEQ ID NO: 154)
Sh24C05 Kv1-9 (SEQ ID NO: 164) Hu24C05 HvA (SEQ ID NO: 162)
Таблица 9 (Продолжение)
Вариабельный участок легкой цепи Вариабельный участок тяжелой цепи
Sh24C05 Kv1-9 (SEQ ID NO: 164) Sh24C05 Hv3-21 (SEQ ID NO: 156)
Sh24C05 Kv1-9 (SEQ ID NO: 164) Sh24C05 Hv3-23 (SEQ ID NO: 158)
Sh24C05 Kv1-9 (SEQ ID NO: 164) Sh24C05 Hv3-30 (SEQ ID NO: 160)
Sh24C05 Kv1-9 (SEQ ID NO: 164) Sh24C05 Hv3-7 (SEQ ID NO: 150)
Sh24C05 Kv1-9 (SEQ ID NO: 164) Sh24C05 Hv3-11 (SEQ ID NO: 152)
Sh24C05 Kv1-9 (SEQ ID NO: 164) Sh24C05 Hv3-11 N62S (SEQ ID NO: 154)
Sh24C05 Kv1-39 (SEQ ID NO: 172) Hu24C05 HvA (SEQ ID NO: 162)
Sh24C05 Kv1-39 (SEQ ID NO: 172) Sh24C05 Hv3-21 (SEQ ID NO: 156)
Sh24C05 Kv1-39 (SEQ ID NO: 172) Sh24C05 Hv3-23 (SEQ ID NO: 158)
Sh24C05 Kv1-39 (SEQ ID NO: 172) Sh24C05 Hv3-30 (SEQ ID NO: 160)
Sh24C05 Kv1-39 (SEQ ID NO: 172) Sh24C05 Hv3-7 (SEQ ID NO: 150)
Sh24C05 Kv1-39 (SEQ ID NO: 172) Sh24C05 Hv3-11 (SEQ ID NO: 152)
Sh24C05 Kv1-39 (SEQ ID NO: 172) Sh24C05 Hv3-11 N62S (SEQ ID NO: 154)

[0238] Последовательности нуклеиновых кислот, кодирующие, и последовательности белков, определяющие вариабельные области гуманизированных антител 24С05, сведены ниже (аминотерминальные сигнальные пептидные последовательности не показаны). Последовательности CDR (определение Kabat) в аминокислотных последовательностях показаны жирным шрифтом и подчеркнуты.

[0239] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи Sh24C05 Hv3-7 (SEO ID NO: 149)

[0240] Последовательность белка, определяющая вариабельную область тяжелой цепи Sh24C05 Hv3-7 (SEQ ID NO: 150)

[0241] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи Sh24C05 Hv3-11 (SEQ ID NO: 151)

[0242] Последовательность белка, определяющая вариабельную область тяжелой цепи Sh24C05 Hv3-11 (SEQ ID NO: 152)

[0243] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи Sh24C05 Hv3-11 N62S (SEQ ID NO: 153)

[0244] Последовательность белка, определяющая вариабельную область тяжелой цепи Sh24C05 Hv3-11 N62S (SEQ ID NO: 154)

[0245] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи Sh24C05 Hv3-21 (SEQ ID NO: 155)

[0246] Последовательность белка, определяющая вариабельную область тяжелой цепи Sh24C05 Hv3-21 (SEQ ID NO: 156)

[0247] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи Sh24C05 Hv3-23 (SEQ ID NO: 157)

[0248] Последовательность белка, определяющая вариабельную область тяжелой цепи Sh24C05 Hv3-23 (SEQ ID NO: 158)

[0249] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи Sh24C05 Hv3-30 (SEQ ID NO: 159)

[0250] Последовательность белка, определяющая вариабельную область тяжелой цепи Sh24C05 Hv3-30 (SEQ ID NO: 160)

[0251] Последовательность нуклеиновой кислоты, кодирующая вариабельную область тяжелой цепи Hu24C05 HvA (SEQ ID NO: 161)

[0252] Последовательность белка, определяющая вариабельную область тяжелой цепи Hu24C05 HvA (SEQ ID NO: 162)

[0253] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи Sh24C05 Kv1-9 (SEQ ID NO: 163)

[0254] Последовательность белка, определяющая вариабельную область каппа-цепи Sh24C05 Kv1-9 (SEQ ID NO: 164)

[0255] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи Sh24C05 Kv1-16 (SEQ ID NO: 165)

[0256] Последовательность белка, определяющая вариабельную область каппа-цепи Sh24C05 Kv1-16 (SEQ ID NO: 166)

[0257] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи Sh24C05 Kv1-17 (SEQ ID NO: 167)

[0258] Последовательность белка, определяющая вариабельную область каппа-цепи Sh24C05 Kv1-17 (SEQ ID NO: 168)

[0259] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи Sh24C05 Kv1-33f (SEQ ID NO: 169)

[0260] Последовательность белка, определяющая вариабельную область каппа-цепи Sh24C05 Kv1-33 (SEQ ID NO: 170)

[0261] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи Sh24C05 Kv1-39 (SEQ ID NO: 171)

[0262] Последовательность белка, определяющая вариабельную область каппа-цепи Sh24C05 Kv1-39 (SEQ ID NO: 172)

[0263] Последовательность нуклеиновой кислоты, кодирующая вариабельную область каппа-цепи Hu24C05 (SEQ ID NO: 173)

[0264] Последовательность белка, определяющая вариабельную область каппа-цепи Hu24C05 KvA (SEQ ID NO: 174)

[0265] Аминокислотные последовательности, определяющие вариабельные области тяжелой цепи иммуноглобулина для антител, полученных в Примере 12, выстроены на ФИГ.15. Аминотерминальные сигнальные пептидные последовательности (для правильной экспрессии/секреции) не показаны. CDR1, CDR2, и CDR3 (определение Kabat) обозначены рамками.

[0266] Аминокислотные последовательности, определяющие вариабельные области легкой цепи иммуноглобулина для антител в Примере 12, выстроены на ФИГ.16. Аминотерминальные сигнальные пептидные последовательности (для правильной экспрессии/секреции) не показаны. CDR1, CDR2 и CDR3 обозначены рамками.

[0267] Таблица 10 представляет собой карту соответствий, показывающую SEQ ID NO. каждой последовательности, описанной в данном Примере.

Таблица 10
SEQ. ID NO. Нуклеиновая кислота или белок
149 Sh24C05 Hv3-7 Вариабельная область тяжелой цепи - нуклеиновая кислота
150 Sh24C05 Hv3-7 Вариабельная область тяжелой цепи - белок
57 Sh24C05 Hv3-7 CDR1 тяжелой цепи
58 Sh24C05 Hv3-7 CDR2 тяжелой цепи
59 Sh24C05 Hv3-7 CDR3 тяжелой цепи
151 Sh24C05 Hv3-11 Вариабельная область тяжелой цепи - нуклеиновая кислота
152 Sh24C05 Hv3-11 Вариабельная область тяжелой цепи - белок
57 Sh24C05 Hv3-11 CDR1 тяжелой цепи
58 Sh24C05 Hv3-11 CDR2 тяжелой цепи
59 Sh24C05 Hv3-11 CDR3 тяжелой цепи
153 Sh24C05 Hv3-11 N62S Вариабельная область тяжелой цепи - нуклеиновая кислота
154 Sh24C05 Hv3-11 N62S Вариабельная область тяжелой цепи - белок
57 Sh24C05 Hv3-11 N62S CDR1 тяжелой цепи
148 Sh24C05 Hv3-11 N62S CDR2 тяжелой цепи
59 Sh24C05 Hv3-11 N62S CDR3 тяжелой цепи
155 Sh24C05 Hv3-21 Вариабельная область тяжелой цепи - нуклеиновая кислота
156 Sh24C05 Hv3-21 Вариабельная область тяжелой цепи - белок
Таблица 10 (Прод.)
SEQ. ID NO. Нуклеиновая кислота или белок
57 Sh24C05 Hv3-21 CDR1 тяжелой цепи
58 Sh24C05 Hv3-21 CDR2 тяжелой цепи
59 Sh24C05 Hv3-21 CDR3 тяжелой цепи
157 Sh24C05 Hv3-23 Вариабельная область тяжелой цепи - нуклеиновая кислота
158 Sh24C05 Hv3-23 Вариабельная область тяжелой цепи - белок
57 Sh24C05 Hv3-23 CDR1 тяжелой цепи
58 Sh24C05 Hv3-23 CDR2 тяжелой цепи
SEQ. ID NO. Нуклеиновая кислота или белок
59 Sh24C05 Hv3-23 CDR3 тяжелой цепи
159 Sh24C05 Hv3-30 Вариабельная область тяжелой цепи - нуклеиновая кислота
160 Sh24C05 Hv3-30 Вариабельная область тяжелой цепи - белок
57 Sh24C05 Hv3-30 CDR1 тяжелой цепи
58 Sh24C05 Hv3-30 CDR2 тяжелой цепи
59 Sh24C05 Hv3-30 CDR3 тяжелой цепи
161 Hu24C05 HvA Вариабельная область тяжелой цепи - нуклеиновая кислота
162 Hu24C05 HvA Вариабельная область тяжелой цепи - белок
57 Hu24C05 HvA CDR1 тяжелой цепи
58 Hu24C05 HvA CDR2 тяжелой цепи
59 Hu24C05 HvA CDR3 тяжелой цепи
163 Sh24C05 Kv1-9 Вариабельная область легкой (каппа) цепи - нуклеиновая кислота
164 Sh24C05 Kv1-9 Вариабельная область легкой (каппа) цепи - белок
60 Sh24C05 Kv1-9 CDR1 легкой (каппа) цепи
61 Sh24C05 Kv1-9 CDR2 легкой (каппа) цепи
62 Sh24C05 Kv1-9 CDR3 легкой (каппа) цепи
165 Sh24C05 Kv1-16 Вариабельная область легкой (каппа) цепи - нуклеиновая кислота
166 Sh24C05 Kv1-16 Вариабельная область легкой (каппа) цепи - белок
Таблица 10 (Прод.)
SEQ. ID NO. Нуклеиновая кислота или белок
60 Sh24C05 Kv1-16 CDR1 легкой (каппа) цепи
61 Sh24C05 Kv1-16 CDR2 легкой (каппа) цепи
62 Sh24C05 Kv1-16 CDR3 легкой (каппа) цепи
167 Sh24C05 Kv1-17 Вариабельная область легкой (каппа) цепи- нуклеиновая кислота
168 Sh24C05 Kv1-17 Вариабельная область легкой (каппа) цепи- белок
60 Sh24C05 Kv1-17 CDR1 легкой (каппа) цепи
61 Sh24C05 Kv1-17 CDR2 легкой (каппа) цепи
SEQ. ID NO. Нуклеиновая кислота или белок
62 Sh24C05 Kv1-17 CDR.3 легкой (каппа) цепи
169 Sh24C05 Kv1-33 Вариабельная область легкой (каппа) цепи - нуклеиновая кислота
170 Sh24C05 Kv1-33 Вариабельная область легкой (каппа) цепи - белок
60 Sh24C05 Kv1-33 CDR1 легкой (каппа) цепи
61 Sh24C05 Kv1-33 CDR2 легкой (каппа) цепи
62 Sh24C05 Kv1-33 CDR3 легкой (каппа) цепи
171 Sh24C05 Kv1-39 Вариабельная область легкой (каппа) цепи - нуклеиновая кислота
172 Sh24C05 Kv1-39 Вариабельная область легкой (каппа) цепи - белок
60 Sh24C05 Kv1-39 CDR1 легкой (каппа) цепи
61 Sh24C05 Kv1-39 CDR2 легкой (каппа) цепи
62 Sh24C05 Kv1-39 СОК3 легкой (каппа) цепи
173 Hu24C05 KvA Вариабельная область легкой (каппа) цепи - нуклеиновая кислота
174 Hu24C05 KvA Вариабельная область легкой (каппа) цепи - белок
60 Hu24C05 KvA CDR1 легкой (каппа) цепи
61 Hu24C05 KvA CDR2 легкой (каппа) цепи
62 Hu24C05 KvA CDR3 легкой (каппа) цепи

[0268] CDR последовательности тяжелой цепи гуманизированного моноклонального антитела (определения по Kabat, Chothia и IMGT) показаны в таблице 11.

Таблица 11
Kabat
CDR1 CDR 2 CDR3
24С05 DYAMS (SEQ ID NO: 57) TISDGGTYTYYPDNVKG (SEQ ID NO: 58) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-7 DYAMS (SEQ ID NO: 57) TISDGGTYTYYPDNVKG (SEQ ID NO: 58) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-11 DYAMS (SEQ ID NO: 57) TISDGGTYTYYPDNVKG (SEQ ID NO: 58) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-11N62S DYAMS (SEQ ID NO: 57) TISDGGTYTYYPDSVKG (SEQ ID NO: 148) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-21 DYAMS (SEQ ID NO: 57) TISDGGTYTYYPDNVKG (SEQ ID NO: 58) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-23 DYAMS (SEQ ID NO: 57) TISDGGTYTYYPDNVKG (SEQ ID NO: 58) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-30 DYAMS (SEQ ID NO: 57) TISDGGTYTYYPDNVKG (SEQ ID NO: 58) EWGDYDGFDY (SEQ ID NO: 59)
Hu24CO 5HvA DYAMS (SEQ ID NO: 57) TISDGGTYTYYPDNVKG (SEQ ID NO: 58) EWGDYDGFDY (SEQ ID NO: 59)
Chothia
CDR 1 CDR2 CDR3
24C05 GFTFSDY (SEQ ID NO: 75) SDGGTY (SEQ ID NO: 76) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-7 GFTFSDY (SEQ ID NO: 75) SDGGTY (SEQ ID NO: 76) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-11 GFTFSDY (SEQ ID NO: 75) SDGGTY (SEQ ID NO: 76) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-11 N62S GFTFSDY (SEQ ID NO: 75) SDGGTY (SEQ ID NO: 76) EWGDYDGFDY (SEQ ID NO: 59)
Таблица 11 (Прод.)
Chothia
CDR 1 CDR2 CDR3
Sh24C05 Hv3-21 GFTFSDY (SEQ ID NO: 75) SDGGTY (SEQ ID NO: 76) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-23 GFTFSDY (SEQ ID NO: 75) SDGGTY (SEQ ID NO: 76) EWGDYDGFDY (SEQ ID NO: 59)
Sh24C05 Hv3-30 GFTFSDY (SEQ ID NO: 75) SDGGTY (SEQ ID NO: 76) EWGDYDGFDY (SEQ ID NO: 59)
Hu24CO 5HvA GFTFSDY (SEQ ID NO: 75) SDGGTY (SEQ ID NO: 76) EWGDYDGFDY (SEQ ID NO: 59)
IMGT
CDR1 CDR2 CDR 3
24C05 GFTFSDYA (SEQ ID NO: 94) ISDGGTYT (SEQ ID NO: 95) AREWGDYDGFDY (SEQ ID NO: 96)
Sh24C05 Hv3-7 GFTFSDYA (SEQ ID NO: 94) ISDGGTYT (SEQ ID NO: 95) AREWGDYDGFDY (SEQ ID NO: 96)
Sh24C05 Hv3-11 GFTFSDYA (SEQ ID NO: 94) ISDGGTYT (SEQ ID NO: 95) AREWGDYDGFDY (SEQ ID NO: 96)
Sh24C05 Hv3-11 N62S GFTFSDYA (SEQ ID NO: 94) ISDGGTYT (SEQ ID NO: 95) AREWGDYDGFDY (SEQ ID NO: 96)
Sh24C05 Hv3-21 GFTFSDYA (SEQ ID NO: 94) ISDGGTYT (SEQ ID NO: 95) AREWGDYDGFDY (SEQ ID NO: 96)
Sh24C05 Hv3-23 GFTFSDYA (SEQ ID NO: 94) ISDGGTYT (SEQ ID NO: 95) AREWGDYDGFDY (SEQ ID NO: 96)
Sh24C05 Hv3-30 GFTFSDYA (SEQ ID NO: 94) ISDGGTYT (SEQ ID NO: 95) AREWGDYDGFDY (SEQ ID NO: 96)
Hu24CO 5HvA GFTFSDYA (SEQ ID NO: 94) ISDGGTYT (SEQ ID NO: 95) AREWGDYDGFDY (SEQ ID NO: 96)

[0269] CDR последовательности легкой каппа-цепи гуманизированного моноклонального антитела (определения по Kabat, Chothia и IMGT) показаны в таблице 12.

Таблица 12
Kabat/Chothia
CDR 1 CDR 2 CDR 3
24C05 RASQEISGYLS (SEQ ID NO: 60) AASTLDS (SEQ ID NO: 61) LQYDSYPYT (SEQ ID NO: 62)
Sh24C05 Kv1-9 RASQEISGYLS (SEQ ID NO: 60) AASTLDS (SEQ ID NO: 61) LQYDSYPYT (SEQ ID NO: 62)
Sh24C05 Kv1-16 RASQEISGYLS (SEQ ID NO: 60) AASTLDS (SEQ ID NO: 61) LQYDSYPYT (SEQ ID NO: 62)
Sh24C05 Kv1-17 RASQEISGYLS (SEQ ID NO: 60) AASTLDS (SEQ ID NO: 61) LQYDSYPYT (SEQ ID NO: 62)
Sh24C05 Kvl-33 RASQEISGYLS (SEQ ID NO: 60) AASTLDS (SEQ ID NO: 61) LQYDSYPYT (SEQ ID NO: 62)
Sh24C05 Kvl-39 RASQEISGYLS (SEQ ID NO: 60) AASTLDS (SEQ ID NO: 61) LQYDSYPYT (SEQ ID NO: 62)
Hu24CO 5KvA RASQEISGYLS (SEQ ID NO: 60) AASTLDS (SEQ ID NO: 61) LQYDSYPYT (SEQ ID NO: 62)
IMGT
CDR1 CDR2 CDR3
24C05 QEISGY (SEQ ID NO: 101) AAS LQYDSYPYT (SEQ ID NO: 62)
Sh24C05 Kv1-9 QEISGY (SEQ ID NO: 101) AAS LQYDSYPYT (SEQ ID NO: 62)
Sh24C05 Kv1-16 QEISGY (SEQ ID NO: 101) AAS LQYDSYPYT (SEQ ID NO: 62)
Sh24C05 Kv1-17 QEISGY (SEQ ID NO: 101) AAS LQYDSYPYT (SEQ ID NO: 62)
Sh24C05 Kv1-33 QEISGY (SEQ ID NO: 101) AAS LQYDSYPYT (SEQ ID NO: 62)
Sh24C05 Kv1-39 QEISGY (SEQ ID NO: 101) AAS LQYDSYPYT (SEQ ID NO: 62)
Hu24CO 5KvA QEISGY (SEQ ID NO: 101) AAS LQYDSYPYT (SEQ ID NO: 62)

[0270] В таблицах 11 и 12 самые длинные CDR последовательности для тяжелой и легкой цепи иммуноглобулина показаны жирным шрифтом.

[0271] Для создания последовательностей тяжелой или каппа-цепи полного химерного и гуманизированного антитела каждую вышеуказанную последовательность вариабельной области комбинируют с соответствующей таковой константной областью человека. Например, полная тяжелая цепь содержит тяжелую вариабельную последовательность, за которой следует константная последовательность тяжелой цепи IgG1 человека или константная последовательность тяжелой цепи IgG2 человека. Полная каппа-цепь содержит каппа вариабельную последовательность, за которой следует константная последовательность легкой каппа-цепи человека.

[0272] Последовательность нуклеиновой кислоты, кодирующая константную область тяжелой цепи IgG1 человека (SEQ ID NO: 175)

[0273] Последовательность белка, определяющая константную область тяжелой цепи IgG1 человека (SEQ ID NO: 176)

[0274] Последовательность нуклеиновой кислоты, кодирующая константную область тяжелой цепи IgG2 человека (SEQ ID NO: 177)

[0275] Последовательность белка, определяющая константную область тяжелой цепи IgG2 человека (SEQ ID NO: 178)

[0276] Последовательность нуклеиновой кислоты, кодирующая константную область легкой каппа-цепи человека (SEQ ID NO: 179)

[0277] Последовательность белка, определяющая константную область легкой каппа-цепи человека (SEO ID NO: 180)

[0278] Следующие последовательности представляют действительные или предполагаемые последовательности тяжелой и легкой цепи полной длины (т.е. содержащие последовательности как вариабельной, так и константной областей) для каждого антитела, описанного в данном Примере. Сигнальные последовательности для правильной секреции антител также включены в 5'-конец последовательностей ДНК или аминотерминальный конец последовательностей белка. Также в данном документе предполагается, что последовательности вариабельной области могут быть сшиты с другими последовательностями константной области для получения активных тяжелой и легкой цепей IgG полной длины.

[0279] Последовательность нуклеиновой кислоты, кодирующая химерную тяжелую цепь 24С05 полной длины (вариабельную область тяжелой цепи мыши и константную область IgG1 человека) (SEQ ID NO: 181)

[0280] Последовательность белка, определяющая химерную тяжелую цепь 24С05 полной длины (вариабельную область тяжелой цепи мыши и константную область IgG1 человека) (SEO ID NO: 182)

[0281] Последовательность нуклеиновой кислоты, кодирующая химерную легкую цепь 24С05 полной длины (вариабельную область каппа-цепи мыши и константную каппа-область человека) (SEQ ID NO: 183)

[0282] Последовательность белка, определяющая химерную легкую цепь 24С05 полной длины (вариабельную область каппа-цепи мыши и константную каппа-область человека) (SEQ ID NO: 184)

[0283] Последовательность нуклеиновой кислоты, кодирующая гуманизированную тяжелую цепь sh24C05 Hv3-7 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 185)

[0284] Последовательность белка, определяющая гуманизированную тяжелую цепь Sh24C05 Hv3-7 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 186)

[0285] Последовательность нуклеиновой кислоты, кодирующая гуманизированную тяжелую цепь Sh24C05 Hv3-11 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEO ID NO: 187)

[0286] Последовательность белка, определяющая гуманизированную тяжелую цепь Sh24C05 Hv3-11 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 188)

[0287] Последовательность нуклеиновой кислоты, кодирующая гуманизированную тяжелую цепь Sh24C05 Hv3-11 N62S IgG1 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 189)

[0288] Последовательность белка, определяющая гуманизированную тяжелую цепь Sh24C05 Hv3-11 N62S IgG1 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 190)

[0289] Последовательность нуклеиновой кислоты, кодирующая гуманизированную тяжелую цепь Sh24C05 Hv3-11 N62S IgG2 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG2 человека) (SEQ ID NO: 191)

[0290] Последовательность белка, определяющая гуманизированную тяжелую цепь Sh24C05 Hv3-11 N62S IgG2 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG2 человека) (SEQ ID NO: 192)

[0291] Последовательность нуклеиновой кислоты, кодирующая гуманизированную тяжелую цепь SH24C05 Hv3-21 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 193)

[0292] Последовательность белка, определяющая гуманизированную тяжелую цепь 24С05 Hv3-21 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 194)

[0293] Последовательность нуклеиновой кислоты, кодирующая гуманизированную тяжелую цепь Sh24C05 Hv3-23 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) CSEO ID NO: 195)

[0294] Последовательность белка, определяющая гуманизированную тяжелую цепь Sh24C05 Hv3-23 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 196)

[0295] Последовательность нуклеиновой кислоты, кодирующая гуманизированную тяжелую цепь Sh24C05 Hv3-30 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 197)

[0296] Последовательность белка, определяющая гуманизированную тяжелую цепь Sh24C05 Hv3-30 полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 198)

[0297] Последовательность нуклеиновой кислоты, кодирующая гуманизированную тяжелую цепь Hu24C05 HvA полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 199)

[0298] Последовательность белка, определяющая гуманизированную тяжелую цепь Hu24C05 HvA полной длины (гуманизированную вариабельную область тяжелой цепи и константную область IgG1 человека) (SEQ ID NO: 200)

[0299] Последовательность нуклеиновой кислоты, кодирующая гуманизированную легкую цепь Sh24C05 Kv1-9 полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 201)

[0300] Последовательность белка, определяющая гуманизированную легкую цепь Sh24C05 Kv1-9 полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 202)

[0301] Последовательность нуклеиновой кислоты, кодирующая гуманизированную легкую цепь Sh24C05 Kv1-16 полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 203)

[0302] Последовательность белка, определяющая гуманизированную легкую цепь Sh24C05 Kv1-16 полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 204)

[0303] Последовательность нуклеиновой кислоты, кодирующая гуманизированную легкую цепь Sh24C05 Kv1-17 полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 205)

[0304] Последовательность белка, определяющая гуманизированную легкую цепь Sh24C05 Kv1-17 полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEO ID NO: 206)

[0305] Последовательность нуклеиновой кислоты, кодирующая гуманизированную легкую цепь Sh24C05 Kv1-33 полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 207)

[0306] Последовательность белка, определяющая гуманизированную легкую цепь Sh24C05 Kv1-33 полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 208)

[0307] Последовательность нуклеиновой кислоты, кодирующая гуманизированную легкую цепь Sh24C05 Kv1-39 полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 209)

[0308] Последовательность белка, определяющая гуманизированную легкую цепь Sh24C05 Kv1-39 полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 210)

[0309] Последовательность нуклеиновой кислоты, кодирующая гуманизированную легкую цепь Hu24C05 KvA полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 211)

[0310] Последовательность белка, определяющая гуманизированную легкую цепь Hu24C05 KvA полной длины (гуманизированную вариабельную область каппа-цепи и константную область человека) (SEQ ID NO: 212)

[0311] Для удобства в таблице 13 приведена карта соответствий, показывающая SEQ ID NO. каждой последовательности, описанной в данном примере.

Таблица 13
SEQ ID NO. Нуклеиновая кислота или белок
175 Константная область IgG1 человека - нуклеиновая кислота
176 Константная область IgG1 человека - белок
177 Константная область IgG2 человека - нуклеиновая кислота
178 Константная область IgG2 человека - белок
179 Константная область каппа-цепи человека - нуклеиновая кислота
180 Константная область каппа-цепи человека - белок
181 Вариабельная область тяжелой цепи химерного 24С05 мыши + константная область IgG1 человека - нуклеиновая кислота
182 Вариабельная область тяжелой цепи химерного 24С05 мыши + константная область IgG1 человека - белок
183 Вариабельная область легкой цепи химерного 24С05 мыши + константная область каппа-цепи человека - нуклеиновая кислота
184 Вариабельная область легкой цепи химерного 24С05 мыши + константная область каппа-цепи человека - белок
185 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-7 человека + константная область IgG1 человека - нуклеиновая кислота
186 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-7 человека + константная область IgG1 человека - белок
187 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-11 человека + константная область IgG1 человека - нуклеиновая кислота
188 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-11 человека + константная область IgG1 человека - белок
189 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-11 N62S IgG1 человека + константная область IgG1 человека - нуклеиновая кислота
190 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-11 N62S IgG1 человека + константная область IgG1 человека - белок
191 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-11 N62S IgG2 человека + константная область IgG2 человека - нуклеиновая кислота
192 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-11 N62S IgG2 человека + константная область IgG2 человека - белок
Таблица 13 (Прод.)
SEQ ID NO. Нуклеиновая кислота или белок
193 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-21 человека + константная область IgG1 человека - нуклеиновая кислота
194 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-21 человека + константная область IgG1 человека - нуклеиновая кислота
195 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-23 человека + константная область IgG1 человека - нуклеиновая кислота
196 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-23 человека + константная область IgG1 человека - белок
197 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-30 человека + константная область IgG1 человека - нуклеиновая кислота
198 Вариабельная область тяжелой цепи гуманизированного Sh24C05 Hv3-30 человека + константная область IgG1 человека - белок
199 Вариабельная область тяжелой цепи гуманизированного Hu24C05 HvA человека + константная область IG1 человека - нуклеиновая кислота
200 Вариабельная область тяжелой цепи гуманизированного Hu24C05 HvA человека + константная область IG1 человека - белок
201 Вариабельная область гуманизированного Sh24C05 Kv1-9 человека + константная область каппа-цепи человека - нуклеиновая кислота
202 Вариабельная область гуманизированного Sh24C05 Kv1-9 человека + константная область каппа-цепи человека - белок
203 Вариабельная область гуманизированного Sh24C05 Kv1-16 человека + константная область каппа-цепи человека - нуклеиновая кислота
204 Вариабельная область гуманизированного Sh24C05 Kv1-16 человека + константная область каппа-цепи человека - белок
205 Вариабельная область гуманизированного Sh24C05 Kv1-17 человека + константная область каппа-цепи человека - нуклеиновая кислота
206 Вариабельная область гуманизированного Sh24C05 Kv1-17 человека + константная область каппа-цепи человека - белок
207 Вариабельная область гуманизированного Sh24C05 Kv1-33 человека + константная область каппа-цепи человека - нуклеиновая кислота
208 Вариабельная область гуманизированного Sh24C05 Kv1-33 человека + константная область каппа-цепи человека - белок
209 Вариабельная область гуманизированного Sh24C05 Kv1-39 человека + константная область каппа-цепи человека - нуклеиновая кислота
210 Вариабельная область гуманизированного Sh24C05 Kv1-39 человека + константная область каппа-цепи человека - белок
Таблица 13 (Прод.)
SEQ ID NO. Нуклеиновая кислота или белок
211 Вариабельная область гуманизированного Hu24C05 KvA человека + константная область каппа-цепи человека - нуклеиновая кислота
212 Вариабельная область гуманизированного Hu24C05 KvA человека + константная область каппа-цепи человека - белок

[0312] В таблице 14 ниже показаны антитела, содержащие тяжелую и легкую цепи химерного иммуноглобулина и каждую из возможных комбинаций тяжелой и легкой цепей гуманизированного иммуноглобулина полной длины.

Таблица 14
Название антитела Легкая цепь Тяжелая цепь
Sh24C05-1 24С05 Химерный каппа (SEQ ID NO:184) GP203 24С05 Химерный тяжелый IgG1 (SEQ ID NO: 182)
Sh24C05-14 Hu24C05 KvA Каппа (SEQ ID NO: 212) Hu24C05 HvA IgG1 (SEQ ID NO; 200)
Sh24C05-15 Hu24C05 KvA Каппа (SEQ ID NO: 212) Sh24C05 Hv3-21 Тяжелый IgG1 (SEQ ID NO: 194)
Sh24C05-16 Hu24C05 KvA Каппа (SEQ ID NO: 212) Sh24C05 Hv3-23 Тяжелый IgG1 (SEQ ID NO: 196)
Sh24C05-17 Hu24C05 KvA Каппа (SEQ ID NO: 212) Sh24C05 Hv3-30 Тяжелый IgG1 (SEQ ID NO: 198)
Sh24C05-18 Hu24C05 KvA Каппа (SEQ ID NO: 212) Sh24C05 Hv3-7 Тяжелый IgG1 (SEQ ID NO: 186)
Sh24C05-19 Hu24C05 KvA Каппа (SEQ ID NO: 212) Sh24C05 Hv3-11 Тяжелый IgG1 (SEQ ID NO: 188)
Sh24C05-19 N62S IgG1 Hu24C05 KvA Каппа (SEQ ID NO: 212) Sh24C05 Hv3-11 N62S Тяжелый IgG1 (SEQ ID NO: 190)
Sh24C05-19 N62S IgG2 Hu24C05 KvA Каппа (SEQ ID NO: 212) Sh24C05 Hv3-11 N62S Тяжелый IgG2 (SEQ ID NO: 192)
Sh24C05-20 Sh24C05 Kv1-16 Каппа (SEQ ID NO: 204) Hu24C05 HvA IgG1 (SEQ ID NO: 200)
Таблица 14 (Прод.)
Название антитела Легкая цепь Тяжелая цепь
Sh24C05-21 Sh24C05 Kv1-16 Каппа (SEQ ID NO: 204) Sh24C05 Hv3-21 Тяжелый IgG1 (SEQ ID NO: 194)
Sh24C05-22 Sh24C05 Kv1-16 Каппа (SEQ ID NO: 204) Sh24C05 Hv3-23 Тяжелый IgG1 (SEQ ID NO: 196)
Sh24C05-23 Sh24C05 Kv1-16 Каппа (SEQ ID NO: 204) Sh24C05 Hv3-30 Тяжелый IgG1 (SEQ ID NO: 198)
Sh24C05-24 Sh24C05 Kv1-16 Каппа (SEQ ID NO: 204) Sh24C05 Hv3-7 Тяжелый IgG1 (SEQ ID NO: 186)
Sh24C05-25 Sh24C05 Kv1-16 Каппа (SEQ ID NO: 204) Sh24C05 Hv3-11 Тяжелый IgG1 (SEQ ID NO: 188)
Sh24C05-25 N62S IgG1 Sh24C05 Kv1-16 Каппа (SEQ ID NO: 204) Sh24C05 Hv3-11 N62S Тяжелый IgG1 (SEQ ID NO: 190)
Sh24C05-25 N62S IgG2 Sh24C05 Kv1-16 Каппа (SEQ ID NO: 204) Sh24C05 Hv3-11 N62S Тяжелый IgG2 (SEQ ID NO: 192)
Sh24C05-26 Sh24C05 Kv1-17 Каппа (SEQ ID NO: 206) Hu24C05 HvA IgG1 (SEQ ID NO: 200)
Sh24C05-27 Sh24C05 Kv1-17 Каппа (SEQ ID NO: 206) Sh24C05 Hv3-21 Тяжелый IgG1 (SEQ ID NO: 194)
Sh24C05-28 Sh24C05 Kv1-17 Каппа (SEQ ID NO: 206) Sh24C05 Hv3-23 Тяжелый IgG1 (SEQ ID NO: 196)
Sh24C05-29 Sh24C05 Kv1-17 Каппа (SEQ ID NO: 206) Sh24C05 Hv3-30 Тяжелый IgG1 (SEQ ID NO: 198)
Sh24C05-30 Sh24C05 Kv1-17 Каппа (SEQ ID NO: 206) Sh24C05 Hv3-7 Тяжелый IgG1 (SEQ ID NO: 186)
Sh24C05-31 Sh24C05 Kv1-17 Каппа (SEQ ID NO: 206) Sh24C05 Hv3-11 Тяжелый IgG1 (SEQ ID NO: 188)
Sh24C05-31N62S IgG1 Sh24C05 Kv1-17 Каппа (SEQ ID NO: 206) Sh24C05 Hv3-11 N62S Тяжелый IgG1 (SEQ ID NO: 190)
Sh24C05-31N62S IgG2 Sh24C05 Kv1-17 Каппа (SEQ ID NO: 206) Sh24C05 Hv3-11 N62S Тяжелый IgG2 (SEQ ID NO: 192)
Таблица 14 (Прод.)
Название антитела Легкая цепь Тяжелая цепь
Sh24C05-32 Sh24C05 Kv1-33 Каппа (SEQ ID NO: 208) Hu24C05 HvA IgG1 (SEQ ID NO: 200)
Sh24C05-33 Sh24C05 Kv1-33 Каппа (SEQ ID NO: 208) Sh24C05 Hv3-21 Тяжелый IgG1 (SEQ ID NO: 194)
Sh24C05-34 Sh24C05 Kv1-33 Каппа (SEQ ID NO: 208) Sh24C05 Hv3-23 Тяжелый IgG1 (SEQ ID NO: 196)
Sh24C05-35 Sh24C05 Kv1-33 Каппа (SEQ ID NO: 208) Sh24C05 Hv3-30 Тяжелый IgG1 (SEQ ID NO: 198)
Sh24C05-36 Sh24C05 Kv1-33 Каппа (SEQ ID NO: 208) Sh24C05 Hv3-7 Тяжелый IgG1 (SEQ ID NO: 186)
Sh24C05-37 Sh24C05 Kv1-33 Каппа (SEQ ID NO: 208) Sh24C05 Hv3-11 Тяжелый IgG1 (SEQ ID NO: 188)
Sh24C05-37 N62S IgG1 Sh24C05 Kv1-33 Каппа (SEQ ID NO: 208) Sh24C05 Hv3-11 N62S Тяжелый IgG1 (SEQ ID NO: 190)
Sh24C05-37 N62S IgG2 Sh24C05 Kv1-33 Каппа (SEQ ID NO: 208) Sh24C05 Hv3-11 N62S Тяжелый IgG2 (SEQ ID NO: 192)
Sh24C05-38 Sh24C05 Kv1-9 Каппа (SEQ ID NO: 202) Hu24C05 HvA IgG1 (SEQ ID NO: 200)
Sh24C05-39 Sh24C05 Kv1-9 Каппа (SEQ ID NO: 202) Sh24C05 Hv3-21 Тяжелый IgG1 (SEQ ID NO: 194)
Sh24C05-40 Sh24C05 Kv1-9 Каппа (SEQ ID NO: 202) Sh24C05 Hv3-23 Тяжелый IgG1 (SEQ ID NO: 196)
Sh24C05-41 Sh24C05 Kv1-9 Каппа (SEQ ID NO: 202) Sh24C05 Hv3-30 Тяжелый IgG1 (SEQ ID NO: 198)
Sh24C05-42 Sh24C05 Kv1-9 Каппа (SEQ ID NO: 202) Sh24C05 Hv3-7 Тяжелый IgG1 (SEQ ID NO: 186)
Sh24C05-43 Sh24C05 Kv1-9 Каппа (SEQ ID NO: 202) Sh24C05 Hv3-11 Тяжелый IgG1 (SEQ ID NO: 188)
Sh24C05-43 N62S IgG1 Sh24C05 Kvl-9 Каппа (SEQ ID NO: 202) Sh24C05 Hv3-11 N62S Тяжелый IgG1 (SEQ ID NO: 190)
Таблица 14 (Прод.)
Название антитела Легкая цепь Тяжелая цепь
Sh24C05-43 N62S IgG2 Sh24C05 Kv1-9 Каппа (SEQ ID NO: 202) Sh24C05 Hv3-11 N62S Тяжелый IgG2 (SEQ ID NO: 192)
Sh24C05-44 Sh24C05 Kv1-39 Каппа (SEQ ID NO: 210) Hu24C05 HvA IgG1 (SEQ ID NO: 200)
Sh24C05-45 Sh24C05 Kv1-39 Каппа (SEQ ID NO: 210) Sh24C05 Hv3-21 Тяжелый IgG1 (SEQ ID NO: 194)
Sh24C05-46 Sh24C05 Kv1-39 Каппа (SEQ ID NO: 210) Sh24C05 Hv3-23 Тяжелый IgG1 (SEQ ID NO: 196)
Sh24C05-47 Sh24C05 Kv1-39 Каппа (SEQ ID NO: 210) Sh24C05 Hv3-30 Тяжелый IgG1 (SEQ ID NO: 198)
Sh24C05-48 Sh24C05 Kv1-39 Каппа (SEQ ID NO: 210) Sh24C05 Hv3-7 Тяжелый IgG1 (SEQ ID NO: 186)
Sh24C05-49 Sh24C05 Kv1-39 Каппа (SEQ ID NO: 210) Sh24C05 Hv3-11 Тяжелый IgG1 (SEQ ID NO: 188)
Sh24C05-49 N62S IgG1 Sh24C05 Kv1-39 Каппа (SEQ ID NO: 210) Sh24C05 Hv3-11 N62S Тяжелый IgG1 (SEQ ID NO: 190)
Sh24C05-49 N62S IgG2 Sh24C05 Kv1-39 Каппа (SEQ ID NO: 210) Sh24C05 Hv3-11 N62S Тяжелый IgG2 (SEQ ID NO: 192)

[0313] Конструкт антитела, содержащий химерные тяжелую и легкую цепи полной длины, указан ниже:

Химерный 24С05 = Тяжелая цепь полной длины химерного 24С05 (вариабельная область мыши и константная область IgG1 человека) (SEQ ID NO: 182) плюс легкая цепь полной длины химерного 24С05 (вариабельная область мыши и каппа-константная область человека) (SEQ ID NO: 184)

[0314] Четыре из возможных конструктов антител, содержащих тяжелую и легкую цепи полной длины иммуноглобулина, содержащие гуманизированные вариабельные области, указаны ниже.

Sh24C05-25 N62S IgG1 = Гуманизированная вариабельная область тяжелой цепи Sh24C05 Hv3-11 N62S и константная область IgG1 человека (SEQ ID NO: 190) плюс вариабельная область легкой цепи Sh24C05 Kv1-16 и каппа-константная область человека (SEQ ID NO: 204)

Sh24C05-25 N62S IgG2 = Гуманизированная вариабельная область тяжелой цепи Sh24C05 Hv3-11 N62S и константная область IgG2 человека (SEQ ID NO: 192) плюс вариабельная область легкой цепи Sh24C05 Kv1-16 и каппа-константная область человека (SEQ ID NO: 204)

Sh24C05-31 N62S IgG1 = Гуманизированная вариабельная область тяжелой цепи Sh24C05 Hv3-11 N62S и константная область IgG1 человека (SEQ ID NO: 190) плюс вариабельная область легкой цепи Sh24C05 Kv1-17 и каппа-константная область человека (SEQ ID NO: 206)

Sh24C05-31 N62S IgG2 = Гуманизированная вариабельная область тяжелой цепи Sh24C05 Hv3-11 N62S и константная область IgG2 человека (SEQ ID NO: 192) плюс вариабельная область легкой цепи Sh24C05 Kv1-17 и каппа-константная область человека (SEQ ID NO: 206)

В. Связывающие аффинности гуманизированных и химерных моноклональных антител к ErbB3

[0315] Связывающие аффинности и кинетики взаимодействия моноклональных антител, полученных в примере 12, к рекомбинантному мономерному белку ErbB3 человека (расщепленному rhErbB3) измеряли с помощью поверхностного плазмонного резонанса с использованием прибора Biacore® Т 100 (Biacore). Мономерный ErbB3 получали путем протеазного расщепления rhErbB3-Fc (R&D Systems, № по кат. 348-RB).

[0316] Антитело козы к Fc IgG человека (Jackson ImmunoResearch, № по кат. 109-005-098) иммобилизировали на сенсорных чипах СМ4 с карбоксиметилированным декстраном (Biacore, № по кат. BR-1005-34) путем аминного связывания (Biacore, № по кат. BR-1000-50) с использованием стандартного протокола связывания в соответствии с инструкциями поставщика. Анализы проводили при 37°С с использованием PBS (Invitrogen, № по кат. 14040-133), содержащего 0,05% сурфактанта Р20 (Biacore, № по кат. BR-1000-54) в качестве подвижного буфера.

[0317] Антитела захватывались в отдельные проточные ячейки при скорости потока 60 мкл/мин. Время впрыскивания варьировали для каждого антитела так, чтобы достичь Rmax между 30 и 60 RU. Буфер или расщепленный rhErbB3, разведенный в подвижном буфере, впрыскивали последовательно над стандартной поверхностью (без захваченного антитела) и активной поверхностью (тестируемое антитело) в течение 300 секунд при 60 мкл/мин. Фазу диссоциации контролировали в течение вплоть до 1200 секунд. Поверхность затем регенерировали путем двух 60-секундных впрыскиваний глицина, рН 2,25 (получен из глицина рН 2,0 (Biacore, № по кат. BR-1003-55) и рН 2,5 (Biacore, № по кат. BR-1003-56)) при 60 мкл/мин. Для первоначального скрининга тестировали только одну или две концентрации расщепленного rhErbB3, как правило, 5,0 и 1,25 нМ (результаты суммированы в таблице 15).

[0318] Кинетические параметры определяли с использованием кинетической функции программного обеспечения BIAevaluation (Biacore) с вычитанием двойного контроля. Определяли кинетические параметры для каждого антитела, ka (константа скорости ассоциации), kd (константа скорости диссоциации) и KD (равновесная константа диссоциации). Исходные моноклональные антитела подвергли скринингу с использованием супернатанта среды клеточной культуры, содержащей секретируемые антитела, и кинетические значения моноклональных антител относительно расщепленного rhErbB3 при 37°С суммируются в таблице 15.

Таблица 15
Антитело ka (1/Mc) kd (1/c) KD (M) n
Sh24C05-1 2,52E+06 4,48E-04 1,78E-10 3
Sh24C05-14 2,88E+06 4,98E-04 1,73E-10 2
Sh24C05-15 2,67E+06 4,99E-04 1,87E-10 2
Sh24C05-16 2,75E+06 4,04E-04 1,47E-10 2
Sh24C05-17 2,79E+06 4,17E-04 1,50E-10 2
Sh24C05-18 2,88E+06 4,63E-04 1,61E-10 2
Sh24C05-19 3,00E+06 2,55E-04 8,55E-11 2
Sh24C05-20 2,67E+06 5,91E-04 2,21E-10 2
Sh24C05-21 3,11E+06 6,62E-04 2,20E-10 2
Sh24C05-22 2,79E+06 6,01E-04 2,16E-10 2
Sh24C05-23 2,79E+06 7,21E-04 2,63E-10 2
Sh24C05-24 2,90E+06 6,28E-04 2,18E-10 2
Sh24C05-25 2,63E+06 4,59E-04 1,75E-10 2
Sh24C05-26 3,36E+06 7,39E-04 2,20E-10 2
Sh24C05-27 3,34E+06 7,98E-04 2,40E-10 2
Sh24C05-28 3,26E+06 6,14E-04 1,89E-10 2
Sh24C05-29 3,25E+06 5,88E-04 1,82E-10 2
Таблица 15 (Прод.)
Антитело ka (1/Mc) kd (1/c) KD (М) n
Sh24C05-30 4,48Е+06 7,87E-04 1,90E-10 2
Sh24C05-31 3,47E+06 2,92E-04 8,65E-11 2
Sh24C05-32 9,98E+06 6,02E-03 6,03E-10 1
Sh24C05-33 4,02E+06 4,33E-03 1,08E-09 1
Sh24C05-34 1,09E+07 6,00E-03 5,52E-10 1
Sh24C05-35 8,44E+06 5,53E-03 6,55E-10 1
Sh24C05-36 5,18E+06 4,34E-03 8,37E-10 1
Sh24C05-37 5,94E+06 2,00E-03 3,74E-10 2
Sh24C05-38 2,71E+07 1,54E-02 5,67E-10 1
Sh24C05-39 1,18E+07 9,67E-03 8,19E-10 1
Sh24C05-40 2,11E+07 1,06E-02 5,03E-10 1
Sh24C05-41 1,81E+07 1,21E-02 6,69E-10 1
Sh24C05-42 7,35E+06 6,82E-03 9,27E-10 1
Sh24C05-43 6,16E+06 3,58E-03 5,82E-10 1
Sh24C05-44 7,96E+06 5,12E-03 6,44E-10 1
Sh24C05-45 8,57E+06 6,06E-03 7,07E-10 1
Sh24C05-46 7,99E+06 4,40E-03 5,51E-10 1
Sh24C05-47 7,98E+06 4,41E-03 5,53E-10 1
Sh24CQ5-48 8,72E+06 4,90E-03 5,62E-10 1
Sh24C05-49 4,08E+06 1,70E-03 4,16E-10 2

[0319] Результаты в таблице 15 демонстрируют, что химерные и каждое из гуманизированных антител 24С05 обладают быстрыми скоростями ассоциации (ka), очень медленными скоростями диссоциации (kd) и очень высокими аффинностями (KD). В частности, антитела имеют аффинности в пределах от около 87 пМ до около 1 нМ.

[0320] Также определяли связывающие аффинности и кинетику конкретных очищенных моноклональных антител. Для дальнейшей характеристики конкретных антител проводили эксперименты с плазменным поверхностным резонансом, описываемые выше, с использованием концентраций расщепленного rhErbB3 между 0,3125 нМ и 5,0 нМ (2-кратные серийные разведения).

[0321] Кинетические значения конкретных очищенных моноклональных антител (т.е. Sh24C05-1, Sh24C05-25, Sh24C05-25 N62S IgG1, Sh24C05-25 N62S IgG2, Sh24C05-31, Sh24C05-31 N62S IgG1 и Sh24C05-31 N62S IgG2) на расщепленном rhErbB3 при 37°С суммированы в таблице 16.

Таблица 16
Антитело ka (1/Мc) kd (1/с) KD (М) n
Sh24C05-1 3,5Е+06 4,4Е-04 1,4Е-10 3
Sh24C05-25 4,0Е+06 5,0Е-04 1,3Е-10 4
Sh24C05-25 N62S IgG1 2,9Е+06 4,5Е-04 1,6Е-10 4
Sh24C05-25 N62S IgG2 2,7Е+06 3,4Е-04 1,2Е-10 4
Sh24C05-31 4,7Е+06 2,8Е-04 6,3Е-11 3
Sh24C05-31 N62S IgG1 3,5Е+06 2,7Е-04 7,6Е-11 6
Sh24C05-31 N62S IgG2 3,2Е+06 2,4Е-04 7,4Е-11 3

[0322] Результаты в таблице 16 демонстрируют, что связывающие аффинности очищенных антител находятся в пределах от около 63 пМ до около 160 пМ, когда тестируются при 37°С.

С.Сравнение других антител к ErbB3

[0323] Три антитела человека, которые ингибируют функцию ErbB3 человека, сконструировали и экспрессировали с использованием опубликованной информации. Одно антитело, называемое как АЬ #6, сконструировали как антитело человека IgG2/Лямбда, на основании раскрытия Schoeberi et al., US 2009/0291085 (Merrimack Pharmaceuticals, Inc.). Два дополнительных антитела, называемые как U1-53 и U1-59, сконструировали как антитела человека IgG1/Каппа, на основании раскрытия Rothe et al., US 2008/0124345 (U3 Pharma AG and Amgen, Inc.).

[0324] Кинетические параметры для антител Ab#6, U1-53 и U1-59 определили посредством Biacore при 37°С с использованием расщепленного rhErbB3 (мономера), описываемого выше (См. Раздел В. Связывающие аффинности гуманизированных и химерных моноклональных антител к ErbB3). Как сенсограммы Biacore (ФИГ.17), так и кинетические значения (Таблица 17) показаны для каждого антитела.

Таблица 17
Антитело ka (1/Mc) kd (1/c) KD (M) n
Sh24C05-31 N62S IgG1 3,5+06 2,7E-04 7,6E-11 6
Ab#6 9,3E+05 1,9E-04 2,3E-10 3
U1-59 1,8E+06 9,4E-04 5,3E-10 3
U1-53 - - - -

[0325] Результаты в таблице 17 демонстрируют, что общая равновесная константа диссоциации (KD) для Sh24C05-31 N62S IgG1 (76 пМ) была меньше (т.е. более высокая аффинность), чем KD для антител Ab#6 и U1-59 (230 пМ (p<0,01) и 530 пМ (p<0,0005), соответственно). Равновесную константу диссоциации (KD) для U1-53 не смогли определить из-за слабого подбора кривой (см. ФИГ.17, на которой показана высокая Кдис U1-53). KD антител Ab#6, U1-53 и U1-59 можно также сравнить с другими гуманизированные вариантами 24С05, сравнивая таблицы 16 и 17.

[0326] Таким образом, аффинность для Sh24C05-31 N62S IgG1 значительно выше, чем аффинность Ab#6 и U1-59, как раскрывается в данном документе.

Пример 13 - Активность нейтрализации для гуманизированных антител к ErbB3

[0327] В этом примере гуманизированные антитела, полученные в Примере 12, тестировали в отношении их способности ингибировать связывание rhErbB3 с NRG1-β1 посредством ECL-анализа. 96-луночные стандартные планшеты для связывания Multi-array (Meso Scale Discovery, № по кат. L15XA-3) покрывали 50 мкл 0,5 мкг/мл rhErbB3/Fc (R&D Systems, № по кат. 348-RB) в PBS (Invitrogen, № по кат. 14040-133) в течение одного часа при комнатной температуре без встряхивания. Планшеты затем промывали три раза PBS +0,1% Tween 20 (Sigma P5927) и блокировали 200 мкл 100% лошадиной сыворотки, инактивированной нагреванием (GIBCO, № по кат. 26050-088) в течение 1,5 часов при комнатной температуре. После трехразового промывания планшетов PBS +0,1% Tween в планшеты добавляли 25 мкл разведении антитела в течение еще одного часа при комнатной температуре со встряхиванием. Лиганд NRG1-β1 (R&D Systems, № по кат. 377-НВ, 26 кДа) добавляли в лунки в конечной концентрации 0,25 мкг/мл. Планшеты промывали три раза PBS +0,1% Tween и инкубировали с 25 мкл 1 мкг/мл биотинилированного антитела к NRG1-β1 человека (R&D Systems, кат. Нет BAF377), проинкубированного в течение одного часа с SULTO-TAG Streptavidin (Meso Scale Discovery, № по кат. R32AD-5), в течение одного часа при комнатной температуре со встряхиванием. Планшеты затем промывали три раза PBS +0,1% Tween, и в каждую лунку добавляли 150 мкл IX буфера для считывания (Meso Scale Discovery, № по кат. R92TC-1) перед тем, как планшеты анализировали на приборе Sector® Imager 2400 (Meso Scale Discovery).

[0328] Взаимодействие NRG1-β1 с rhErbB3 ингибировалось антителами Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 и Sh24C05-31 N62S-IgG2 (ФИГ.18а). Антитело Ab#6 IgG2, описываемое в Schoeberi et al. (выше), и антитела U1-53 и U1-59, описываемые в Rothe et al. (выше), также протестировали на их способность ингибировать связывание ErbB3 с NRG1-β1. Как показано на ФИГ.18В, каждое из антител Ab#6 IgG2, U1-53 и U1-59 ингибирует связывание ErbB3 с NRG1-β1.

[0329] Значения IC50 гуманизированных антител 24С05 в отношении нейтрализации связывания NRG1-β1 с hErbB3 (т.е. Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 и Sh24C05-31-N62S IgG2) были вычислены и суммированы в таблице 18. Значения IC50 для активности нейтрализации NRG1-β1 антителами человека к ErbB3, Ab#6 IgG2, U1-53 и U1-59, также показаны в таблице 18.

Таблица 18
IC50 (нм)
Антитело Среднее Стандартное отклонение n
Sh24C05-25 N62S-IgG1 0,1219 0,0173 4
Sh24C05-25 N62S-IgG2 0,1117 0,0154 4
Sh24C05-31 N62S-IgG1 0,1242 0,0391 5
Sh24C05-31 N62S-IgG2 0,0860 0,0588 4
U1-53 0,1128 0,0615 3
U1-59 0,3181 0,0274 3
Ab#6 IgG2 1,5161 0,5883 5

[0330] Результаты в таблице 18 демонстрируют, что антитела Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 и Sh24C05-31 N62S-IgG2 эффективно нейтрализировали связывание NRG1-β1 с rhErbB3. Хотя антитела человека к ErbB3, Ab#6 IgG2, U1-53 и U1-59, также показали активность нейтрализации, гуманизированные антитела Sh24C05 (т.е. Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgGl и Sh24C05-31 N62S-IgG2) имели превосходящую способность к нейтрализации, чем U1-59 или Ab#6 IgG2.

Пример 14 - Антипролиферативная активность

[0331] В данном примере гуманизированные антитела, полученные в Примере 12, тестировали в отношении их способности ингибировать NRG1-β1-зависимую пролиферацию клеток в клеточной системе BaF/3, разработанной для экспрессии как Her2, так и ErbB3 человека.

[0332] Клетки BaF/3, экспрессирующие рецепторы Her2 и ErbB3, описываемые в примере 6, обрабатывали антителами к ErbB3 в отсутствии кондиционированной WEHI среды, но в присутствие NRG1-β1 (100 нг/мл). Анализы проводили в 96-луночном планшете (5000 клеток на лунку) в присутствии NRG1-β1 (100 нг/мл) и различных концентрациях антител (0,018-5000 нг/мл в конечного объеме 100 мкл). МТТ-анализы (3-(4,5-диметилтиазол-2-ил)-2,5-дифенилтетразолия бромид) проводили через 3-4 дня после стимуляции NRG1-β1.

[0333] Результаты демонстрируют, что Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 и Sh24C05-31 N62S-IgG2 ингибировали NRG-индуцированную пролиферацию клеток Her2/ErbB3 - BaF/3 дозозависимым образом (ФИГ.19А).

[0334] Значения IC50 для ингибирования пролиферации NRG1-β1-зависимой линии клеток Her2/ErbB3-BaF/3 гуманизированными антителами 24С05 (т.е. Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1, Sh24C05-31 N62S-IgG2) рассчитали и суммировали в таблице 19.

Таблица 19
Her2/ErbB3-BaF/3, NRG1-β1-зависимая пролиферация
Антитело IC50 (нм) - Среднее Стандартное отклонение n
Sh24C05-25 N62S-IgG1 0,0981 0,0187 2
Sh24C05-25 N62S-IgG2 0,2482 0,0124 2
Sh24C05-31 N62S-IgG1 0,1245 0,0181 5
Sh24C05-31N62S-IgG2 0,2392 0,0217 2
U1-53 0,8128 0,0268 3
U1-59 0,8364 0,0434 5
Ab#6 IgG2 6,3015 0,8577 2

[0335] Результаты в таблице 19 демонстрируют, что антитела Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 и Sh24C05-31 N62S-IgG2 сильно ингибировали NRG1-β1-индуцированную пролиферацию клеток BaF/3, экспрессирующих Her2/ErbB3.

[0336] Ингибиторную активность антител к ErbB3, Ab#6 IgG2, U1-53 и U1-59, также тестировали в анализе NRG1-β1-зависимой пролиферации клеток Her2/ErbB3-BaF/3. Показанные на ФИГ.19В результаты демонстрируют, что антитела Ab#6 IgG2, U1-53 и U1-59 ингибировали NRG-индуцированную пролиферацию клеток Her2/ErbB3-BaF/3 дозозависимым образом. Данные ингибирования NRG1-β1-зависимой пролиферации клеток Her2/ErbB3-BaF/3 антителами Ab#6 IgG2, U1-53 и U1-59 суммированы в таблице 19. Результаты в таблице 19 демонстрируют, что антитела Ab#6 IgG2, U1-53 и U1-59 ингибировали NRG1-β1-индуцированную пролиферацию клеток Her2/ErbB3-BaF/3. Сравнение ингибиторной активности протестированных антител к ErbB3 в анализе NRG1-β1-зависимой пролиферации клеток Her2/ErbB3-BaF/3 указывает, что ингибиторная активность гуманизированных антител Sh24C05 превосходит ингибиторную активность антител Ab#6 IgG2, U1-53 и U1-59 (напр., IC50 составила 0,1245 нМ для Sh24C05-31 N62S-IgG1, по сравнению с 0,8128 нМ для U1-53).

Пример 15 - Ингибирование нисходящего сигнального пути в клетках SKBR-3

[0337] Этот пример описывает характеристику гуманизированных антител, полученных в примере 12, относительно их возможности разрушать общий ErbB3 и ингибировать фосфорилирование ErbB3 в экспоненциально растущих SKBR-3 клетках.

[0338] Клетки рака молочной железы SKBR-3 содержали, как рекомендовано АТСС. Клетки, содержавшиеся в условиях с полным содержанием сыворотки, обрабатывали в течение 1, 2, 4 или 6 часов 40 мкг/мл антитела к ErbB3 (т.е. Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 и Sh24C05-31 N62S-IgG2). Лизаты анализировали посредством ELISA с набором Total-ErbB3 или Phospho-ErbB3 от R&D Systems (№ по кат. DYC234 и № по кат. DYC1769, соответственно).

[0339] Результаты демонстрируют, что антитела к ErbB3, Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 и Sh24C05-31 N62S-IgG2, ингибируют по меньшей мере 50% фосфорилирования ErbB3 в экспоненциально растущих SKBR-3 клетках (ФИГ.20).

[0340] Результаты также демонстрируют, что антитела к ErbB3, Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 и Sh24C05-31 N62S-IgG2, разрушали по меньшей мере 50% общего рецептора ErbB3, присутствующего в экспоненциально растущих SKBR-3 клетках (ФИГ.21).

Пример 16 - Ингибирование роста ксенотрансплантата опухоли BxPC3

[0341] Способность гуманизированных моноклональных антител, полученных в примере 12, ингибировать рост опухоли тестировали на модели ксенотрансплантата поджелудочной железы ВхРС3. Клетки поджелудочной железы человека ВхРС3 выращивали в культуре при 37°С в атмосфере, содержащей 5% СO2, с использованием среды RMPI, содержащей 10% эмбриональной бычьей сыворотки. Клетки ВхРС3 инокулировали подкожно в бок 8-недельным самкам SCID-мышей СВ.17 (Taconic Labs), 10×106 клеток на мышь в 50% матригеле (BD Biosciences, № по кат. 356237). Измерения опухоли проводили два раза в неделю с использованием штангенциркуля. Объем опухоли рассчитывали по формуле: ширина × ширина × длина/2. Когда опухоли достигали приблизительно 200 мм3, мышей рандомизировали в 8 групп по 10 мышей каждая. Одна группа получала PBS, другая получала huIgG-контроль, и еще одна получала muIgG-контроль. Каждая из оставшихся пяти групп получала одно из антител (т.е. 24С05, Sh24C05-25 N62S-IgG1, Sh24C05-25 N62S-IgG2, Sh24C05-31 N62S-IgG1 или Sh24C05-31 N62S-IgG2 мыши). Все эти антитела давали в дозе 2 мг/кг веса тела, два раза в неделю, путем внутрибрюшинной инъекции в течение 7 недель. Объемы опухоли и вес тела мышей фиксировали два раза в неделю. Ингибирование роста опухоли анализировали с помощью ANOVA, и оно выражается как процент ингибирования по сравнению с PBS-контролем.

[0342] Тестируемые гуманизированные антитела были активны in vivo. Все четыре гуманизированных антитела к ErbB3 обладали сходной эффективностью в модели с ВхРС3 при дозировке 2 мг/кг, варьируя от 75-80% ингибирования роста опухоли (p<0,001) (т.е. Sh24C05-25 N62S-IgG1, 75%; Sh24C05-25 N62S-IgG2, 76%; Sh24C05-31 N62S-IgG1, 79% и Sh24C05-31 N62S-IgG2, 80%) на день 28 исследования (ФИГ.22). Антитело мыши показывало 65% Ингибирование роста опухоли в данном исследовании (p<0,05). Эти результаты предполагают сходную эффективность и активность четырех гуманизированных антител в этой модели.

[0343] Способность гуманизированных моноклональных антител U1-53, U1-59 и Ab#6 IgG2 ингибировать рост опухоли также тестировали в модели ксенотрансплантата ВхРС3. Используя протокол, описанный выше, опухоли ВхРС3 были выращены в SCID-мышах СВ.17. Когда опухоли достигали приблизительно 200 мм3, мышей рандомизировали в 11 групп по 10 мышей каждая. Одна группа получала PBS, а другая получала huIgG-контроль. Каждая из других девяти групп получала одно из гуманизированных антител (т.е. Sh24C05-31 N62S-IgG1, U1-53, U1-59 или Ab#6 IgG2).

Антитела давали в дозе 0,5 мг/кг, 1 мг/кг или 5 мг/кг веса тела, два раза в неделю, путем внутрибрюшинной инъекции в течение 7 недель. Объемы опухоли и вес мыши фиксировали два раза в неделю. Ингибирование роста опухоли анализировали с использованием ANOVA, и оно выражается как процент ингибирования по сравнению с PBS-контролем.

[0344] Данные ингибирования роста опухоли, определенные на день 29 после обработки одним из гуманизированных антител (т.е. Sh24C05-31 N62S-IgG1, U1-59 или Ab#6 IgG2), показаны в таблице 20.

Таблица 20
Гр. Обработка Ингибирование роста опухоли (%) Анализ ANOVA (в сравнении с PBS) Анализ ANOVA (в сравнении с hIgG)
Средство мг/кг
1 PBS - NA NA NA
2 hIgG 5 29,2 NS NS
3 Sh24C05-31 N62S-IgG1 0,5 63,3 Р<0,001 P<0,01
4 Sh24C05-31 N62S-IgG1 1 75,0 Р<0,001 P<0,001
5 Sh24C05-31 N62S-IgG1 5 76,5 Р<0,001 P<0,001
6 Ab#6 IgG2 0,5 31,5 Р<0,05 NS
7 Ab#6 IgG2 1 2,1 NS NS
8 Ab#6 IgG2 5 40,6 Р<0,001 NS
Таблица 20 (Прод.)
Гр. Обработка Ингибирование роста опухоли (%) Анализ ANOVA (в сравнении с PBS) Анализ ANOVA (в сравнении с hIgG)
Средство мг/кг
9 U1-59 0,5 32,6 Р<0,01 NS
10 U1-59 1 52,9 Р<0,001 NS
11 U1-59 5 60,3 Р<0,001 Р<0,05

[0345] Результаты демонстрируют, что Sh24C05-31 N62S-IgG1 показал наибольшее Ингибирование роста опухоли на день 29 (76,5%, p<0,001) в дозе 5 мг/кг в модели ксенотрансплантата поджелудочной железы ВхРС3. Антитела U1-59 и Ab#6 IgG2 антител демонстрировали приблизительно 60% и 41% ингибирования роста опухоли в дозе 5 мг/кг в модели ВхРС3, соответственно (Р<0,001).

[0346] Результаты также демонстрируют, что Sh24C05-31 N62S-IgG1 показал наибольшее ингибирование роста опухоли на день 29 при дозе 0,5 мг/кг (63,3%, p<0,001) и при дозе 1 мг/кг (75,0%, p<0,001) в модели ксенотрансплантата поджелудочной железы ВхРС3. Антитела U1-59 и АВ#6 IgG2 демонстрируют ингибирование роста опухоли приблизительно на 33% (p<0,01) и 31% (p<0,05) при дозе 0,5 мг/кг в модели ВхРС3, соответственно. Антитела U1-59 и АВ#6 IgG2 демонстрировали приблизительно 53% (p<0,001) и 2% (незначимое) ингибирование роста опухоли при дозе 1,0 мг/кг в модели ВхРС3, соответственно.

Пример 17 - Ингибирование роста ксенотрансплантата опухоли Calu-3

[0347] Способность гуманизированных моноклональных антител, полученных в примере 12, ингибировать рост опухоли тестировали на модели ксенотрансплантата немелкоклеточного рака легкого Calu-3. Способность гуманизированных моноклональных антител U1-59 и Ab#6 IgG2, описанных в примере 12, ингибировать рост опухоли также тестировали в этой же модели.

[0348] Клетки немелкоклеточного рака легкого человека Calu-3 выращивали в культуре при 37°С в атмосфере, содержащей 5% CO2, с использованием среды ЕМЕМ, содержащей 10% эмбриональной бычьей сыворотки. Клетки Calu-3 инокулировали подкожно в бок 8-недельным самкам голых мышей NCR (Taconic Labs) 10×106 клеток на мышь в 50% матригеле (BD Biosciences, № по кат. 356237). Измерения опухоли проводили два раза в неделю с использованием штангенциркуля. Объем опухоли рассчитывали по формуле: ширина × ширина × длина/2.

[0349] Когда опухоли достигали приблизительно 200 мм3, мышей рандомизировали в 11 групп по 10 мышей каждая. Одна группа получала PBS, а другая получала muIgG-контроль. Каждая из оставшихся девяти групп получала одно из гуманизированных антител (т.е. Sh24C05-31 N62S-IgG1, U1-59 или Ab#6 IgG2) в дозе 5 мг/кг, 10 мг/кг или 20 мг/кг веса тела, два раза в неделю, путем внутрибрюшинной инъекции в течение 4 недель. Объемы опухоли и вес тела мышей фиксировали два раза в неделю. Ингибирование роста опухоли анализировали с помощью ANOVA, и оно выражается как процент ингибирования по сравнению с PBS-контролем.

[0350] Данные ингибирования роста опухоли, определенные на день 26 после обработки одним из гуманизированных антител (т.е. Sh24C05-31 N62S-IgG1, U1-59 или Ab#6 IgG2), показаны в таблице 21.

Таблица 21
Гр. Обработка Ингибирование роста опухоли (%) Анализ ANOVA (в сравнении с PBS) Анализ ANOVA (в сравнении с hIgG)
Средство мг/кг
1 PBS - NA NA NA
2 muIgG 20 -1,2 NS NA
3 Sh24C05-31 N62S-IgG1 5 62,3 Р<0,001 Р<0,001
4 Sh24C05-31 N62S-IgG1 10 62,0 Р<0,001 Р<0,001
5 Sh24C05-31 N62S-IgG1 20 69,0 Р<0,001 Р<0,001
6 Ab#6 IgG2 5 24,7 NS NS
7 Ab#6 IgG2 10 35,9 Р<0,01 Р<0,01
8 Ab#6 IgG2 20 48,4 Р<0,001 Р<0,001
9 U1-59 5 47,8 Р<0,001 Р<0,001
10 U1-59 10 56,7 Р<0,001 Р<0,001
11 U1-59 20 57,7 Р<0,001 Р<0,001

[0351] Результаты с использованием модели ксенотрансплантата немелкоклеточного рака легкого Calu-3 демонстрируют, что Sh24C05-31 N62S-IgG1 показал наибольшее ингибирование роста опухоли на день 26 при всех протестированных дозах (т.е. 5 мг/кг, 10 мг/кг и 20 мг/кг веса тела).

[0352] Например, при дозе 10 мг/кг, Sh24C05-31 N62S-IgG1 показал наибольшее ингибирование роста опухоли на день 26 (62%, Р<0,001) в сравнении с Ab#6 IgG2 (36%, NS) или U1-59 (57%, Р<0,001). При дозе 20 мг/кг Sh24C05-31 N62S-IgG1 также показал наибольшее ингибирование роста опухоли на день 26 (69%, Р<0,001) в сравнении с Ab#6 IgG2 (48%, Р<0,001) или U1-59 (58%, Р<0,001).

Пример 18 - Ингибирование роста ксенотрансплантата опухоли MDA-MB-453

[0353] Способность гуманизированных моноклональных антител, полученных в примере 12, ингибировать рост опухоли тестировали на модели ксенотрансплантата молочной железы MDA-MB-453 (которая является моделью с клетками молочной железы, позитивными в отношении Her2). Способность гуманизированных моноклональных антител U1-59 и Ab#6 IgG2, описанных в примере 12, ингибировать рост опухоли также тестировали в этой же модели.

[0354] Клетки молочной железы человека MDA-MB-453 выращивали в культуре при 37°С в атмосфере, содержащей 0% CO2, с использованием среды Leibovitz ATCC (№ по кат. 30-2008), содержащей 10% эмбриональной бычьей сыворотки. Клетки MDA-MB-453 инокулировали подкожно в бок 8-недельным самкам SCID-мышей NOD (Taconic Labs) 20×106 клеток на мышь в 50% матригеле (BD Biosciences, № по кат. 356237). Измерения опухоли проводили два раза в неделю с использованием штангенциркуля. Объем опухоли рассчитывали по формуле: ширина × ширина × длина/2.

[0355] Когда опухоли достигали приблизительно 200 мм3, мышей рандомизировали в 7 групп по 10 мышей каждая. Одна группа получала PBS, а другая получала huIgG-контроль. Каждая из остальных девяти групп получала одно из гуманизированных антител (т.е. Sh24C05-31 N62S-IgG1, U1-59 или Ab#6 IgG2). Sh24C05-31 N62S-IgG1 давали в дозе 5 мг/кг, 10 мг/кг или 20 мг/кг веса тела, два раза в неделю, путем внутрибрюшинной инъекции в течение более 10 недель, U1-59 или Ab#6 давали в дозе 10 мг/кг с такой же частотой. Объемы опухолей и вес тела мышей фиксировали два раза в неделю. Ингибирование роста опухоли анализировали с помощью ANOVA, и оно выражается как процент ингибирования по сравнению с PBS-контролем.

[0356] Данные ингибирования роста опухоли, определенные на 71 день после обработки одним из гуманизированных антител (т.е. Sh24C05-31 N62S-IgG1, U1-59 или Ab#6 IgG2), показаны в таблице 22.

Таблица 22
Гр. Обработка Ингибирование роста опухоли (%) Анализ ANOVA (в сравнении с PBS) Анализ ANONA (в сравнении с hIgG)
Средство мг/кг
1 PBS - NA NA NA
2 hIgG 20 28,87 p<0,001 p<0,001
3 Sh24C05-31 N62S-IgG1 5 86,57 p<0,001 p<0,001
4 Sh24C05-31 N62S-IgG1 10 84,09 p<0,001 p<0,001
5 Sh24C05-31 N62S-IgG1 20 85,26 p<0,001 p<0,001
6 Ab#6 IgG2 10 62,48 p<0,001 p<0,001
7 U1-59 10 83,93 p<0,001 p<0,001

[0357] Результаты с использованием модели ксенотрансплантата MDA-MB-453 демонстрируют, что Sh24C05-31 N62S-IgG1 показал сильное ингибирование роста опухоли на день 71 во всех протестированных дозах (т.е. 5 мг/кг, 10 мг/кг и 20 мг/кг веса тела).

[0358] Результаты также демонстрируют, что при дозе 10 мг/кг, Sh24C05-31 N62S-IgG1 показал большее ингибирование роста опухоли на день 71 (84%, Р<0,001) в сравнении с Ab#6 IgG2 (62%, Р0,001). Sh24C05-31 N62S-IgG1 показал ингибирование роста опухоли эквивалентное U1-59 в той же дозе.

ВКЛЮЧЕНИЕ ПОСРЕДСТВОМ ССЫЛКИ

[0359] Полное раскрытие каждого из патентных документов и научных статей, на которые ссылаются в данном документе, включаются посредством ссылки для всех целей.

ЭКВИВАЛЕНТЫ

[0360] Настоящее изобретение может осуществляться в других специфических формах без отступления от его сущности и важнейших характеристик. Вышеуказанные варианты осуществления, следовательно, рассматриваются во всех отношениях скорее как иллюстративные, нежели ограничивающие настоящее изобретение, описанное в данном документе. Объем настоящего изобретения, таким образом, выражается приложенной формулой, а не вышеуказанным описанием, и подразумевается, что все изменения, которые происходят в пределах значения и объема эквивалентности формулы, охватываются в нем.

1. Выделенное антитело или его антигенсвязывающий фрагмент, которое связывает ErbB3 человека, содержащее:
(i) вариабельную область тяжелой цепи иммуноглобулина, содержащую CDRH1, который содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 57 и SEQ ID NO: 75, CDRH2, который содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 58 и SEQ ID NO: 148, и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 59; и
(ii) вариабельную область легкой цепи иммуноглобулина, содержащую CDRL1, который содержит аминокислотную последовательность SEQ ID NO: 60, CDRL2, который содержит аминокислотную последовательность SEQ ID NO: 61, и CDRL3, который содержит аминокислотную последовательность SEQ ID NO: 62.

2. Антитело по п. 1, где вариабельная область тяжелой цепи иммуноглобулина содержит CDRH1, который содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 57 и SEQ ID NO: 75, CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 58, и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 59; и
вариабельная область легкой цепи иммуноглобулина содержит CDRL1, который содержит аминокислотную последовательность SEQ ID NO: 60, CDRL2, который содержит аминокислотную последовательность SEQ ID NO: 61, и CDRL3, который содержит аминокислотную последовательность SEQ ID NO: 62.

3. Антитело по п. 1, где вариабельная область тяжелой цепи иммуноглобулина содержит CDRH1, который содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 57 и SEQ ID NO: 75, CDRH2, который содержит аминокислотную последовательность SEQ ID NO: 148, и CDRH3, который содержит аминокислотную последовательность SEQ ID NO: 59; и
где вариабельная область легкой цепи иммуноглобулина содержит CDRL1, который содержит аминокислотную последовательность SEQ ID NO: 60, CDRL2, который содержит аминокислотную последовательность SEQ ID NO: 61, и CDRL3, который содержит аминокислотную последовательность SEQ ID NO: 62.

4. Антитело по любому из пп. 1-3, где последовательности CDR помещаются между каркасными последовательностями человека или гуманизированными каркасными последовательностями.

5. Выделенное антитело, которое связывает ErbB3 человека, содержащее вариабельную область тяжелой цепи иммуноглобулина и вариабельную область легкой цепи иммуноглобулина, выбранные из группы, состоящей из:
(a) вариабельной области тяжелой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 154, и
вариабельной области легкой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 168;
(b) вариабельной области тяжелой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 154, и
вариабельной области легкой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 166;
(c) вариабельной области тяжелой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 152, и
вариабельной области легкой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 168; и
(d) вариабельной области тяжелой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 152, и
вариабельной области легкой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 166.

6. Антитело по п. 5, где вариабельная область тяжелой цепи иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 154 и вариабельная область легкой цепи иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 168.

7. Антитело по п. 5, где вариабельная область тяжелой цепи иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 154 и вариабельная область легкой цепи иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 166.

8. Антитело по п. 5, где вариабельная область тяжелой цепи иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 152 и вариабельная область легкой цепи иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 168.

9. Антитело по п. 5, где вариабельная область тяжелой цепи иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 152 и вариабельная область легкой цепи иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 166.

10. Выделенное антитело, которое связывает ErbB3 человека, содержащее тяжелую цепь иммуноглобулина и легкую цепь иммуноглобулина, выбранные из группы, состоящей из:
(a) тяжелой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 190, и легкой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 206;
(b) тяжелой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 190, и легкой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 204;
(c) тяжелой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 188, и легкой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 206; и
(d) тяжелой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 188, и легкой цепи иммуноглобулина, содержащей аминокислотную последовательность SEQ ID NO: 204.

11. Антитело по п. 10, где тяжелая цепь иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 190 и легкая цепь иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 206.

12. Антитело по п. 10, где тяжелая цепь иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 190 и легкая цепь иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 204.

13. Антитело по п. 10, где тяжелая цепь иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 188 и легкая цепь иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 206.

14. Антитело по п. 10, где тяжелая цепь иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 188 и легкая цепь иммуноглобулина содержит аминокислотную последовательность SEQ ID NO: 204.

15. Антитело по любому из пп. 1-3, 5-14, где антитело представляет собой моноклональное антитело или его антигенсвязывающий фрагмент.

16. Антитело по любому из пп. 1-3, 5-14, где антитело имеет KD 200 пМ или ниже, измеряемое с помощью поверхностного плазмонного резонанса.

17. Способ ингибирования или уменьшения пролиферации опухолевых клеток, включающий воздействие на клетку эффективного количества антитела по любому из пп. 1-16 для ингибирования или уменьшения пролиферации опухолевых клеток.

18. Способ ингибирования или уменьшения роста опухоли у млекопитающего, причем способ включает воздействие на млекопитающее эффективного количества антитела по любому из пп. 1-16 для ингибирования или уменьшения пролиферации опухоли.

19. Способ лечения рака у млекопитающего, причем способ включает введение эффективного количества антитела по любому из пп. 1-16 млекопитающему, нуждающемуся в этом.

20. Способ по п. 19, где рак выбран из группы, состоящей из рака груди, рака яичника, рака простаты, рака шейки матки, рака толстой и прямой кишок, рака легкого, рака поджелудочной железы, рака желудка, рака кожи, рака почек, рака головы и шеи и невриномы.

21. Способ по п. 19, где рак выбран из группы, состоящей из рака груди, рака легкого и рака поджелудочной железы.

22. Способ по п. 19, где млекопитающим является человек.

23. Выделенная нуклеиновая кислота, содержащая нуклеотидную последовательность, кодирующую вариабельную область тяжелой цепи иммуноглобулина по любому из пп. 1-14 для использования при получении антитела или антигенсвязывающего фрагмента.

24. Выделенная нуклеиновая кислота, содержащая нуклеотидную последовательность, кодирующую вариабельную область легкой цепи иммуноглобулина по любому из пп. 1-14 для использования при получении антитела или антигенсвязывающего фрагмента.

25. Вектор экспрессии, содержащий нуклеиновую кислоту по п. 23.

26. Вектор экспрессии, содержащий нуклеиновую кислоту по п. 24.

27. Вектор экспрессии по п. 26, дополнительно содержащий нуклеиновую кислоту по п. 23.

28. Клетка-хозяин млекопитающего для экспрессии нуклеиновой кислоты, содержащая вектор экспрессии по п. 25.

29. Клетка-хозяин млекопитающего для экспрессии нуклеиновой кислоты, содержащая вектор экспрессии по п. 26.

30. Клетка-хозяин млекопитающего для экспрессии нуклеиновой кислоты, содержащая вектор экспрессии по п. 27.

31. Клетка-хозяин по п. 29, дополнительно содержащая вектор экспрессии по п. 25.

32. Способ получения полипептида, содержащего вариабельную область тяжелой цепи иммуноглобулина, причем способ включает:
(a) выращивание клетки-хозяина по п. 28 при условиях таким образом, что клетка-хозяин экспрессирует полипептид, содержащий вариабельную область тяжелой цепи иммуноглобулина, и
(b) очищение полипептида, содержащего вариабельную область тяжелой цепи иммуноглобулина.

33. Способ получения полипептида, содержащего вариабельную область легкой цепи иммуноглобулина, причем способ включает:
(a) выращивание клетки-хозяина по п. 29 при условиях таким образом, что клетка-хозяин экспрессирует полипептид, содержащий вариабельную область легкой цепи иммуноглобулина, и
(b) очищение полипептида, содержащего вариабельную область легкой цепи иммуноглобулина.

34. Способ получения антитела, которое связывает ErbB3 человека, или антигенсвязывающего фрагмента антитела, причем способ включает:
(a) выращивание клетки-хозяина по п. 30 или 31 при условиях таким образом, что клетка-хозяин экспрессирует полипептид, содержащий вариабельную область тяжелой цепи иммуноглобулина, и полипептид, содержащий вариабельную область легкой цепи иммуноглобулина, благодаря чему получая антитело или антигенсвязывающий фрагмент антитела, и
(b) очищение антитела или антигенсвязывающего фрагмента антитела.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к получению меченых антител, и может быть использовано для диагностики. Антитела конструируют с заменой одной или нескольких аминокислот исходного антитела на не являющиеся перекрестно связанными, высокореакционноспособные цистеиновые аминокислоты.

Данное изобретение относится к области биотехнологии. Предложены антитела, которые связываются с фибронектиновым доменом III типа 1 (FND1) белка AXL и вызывают деактивацию AXL, а также применение таких антител для подавления роста злокачественной опухоли, опосредованной AXL, продуцирующие их гибридомы и композиция для подавления роста злокачественной опухоли, опосредованной AXL, которая в качестве активного ингредиента содержит антитело по настоящему изобретению.

Изобретение относится к биотехнологии. Предложена композиция антитела для лечения HER2-позитивного рака, содержащая в качестве активного начала антитело, характеризующееся наличием вариабельной области лёгкой и тяжёлой цепи, и его кислые варианты, а именно: гликозилированный, дезаминированный варианты, а также вариант с восстановленной дисульфидной связью, сиалилированный вариант и невосстанавливаемый вариант.

Изобретение относится к биотехнологии. .

Изобретение относится к медицине, а именно к иммунотерапии. .

Изобретение относится к области медицины и касается комбинированной терапии антителами для лечения В-клеточных злокачественных опухолей с использованием иммунорегуляторного антитела, особенно антитела против В7, против CD23 или против антитела, уменьшающего количество В-клеток, особенно антитела против CD20.

Изобретение относится к генетической инженерии. .

Изобретение относится к биохимии. Раскрыто меченное радиоактивным металлом антитело против Р-кадгерина, полученное связыванием радиоактивного металлического элемента с антителом против Р-кадгерина через металл-хелатирующий реагент. Представлены средства и способы лечения и диагностики злокачественной опухоли. Также представлены антитело-продуцирующие клетки для продукции раскрытого антитела, депонированные под номерами NITE BP-897, NITE BP-898, NITE BP-899, NITE BP-1040, NITE BP-1044, NITE BP-1048, NITE BP-1049, NITE BP-1050. Изобретение предоставляет меченное радиоактивным металлом антитело против Р-кадгерина, которое в высокой степени накапливается специфично в злокачественной ткани. А также предоставляет лекарственное средство против злокачественной опухоли, имеющее высокий эффект против злокачественной опухоли и безопасность, и средство для диагностики злокачественной опухоли. 17 н. и 11 з.п. ф-лы, 14 ил., 2 табл., 14 пр.
Наверх