Меченное радиоактивным металлом антитело против кадгерина



Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина
Меченное радиоактивным металлом антитело против кадгерина

 


Владельцы патента RU 2577125:

ФУДЖИФИЛМ РИ ФАРМА КО., ЛТД. (JP)
ПЕРСЕУС ПРОТЕОМИКС ИНК. (JP)

Изобретение относится к биохимии. Раскрыто меченное радиоактивным металлом антитело против Р-кадгерина, полученное связыванием радиоактивного металлического элемента с антителом против Р-кадгерина через металл-хелатирующий реагент. Представлены средства и способы лечения и диагностики злокачественной опухоли. Также представлены антитело-продуцирующие клетки для продукции раскрытого антитела, депонированные под номерами NITE BP-897, NITE BP-898, NITE BP-899, NITE BP-1040, NITE BP-1044, NITE BP-1048, NITE BP-1049, NITE BP-1050. Изобретение предоставляет меченное радиоактивным металлом антитело против Р-кадгерина, которое в высокой степени накапливается специфично в злокачественной ткани. А также предоставляет лекарственное средство против злокачественной опухоли, имеющее высокий эффект против злокачественной опухоли и безопасность, и средство для диагностики злокачественной опухоли. 17 н. и 11 з.п. ф-лы, 14 ил., 2 табл., 14 пр.

 

Область техники

Настоящее изобретение относится к меченному радиоактивным металлом антителу против кадгерина, которое в высокой степени специфично накапливается в злокачественных клетках, и к лекарственному средству против злокачественной опухоли и к средству для диагностики злокачественных опухолей, содержащим это антитело.

Уровень техники

Существует острая необходимость в новых способах лечения злокачественных опухолей, которые в настоящее время являются ведущей причиной смертности. В настоящее время используют такие способы терапии, как хирургическая терапия, лучевая терапия и химиотерапия (с использованием противораковых средств). Даже после хирургической операции в послеоперационной терапии используют противораковое средство.

В настоящее время используемые противораковые средства включают алкилирующее средство, антиметаболит, алкалоидное противораковое средство, антибиотическое противораковое средство и средство на основе платины. Эффекты лечения этими средствами являются не полностью удовлетворительными. Некоторые средства не являются специфичными для злокачественной опухоли и часто вызывают неблагоприятные побочные эффекты, которые являются проблематическими. В таких обстоятельствах существует потребность в разработке более эффективных противораковых средств.

Между тем, кадгерин представляет собой Ca2+-зависимую молекулу адгезии, которая экспрессируется на клеточной поверхности. Примеры известных типов кадгеринов включают классические кадгерины, такие как E-кадгерин, N-кадгерин и P-кадгерин (CDH3); а также протокадгерин и десмосомальный кадгерин. Известно, что эти кадгерины гомофильно связываются, образуя адгезионное соединение и связываясь с системой цитоскелета (актиновые филаменты) через внутриклеточный катенин, и считается, что с помощью такого механизма они контролируют клеточную адгезию.

В дополнение к клеточной адгезии полагают, что кадгерин связан с эмбриогенезом, морфогенезом, синаптогенезом, синаптической пластичностью и инфильтрацией и метастазированием злокачественной опухоли. Таким образом, описано, что антитело против кадгерина подходит для терапии злокачественной опухоли (патентные документы 1-3).

Документы уровня техники

Патентные документы

Патентный документ 1: Публикация патента Японии Kohyo (PCT) № 2005-522982

Патентный документ 2: Публикация патента Японии Kohyo (PCT) No. 2008-538909

Патентный документ 3: Публикация патента Японии Kohyo (PCT) № 2009-528257

Сущность изобретения

Проблемы, решаемые с помощью изобретения

Однако эффект антитела против кадгерина в отношении злокачественной опухоли не является удовлетворительным и существует потребность в разработке более эффективного лекарственного средства против злокачественной опухоли.

Таким образом, задачей настоящего изобретения является предоставление меченного радиоактивным металлом антитела против кадгерина, которое может в высокой степени накапливаться в злокачественной ткани. Другой задачей является предоставление лекарственного средства против злокачественной опухоли, которое содержит антитело в качестве активного ингредиента и которое проявляет высокий эффект против злокачественной опухоли. Другой задачей является предоставление средства для диагностики злокачественной опухоли, которое может предсказать эффективность лекарственного средства против злокачественной опухоли и подтвердить его терапевтический эффект.

Способы решения проблем

Авторы настоящего изобретения провели тщательные исследования для решения упомянутых выше задач и открыли, что меченное радиоактивным металлом антитело против кадгерина, в котором радиоактивный металлический элемент связан с антителом против кадгерина через металл-хелатирующий реагент, накапливается специфично в злокачественной ткани у имеющего злокачественную опухоль животного, и что его эффект против злокачественной опухоли, в особенности, значительно усилен по сравнению с группой введения немеченого антитела против кадгерина. Настоящее изобретение осуществлено, основываясь на этих открытиях.

Таким образом, настоящее изобретение относится к меченному радиоактивным металлом антителу против кадгерина, которое получают путем связывания радиоактивного металлического элемента с антителом против кадгерина через металл-хелатирующий реагент, и к лекарственному средству против злокачественной опухоли и средству для диагностики злокачественной опухоли, содержащим, в качестве активного ингредиента, меченное радиоактивным металлом антитело против кадгерина.

Также настоящее изобретение относится к меченному радиоактивным металлом антителу против кадгерина для применения в лечении или диагностике злокачественной опухоли.

Также настоящее изобретение относится к применению меченного радиоактивным металлом антитела против кадгерина для получения лекарственного средства против злокачественной опухоли или средства для диагностики злокачественной опухоли.

Настоящее изобретение также относится к способу лечения или диагностики злокачественной опухоли, включающему введение эффективного количества меченного радиоактивным металлом антитела против кадгерина индивидууму, нуждающемуся в этом.

Эффекты изобретения

Лекарственное средство против злокачественной опухоли, содержащее в качестве активного ингредиента меченное радиоактивным металлом антитело против кадгерина по настоящему изобретению, в высокой степени накапливается в злокачественной ткани и проявляет высокий эффект уменьшения размера злокачественной опухоли. Таким образом, с использованием лекарственного средства против злокачественной опухоли можно эффективно проводить терапию злокачественной опухоли без возникновения побочных эффектов. Также, с использованием средства для диагностики злокачественной опухоли по настоящему изобретению можно предсказать эффективность лекарственного средства против злокачественной опухоли по настоящему изобретению, и можно подтвердить его терапевтический эффект.

Краткое описание чертежей

[Фиг. 1] Графики, демонстрирующие результат оценки аффинности антител проточной цитометрией.

[Фиг. 2] Биораспределение антитела 67Ga-DOTA-PPMX2016 (соотношение при добавлении 1:10) через 96 часов после его введения.

[Фиг. 3] Биораспределение антитела 67Ga-DOTA-PPMX2016 (соотношение при добавлении 1:3) через 96 часов после его введения.

[Фиг. 4] Биораспределение антитела 67Ga-DOTA-PPMX2029 (соотношение при добавлении 1:10) через 96 часов после его введения.

[Фиг. 5] Биораспределение антитела 67Ga-DOTA-PPMX2029 (соотношение при добавлении 1:3) через 96 часов после его введения.

[Фиг. 6] Биораспределение антитела 67Ga-DOTA-PPMX2025 (соотношение при добавлении 1:10) через 96 часов после его введения.

[Фиг. 7] Биораспределение антитела 67Ga-DOTA-PPMX2025 (соотношение при добавлении 1:3) через 96 часов после его введения.

[Фиг. 8] Биораспределение антитела 67Ga-DOTA-PPMX2025 в случае соотношений антитело-DOTA при добавлении 1:1, 1:3 и 1:10 через 96 часов после его введения.

[Фиг. 9] Биораспределение антитела 111In-DOTA-PPAT-052-27c (соотношение при добавлении 1:3) через 96 часов после его введения.

[Фиг. 10] Биораспределение антитела 111In-DOTA-PPAT-052-27c (соотношение при добавлении 1:3) через 48 часов после его введения.

[Фиг. 11] Биораспределение антитела 111In-DOTA-PPAT-052-28c (соотношение при добавлении 1:3) через 48 часов и через 96 часов после его введения.

[Фиг. 12] Противоопухолевый эффект антитела 90Y-DOTA-PPMX2029 (соотношение при добавлении 1:3) в модели с ксенотрансплантатом.

[Фиг. 13] Противоопухолевый эффект антитела 90Y-DOTA-PPAT-052-27c (соотношение при добавлении 1:3) в модели с ксенотрансплантатом.

[Фиг. 14] Фотографии, демонстрирующие результаты иммуногистохимического окрашивания для подтверждения экспрессии белка CDH3.

Способы осуществления изобретения

Меченное радиоактивным металлом антитело против кадгерина по настоящему изобретению представляет собой меченое антитело против кадгерина, с которым радиоактивный металлический элемент связан через металл-хелатирующий реагент. Лекарственное средство против злокачественной опухоли или средство для диагностики злокачественной опухоли содержит меченное радиоактивным металлом антитело против кадгерина.

Антитело против кадгерина конкретно не ограничено, при условии, что антитело специфично связывается с кадгерином. Примеры кадгерина включают E-кадгерин, N-кадгерин и P-кадгерин. Среди них более предпочтительным является P-кадгерин.

Антитело против кадгерина охватывает моноклональное антитело, поликлональное антитело, антитело, сохраняющее способность специфично связываться с группой антигенных детерминант и варианты и производные антитела, такие как фрагмент T-клеточного рецептора.

Тип антитела против кадгерина конкретно неограничен и можно соответствующим образом использовать антитела, такие как антитело мыши, антитело человека, антитело крысы, антитело кролика, антитело овцы, антитело верблюда и антитело курицы; и генно-рекомбинантные антитела, которые намеренно модифицированы, чтобы снизить гетероантигенность у человека, такие как химерное антитело и гуманизированное антитело. Рекомбинантное антитело можно получать известным способом. Химерное антитело представляет собой антитело, образованное из вариабельных областей тяжелой цепи и легкой цепи антитела млекопитающих, отличного от антитела человека, например, антитела мыши, и константных областей тяжелой цепи и легкой цепи антитела человека, и его можно получать связыванием фрагмента ДНК, кодирующего вариабельную область антитела мыши, с фрагментом ДНК, кодирующим константную область антитела человека, встраиванием полученного фрагмента в вектор экспрессии, и введением вектора в клетки-хозяева (см., например, Cabilly S. et al., Proc. Natl. Acad. Sci. USA, 1984, 81(11) 3273-7; Morrison et al., Proc. Natl. Acad. Sci. USA, 1984, 81 (21), 6851-5; и опубликованную патентную заявку Европы № 171496). Гуманизированное антитело, которое также называют реконструированным антителом, представляет собой антитело, получаемое путем трансплантации определяющей комплементарность области (CDR) антитела млекопитающего, отличного от антитела человека, например, антитела мыши, в CDR антитела человека, и способы рекомбинации генов для этого общеизвестны. В частности, последовательность ДНК, включающая CDR антитела мыши, связанную с каркасной областью (FR) антитела человека, синтезируют способом ПЦР с использованием нескольких олигонуклеотидов, которые изготавливают так, чтобы они имели перекрывающуюся часть на их конце. Полученный таким образом фрагмент ДНК связывают с фрагментом ДНК, кодирующим константную область антитела человека, затем полученный фрагмент встраивают в вектор экспрессии и вектор вводят в клетки-хозяева, тем самым получая гуманизированное антитело (см. EP239400 A и WO 96/02576 A). FR антитела человека, связанную через CDR, выбирают из FR, имеющих CDR, которая образует подходящий антигенсвязывающий центр. При необходимости аминокислоту в FR вариабельной области антитела можно заменять, так чтобы CDR гуманизированного антитела образовывала соответствующий антигенсвязывающий центр (Sato, K. et al., Cancer Res., 1993, 53, 851-856).

Аминокислотная последовательность химерного антитела или гуманизированного антитела предпочтительно имеет 100% идентичность с аминокислотной последовательностью VH- или VL-области кДНК, экспрессируемой депонированной гибридомой. Вследствие генетической модификации, также предпочтительным является антитело, имеющее идентичность аминокислотной последовательности 90% или выше. В процессе гуманизации или химеризации обычно проводят такую контролируемую замену остатков для повышения связывания с антигеном. Такое антитело, имеющее частично модифицированную последовательность, по существу считается антителом, происходящим из исходной гибридомы.

Способы получения химерного антитела и гуманизированного антитела на основе технологии генетической инженерии уже известны. В частности, последовательности VH и VL моноклонального антитела, выступающие в качестве подтвержденной группы, генетически модифицируют, а затем проводят химеризацию или гуманизацию общепринятыми способами.

Способ выделения антитела человека также известен. В одной методике лимфоциты человека сенсибилизируют in vitro представляющим интерес антигеном или клетками, экспрессирующими антиген, и сенсибилизированные таким образом лимфоциты подвергают слиянию с клетками миеломы человека, например, U266, тем самым продуцируя представляющее интерес антитело человека, обладающее активностью связывания с антигеном (см. JP-B-1989-59878). Альтернативно, представляющее интерес антитело человека можно выделять путем иммунизации представляющим интерес антигеном трансгенного животного, обладающего полным набором генов антител человека (см. WO 93/12227, WO 92/03918, WO 94/02602, WO 94/25585, WO96/34096 и W096/33735). Также известен способ выделения антитела человека путем пэннинга с использованием библиотеки антител. В одной методике вариабельную область антитела человека экспрессируют в качестве одноцепочечного антитела (scFv) на поверхности фага способом фагового дисплея, и фаг, который связывает антиген, можно отбирать. С помощью анализа генов отобранного таким образом фага, можно определять последовательность ДНК, кодирующую вариабельную область антитела человека, которая связывается с антигеном. Когда последовательность ДНК scFv, которая связывается с антигеном, становится известной, из последовательности можно получать соответствующий вектор экспрессии, посредством чего можно выделять представляющее интерес антитело. Эти способы широко известны (см. WO 92/01047, WO 92/20791, WO 93/06213, WO 93/11236, WO 93/19172, WO 95/01438 и WO 95/15388).

Эти антитела против кадгерина могут представлять собой низкомолекулярное антитело, такое как фрагмент антитела, модифицированное антитело или сходные с ними, при условии сохранения способности распознавать весь белок или часть белка, кодируемого геном кадгерина. Примеры фрагмента антитела включают Fab, Fab', F(ab')2, Fv и диатело. Такой фрагмент антитела можно получать конструированием гена, кодирующего фрагмент антитела, встраиванием гена в вектор экспрессии и экспрессией его в подходящих клетках-хозяевах (см., например, Co, M.S. et al., J. Immunol. (1994) 152, 2968-2976; Better, M. and Horwitz, A.H., Methods Enzymol. (1989) 178, 476-496, Pluckthun, A. and Skerra, A., Methods Enzymol. (1989) 178, 497-515; Lamoyi, E., Methods Enzymol. (1986) 121, 652-663; Rousseaux, J. et al., Methods Enzymol. (1986) 121, 663-669; и Bird, R.E. and Walker, B.W., Trends Biotechnol. (1991) 9, 132-137).

В качестве модифицированного антитела можно использовать антитело, которое связано с любой из различных молекул, таких как полиэтиленгликоль (PEG). Такое модифицированное антитело можно получать путем химической модификации полученного антитела. Способ модификации антител уже является общеизвестным в данной области.

В настоящем изобретении можно использовать антитело с модифицированной цепью сахаров для усиления цитотоксической активности. Способы модификации цепи сахаров в антителе уже известны (например, WO 00/61739 и WO 02/31140).

Антитело против кадгерина по настоящему изобретению также охватывает полиспецифическое антитело, обладающее специфичностью к двум или более различным антигенам. Типичным примером такой молекулы может быть молекула, которая связывает два антигена (т.е. биспецифическое антитело). "Полиспецифическое антитело" по настоящему изобретению включает антитело, обладающее специфичностью к двум или более (например, трем) антигенам. Полиспецифическое антитело может представлять собой полноразмерное антитело или фрагмент такого антитела (например, F(ab')2-биспецифическое антитело).

Антитело против кадгерина по настоящему изобретению и его фрагмент можно получать любым подходящим способом, таким как реакция трансляции in vivo, в культивированных клетках, in vitro, и система для рекомбинантной экспрессии ДНК.

Способы получения моноклональных антител и антителопродуцирующих клеток (гибридом), главным образом, известны в данной области (Campbell, "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology", Elsevier Science Publishers, Amsterdam, The Netherlands, 1984, и St. Groth et al., J. Immunol. Methods 35: 1-21, 1980). В одной конкретной методике белок или его фрагмент, кодируемый геном кадгерина, служащий в качестве иммуногена, подкожно или внутрибрюшинно инъецируют для иммунизации любому животному (например, мыши или кролику), о котором известно, что оно продуцирует антитело. При иммунизации можно использовать адъювант, и такой адъювант хорошо известен в данной области.

Поликлональное антитело можно получать путем выделения антисыворотки, содержащей антитела, из иммунизированного животного и скрининга в отношении присутствия антитела, имеющего заданную специфичность, способом, хорошо известным в данной области (например, ELISA, вестерн-блоттинг или радиоиммунный анализ).

Моноклональное антитело можно получать путем извлечения клеток селезенки из иммунизированного животного и слияния клеток с клетками миеломы, тем самым получая гибридомы, которые могут продуцировать моноклональные антитела. Гибридомные клетки, продуцирующие антитело, которое может распознавать представляющий интерес белок или его фрагмент, можно выбирать с помощью способа, хорошо известного в данной области (например, ELISA, вестерн-блоттинг или радиоиммунный анализ). Затем, гибридому, секретирующую представляющее интерес антитело, клонируют и полученные клетки культивируют в соответствующих условиях. Секретированное таким образом антитело выделяют и очищают способом, хорошо известным в данной области (например, ионообменная колоночная хроматография или аффинная хроматография). В альтернативной методике моноклональное антитело человека можно получать с использованием линии xenomouse (см. Green, J. Immunol. Methods 231: 11-23, 1999; и Wells, Eek, Chem. Biol. 2000 Aug; 7(8): R185-6). В настоящее время проводят получение моноклональных антител на основе фагового дисплея, не вовлекающего иммунизацию. Моноклональное антитело по настоящему изобретению представляет собой антитело одного молекулярного типа, продуцируемое антителопродуцирующими клетками одного типа, или фрагмент ДНК, полученный из них и кодирующий антитело. Моноклональное антитело можно получать любым из описанных выше способов.

Фрагмент ДНК, кодирующий моноклональное антитело, можно легко выделять и секвенировать общепринятым способом (например, с использованием олигонуклеотидного зонда, который может специфично связываться с генами, кодирующими тяжелую цепь и легкую цепь моноклонального антитела). Гибридомная клетка является предпочтительным исходным материалом для получения такого фрагмента ДНК. После выделения такой фрагмент ДНК встраивают в вектор экспрессии, и вектор рекомбинируют с клетками-хозяевами, такими как клетки E. coli, клетки COS обезьяны, клетки яичника китайского хомячка (CHO) или клетки миеломы, в которых иммуноглобулин не продуцируется, пока клетки не трансформируют. Представляющее интерес моноклональное антитело продуцируется рекомбинантными клетками-хозяевами. Альтернативно, антитело или фрагмент антитела можно выделять из фаговой библиотеки антител способом McCafferty et al. (Nature 348: 552-554 (1990)).

Клетка-хозяин, используемая для экспрессии моноклонального антитела, предпочтительно представляет собой клетку-хозяина, источником которой является млекопитающее. Можно выбирать клетку-хозяина, наиболее подходящую для экспрессии моноклонального антитела. Клетка-хозяин не ограничена, и ее типичные примеры включают происходящую из CHO клеточную линию (клетка яичника китайского хомяка), CV1 (почка обезьяны), COS (производное CV1, экспрессирующее антиген SV40T), SP2/0 (миелома мыши), Р3х63-Ag3.653 (миелома мыши), 293 (почка человека) и 293T (производное 293, экспрессирующее антиген SV40T). Систему клеток-хозяев можно получать из коммерческого предприятия, American Tissue Culture Collection (ATCC), или из организации, которая опубликовала соответствующий документ.

Клетка-хозяин предпочтительно представляет собой происходящую из CHO клеточную линию с дефектом экспрессии гена dhfr (делеция в гене dhfr) или SP2/0 (см. Urland, G. et al., Effect of gamma rays at the dihydrofolate reductase locus: deletions and inversions; Somat. Cell. Mol. Genet. Vol. 12, 1986, p. 5555-566; и Schulman, M. et al., A better cell line for making hybridomas secreting specific antibodies. Nature Vol. 276, 1978, p. 269-270). Предпочтительно, клеткой-хозяином является CHO с делецией DHFR. Трансфекцию плазмид в клетки-хозяева можно проводить любым способом. Способ трансфекции не ограничен, и его конкретные примеры включают трансфекцию (включая способ с фосфатом кальция, способ с DEAE, липофекцию и электропорацию), включение ДНК с использованием оболочки (например, вирус Сендай), микроинъекцию и инфицирование с использованием вирусного (например, ретровирусного или аденовирусного) вектора (см. Current Protocols in Molecular Biology, Chapter 9 Introduction of DNA into Mammalian Cells, John Wiley and Sons, Inc.). Среди них, особенно предпочтительным является включение плазмиды в клетки-хозяева путем электропорации.

Участок распознавания кадгерина в антителе против кадгерина по настоящему изобретению предпочтительно представляет собой область 1-655 SEQ ID NO: 2.

Антитело против кадгерина по настоящему изобретению предпочтительно получают из гибридомы PPMX2016, PPMX2025, PPMX2029, PPAT-052-02, PPAT-052-03, PPAT-052-09, PPAT-052-24, PPAT-052-25, PPAT-052-26 или PPAT-052-28, или трансгенной клеточной линии CHO PPAT-052-27с, PPAT-052-02c, РРАТ-052-03с, PPAT-052-09c, PPAT-052-21c, PPAT-052-24c, PPAT-052-25c, PPAT-052-26c, PPAT-052-28C или PPAT-052-29C. В настоящем описании числа при PPMX или PPAT приведены для указания либо на антителопродуцирующие клетки, либо на антитела, продуцируемые антителопродуцирующими клетками.

Радиоактивный металл, который связан с антителом против кадгерина, предпочтительно представляет собой цитотоксический радиоактивный металл, когда меченное радиоактивным металлом антитело против кадгерина используют в качестве лекарственного средства против злокачественной опухоли, либо нецитотоксический радиоактивный металл, когда меченное радиоактивным металлом антитело против кадгерина используют в качестве средства для диагностики злокачественной опухоли.

Примеры цитотоксического радиоактивного металла включают иттрий-90 (90Y), рений-186 (186Re), рений-188 (188Re), медь-67 (67Cu), железо-59 (59Fe), стронций-89 (89Sr), золото-198 (198Au), ртуть-203 (203Hg), свинец-212 (212Pb), диспрозий-165 (165Dy), рутений-103 (103Ru), висмут-212 (212Bi), висмут-213 (213Bi), холмий-166 (166Ho), самарий-153 (153Sm) и лютеций-177 (177Lu).

Среди этих радиоактивных металлов предпочтительными являются 90Y, 153Sm и 177Lu, с точки зрения срока полураспада, энергии излучения, простоты реакции мечения, процента мечения, стабильности комплекса и т.д.

Нецитотоксический радиоактивный металл, который является подходящим для использования в средстве для диагностики злокачественной опухоли, не ограничен, и его примеры включают технеций-99m (99mTc), индий-111 (111In), индий-113m (113mIn), галлий-67 (67Ga), галлий-68 (68Ga), таллий-201 (201Tl), хром-51 (51Cr), кобальт-57 (57Co), кобальт-58 (58Co), кобальт-60 (60Co), стронций-85 (85Sr), ртуть-197 (197Hg) и медь-64 (64Cu).

Для присоединения радиоактивного металлического элемента к антителу против кадгерина предпочтительно металл-хелатирующий реагент подвергают реакции с антителом против кадгерина, и продукт далее подвергают реакции с радиоактивным металлическим элементом, тем самым формируя комплекс. В полученном таким образом модифицированном антителе радиоактивный металлический элемент связан с антителом против кадгерина через металл-хелатирующий реагент.

Примеры металл-хелатирующего реагента для формирования такого комплекса включают (1) производные хинолина, такие как соединения 8-гидроксихинолина, 8-ацетоксихинолина, 8-гидроксихиналдина, оксихинолинсульфата, O-ацетилоксина, O-бензоилоксина, O-п-нитробензоилоксина и хинолона, имеющие скелет хинолина (например, норфлоксацин, офлоксацин, эноксацин, ципрофлоксацин, ломефлоксацин, тосфлоксацин, флероксацин и спарфлоксацин); (2) соединения, такие как хлораниловая кислота, алюминон, тиомочевина, пирогаллол, купферон, висмутиол (II), галлоилгалловую кислоту, тиолид, 2-меркаптобензотиазол и хлорид тетрафениларсония; (3) этилендиаминтетрауксусную кислоту (EDTA), диэтилентриаминпентауксусную кислоту (DTPA) и соединения, имеющие сходный скелет (дигидроксиэтилглицин, диаминопропанолтетрауксусная кислота, этилендиаминдиуксусная кислота, гидрохлорид этилендиаминдипропионовой кислоты, гидроксиэтилэтилендиаминтриуксусная кислота, этилендиаминтетракис(метиленсульфоновая кислота), гликолевый простой эфир-диаминтетрауксусная кислота, гексаметилендиаминтетрауксусная кислота, гидроксиэтилиминодиуксусная кислота, иминодиуксусная кислота, диаминопропантетрауксусная кислота, нитрилотриуксусная кислота, нитрилотрипропионовая кислота, нитрилотрис(метиленсульфоновая кислота) тринатриевая соль, триэтилентетрамингексауксусная кислота, метил-DTPA, циклогексил-DTPA, аминобензил-EDTA, изотиоцианобензил-EDTA, изотиоцианобензил-DTPA, метилизотиоцианобензил-DTPA, циклогексилизотиоцианобензил-DTPA, малеимидопропиламидобензил-EDTA, малеимидопентиламидобензил-EDTA, малеимидодециламидобензил-EDTA, малеимидопентиламидобензил-DTPA и малеимидодециламидобензил-DTPA); и (4) 1,4,7,10-тетраазациклододекан-1,4,7,10-тетрауксусную кислоту (DOTA), 1,4,7-триазациклононан-1,4,7-триуксусную кислоту (NOTA), 1,4,8,11-тетраазациклотетрадекан-1,4,8,11-тетрауксусную кислоту (TETA), 1,4,7,10-тетраазациклододекан (циклен), 1,4,8,11-тетраазациклотетрадекан (циклам), изотиоцианобензил-DOTA и изотиоцианобензил-NOTA.

Среди металл-хелатирующих реагентов предпочтительными являются изотиоцианобензил-DOTA, метилизотиоцианобензил-DTPA, циклогексилизотиоцианобензил-DTPA, с точки зрения простоты реакции встраивания металл-хелата в антитело, процента мечения, стабильности комплекса и т.д.

Радиоактивный металлический элемент может быть связан с антителом против кадгерина общепринятым способом. В одной методике металл-хелатирующий реагент подвергают реакции с антителом против кадгерина, тем самым получая предшественника метки, и предшественник подвергают реакции с радиоактивным металлическим элементом.

В лекарственном средстве против злокачественной опухоли и средстве для диагностики злокачественной опухоли по настоящему изобретению, молярное соотношение антитела против кадгерина и металл-хелатирующего реагента является важным для накопления в злокачественных клетках и эффекта против злокачественной опухоли. Молярное отношение (антитело против кадгерина:хелатирующий реагент) предпочтительно составляет от 1:0,1 до 1:4,5, более предпочтительно от 1:0,5 до 1:3. Для достижения таких молярных отношений антитело против кадгерина и хелатирующий реагент предпочтительно добавляют в реакционную смесь в соотношении от 1:0,1 до 1:менее 5, особенно предпочтительно от 1:1 до 1:3. Количество хелатирующей молекулы(молекул) на антитело против кадгерина можно вычислять путем измерения молекулярной массы с помощью анализа масс MALDI-TOF или сходного способа и сравнения молекулярной массы немодифицированного антитела с молекулярной массой модифицированного антитела (публикация патента США № 7514078, Lu et al., J. Pharm. Sci. 94(4), 2005, p. 788-797, и Tedesco et al., J. Clin. Onco. 23 (16S), 2005, 4765). Альтернативно, количество хелатирующей молекулы(молекул) на антитело против кадгерина можно определять путем хелатометрического титрования. В одном из известных способов используется колориметрический реагент на основе щелочноземельного металла (arsenazo III) (Bradyr et al., Nucl. Med. Biol. 31, 795-802, 2004, и Dadachova et al., Nucl. Med. Biol. 26, 977-982, 1999).

Лекарственное средство против злокачественной опухоли или средство для диагностики злокачественной опухоли по настоящему изобретению может быть предоставлено в качестве меченого состава или состава в наборе, содержащего предшественник метки. В настоящем изобретении можно использовать любой из составов. В случае меченого состава лекарственное средство против злокачественной опухоли или средство для диагностики злокачественной опухоли, содержащее меченое антитело против кадгерина, можно вводить как есть. В случае состава в наборе, средство можно вводить после мечения представляющим интерес радиоактивным металлическим элементом.

Антитело против кадгерина, содержащее радиоактивный металлический элемент, связанный с ним, в высокой степени накапливается в злокачественной ткани и проявляет высокую токсическую активность в отношении злокачественных клеток. Таким образом, антитело представляет собой подходящее лекарственное средство против злокачественной опухоли, которое в меньшей степени повреждает ткань, отличную от злокачественной ткани, и которое является высоко безопасным. Также антитело против кадгерина, содержащее радиоактивный металлический элемент, связанный с ним, обладает активностью против злокачественной опухоли, значительно превышающей активность соответствующего антитела против кадгерина. Активность против злокачественной опухоли является значительно более высокой, особенно когда молярное отношение антитела к хелатирующему агенту составляет от 1:0,1 до 1:4,5.

Лекарственное средство против злокачественной опухоли по настоящему изобретению можно использовать в комбинации с другим средством против злокачественной опухоли. Примеры такого средства против злокачественной опухоли включают алкилирующее средство, антиметаболит, ингибитор микротрубочек, антибиотическое средство против злокачественной опухоли, ингибитор топоизомераз, средство на основе платины, лекарственное средство против молекулярной мишени, гормональное средство и биологические средства. Примеры алкилирующего средства включают средства против злокачественной опухоли на основе азотистого иприта (например циклофосфамид), средства против злокачественной опухоли на основе нитрозомочевины (например ранимустин) и дакарбазин. Примеры антиметаболита включают 5-FU, UFT, кармофур, капецитабин, тегафур, TS-1, гемцитабин и цитарабин. Примеры ингибитора микротрубочек включают алкалоидные средства против злокачественной опухоли (например винкристин) и средства против злокачественной опухоли на основе таксанов (например доцетаксел и паклитаксел). Примеры антибиотического средства против злокачественной опухоли включают митомицин C, доксорубицин, эпирубицин, даунорубицин и блеомицин. Примеры ингибитора топоизомераз включают иринотекан и ногитекан, обладающие активностью ингибирования топоизомеразы I, и этопозид, обладающий активностью ингибирования топоизомеразы II. Примеры средства на основе платины включают цисплатин, параплатин, недаплатин и оксалиплатин. Примеры лекарственного средства против молекулярной мишени включают трастузумаб, ритуксимаб, иматиниб, гефитиниб, эрлотиниб, бевацизумаб, бортезомиб, сунитиниб и сорафениб. Примеры гормонального средства включают дексаметазон, финастерид и тамоксифен. Примеры биологических средств включают интерфероны α, β и γ, и интерлейкин 2.

Лекарственное средство против злокачественной опухоли по настоящему изобретению можно использовать в комбинации с терапией против злокачественной опухоли. Примеры терапии против злокачественной опухоли включают хирургическую операцию, лучевую терапию (включая терапию гамма-ножом, терапию киберножом, бор-нейтронзахватную терапию и терапию протонным пучком/пучком тяжелых ионов), MR-управляемую сфокусированную ультразвуковую хирургическую операцию, криотерапию, радиочастотную аблацию, терапию подкожной инъекцией этанола и эмболотерапию.

Лекарственное средство против злокачественной опухоли по настоящему изобретению является эффективным в отношении различных злокачественных опухолей млекопитающего (в том числе человека). Примеры злокачественной опухоли-мишени включают карциномы, такие как рак глотки, рак гортани, рак языка, рак легкого, рак молочной железы, рак пищевода, рак желудка, рак ободочной и прямой кишки, рак тела матки, рак яичника, рак печени, рак поджелудочной железы, рак желчного пузыря, рак почки, рак предстательной железы, злокачественная меланома и рак щитовидной железы; и саркомы, такие как остеосаркома, хондросаркома, рабдомиосаркома, лейомиосаркома, липосаркома, ангиосаркома, фибросаркома, лейкоз, злокачественная лимфома и миелома.

Лекарственное средство против злокачественной опухоли по настоящему изобретению можно растворять в водном растворе, предпочтительно физиологически адаптируемом буфере, таком как раствор Хэнкса, раствор Рингера или забуференный физиологический раствор. Также лекарственное средство может иметь форму суспензии, раствора, эмульсии или сходных с ними в маслянистом или водном носителе.

Дозировка лекарственного средства против злокачественной опухоли по настоящему изобретению, которая варьирует в зависимости от симптома, пути введения, массы тела, возраста и т.д. пациента, нуждающегося в этом, предпочтительно составляет, например, от 37 до 3700 МБк для одной обработки у взрослого.

Лекарственное средство против злокачественной опухоли по настоящему изобретению, главным образом, вводят парентерально. Например, лекарственное средство против злокачественной опухоли инъецируют (например, подкожно, внутривенно, внутримышечно, внутрибрюшинно) или вводят чрескожно, через слизистую оболочку, через носовую полость, через легкие и т.д.

Средство для диагностики злокачественной опухоли по настоящему изобретению можно использовать в визуализации опухоли. В случае, когда пациент имеет опухоль, в которой экспрессируется белок CDH3, средство для диагностики злокачественной опухоли по настоящему изобретению накапливается в опухоли. Таким образом, опухоль можно визуализировать путем детекции радиации с помощью устройства, такого как однофотонный эмиссионный компьютерный томограф (SPECT), позитронно-эмиссионный томограф (PET) или сцинтилляционная камера. Например, с использованием средства для диагностики злокачественной опухоли по настоящему изобретению, можно предсказывать терапевтический эффект лекарственного средства против злокачественной опухоли по настоящему изобретению до введения лекарственного средства. Диагностическое средство вводят пациенту до лечения и визуализируют опухоль. Когда наблюдают высокое накопление, может быть предсказана возможность лучшего эффекта лекарственного средства. Для определения терапевтического эффекта можно использовать диагностическое средство. Диагностическое средство по настоящему изобретению вводят пациенту, которому проводили лечение лекарственным средством по настоящему изобретению или любое другое лечение, так чтобы визуализировать опухоль. Путем мониторинга зависимого от времени варьирования накопления диагностического средства, можно наблюдать увеличение или уменьшение опухоли с течением времени.

Антитело для применения в качестве диагностического средства предпочтительно распознает эпитоп, за который конкурирует лекарственное средство. Более предпочтительно, антитело распознает тот же эпитоп, который распознается лекарственным средством. Наиболее предпочтительно, лекарственное средство и диагностическое средство представляют собой одно и то же антитело.

Средство для диагностики злокачественной опухоли по настоящему изобретению обычно вводят индивидууму внутривенно. Однако средство для диагностики злокачественной опухоли также можно вводить внутриартериально. Его дозировка, которая варьирует, в зависимости от симптома, пути введения, массы тела, возраста и т.д. пациента, нуждающегося в этом, предпочтительно составляет например, 37-1120 МБк за одну обработку у взрослого.

Примеры

Настоящее изобретение далее подробно описано с помощью примеров, которые не следует истолковывать как ограничивающие изобретение.

Пример 1: Получение растворимого антигена CDH3

Растворимый белок CDH3 (sCDH3), в котором C-концевая трансмембранная область удалена, получали, чтобы он служил в качестве иммуногена для получения антитела против CDH3.

(1) Получение вектора экспрессии для растворимого антигена CDH3

ПЦР проводили с использованием полноразмерной кДНК CDH3 в качестве матрицы и прямого праймера (SEQ ID NO:3: CGCGGTACCATGGGGCTCCCTCGT, (hCDH3FullFW)) и обратного праймера (SEQ ID NO:4: CCGTCTAGATAACCTCCCTTCCAGGGTCC, (hCDH3SolbRV)), который сконструирован так, чтобы амплифицировать сегмент, соответствующий внеклеточной области CDH3 (1-654 в SEQ ID NO:2, далее обозначаемая как кДНК sCDH3). Реакцию проводили с использованием KOD-Plus (продукт Toyobo) и в следующих условиях: 94°C-15 с, 55°C-30 с и 68°C-90 с (30 циклов)).

После завершения реакции ПЦР реакционную смесь подвергали агарозному гель-электрофорезу, и фрагмент геля, содержавший полосу целевого размера (приблизительно 2,0 т.п.н.) вырезали. Целевую кДНК sCDH3 выделяли из фрагмента геля с использованием набора для быстрой экстракции из геля QIA quick gel extraction kit (продукт Quiagen).

Для встраивания кДНК sCDH3 в вектор экспрессии pEF4/myc-HisB, кДНК sCDH3 обрабатывали двумя ферментами рестрикции: KpnI и XbaI. Полученный таким образом фрагмент встраивали в pEF4/myc-HisB, который обрабатывали теми же ферментами рестрикции KpnI и XbaI, с использованием ДНК-лигазы T4 с помощью общепринятого способа, посредством чего получали вектор экспрессии pEF4-sCDH3-myc-His.

(2) Экспрессия растворимого белка CDH3

Согласно протоколу реагента для трансфекции FuGENE6, 8×105 клеток CHO инокулировали в чашку диаметром 10 см за сутки до трансфекции и клетки культивировали в течение ночи. После этого вектор экспрессии pEF4-sCDH3-myc-His (8 мкг) и реагент FuGENE6 (16 мкл) смешивали с бессывороточной средой RPMI 1640 (400 мкл), и смеси позволяли стоять при комнатной температуре в течение 15 минут. Полученную смесь добавляли в клеточную культуральную жидкость для трансфекции. Через двое суток после трансфекции проводили клонирование путем лимитирующих разведений с использованием реагента для селекции (зеоцин).

Клетки CHO, экспрессирующие растворимый CDH3, отбирали с помощью вестерн-блоттинга с использованием моноклонального антитела против c-Myc (продукт SANTA CRUZ BIOTECHNOLOGY). Клеточные линии, которые проявляли высокий уровень секреции в культуральный супернатант и высокую пролиферацию, отбирали с получением клеточной линии CHO, экспрессирующей растворимый CDH3 (EXZ1702). Отобранные таким образом клетки CHO, экспрессирующие растворимый CDH3 (EXZ1702), культивировали в течение 72 часов в трех вращающихся флаконах (площадь культивирования в каждом: 1500 см2) с бессывороточной средой CHO-S-SFM-II (333 мл/флакон) (продукт Invitrogen), и культуральные супернатанты выделяли. Полученный таким образом культуральный супернатант подвергали аффинной хроматографии с помощью HP-колонки HisTrap (зарегистрированный торговый знак) (продукт GE Healthcare Bio-science) и гель-фильтрационной хроматографии с помощью колонки 200 pg Superdex (зарегистрированный торговый знак) (продукт GE Healthcare Bio-science), тем самым, получая растворимый белок CDH3.

Пример 2: Получение клеточной линии CHO, экспрессирующей CDH3

Для получения клеточной линии для скрининга антител против CDH3 получали клеточную линию CHO, экспрессирующую полноразмерный CDH3.

(1) Получение вектора экспрессии для гена CDH3

Для встраивания полноразмерной ДНК CDH3 человека, соответствующей SEQ ID NO: 1, в вектор экспрессии млекопитающих pEF4/myc-HisB (продукт Invitrogen), полноразмерную ДНК CDH3 человека обрабатывали двумя ферментами рестрикции: KpnI (продукт Takara Bio Inc.) и XbaI (продукт Takara Bio Inc.) при 37°C в течение одного часа. Полученный таким образом фрагмент встраивали в pEF4/myc-HisB, которую обрабатывали теми же ферментами рестрикции KpnI и XbaI с использованием ДНК-лигазы T4 (продукт Promega) общепринятым способом, посредством чего получали вектор экспрессии pEF4-CDH3-myc-His.

(2) Получение стабильной экспрессирующей CDH3 линии

Согласно протоколу реагента для трансфекции 6 FuGENE (зарегистрированный торговый знак) (продукт Roche Diagnostics K.K.), 8×105 клеток CHO инокулировали в чашку диаметром 10 см за сутки до трансфекции, и клетки культивировали в течение ночи. После этого вектор экспрессии pEF4-CDH3-myc-His (8 мкг) и реагент FuGENE6 (16 мкл) смешивали с бессывороточной средой RPMI1640 (продукт SIGMA-ALDRICH) (400 мкл), и смеси позволяли стоять при комнатной температуре в течение 15 минут. Полученную смесь добавляли к клеточной культуральной жидкости для трансфекции. Через двое суток после трансфекции проводили клонирование способом лимитирующих разведений с использованием реагента для селекции (зеоцин).

Клоны CHO, экспрессирующих полноразмерный CDH3, отбирали с помощью вестерн-блоттинга с использованием моноклонального антитела против c-Myc (продукт SANTA CRUZ BIOTECHNOLOGY). В результате была отобрана клеточная линия CHO, экспрессирующая полноразмерный CDH3 (EXZ1501), в качестве клеточной линии, которая проявляла высокий уровень экспрессии и высокую пролиферацию. Реакцию между EXZ1501 и коммерческим антителом против CDH3 (продукт R&D SYSTEMS) подтверждали проточной цитометрией. Таким образом, была подтверждена экспрессия белка CDH3 на клеточной мембране EXZ1501.

Пример 3: Получение моноклонального антитела против CDH3

(1) Получение моноклонального антитела с использованием растворимого белка CDH3 в качестве иммуногена

Растворимый белок CDH3 (50 мкг), растворенный в физиологическом растворе, смешивали с равным количеством Titer-MAX Gold (зарегистрированный торговый знак) (продукт Titer Max), и смесь внутрибрюшинно и подкожно инъецировали мышам MRL/lpr (Japan SLC inc.) для первоначальной иммунизации. Последующие процедуры иммунизации проводили путем внутрибрюшинной и подкожной инъекции мышам смеси растворимого белка CDH3 (25 мкг) и Titer-MAX Gold, полученного аналогичным образом. Через трое суток после конечной иммунизации клетки селезенки получали от мышей в асептических условиях и клетки подвергали слиянию с клетками миеломы мыши SP2/О-Ag14 или P3-X63-Ag8.653 с помощью обычно используемого способа с полиэтиленгликолем.

(2) Селекция гибридом, продуцирующих антитело против CDH3

Селекцию антител против CDH3 проводили с помощью проточной цитометрии с использованием клеточной линии CHO, экспрессирующей полноразмерный CDH3 (EXZ1501).

В частности, клетки CHO, экспрессирующие полноразмерный CDH3 (EXZ1501), извлекали из культурального планшета путем обработки 2 мМ EDTA-PBS и суспендировали в растворе FACS до концентрации клеток 1×106 клеток/мл. Суспензию клеток инокулировали в 96-луночный планшет до концентрации 50 мкл/лунка, и к ним добавляли культуральный супернатант гибридомы с последующей реакцией при 4°C в течение 60 минут. Планшет промывали два раза раствором FACS (200 мкл/лунка) и добавляли меченный Alexa Fluor 488 F(ab')2 козы против IgG мыши (продукт Invitrogen) с последующей реакцией при 4°C в течение 30 минут. Затем планшет промывали два раза раствором FACS и проводили проточную цитометрию, тем самым отбирая гибридомы, продуцирующие антитело, которое связывается с клетками CHO, экспрессирующими CDH3. В результате было получено 40 клонов от PPMX2016 до PPAT-052-28. С помощью проточной цитометрии было подтверждено, что все гибридомы реагировали с клетками CHO, экспрессирующими CDH3 (EXZ1501) и NCI-H358, но не реагировали с клетками CHO. Антитела очищали из культурального супернатанта гибридомы с помощью колонки с белком G и использовали в последующих экспериментах. Среди отобранных гибридом, PPMX2016 (NITE BP-897), PPMX2025 (NITE BP-898), PPMX2029 (NITE BP-899), PPAT-052-02 (NITE BP-1034), PPAT-052-03 (NITE BP-1035), PPAT-052-09 (NITE BP-1036), PPAT-052-24 (NITE BP-1037), PPAT-052-25 (NITE BP-1038), PPAT-052-26 (NITE BP-1039), и PPAT-052-28(NITE BP-1040) были депонированы в Incorporated Administrative Agency, National Institute of Technology and Evaluation, Patent Microorganisms Depositary (2-5-8, Kazusakamatari, Kisarazu-shi, Chiba, Япония) 10 февраля 2010 года и 18 января 2011 года.

Пример 4: Клонирование генов антител

(1) Фрагмент ДНК, кодирующий V-область моноклонального антитела мыши к CDH3 человека клонировали по следующей методике. Цитоплазматическую РНК выделяли из клеток гибридомы мыши с помощью способа, описанного в документе (Gough, "Rapid and quantitative preparation of cytoplasmatic RNA from small numbers of cells", Analytical Biochemisty, 173, p. 93-95 (1988)), при условии, что вместо буфера для растворения, использованного в том документе, использовали буфер TNE (т.е. 25 мМ Tris-HCl, pH: 7,5; 1% NP-40; 150 мМ NaCl; 1 мМ EDTA, pH: 8,0). Более конкретно, 5×106 клеток гибридомы суспендировали в буфере TNE (200 мкл), тем самым растворяя клеточные мембраны, и ядра клеток удаляли центрифугированием. К полученному таким образом супернатанту цитоплазмы (приблизительно 200 мкл), добавляли буфер для экстракции (10 мМ Tris-HCl, pH: 7,5; 0,35 M NaCl; 1% (масс./об.) SDS; 10 мМ EDTA, pH: 8,0; 7 M мочевина) (200 мкл). Смесь подвергали экстракции фенолом и хлороформом. К полученному таким образом раствору РНК добавляли гликоген (продукт Roche, каталожный номер № 901393), служащий в качестве носителя. Затем для осаждения продукта добавляли этанол. Осадок РНК растворяли в стерилизованной дистиллированной воде (от 10 до 50 мкл) до концентрации цитоплазматической РНК от 0,5 до 2 мкг/мл.

(2) Получение библиотеки кДНК из РНК, полученной из гибридом

Для синтеза одноцепочечной кДНК приготавливали реакционную смесь (20 мкл), содержавшую полученную, как описано выше, цитоплазматическую РНК (от 0,5 до 3 мкг), 50 мМ Tris-HCl (pH: 8,3, комнатная температура), 75 мМ KCl, 3 мМ MgCl2, и 10 мМ DTT), случайный праймер (100 нг), 0,5 мМ dNTP и Superscript II (обратная транскриптаза, продукт Invitrogen) (200 единиц). Смесь инкубировали при 42°C в течение 50 минут. Синтезированную таким образом библиотеку кДНК использовали в качестве матрицы для полимеразной цепной реакции (ПЦР) без проведения дальнейшей обработки.

(3) Амплификация гена, кодирующего вариабельную область антитела против CDH3, с помощью ПЦР

Все праймеры, использованные в экспериментах, были синтезированы Hokkaido System Science Co., Ltd.

A. Праймеры, использованные для амплификации способом ПЦР гена, кодирующего V-область L-цепи мыши

Использовали следующие два набора праймеров: (i) ДНК-праймер, обладающий на 5'-конце гомологией с частью FR1, и праймеры 4 набора, обладающие на 3'-конце гомологией с геном J-цепи в L-цепи мыши, и (ii) праймеры 7 набора, обладающие на 5'-конце гомологией с сигнальной частью L-цепи, и антисмысловой праймер, обладающий на 3'-конце гомологией с КС-частью (антисмысловой праймер KVL). Полимеразную цепную реакцию проводили с использованием двух наборов праймеров, тем самым получая фрагмент ДНК вариабельной области L-цепи иммуноглобулина мыши из кДНК. Последовательности праймеров являются следующими.

(i) Праймеры 4 набора для клонирования вариабельной области L-цепи мыши

Согласно "Phage Display -A Laboratory Manual-, Barbas Burton Scott Silverman", PROTOCOL 9.5, было синтезировано 17 смысловых праймеров и 3 обратных праймера в Hokkaido System Science Co., Ltd.

Смысловые для VK (часть FR1)

В качестве смыслового праймера для VK использовали смесь из следующих 17 праймеров.

5'-GAY АТС CAG CTG ACT CAG CC-3' (вырожденность 2): SEQ ID NO:5

5'-GAY ATT GTT CTC WCC CAG TC-3' (вырожденность 4): SEQ ID NO:6

5'-GAY ATT GTG MTM ACT CAG TC-3' (вырожденность 8): SEQ ID NO:7

5' GAY ATT GTG YTR АСА CAG TC-3' (вырожденность 8): SEQ ID NO:8

5' GAY ATT GTR ATG ACM CAG TC-3' (вырожденность 8): SEQ ID NO:9

5' GAY ATT MAG ATR AMC CAG TC-3' (вырожденность 16): SEQ ID NO:10

5' GAY ATT CAG ATG AYD CAG TC-3' (вырожденность 12): SEQ ID NO:11

5' GAY ATY CAG ATG АСА CAG AC-3' (вырожденность 4): SEQ ID NO:12

5' GAY ATT GTT CTC AWC CAG TC-3' (вырожденность 4): SEQ ID NO:13

5' GAY ATT GWG CTS ACC CAA TC-3' (вырожденность 8): SEQ ID NO:14

5' GAY ATT STR ATG ACC CAR TC-3' (вырожденность 16): SEQ ID NO:15

5' GAY RTT KTG ATG ACC CAR AC-3' (вырожденность 16): SEQ ID NO:16

5' GAY ATT GTG ATG ACB CAG KC-3' (вырожденность 12): SEQ ID NO:17

5' GAY ATT GTG ATA ACY CAG GA-3' (вырожденность 4): SEQ ID NO:18

5' GAY ATT GTG ATG ACC CAG WT-3' (вырожденность 4): SEQ ID NO:19

5' GAY ATT GTG ATG АСА CAA CC-3' (вырожденность 2): SEQ ID NO:20

5' GAY ATT TTG CTG ACT CAG TC-3' (вырожденность 2): SEQ ID NO:21

Антисмысловые для J (праймеры 4 набора)

Антисмысловой праймер для J1/J2 (1)

5'-GGS ACC AAR CTG GAA ATM AAA-3' (вырожденность 8): SEQ ID NO: 22

Антисмысловой праймер для J4 (2)

5'-GGG АСА AAG TTG GAA ATA AAA-3': SEQ ID NO: 23

Антисмысловой праймер для J5 (3)

5'-GGG ACC AAG CTG GAG CTG AAA-3': SEQ ID NO: 24

Смесь антисмысловых праймеров J1/J2, J4, J5 (4)

(ii) Праймеры 7 набора для клонирования вариабельной области L-цепи мыши

Смысловые для VK (часть сигнального пептида)

Праймеры получали путем модификации нуклеотидной последовательности набора праймеров Ig мыши (Novagen; Merck, каталожный номер № 69831-3), так чтобы удалить участки фермента рестрикции.

Смысловой праймер набора A

5'-ATGRAGWCACAKWCYCAGGTCTTT-3': SEQ ID NO:25

Смысловой праймер набора B

5'-ATGGAGACAGACACACTCCTGCTAT-3': SEQ ID NO:26

Смысловой праймер набора C

5'-ATGGAGWCAGACACACTSCTGYTATGGGT-3': SEQ ID NO:27

Смысловой праймер набора D (смесь следующих 2 праймеров)

5'-ATGAGGRCCCCTGCTCAGWTTYTTGGIWTCTT-3': SEQ ID NO:28

5'-ATGGGCWTCAAGATGRAGTCACAKWYYCWGG-3': SEQ ID NO:29

Смысловой праймер набора E (смесь следующих 3 праймеров)

5'-ATGAGTGTGCYCACTCAGGTCCTGGSGTT-3': SEQ ID NO:30

5'-ATGTGGGGAYCGKTTTYAMMCTTTTCAATTG-3': SEQ ID NO:31

5'-ATGGAAGCCCCAGCTCAGCTTCTCTTCC-3': SEQ ID NO:32

Смысловой праймер набора F (смесь следующих 4 праймеров)

5'-ATGAGIMMKTCIMTTCAITTCYTGGG-3': SEQ ID NO:33

5'-ATGAKGTHCYCIGCTCAGYTYCTIRG-3': SEQ ID NO:34

5'-ATGGTRTCCWCASCTCAGTTCCTTG-3': SEQ ID NO:35

5'-ATGTATATATGTTTGTTGTCTATTTCT-3': SEQ ID NO:36

Смысловой праймер набора G (смесь следующих 4 праймеров)

5'-ATGAAGTTGCCTGTTAGGCTGTTGGTGCT-3': SEQ ID NO:37

5'-ATGGATTTWCARGTGCAGATTWTCAGCTT-3': SEQ ID NO:38

5'-ATGGTYCTYATVTCCTTGCTGTTCTGG-3': SEQ ID NO:39

5'-ATGGTYCTYATVTTRCTGCTGCTATGG-3': SEQ ID NO: 40

Антисмысловой праймер KVL

ACTGGATGGTGGGAAGATGGA: SEQ ID NO: 41

B. Праймеры для применения в амплификации способом ПЦР гена, кодирующего V-область H-цепи мыши

Использовали следующие два набора праймеров: праймеры 4 набора, обладающие на 5'-конце гомологией с сигнальной частью H-цепи мыши, и праймер, обладающий на 3'-конце гомологией с частью IGHC; и праймеры 1 набора, обладающие на 5'-конце гомологией с FR1-частью, и праймеры 2 набора, обладающие на 3'-конце гомологией с константной областью H-цепи (IGHC) мыши. Полимеразную цепную реакцию проводили с использованием двух наборов праймеров, посредством чего фрагмент ДНК вариабельной области H-цепи иммуноглобулина мыши выделяли из кДНК. Последовательности праймеров являются следующими.

(i) Праймеры для клонирования вариабельной области H-цепи мыши

Смысловые для VH (сигнальная часть: праймеры 4 набора)

Эти праймеры синтезировали согласно Current Protocols in Immunology (John Wiley и Sons, Inc.), Unit 2.12 Cloning, Expression, and Modification of Antibody V Regions (таблица 2.12.2).

5'-ATG GRA TGS AGC TGK GTM ATS CTC TT-3' (вырожденность: 32): SEQ ID NO: 42

5'-ATG RAC TTC GGG YTG AGC TKG GTT TT-3' (вырожденность 8): SEQ ID NO: 43

5'-ATG GCT GTC TTG GGG CTG CTC TTC T-3': SEQ ID NO: 44

5'-ATG GRC AGR CTT ACW TYY-3' (вырожденность: 32): SEQ ID NO: 45

(ii) Праймеры для клонирования вариабельной области H-цепи мыши

Смысловые для VH (часть FR1)

Эти праймеры были сконструированы путем модификации нуклеотидной последовательности смысловых праймеров, описанных в документе (Tan et al, "Superhumanized" Antibodies: Reduction of Immunoogenic Potential by Complementarity-Determining Region Grafting with Human Germline Sequences: Application to an Anti-CD281, Journal of Immunology 169 (2002), p. 1119-1125).

5'-SAG GTS MAR CTK SAG SAG TCW GG-3'(вырожденность: 256): SEQ ID NO: 46

Антисмысловые для VH (антисмысловой праймер, общий для 3 и 4)

Праймер конструировали с вырожденностью нуклеотидной последовательности, так чтобы праймер мог подвергаться отжигу со всеми изоформами IgG мыши.

5'-CAS CCC CAT CDG TCT АТС C-3' (вырожденность: 6): SEQ ID NO: 47

Пример 5

Получение вектора экспрессии для химеры CDH3-иммуноглобулин

Получение экспрессирующей плазмиды

С помощью ПЦР с использованием DNA Engine (Peltier Thermal Cycler, MJ Research, Bio-Rad), каждую вариабельную область L-цепи и H-цепи моноклонального антитела мыши против CDH3 амлифицировали с использованием праймеров, описанных в примере 4. Каждый из амплифицированных таким образом фрагментов ДНК встраивали в вектор для субклонирования pGEM (продукт Promega). Нуклеотидную последовательность фрагмента ДНК определяли с использованием универсального праймера, который связывается с промотором T7 и SP6 вектора. Полученные таким образом нуклеотидные последовательности вариабельных областей L-цепи и H-цепи антитела против CDH3 подвергали поиску на странице для поиска IMGT/V-QUEST Search page (http://imgt.cines.f r/IMGT_vquest/vquest?livret=0&Option=mouseIg), посредством чего подтверждали завершение клонирования генов антител.

Далее ген, кодирующий область Сκ человека, связывали с клонированным геном, кодирующим V-область L-цепи антитела против CDH3, и ген, кодирующий область Cγ1 человека, связывали с геном, кодирующим V-область H-цепи. Сконструированные таким образом гены L-цепи и H-цепи химерного антитела синтезировали в полноразмерной форме в GenScript. В то же время, частоту использования кодонов оптимизировали так, чтобы получить эффективную экспрессию генов в продуцирующих клетках (согласно способу, описанному в Kim et al., Codon optimization for high-level expression of human erythropoietin (EPO) in mammalian cells, Gene, 199, 1997, p. 293-301). В частности, в случае L-цепи, для цели эффективной трансляции необходимую последовательность ДНК (Kozak, M., J., At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196, p. 947-950, 1987), сигнальный пептид IGKV мыши, V-область L-цепи антитела против CDH3 и Сκ-область человека располагали рядом в указанном порядке, и на оба конца добавляли участки для ферментов рестрикции (NheI на 5'-стороне и EcoRI на 3'-стороне). Химерную H-цепь получали аналогичным образом. Каждый из синтезированных генов вырезали с помощью NheI и EcoRI, и вырезанный фрагмент встраивали в вектор экспрессии pCAGGS между участком NheI и участком EcoRI, тем самым получая вектор экспрессии pCAGGS-IGK с L-цепью и вектор экспрессии с H-цепью pCAGGS-IGH химерного антитела против CDH3.

Пример 6: Получение стабильного вектора экспрессии для химерного иммуноглобулина против CDH3

Для реализации экспрессии на высоком уровне гена генетически модифицированного антитела в клетках CHO получали вектор экспрессии, в который был включен ген дигидрофолатредуктазы (dhfr), связанный с последовательностью промотора CMV и имеющий поли-A сигнал.

Для получения стабильно экспрессирующей/продуцирующей химерное антитело клеточной линии получали вектор экспрессии pCAGGS, в который был встроен ген dhfr. В частности, в pCAGGS-IGH и pCAGGS-IGK, которые представляют собой векторы для временной экспрессии, встраивали ген dhfr, имеющий промотор CMV, и поли-A сигнал. Каждый из гена dhfr, имеющего промотор CMV и последовательность Kozak, и поли-A сигнала SV40 амплифицировали способом ПЦР. Эти гены в форме смеси связывали друг с другом с помощью ПЦР, и на оба конца связанного продукта добавляли участок HindIII, тем самым получая фрагмент гена HindIII-промотор CMV-Kozak-dhfr-поли A-HindIII. Этот фрагмент встраивали в pCAGGS-IGH или pCAGGS-IGK в участках HindIII, тем самым, получая pCAGGS-IGH-CMVp-dhfr-A и pCAGGS-IGK-CMVp-dhfr-A. Эти векторы экспрессии обеспечивают экспрессию химерного антитела с помощью промотора CAG, и экспрессию гена dhfr с помощью промотора CMV, посредством чего можно эффективно получать химерное антитело путем амплификации генов.

Пример 7: Получение клеточной линии CHO, продуцирующей химерное антитело против CDH3

Клетки CHO dhfr (G. Urlaub et al., Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity, Proc. Natl. Acad. Sci. USA 77, p. 4216-4220, 1980) одновременно трансформировали с использованием двух плазмид (линейные плазмиды, полученные разрезанием кольцевых плазмид с помощью PvuI в устойчивом к ампициллину гене); т.е. вектор pCAGGS-IGK-CMV-dhfr-A для экспрессии L-цепи химерного антитела против CDH3 и вектор pCAGGS-IGH-CMV-dhfr-A для экспрессии H-цепи химерного антитела против CDH3. Электропорацию проводили с помощью Amaxa (продукт Lonza). Фрагмент ДНК (2 мкг/образец; в случае плазмиды для L-цепи или плазмиды для H-цепи) добавляли в 0,1 мл буфера для электропорации CHO Amaxa, содержавший 3×103 клеток, и применяли импульс.

Клетки, претерпевшие электропорацию, добавляли в модифицированную по способу Исков среду Дульбекко (IMDM: не содержащая HT), содержавшую 10% подвергнутую диализу FBS, не содержащую HT (H: гипоксантин, T: тимидин). Через трое суток после трансфекции среду заменяли на среду IMDM, не содержавшую 10% подвергнутой диализу FBS, с 2 мМ L-глутамином и HT, и трансформированные neo+ клетки отбирали с использованием 1 мг/мл G418, тем самым получая клоны положительной клеточной линии, продуцирующей химерное антитело. Затем проводили амплификацию генов с использованием клонов, отобранных с использованием G418. Проводили амплификацию из 2 раундов в 250 нМ и 1000 нМ метотрексате (MTX) и выявляли клеточные линии, которые могут продуцировать химерное антитело против CDH3 (приблизительно от 50 до 100 мг/л культурального супернатанта). Полученные таким образом клеточные линии CHO, стабильно экспрессирующие химерное антитело против CDH3, депонировали в Incorporated Administrative Agency, the National Institute of Technology and Evaluation, Patent Microorganisms Depositary.

Таблица 1
Клеточная линия № доступа Клеточная линия № доступа
PPAT-052-02c NITE BP-1041 PPAT-052-25c NITE BP-1046
PPAT-052-03c NITE BP-1042 PPAT-052-26c NITE BP-1047
PPAT-052-09c NITE BP-1043 PPAT-052-27c NITE BP-1048
PPAT-052-21c NITE BP-1044 PPAT-052-28c NITE BP-1049
PPAT-052-24c NITE BP-1045 PPAT-052-29c NITE BP-1050

Пример 8: Получение очищенных антител

Антитела очищали из культурального супернатанта с использованием белка A.

Пример 9: Подтверждение аффинности

С помощью конкурентного способа аффинность антитела мыши против CDH3 сравнивали с аффинностью химерного антитела против CDH3. В конкурентном способе аффинность антитела против CDH3 определяли с помощью проточной цитометрии (BD, FACS Calibur) с использованием злокачественных клеток NCI-H358, о которых известно, что они являются клетками с высокой экспрессией CDH3.

В частности, образец с серийным разбавлением антитела (от 400 мкг/мл до 24 нг/мл) (50 мкл) и меченное Alexa488 антитело (4 мкг/мл) (50 мкл) добавляли в 96-луночный планшет и перемешивали. Клетки NCI-H358 извлекали из культурального планшета путем обработки 2 мМ EDTA-PBS, и клетки суспендировали в растворе FACS (1% BSA PBS) до концентрации 1,5×106/мл. В лунки, содержавшие смесь антител, добавляли аликвоту (100 мкл) суспензии. После добавления реакцию проводили при комнатной температуре в течение 60 минут и планшет промывали два раза раствором FACS (200 мкл/лунка). Затем определяли интенсивность флуоресценции (среднее значение GEO) каждой лунки проточной цитометрией.

Процент ингибирования связывания меченного Alexa488 антитела вычисляли из средней величины GEO, по сравнению с величиной, полученной путем реакции только с меченным Alexa488 антителом (1 мкг/мл). Вычисляли концентрацию антитела, демонстрирующую 50% ингибирование, и данные сравнивали.

На фиг. 1 представлена оценка аффинности PPMX2016 (антитело мыши) и PPAT-052-27C (его химерное антитело). Между двумя антителами практически не наблюдали отличий.

Пример 10: Получение меченых антител

(1) Связывание DOTA с антителом

Антитело растворяли в буфере (50 мМ Bicine-NaOH, 150 мМ NaCl, pH: 8,5) до концентрации антитела 10 мг/мл. Отдельно, изотиоцианобензил-DOTA (B-205, продукт Macrocyclics) растворяли в DMSO до концентрации 10 мг/мл. Два раствора смешивали для доведения молярного соотношения антитела и DOTA 1:1 (соотношение при добавлении 1:1), 1:3 (соотношение при добавлении 1:3) или 1:10 (соотношение при добавлении 1:10), и смесь перемешивали и позволяли ей стоять при 25°C в течение 17 часов. После завершения реакции реакционную смесь очищали с помощью колонки для обессоливания (PD-10, продукт GE Healthcare, 17-0435-01) с PBS. Использовали следующие антитела: PPMX2016, PPMX2025, PPMX2029, PPAT-052-27c и РРАТ-052-28С.

(2) Определение процента включения хелата

Процент хелата, включенного в антитело, определяли с помощью хелатометрического титрования. Концентрацию модифицируемого антитела определяли заранее стандартным способом и количество моль модифицируемого антитела вычисляли из молекулярной массы IgG. К стандартному раствору меди 1 мг/мл (100 мкл), концентрация которой была определена с помощью атомной абсорбционной спектрометрии, добавляли реагент arsenazo III (0,776 мг) и не содержащий металла 5 M раствор ацетата аммония (продукт Sigma Aldrich) (3 мл), и к раствору добавляли сверхчистую воду для доведения конечного объема до 10 мл. Полученный раствор хранили при комнатной температуре в темноте для получения раствора arsenazo III. DOTA растворяли в сверхчистой воде, тем самым получая стандартный раствор DOTA. Модифицируемое антитело растворяли в сверхчистой воде, тем самым получая раствор модифицируемого антитела. Стандартный раствор DOTA или раствор модифицируемого антитела (10 мкл) смешивали с раствором arsenazo III (190 мкл), и смесь инкубировали при 37°C в течение 30 минут. Затем измеряли поглощение при длине волны 630 нм. Из показателей поглощения стандартных растворов DOTA строили стандартную кривую. С помощью стандартной кривой вычисляли количество молекулы(молекул) DOTA, связанной с модифицируемым антителом (среднее количество DOTA при модификации).

В таблице 2 представлены результаты (соотношение при добавлении DOTA и истинное среднее количество модифицирующей DOTA). Как очевидно из таблицы 2, было выявлено количество молекул DOTA, связанных с антителом, путем определения по соотношению при добавлении DOTA.

Таблица 2
Соотношение при добавлении антитела и DOTA Среднее количество модифицирующей DOTA
PPMX2025 (соотношение при добавлении 1:1) 0,9
PPMX2025 (соотношение при добавлении 1:3) 2,0
PPMX2025 (соотношение при добавлении 1:10) 5,3
PPMX2016 (соотношение при добавлении 1:1) 0,7
PPMX2016 (соотношение при добавлении 1:3) 2,1
PPMX2016 (соотношение при добавлении 1:10) 5,2
PPAT-052-27c (соотношение при добавлении 1:3) 1,8
(Примечание) PPAT-052-27c тестировали только в соотношении при добавлении 1:3

(3) Получение меченных 67Ga, 111In или 90Y антител

(i) Мечение 67Ga или 111In

Каждое из очищенных антител PPMX2016, PPMX2025, PPMX2029, и PPAT-052-27с и антитело PPAT-052-28c растворяли в буфере (0,25 M ацетат аммония-HCl, pH: 5,5) до концентрации 6 мг/мл. К раствору антитела добавляли раствор 67GaCl3 (продукт Fuji Film RI Pharma) или раствор 111InCl3 (продукт MDS Nordion Inc.) и смесь инкубировали при 45°C в течение одного часа.

(ii) Мечение 90Y

Каждое из очищенных антител PPMX2029 и PPAT-052-27с растворяли в буфере (0,25 М ацетат аммония-HCl, pH: 5,5) до концентрации 6 мг/мл. К раствору антитела добавляли раствор 90YCl3 (продукт Nuclitec), и смесь инкубировали при 45°C в течение одного часа.

(iii) Определение процента мечения

Аликвоту реакционной смеси для мечения отбирали и подвергали тонкослойной хроматографии (61885, продукт PALL), тем самым определяя процент мечения. В качестве элюента использовали физиологический раствор и на верхнем и нижнем концах полоски измеряли радиоактивность с помощью γ-счетчика. Процент мечения вычисляли по следующему уравнению.

[E1]

Процент мечения = (количество импульсов на нижнем конце/ (количество импульсов на верхнем конце + количество импульсов на нижнем конце))×100 (%)

Когда процент мечения достигал 90% или выше, меченое антитело использовали в последующем эксперименте. Меченые антитела очищали на колонке для обессоливания (PD-10, продукт GE Healthcare, 17-0435-01) с PBS.

Пример 11: Исследование взаимосвязи между процентом включения хелата и биораспределением (т.е. распределения в организме)

PPMX2016, PPMX2025 и PPMX2029 исследовали в отношении биораспределения по разности величин процента включения хелата (соотношение при добавлении DOTA 1:1, 1:3 и 1:10).

Во-первых, NCI-H358 вычисляли в среде RPMI1640, содержавшей 10% FBS, и культивированные клетки подкожно трансплантировали в правую брюшную область каждой мыши “nude” (самка, возраст 7 недель, CLEA Japan Inc.) при концентрации клеток 1×107 клеток/мышь. Мышей выводили до тех пор, пока средний объем опухоли не достигал 100-150 мм3.

Затем мышам с трансплантированными NCI-H358 вводили антитело 67Ga-DOTA-PPMX2016 (соотношение при добавлении 1:3 и 1:10), антитело 67Ga-DOTA-PPMX2025 (соотношение при добавлении 1:3 и 1:10) или антитело 67Ga-DOTA-PPMX2029 (соотношение при добавлении 1:3 и 1:10) в дозе 370 кБк/мышь.

Через девяносто шесть часов после введения мышей умерщвляли для анатомического исследования и ткани и опухоль извлекали. Измеряли массу каждой ткани и массу опухоли, радиоактивность измеряли с помощью γ-счетчика и %ID/г вычисляли по следующему уравнению.

[E2]

%ID/г=(количество накопленного RI/общее введенное количество RI×100 (%))/масса (г)

Результаты представлены на фиг. 2-7. Все протестированные антитела проявляли усиленное накопление в опухоли при соотношение при добавлении для DOTA 1:3, по сравнению со случаем соотношения 1:10. Такое усиленное накопление приводит к увеличению терапевтического эффекта. Кроме того, можно избежать неблагоприятных побочных эффектов, которые в ином случае были бы вызваны удержанием радиоактивного вещества в не являющихся мишенями органах.

На фиг. 8 представлен результат введения антитела 67Ga-DOTA-PPMX2025 (при использовании соотношения 1:1, 1:3 и 1:10) не имеющим злокачественной опухоли мышам “nude” (самки, возраст 7 недель, CLEA Japan Inc.) в дозе 370 кБк/мышь. Антитело в высокой степени накапливалось в печени, когда соотношение при добавлении составляло 1:10, в то время как накопление в печени было низким, когда соотношение составляло 1:3 или 1:1, что указывает на то, что в печени предотвращаются неблагоприятные побочные эффекты, такие как радиоактивное повреждение.

Пример 12: Исследование поведения химерного антитела против caldina в организме

Исследовали поведение химерных антител PPAT-052-27c и PPAT-052-28c в организме.

Во-первых, NCI-H1373 культивировали в среде RPMI1640, содержавшей 10% FBS, и культивированные клетки подкожно трансплантировали в правую брюшную область каждой мыши “nude” (самки, возраст 9 недель, CLEA Japan Inc.) в концентрации клеток 4×106 клеток/мышь. Мышей выводили до тех пор, пока средний размер опухоли не достигал 100-150 мм3.

Затем мышам с трансплантированными NCI-H1373 вводили 111In-DOTA-PPAT-052-27c (соотношение при добавлении 1:3) или 111In-DOTA-PPAT-052-28c (соотношение при добавлении 1:3) в дозе 370 кБк/мышь.

Через сорок восемь часов или девяносто шесть часов после введения мышей умерщвляли для анатомического исследования и ткани и опухоль извлекали. Измеряли массу каждой ткани и массу опухоли, радиоактивность измеряли с помощью γ-счетчика и вычисляли %ID/г.

Результаты представлены на фиг. 9-11. PPAT-052-27c проявляло процентное накопление в опухоли до 46% ID/г через 48 часов после введения. PPAT-052-28c проявляло процентное накопление в опухоли до 41% ID/г через 48 часов после введения и 52% ID/г через 96 часов после введения.

Пример 13: Испытание с ксенотрансплантатом

NCI-H358 культивировали в среде RPMI1640, содержавшей 10% FBS, и культивированные клетки подкожно трансплантировали в правую брюшную область каждой из мышей “nude” (самки, возраст 7 недель, CLEA Japan Inc.) в концентрации клеток 1×107 клеток/мышь.

Мышей с трансплантированными NCI-H358 разделяли на шесть групп (n=8). Антитело 90Y-DOTA-PPMX2029 (соотношение при добавлении 1:3) вводили в дозе 7,4 МБк/мышь, 5,6 МБк/мышь, 3,7 МБк/мышь и 1,9 МБк/мышь. В качестве контрольных групп вводили немеченое PPMX2029 в дозе 80 мкг/мышь, и физиологический раствор вводили в дозе 100 мкл/мышь. Во всех группах введение проводили, когда средний объем опухоли достигал 100-150 мм3.

После ведения массу тела и объем опухоли измеряли два раза в неделю (каждые 3 или 4 суток). Это наблюдение продолжали до 51 суток после введения.

Результаты испытания представлены на фиг. 12. Антитело 90Y-DOTA-PPMX2029 (соотношение при добавлении 1:3) проявляло противоопухолевый эффект, пропорциональный радиоактивности.

Отдельно NCI-H1373 культивировали в среде RPMI1640, содержавшей 10% FBS, и культивированные клетки подкожно трансплантировали в правую брюшную область каждой мыши “nude” (самки, возраст 7 недель, CLEA Japan Inc.) в концентрации клеток 5×106 клеток/мышь.

Мышей с трансплантированными NCI-H358 разделяли на шесть групп (n=8). Антитело 90Y-DOTA-PPAT-052-27c (соотношение при добавлении 1:3) вводили в дозе 5,6 МБк/мышь и 3,7 МБк/мышь. В качестве контрольных групп вводили немеченое PPMX2029 в дозе 60 мкг/мышь, и физиологический раствор вводили в дозе 100 мкл/мышь. Во всех группах введение проводили, когда средний объем опухоли достигал 100-150 мм3.

После ведения массу тела и объем опухоли измеряли два раза в неделю (каждые 3 или 4 суток). Это наблюдение продолжали до 26 суток после введения.

Результат испытания представлены на фиг. 13. 90Y-DOTA-PPAT-052-27c (соотношение при добавлении 1:3) проявляло противоопухолевый эффект, пропорциональный радиоактивности.

Пример 14: Иммуногистохимическое окрашивание

Экспрессию белка CDH3 в клиническом образце злокачественной опухоли подтверждали иммуногистохимическим окрашиванием набора образцов тканей злокачественной опухоли.

В качестве наборов образцов тканей злокачественной опухоли использовали ткани рака поджелудочной железы (аденокарцинома), рака легкого (аденокарцинома), рака легкого (плоскоклеточная карцинома) и рака ободочной и прямой кишки (аденокарцинома), которые являются продуктами Shanghai Outdo Biotech Co., Ltd.

Предметное стекло с каждым набором тканей депарафинизировали и активировали 10 мМ Tris, 1 мМ EDTA (pH: 9,0) при 95°C в течение 40 минут. Эндогенную пероксидазу на предметном стекле с набором тканей инактивировали блокирующим реагентом, который включен в набор ENVISION+Kit (продукт Dako). Затем предметное стекло с набором тканей подвергали реакции с 5 мкг/мл антитела против CDH3 610227 (продукт BD BIOSCIENCE) или с 5 мкг/мл антитела против HBs Hyb-3423 (отрицательный контроль) при 4°C в течение ночи. Раствор антитела раствор смывали и предметное стекло с набором тканей далее подвергали реакции с реагентом полимер-вторичное антитело, который был включен в набор ENVISION+Kit при комнатной температуре в течение 30 минут. Затем на предметном стекле проявляли цвет с помощью окрашивающего реагента, включенного в набор ENVISION+Kit, и окрашивание ядер проводили с использованием раствора гематоксилин/эозин.

Результаты представлены на фиг. 14. Злокачественные клетки окрашивались антителом против CDH3, а нормальные клетки не окрашивались.

1. Меченное радиоактивным металлом антитело против P-кадгерина, которое получено путем связывания радиоактивного металлического элемента с антителом против P-кадгерина через металл-хелатирующий реагент, где антитело против P-кадгерина специфически связывается с областью 1-655 последовательности SEQ ID NO: 2.

2. Меченное радиоактивным металлом антитело против P-кадгерина по п. 1, где антитело против P-кадгерина представляет собой моноклональное антитело, или антитело против P-кадгерина выбрано из группы, состоящей из химерного антитела, гуманизированного антитела и антитела человека.

3. Меченное радиоактивным металлом антитело против P-кадгерина по п. 1, где антитело против P-кадгерина представляет собой моноклональное антитело или рекомбинантное антитело, продуцируемое антитело-продуцирующей клеткой, которой соответствует номер доступа NITE BP-897, NITE BP-898, NITE BP-899, NITE BP-1040, NITE BP-1048, NITE BP-1049 или NITE BP-1050.

4. Меченное радиоактивным металлом антитело против P-кадгерина по п. 1, где антитело против P-кадгерина представляет собой химерное антитело, гуманизированное антитело или фрагмент со способностью распознавать белок, кодируемый геном P-кадгерина, полученные модификацией моноклонального антитела по п. 1.

5. Меченное радиоактивным металлом антитело против P-кадгерина по п. 1, где металл-хелатирующий реагент выбран из группы, состоящей из изотиоцианобензил-DOTA, метилизотиоцианобензил-DTPA и циклогексилизотиоцианобензил-DTPA.

6. Меченное радиоактивным металлом антитело против P-кадгерина по п. 1, где молярное соотношение антитела против P-кадгерина и металл-хелатирующего реагента составляет от 1:0,1 до 1:4,5, предпочтительно, от 1:0,5 до 1:3.

7. Меченное радиоактивным металлом антитело против P-кадгерина по п. 1, где радиоактивный металлический элемент представляет собой цитотоксический радиоактивный металл, используемый в терапии злокачественной опухоли, который может быть выбран из группы, состоящей из иттрия-90 (90Y), рения-186 (186Re), рения-188 (188Re), меди-67 (67Cu), железа-59 (59Fe), стронция-89 (89Sr), золота-198 (198Au), диспрозия-165 (165Dy), рутения-103 (103Ru), холмия-166 (166Ho), самария-153 (153Sm) и лютеция-177 (177Lu), предпочтительно, представляет собой иттрий-90 (90Y), где терапия злокачественной опухоли нацелена на экспрессирующую P-кадгерин опухоль.

8. Меченное радиоактивным металлом антитело против P-кадгерина по п. 1, где радиоактивный металлический элемент представляет собой нецитотоксический радиоактивный металл, используемый в диагностике злокачественной опухоли, который может быть выбран из группы, состоящей из технеция-99m (99mTc), индия-111 (111In), индия-113m (113mIn), галлия-67 (67Ga), галлия-68 (68Ga), таллия-201 (201Tl), кобальта-57 (57Co), стронция-85 (85Sr) и меди-64 (64Cu), предпочтительно, нецитотоксический радиоактивный металл выбран из индия-111 (111In) и меди-64 (64Cu).

9. Лекарственное средство против злокачественной опухоли, содержащее в качестве активного ингредиента эффективное количество меченного радиоактивным металлом антитела против P-кадгерина по п. 7.

10. Средство для диагностики злокачественной опухоли, содержащее в качестве активного ингредиента эффективное количество меченного радиоактивным металлом антитела против P-кадгерина по п. 8.

11. Антитело-продуцирующая клетка для продукции антитела против P-кадгерина по п. 1, которая депонирована под номером доступа NITE BP-897.

12. Антитело-продуцирующая клетка для продукции антитела против P-кадгерина по п. 1, которая депонирована под номером доступа NITE BP-898.

13. Антитело-продуцирующая клетка для продукции антитела против P-кадгерина по п. 1, которая депонирована под номером доступа NITE BP-899.

14. Антитело-продуцирующая клетка для продукции антитела против P-кадгерина по п. 1, которая депонирована под номером доступа NITE BP-1040.

15. Антитело-продуцирующая клетка для продукции антитела против P-кадгерина по п. 1, которая депонирована под номером доступа NITE BP-1044.

16. Антитело-продуцирующая клетка для продукции антитела против P-кадгерина по п. 1, которая депонирована под номером доступа NITE BP-1048.

17. Антитело-продуцирующая клетка для продукции антитела против P-кадгерина по п. 1, которая депонирована под номером доступа NITE BP-1049.

18. Антитело-продуцирующая клетка для продукции антитела против P-кадгерина по п. 1, которая депонирована под номером доступа NITE BP-1050.

19. Применение меченного радиоактивным металлом антитела против P-кадгерина по п. 7 для получения лекарственного средства против злокачественной опухоли.

20. Применение меченного радиоактивным металлом антитела против P-кадгерина по п. 8 для получения диагностического средства против злокачественной опухоли.

21. Способ лечения злокачественной опухоли, включающий введение эффективного количества меченного радиоактивным металлом антитела против P-кадгерина по п. 7 индивидууму, нуждающемуся в этом.

22. Способ диагностики злокачественной опухоли, включающий введение эффективного количества меченного радиоактивным металлом антитела против P-кадгерина по п. 8 индивидууму, нуждающемуся в этом.

23. Антитело против P-кадгерина, меченное предшественником метки из радиоактивного металла, которое получают путем взаимодействия антитела против P-кадгерина с метал-хелатирующим агентом, где антитело против P-кадгерина представляет собой моноклональное антитело или рекомбинантное антитело, продуцируемое антитело-продуцирующей клеткой, которой соответствует номер доступа NITE BP-897, NITE BP-898, NITE BP-899, NITE BP-1040, NITE BP-1044, NITE BP-1048, NITE BP-1049 или NITE BP-1050, или фрагмент со способностью распознавать белок, кодируемый геном P-кадгерина.

24. Антитело против P-кадгерина, меченное предшественником метки из радиоактивного металла, по п. 23, где антитело против P-кадгерина представляет собой химерное антитело, гуманизированное антитело или фрагмент со способностью распознавать белок, кодируемый геном P-кадгерина, полученные модификацией моноклонального антитела по п. 23.

25. Антитело против P-кадгерина, меченное предшественником метки из радиоактивного металла, по п. 23, где металл-хелатирующий реагент выбран из группы, состоящей из изотиоцианобензил-DOTA, метилизотиоцианобензил-DTPA и циклогексилизотиоцианобензил-DTPA.

26. Антитело против P-кадгерина, меченное предшественником метки из радиоактивного металла, по п. 23, где молярное соотношение антитела против P-кадгерина и металл-хелатирующего реагента составляет от 1:0,1 до 1:4,5, предпочтительно, от 1:0,5 до 1:3.

27. Антитело против P-кадгерина, которое представляет собой моноклональное антитело или рекомбинантное антитело, продуцируемое антитело-продуцирующей клеткой, которой соответствует номер доступа NITE BP-897, NITE BP-898, NITE BP-899, NITE BP-1040, NITE BP-1044, NITE BP-1048, NITE BP-1049 или NITE BP-1050, или фрагмент со способностью распознавать белок, кодируемый геном P-кадгерина.

28. Антитело против P-кадгерина по п. 27, которое является химерным антителом или гуманизированным антителом или фрагментом со способностью распознавать белок, кодируемый геном P-кадгерина, полученные модификацией моноклонального антитела по п. 27.



 

Похожие патенты:

Изобретение относится к биотехнологии. Описано антитело или его антигенсвязывающий фрагмент, которое связывает ErB3 человека.

Изобретение относится к области биотехнологии, конкретно к получению меченых антител, и может быть использовано для диагностики. Антитела конструируют с заменой одной или нескольких аминокислот исходного антитела на не являющиеся перекрестно связанными, высокореакционноспособные цистеиновые аминокислоты.

Данное изобретение относится к области биотехнологии. Предложены антитела, которые связываются с фибронектиновым доменом III типа 1 (FND1) белка AXL и вызывают деактивацию AXL, а также применение таких антител для подавления роста злокачественной опухоли, опосредованной AXL, продуцирующие их гибридомы и композиция для подавления роста злокачественной опухоли, опосредованной AXL, которая в качестве активного ингредиента содержит антитело по настоящему изобретению.

Изобретение относится к биотехнологии. Предложена композиция антитела для лечения HER2-позитивного рака, содержащая в качестве активного начала антитело, характеризующееся наличием вариабельной области лёгкой и тяжёлой цепи, и его кислые варианты, а именно: гликозилированный, дезаминированный варианты, а также вариант с восстановленной дисульфидной связью, сиалилированный вариант и невосстанавливаемый вариант.

Изобретение относится к биотехнологии. .

Изобретение относится к медицине, а именно к иммунотерапии. .

Изобретение относится к области медицины и касается комбинированной терапии антителами для лечения В-клеточных злокачественных опухолей с использованием иммунорегуляторного антитела, особенно антитела против В7, против CD23 или против антитела, уменьшающего количество В-клеток, особенно антитела против CD20.

Изобретение относится к генетической инженерии. .
Наверх