Профилактический или терапевтический агент для лечения фиброза



Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза
Профилактический или терапевтический агент для лечения фиброза

 

C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2583290:

МИЕ ЮНИВЕРСИТИ (JP)
ОЦУКА ФАРМАСЬЮТИКАЛ КО., ЛТД. (JP)

Группа изобретений относится к области биотехнологии, в частности к миРНК и ее применениям для лечения легочного фиброза и рака легких. миРНК имеет полную длину от 17 до 23 нуклеотидов и нацелена на последовательность, содержащую от 17 до 23 идущих подряд оснований, выбранных из группы, состоящей из оснований в положениях с 1285 по 1318, оснований в положениях с 1398 по 1418, оснований в положениях с 1434 по 1463, оснований в положениях с 1548 по 1579, оснований в положениях с 1608 по 1628, оснований в положениях с 1700 по 1726, оснований в положениях с 1778 по 1798, оснований в положениях с 1806 по 1826 и оснований в положениях с 1887 по 1907 последовательности SEQ ID NO: 1, для использования в эффективном ингибировании и подавлении экспрессии гена TGF-β1, при гибридизации. 13 н. и 8 з.п. ф-лы, 5 ил., 10 табл., 9 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к терапевтическому агенту для лечения фиброза. В частности, настоящее изобретение относится к малым интерферирующим РНК (миРНК), нацеленным на ген, кодирующий трансформирующий фактор роста (TGF)-β1, и лекарственному препарату, содержащему миРНК.

Уровень техники

Легочный фиброз характеризуется симптомом, при котором ткани легкого становятся фиброзными в результате накопления избытка коллагена и другого внеклеточного матрикса. В классификации легочного фиброза идиопатический легочный фиброз представляет собой трудноизлечимое хроническое заболевание, имеющее неблагоприятный прогноз со средним временем выживания в среднем три года и пятилетней выживаемостью от 20 до 40%. Для лечения легочного фиброза применяются стероидные лекарственные препараты и иммуносупрессанты; однако эффективная терапия, способная улучшить прогноз, в настоящее время отсутствует, и таким образом, необходим разработка нового лекарственного средства.

Недавно было установлено, что существует много заболеваний, появление которых связано с генотипом, и также имеются сообщения о многих генах, вовлеченных в развитие легочного фиброза (см. Патентные документы 1-4, Непатентные документы 1-6). В качестве основных факторов, связанных с легочным фиброзом упоминаются TGF-β1 (Патентные документы 1 и 2, Непатентные документы 2-6), Smad3 (Непатентный документ 1), MCP-1 (Патентный документ 3) и тому подобное.

Между тем, нуклеиновая кислота, в частности миРНК, вызывает разрушение мРНК гена, имея последовательность идентичную или почти идентичную определенной последовательности, находящейся в клетке, подавляя тем самым экспрессию гена-мишени (РНК интерференция). Таким образом, принцип подавления экспрессии гена-мишени при помощи РНК интерференции является пригодным для облегчения или лечения симптомов заболевания, вызываемых ненормальной экспрессией конкретного гена или группы генов. Также в случае генов, связанных с легочным фиброзом, имеются сообщения о попытках подавления экспрессии этих генов при помощи миРНК (Патентные документы 1-4, Непатентные документы 1-6).

Однако существующие на сегодняшний день технологии обеспечивают подавляющее действие последовательности миРНК на связанный с заболеванием ген только у экспериментальных животных (мышей и крыс), не обеспечивая при этом достаточного подавляющего действия по отношению конкретно к генам человека. Кроме того, что касается подавляющего действия миРНК, то это действие миРНК было показано при концентрациях 200 нМ (Непатентный документ 1) и от 20 до 500 нМ (Непатентный документ 5), молекула нуклеиновой кислоты, способная эффективно подавлять экспрессию гена, связанного с легочным фиброзом, при низкой концентрации неизвестна.

Несколько десятков миРНК, нацеленных на ген TGF-β1, известно на сегодняшний день (Патентные документы 1 и 5-7). Однако, принимая во внимание, что полноразмерный ген TGF-β1 состоит из 2346 оснований (номер доступа GenBank NM_000660.3), и существует бесчисленное количество комбинаций выбора приблизительно 20-нуклеотидных последовательностей из этого полноразмерного гена, нелегко осуществить дизайн молекулы дцРНК или миРНК, способной более эффективно подавлять экспрессию этого гена, на основе этих комбинаций.

Цитируемые документы

Патентные документы

Патентный документ 1: WO2007/109097

Патентный документ 2: WO2003/035083

Патентный документ 3: JP-A-2007-119396

Патентный документ 4: JP-A-2009-516517

Патентный документ 5: WO2009/061417

Патентный документ 6: WO2008/109548

Патентный документ 7: WO2007/79224

Непатентные документы

Непатентный документ 1: Wang Z, Gao Z, Shi Y, Sun Y, Lin Z, Jiang H, Hou T, Wang Q, Yuan X, Zhu X, Wu H, Jin Y, J. Plast. Reconstr. Aesthet. Surg., 1193-1199, 60, 2007.

Непатентный документ 2: Hwang M, Kim HJ, Noh HJ, Chang YC, Chae YM, Kim KH, Jeon JP, Lee TS, Oh HK, Lee YS, Park KK, Exp. Mol. Pathol., 48-54, 81, 2006.

Непатентный документ 3: Takabatake Y, Isaka Y, Mizui M, Kawachi H, Shimizu F, Ito T, Hori M, Imai E, Gene Ther., 965-973, 12, 2005.

Непатентный документ 4: Xu W, Wang LW, Shi JZ, Gong ZJ, Hepatobiliary Pancreat. Dis. Int., 300-308, 8, 2009.

Непатентный документ 5: Liu XJ, Ruan CM, Gong XF, Li XZ, Wang HL, Wang MW, Yin JQ, Biotechnol. Lett., 1609-1615, 27, 2005.

Непатентный документ 6: Jutaro Fukumoto, Saiko Suetsugu, Chika Harada, Tomonobu Kawaguchi, Naoki Hamada, Takashige Maeyama, Kazuyoshi Kuwano and Yoichi Nakanishi, The Journal of The Japanese Respiratory Society, 185, 46, 2008.

Сущность изобретения

Проблема, решаемая изобретением

Настоящее изобретение относится к созданию миРНК, эффективной для лечения фиброза, и лекарственному препарату, содержащему эту миРНК.

Подход к решению проблемы

Авторами настоящего изобретения были проведены интенсивные исследования для решения вышеупомянутой проблемы. В результате ими было обнаружено, что конкретные миРНК, нацеленные на ген TGF-β1, могут эффективно подавлять экспрессию TGF-β1 в клетках человека и, кроме того, облегчать симптомы легочного фиброза в легких мышиной модели легочного фиброза, не вызывая интерфероновой реакции.

Таким образом, настоящее изобретение относится к следующим пунктам 1)-19).

1) миРНК, имеющая полную длину 30 или менее нуклеотидов и нацеленная на последовательность, содержащую от 17 до 23 идущих подряд оснований, выбранных из группы, состоящей из оснований в положениях с 1285 по 1318, оснований в положениях с 1398 по 1418, оснований в положениях с 1434 по 1463, оснований в положениях с 1548 по 1579, оснований в положениях с 1608 по 1628, оснований в положениях с 1700 по 1726, оснований в положениях с 1778 по 1798, оснований в положениях с 1806 по 1826 и оснований в положениях с 1887 по 1907 последовательности SEQ ID NO: 1.

2) миРНК в соответствии с вышеупомянутым пунктом 1), которая выбрана из следующих молекул миРНК (a)-(s):

(a) миРНК, содержащая смысловую последовательность SEQ ID NO: 2 и антисмысловую последовательность SEQ ID NO: 3;

(b) миРНК, содержащая смысловую последовательность SEQ ID NO: 4 и антисмысловую последовательность SEQ ID NO: 5;

(c) миРНК, содержащая смысловую последовательность SEQ ID NO: 6 и антисмысловую последовательность SEQ ID NO: 7;

(d) миРНК, содержащая смысловую последовательность SEQ ID NO: 8 и антисмысловую последовательность SEQ ID NO: 9;

(e) миРНК, содержащая смысловую последовательность SEQ ID NO: 10 и антисмысловую последовательность SEQ ID NO: 11;

(f) миРНК, содержащая смысловую последовательность SEQ ID NO: 12 и антисмысловую последовательность SEQ ID NO: 13;

(g) миРНК, содержащая смысловую последовательность SEQ ID NO: 14 и антисмысловую последовательность SEQ ID NO: 15;

(h) миРНК, содержащая смысловую последовательность SEQ ID NO: 16 и антисмысловую последовательность SEQ ID NO: 17;

(i) миРНК, содержащая смысловую последовательность SEQ ID NO: 18 и антисмысловую последовательность SEQ ID NO: 19;

(j) миРНК, содержащая смысловую последовательность SEQ ID NO: 20 и антисмысловую последовательность SEQ ID NO: 21;

(k) миРНК, содержащая смысловую последовательность SEQ ID NO: 22 и антисмысловую последовательность SEQ ID NO: 23;

(l) миРНК, содержащая смысловую последовательность SEQ ID NO: 24 и антисмысловую последовательность SEQ ID NO: 25;

(m) миРНК, содержащая смысловую последовательность SEQ ID NO: 26 и антисмысловую последовательность SEQ ID NO: 27;

(n) миРНК, содержащая смысловую последовательность SEQ ID NO: 28 и антисмысловую последовательность SEQ ID NO: 29;

(o) миРНК, содержащая смысловую последовательность SEQ ID NO: 30 и антисмысловую последовательность SEQ ID NO: 31;

(p) миРНК, содержащая смысловую последовательность SEQ ID NO: 32 и антисмысловую последовательность SEQ ID NO: 33;

(q) миРНК, содержащая смысловую последовательность SEQ ID NO: 34 и антисмысловую последовательность SEQ ID NO: 35;

(r) миРНК, содержащая смысловую последовательность SEQ ID NO: 36 и антисмысловую последовательность SEQ ID NO: 37;

(s) миРНК, содержащая смысловую последовательность SEQ ID NO: 54 и антисмысловую последовательность SEQ ID NO: 55.

3) миРНК в соответствии с вышеупомянутым пунктами 1) или 2), в которой от 1 до 10 идущих подряд нуклеотидов, за исключением выступающего нуклеотида, на 3'-конце смысловой цепи миРНК преобразованы в ДНК.

4) миРНК в соответствии с вышеупомянутым пунктами 1)-3), в которой от 1 до 10 идущих подряд нуклеотидов на 5'-конце антисмысловой цепи миРНК преобразованы в ДНК.

5) миРНК в соответствии с вышеупомянутым пунктами 1)-4), в которой от 1 до 10 идущих подряд нуклеотидов, за исключением выступающего нуклеотида, на 3'-конце смысловой цепи миРНК преобразованы в ДНК, и от 1 до 10 идущих подряд нуклеотидов на 5'-конце антисмысловой цепи миРНК преобразованы в ДНК.

6) миРНК в соответствии с вышеупомянутым пунктами 1)-5), у которой 5'-конец антисмысловой цепи является монофосфорилированным или монотиофосфорилированным.

7) Фармацевтическая композиция, содержащая миРНК в соответствии с любым вышеупомянутым пунктом 1)-6).

8) Ингибитор экспрессии гена TGF-β1, содержащий в качестве активного ингредиента миРНК в соответствии с любым вышеупомянутым пунктом 1)-6).

9) Профилактический или терапевтический агент для лечения фиброза, содержащий в качестве активного ингредиента миРНК в соответствии с любым вышеупомянутым пунктом 1)-6).

10) Профилактический или терапевтический агент для лечения легочного фиброза или рака легких, содержащий в качестве активного ингредиента миРНК в соответствии с любым вышеупомянутым пунктом 1)-6).

11) Применение миРНК в соответствии с любым вышеупомянутым пунктом 1)-6) для получения ингибитора экспрессии гена TGF-β1.

12) Применение миРНК в соответствии с любым вышеупомянутым пунктом 1)-6) для получения профилактического или терапевтического агента для лечения фиброза.

13) Применение миРНК в соответствии с любым вышеупомянутым пунктом 1)-6) для получения профилактического или терапевтического агент для лечения легочного фиброза или рака легких.

14) миРНК в соответствии с любым вышеупомянутым пунктом 1)-6) для применения в подавлении экспрессии гена TGF-β1.

15) миРНК в соответствии с любым вышеупомянутым пунктом 1)-6) для применения в профилактике или лечении фиброза.

16) миРНК в соответствии с любым вышеупомянутым пунктом 1)-6) для применения в профилактике или лечении легочного фиброза или рака легких.

17) Способ подавления экспрессии гена TGF-β1, включающий введение миРНК в соответствии с любым вышеупомянутым пунктом 1)-6) человеку или животному.

18) Способ профилактики или лечения фиброза, включающий введение миРНК в соответствии с любым вышеупомянутым пунктом 1)-6) человеку или животному.

19) Способ профилактики или лечения легочного фиброза или рака легких, включающий введение миРНК в соответствии с любым вышеупомянутым пунктом 1)-6) человеку или животному.

Эффект изобретения

Так как миРНК настоящего изобретения может эффективно снижать или подавлять экспрессию TGF-β1, находясь в низкой концентрации, она может быть использована в качестве лекарственного препарата для профилактики или лечения фиброза.

Краткое описание чертежей

На Фиг.1 приведена диаграмма, показывающая скорость подавления экспрессии мРНК TGF-β1 миРНК;

На Фиг.2 приведена диаграмма, показывающая скорость подавления экспрессии мРНК TGF-β1 химерной миРНК;

На Фиг.3 приведена диаграмма, показывающая скорость подавления экспрессии мРНК TGF-β1 химерной миРНК, соединенной с фосфатом или тиофосфатом;

На Фиг.4 приведена диаграмма, показывающая скорость подавления экспрессии мРНК TGF-β1 у модели легочного фиброза; и

На Фиг.5 показаны микроизображения, полученные с помощью световой микроскопии, гистологических срезов ткани легкого (окрашивание гематоксилином и эозином и окрашивание трихромом по Массону) (увеличение: 5x).

Способ осуществления изобретения

Последовательность, на которую нацелена миРНК настоящего изобретения состоит из 17-23 идущих подряд оснований, выбранных из группы, состоящей из оснований в положениях с 1285 по 1318, оснований в положениях с 1398 по 1418, оснований в положениях с 1434 по 1463, оснований в положениях с 1548 по 1579, оснований в положениях с 1608 по 1628, оснований в положениях с 1700 по 1726, оснований в положениях с 1778 по 1798, оснований в положениях с 1806 по 1826 и оснований в положениях с 1887 по 1907 последовательности SEQ ID NO: 1. Здесь 17-23 идущих подряд оснований, выбранных из каждой группы, представляют собой предпочтительно от 19 до 23 оснований, и более предпочтительно 21 основание.

Последовательность оснований SEQ ID NO: 1 представляет собой последовательность оснований мРНК TGF-β1, и информация об этой последовательности зарегистрирована в GenBank под номером доступа GenBank NM_000660.3.

миРНК настоящего изобретения образована путем гибридизации антисмысловой цепи, имеющей последовательность, комплементарную вышеупомянутой целевой последовательности мРНК TGF-β1, и смысловой цепи, имеющей последовательность, комплементарную этой антисмысловой цепи. миРНК настоящего изобретения оказывает расщепляющее действие на мРНК TGF-β1 (т.е. РНК интерферирующее действие) и обладает способностью подавлять трансляцию этой мРНК, а именно, способностью подавлять экспрессию гена TGF-β1.

Что касается нуклеотидной длины миРНК настоящего изобретения, то длины смысловой цепи и антисмысловой цепи могут быть одинаковыми или разными, и полноразмерная миРНК состоит из 30 или менее нуклеотидов, предпочтительно из 25 или менее нуклеотидов, более предпочтительно из 23 или менее нуклеотидов или из 21 нуклеотида.

Кроме того, оба конца смысловой и антисмысловой цепи могут являться тупыми концами, или 3'-конец каждой цепи может быть выступающим (т.е. липким концом). Здесь термин «тупой конец» относится к конфигурации, в которой в концевой области двухцепочечной РНК концевая область смысловой цепи и соответствующая концевая область антисмысловой цепи спарены без образования одноцепочечного фрагмента. Кроме того, термин «выступающий конец», также называемый свисающий конец, относится к конфигурации, в которой в двухцепочечная РНК не может образовать двойную цепь в концевой области смысловой цепи или в соответствующей концевой области антисмысловой цепи из-за отсутствия спаривания оснований, образуя одноцепочечный фрагмент (липкий конец).

Что касается количества оснований в области липкого конца, то оно составляет от 1 до 10 нуклеотитдов, предпочтительно от 1 до 4 нуклеотидов и более предпочтительно от 1 до 2 нуклеотидов. Следует отметить, что длина липкого конца никак не связана у двух цепей, и каждая из этих двух цепей может иметь разную длину. Нуклеотид в области липкого конца может представлять собой либо или РНК или ДНК, и хотя является предпочтительным, чтобы он представлял собой основание комплементарное целевой мРНК TGF-β1, он может быть некомплементарным основанием, при условии, что миРНК настоящего изобретения сохраняет вышеупомянутую способность к РНК интерференции.

миРНК настоящего изобретения может быть в виде двухцепочечной РНК, состоящей из двух отдельных цепей. Кроме того, она также может представлять собой одноцепочечную РНК, образующую двухцепочечную РНК путем формирования структуры типа «стебель-петля». То есть, миРНК настоящего изобретения также включает РНК, образующую петлю, состоящую из 2-4 нуклеотидов на 5'-конце смысловой цепи и 3'-конце антисмысловой цепи, и РНК, образующую петлю, состоящую из 2-4 нуклеотидов на 3'-конце смысловой цепи и 5'-конце антисмысловой цепи. Кроме того, она также включает РНК, образующую петли, состоящие из 2-4 нуклеотидов на 5'-конце смысловой цепи и 3'-конце антисмысловой цепи, а также на 3'-конце смысловой цепи и 5'-конце антисмысловой цепи.

миРНК настоящего изобретения и последовательность мишень предпочтительно являются идентичными, однако они могут быть существенно идентичными, т.е. обладать гомологичными последовательностями, при условии, что миРНК может вызывать вышеупомянутую РНК интерференцию. В частности, когда при гибридизации последовательности антисмысловой цепи миРНК настоящего изобретения с последовательностью-мишенью может иметь место некомплементарное спаривание нескольких (например, двух, трех или четырех) оснований. То есть, миРНК настоящего изобретения включает миРНК, имеющую последовательность, модифицированную путем замены, добавления или делеции одного или нескольких оснований по сравнению с последовательностью-мишенью, и способную вызывать РНК интерференцию, или миРНК, имеющую 85% или более, предпочтительно 90% или более, предпочтительно 95% или более и более предпочтительно 98% или более идентичности по последовательности с последовательностью-мишенью, и способную вызывать РНК интерференцию.

Следует отметить, что когда миРНК настоящего изобретения применяется в качестве лекарственного препарата путем введения ее в живой организм, то используемый здесь термин «условия гибридизации» относится к условиям внутри живого организма, а когда миРНК настоящего изобретения используется в качестве реагента in vitro, то к умеренно или сильно жестким условиям. Примеры таких условий включают следующие условия гибридизации: 400 мМ NaCl, 40 мМ ПИПЕС, pH 6,4, 1 мМ ЭДТА, и время гибридизации 12-160 часов при температуре от 50°C до 70°C. Эти условия хорошо известны специалистам в данной области техники и описаны в Sambrook et al. (Molecular Cloning: A Laboratory Manual second edition, Cold Spring Harbor Laboratory Press, New York, USA, 1989).

Также идентичность последовательностей можно вычислить с помощью метода Липмана-Пирсона (Science, 227, 1435, (1985)), и т.д., и, например, она вычисляется с использованием программы поиска гомологии из пакета программ для обработки генетической информации Genetyx-Win (Ver.5.1.1; Software Development Co., Ltd.) с установкой значения параметра Размер единицы сравнения (ktup) равного 2.

Кроме того, миРНК настоящего изобретения включает миРНК, у которой нуклеотиды или смысловой цепи или антисмысловой цепи полностью преобразованы в ДНК (гибридная миРНК), и миРНК, у которой нуклеотиды или смысловой и/или антисмысловой цепи частично преобразованы в ДНК (химерная миРНК), при условии, что миРНК может вызывать вышеупомянутую РНК интерференцию.

Здесь преобразование РНК нуклеотида в ДНК означает преобразование АМФ в дАМФ, ГМФ в дГМФ, ЦМФ в дЦМФ и УМФ в дТМФ.

В качестве гибридной миРНК предпочтительной является миРНК, у которой смысловая цепь преобразована в ДНК. Примеры химерной миРНК включают миРНК, у которой с правой стороны последовательности (т.е. в 3'-концевой области смысловой цепи и 5'-концевой области антисмысловой цепи) частично преобразованы в ДНК. Конкретные примеры такой миРНК включают миРНК, у которой нуклеотиды как в 3'-концевой области смысловой цепи, так и в 5'-концевой области антисмысловой цепи преобразованы в ДНК, и миРНК, у которой или нуклеотиды 3'-концевой области смысловой цепи, или нуклеотиды 5'-концевой области антисмысловой цепи преобразованы в ДНК. Также размер фрагмента, состоящего из преобразованных нуклеотидов, может быть любой длины в пределах половины длины молекулы РНК или короче, например, от 1 до 13 нуклеотидов, предпочтительно от 1 до 10 нуклеотидов с конца. С точки зрения эффекта РНК интерференции, стабильности, безопасности и т.д. молекулы РНК, примеры подходящей химерной миРНК включают миРНК, у которой каждая из двух цепей имеют длину 19-23 нуклеотида, и у которой от 1 до 10, предпочтительно от 1 до 8, и более предпочтительно от 1 до 6 нуклеотидов, за исключением выступающего нуклеотида(ов), на 3'-конце смысловой цепи и от 1 до 10, предпочтительно от 1 до 8, и более предпочтительно от 1 до 6 нуклеотидов на 5'-конце антисмысловой цепи последовательно преобразованы в ДНК в произвольном количестве. (см. приведенную ниже Таблицу 2). Кроме того, в этом случае более предпочтительным является, чтобы количество нуклеотидов, преобразованных в ДНК, было одинаковым в смысловой цепи (за исключением выступающего нуклеотида(ов)) и антисмысловой цепи.

Кроме того, миРНК настоящего изобретения может представлять собой миРНК, у которой нуклеотид (т.е. рибонуклеотид или дезоксирибонуклеотид) является нуклеотидным аналогом, содержащим химически модифицированные сахар, основание и/или фосфат, при условии, что миРНК может вызывать вышеупомянутую РНК интерференцию. Примеры нуклеотидного аналога, содержащего модифицированное основание, включают модифицированный в 5 положении уридин или цитидин (например, 5-пропинилуридин, 5-пропинилцитидин, 5-метилцитидин, 5-метилуридин, 5-(2-амино)пропилуридин, 5-галогенцитидин, 5-галогенуридин и 5-метилоксиуридин); модифицированный в 8 положении аденозин или гуанозин (например, 8-бромогуанозин); деазануклеотид (например, 7-деаза-аденозин); и О- и N-алкилированный нуклеотид (например, N6-метиладенозин).

Кроме того, примеры нуклеотидного аналога, содержащего модифицированный сахар, включают модифицированный во 2 положении сахара аналог, у которого 2'-OH группа рибонуклеотида заменена на H, OR, R, атом галогена, SH, SR, NH2, NHR, NR2, CN (где R представляет собой алкильную, алкенильную или алкинильную группу, имеющую от 1 до 6 атомов углерода) и тому подобное, фосфорилированный с 5'-конца аналог или монотиофосфорилированный с 5'-конца аналог, у которого 5'-концевая OH группа является монофосфорилированной или монотиофосфорилированной.

Примеры нуклеотидного аналога, содержащего модифицированный фосфат, включают аналог, у которого фосфоэфирная группа, соединяющая соседние рибонуклеотиды, заменена фосфотиоатной группой.

Кроме того, помимо вышеупомянутых нуклеотидных аналогов, миРНК настоящего изобретения может содержать конкретный заместитель или функциональную молекулу, связанные с, по меньшей мере, одним из первых шести нуклеотидов 5'-конца или 3'-конца смысловой цепи (5'-конец, 3'-конец или внутреннее основание или сахар, кроме концевого) непосредственно или через линкер, и заместитель или функциональная молекула предпочтительно связаны с, по меньшей мере, одним из первых шести нуклеотидов, предпочтительно с первого по четвертый нуклеотид, 5'-конца смысловой цепи.

Здесь примеры заместителя включают аминогруппу; меркаптогруппу; нитрогруппу; алкильную группу, имеющую от 1 до 40 (предпочтительно от 2 до 20, более предпочтительно от 4 до 12) атомов углерода; аминоалкильную группу, имеющую от 1 до 40 (предпочтительно от 2 до 20, более предпочтительно от 4 до 12) атомов углерода; тиоалкильную группу, имеющую от 1 до 40 (предпочтительно от 2 до 20, более предпочтительно от 4 до 12) атомов углерода; алкоксильную группу, имеющую от 1 до 40 (предпочтительно от 2 до 20, более предпочтительно от 4 до 12) атомов углерода; аминоалкоксильную группу, имеющую от 1 до 40 (предпочтительно от 2 до 20, более предпочтительно от 4 до 12) атомов углерода; тиоалкоксильную группу, имеющую от 1 до 40 (предпочтительно от 2 до 20, более предпочтительно от 4 до 12) атомов углерода; моно- или диалкиламиногруппу, имеющую от 1 до 40 (предпочтительно от 2 до 20, более предпочтительно от 4 до 12) атомов углерода; алкилтио группу, имеющую от 1 до 40 (предпочтительно от 2 до 20, более предпочтительно от 4 до 12) атомов углерода; полиэтиленоксидную группу, имеющую от 2 до 40 (предпочтительно от 2 до 20, более предпочтительно от 4 до 12) атомов углерода; и полипропиленоксидную группу, имеющую от 3 до 39 (предпочтительно от 3 до 21, более предпочтительно от 3 до 12) атомов углерода. Эффект РНК интерференции может быть значительно усилен путем связывания этих заместителей.

Примеры функциональной молекулы включают сахар, белок, пептид, аминокислоту, ДНК, РНК (включая тРНК), аптамеры, модифицированные нуклеотиды, низкомолекулярные органические и неорганические материалы, холестерин, дендримеры, липид и полимерные материалы. При добавлении этих функциональных молекул миРНК настоящего изобретения может проявлять превосходный эффект РНК интерференции и оказывать благоприятное влияние, связанное с этими функциональными молекулами.

Примеры вышеупомянутого сахара включают моносахариды, такие как глюкоза, галактоза, глюкозамин и галактозамин, и олигосахариды или полисахариды, образованные произвольным сочетанием этих моносахаридов.

В качестве вышеупомянутого белка могут быть использованы белки, присутствующие внутри живого организма, белки, обладающие фармакологическим действием, белки, обладающие свойством молекулярного распознавания, и тому подобное, примеры этих белков включают белок импортин-β, авидин и антитела.

Конкретные примеры вышеупомянутой ДНК включают ДНК длиной от 5 до 50 оснований, предпочтительно длиной от 5 до 25 оснований.

Примеры вышеупомянутого пептида включают пептид октааргинин R8, пептидную последовательность сигнала внутриядерной локализации (такую как Tat ВИЧ-1 и SV40T антиген), сигнальный пептид ядерного экспорта (такой как Rev ВИЧ-1 и MAPKK) и мембраносвязанный пептид. Примеры вышеупомянутого модифицированного нуклеотида, включают нуклеотид, имеющий модифицированный фосфатный скелет, такой как фосфотиоат или боранофосфат ДНК/РНК; 2'-модифицированный нуклеотид, такой как 2'-OMe-модифицированная РНК и 2'-F-модифицированная РНК; модифицированный нуклеотид, у которого молекула сахара является поперечно сшитой, такой как ЗНК (т.е. закрытая нуклеиновая кислота) и ЭНК (т.е. нуклеиновые кислоты, в которых этилен соединяет положения 2'-O и 4'-C кольца сахара); модифицированный нуклеотид, имеющий различный основный скелет, такой как ПНК (т.е. пептид-нуклеиновая кислота) и морфолино-нуклеотид (см. W02008/140126 и W02009/123185).

Примеры вышеупомянутых низкомолекулярных органических и неорганических материалов включают флуоресцентные материалы, такие как Cy3 и Cy5; биотин; квантовые точки; и мелкие частицы золота. Примеры вышеупомянутых дендримеров включают поли(амидоаминный) дендример. Примеры вышеупомянутого липида включают , в дополнение к линолевой кислоте, 1,2-диолеоил-sn-глицеро-3-фосфатидилэтаноламин (DOPE), и т.п., двухцепочечный липид, имеющий две гидрофобные группы, как описано в W02009/123185. Примеры вышеупомянутых полимерных материалов включают полиэтиленгликоль и полиэтиленимин.

Здесь группа, имеющая функциональную молекулу, может представлять собой непосредственно остаток функциональной молекулы или остаток функциональной молекулы, к которому присоединена одна из функциональных групп бифункционального линкера. То есть, в первом случае функциональная молекула непосредственно связана с определенной частью вышеупомянутой смысловой цепи РНК, а во втором случае функциональная молекула связана с определенной частью вышеупомянутой смысловой цепи РНК через бифункциональный линкер. При этом на бифункциональный линкер не накладывается специальных ограничений, при условии, что этот линкер имеет две функциональные группы, и, например, N-сукцинимидил-3-(2-пиридилдитио) пропионат, N-4-малеимидомасляная кислота, S-(2-пиридилдитио) цистеамин, йодоацетоксисукцинимид, N-(4-малеимидобутирилокси) сукцинимид, N-[5-(3'-малеимидопропиламидо)-1-карбоксипентил] иминодиуксусная кислота, N-(5-аминопентил)-иминодиуксусная кислота и тому подобное могут быть использованы.

Хотя никаких специальных ограничений не накладывается на сайт связывания вышеупомянутой смысловой цепи РНК для заместителя, функциональной молекулы или линкера, соединяющего заместитель или функциональную молекулу, предпочтительно они связываются таким образом, чтобы замещать атом водорода, входящий в состав гидроксильной группы фосфатной части определенного нуклеотида смысловой цепи РНК.

Конкретными примерами миРНК настоящего изобретения являются двухцепочечные РНК, содержащие смысловые последовательности и антисмысловые последовательности (a)-(s), приведенные ниже.

Таблица 1
No. миРНК Позиции оснований сайта-мишени Смысловая (5'→3') SEQ ID NO Антисмысловая (5'→3') SEQ ID NO
(a) 1285~1305 CCGAGAAGCGGUACCUGAACC 2 UUCAGGUACCGCUUCUCGGAG 3
(b) 1298~1318 CCUGAACCCGUGUUGCUCUCC 4 AGAGCAACACGGGUUCAGGUA 5
(c) 1398~1418 CCUGGCGAUACCUCAGCAACC 6 UUGCUGAGGUAUCGCCAGGAA 7
(d) 1434~1454 GCGACUCGCCAGAGUGGUUAU 8 AACCACUCUGGCGAGUCGCUG 9
(e) 1435~1455 CGACUCGCCAGAGUGGUUAUC 10 UAACCACUCUGGCGAGUCGCU 11
(f) 1436~1456 GACUCGCCAGAGUGGUUAUCU 12 AUAACCACUCUGGCGAGUCGC 13
(g) 1438~1458 CUCGCCAGAGUGGUUAUCUUU 14 AGAUAACCACUCUGGCGAGUC 15
(h) 1440~1460 CGCCAGAGUGGUUAUCUUUUG 16 AAAGAUAACCACUCUGGCGAG 17
(i) 1441~1461 GCCAGAGUGGUUAUCUUUUGA 18 AAAAGAUAACCACUCUGGCGA 19
(j) 1443~1463 CAGAGUGGUUAUCUUUUGAUG 20 UCAAAAGAUAACCACUCUGGC 21
(k) 1548~1568 GGGAUAACACACUGCAAGUGG 22 ACUUGCAGUGUGUUAUCCCUG 23
(l) 1557~1577 CACUGCAAGUGGACAUCAACG 24 UUGAUGUCCACUUGCAGUGUG 25
(s) 1557~1579 CACACUGCAAGUGGACAUCAACG 54 CGUUGAUGUCCACUUGCAGUGUG 55
(m) 1608~1628 CCACCAUUCAUGGCAUGAACC 26 UUCAUGCCAUGAAUGGUGGCC 27
(n) 1700~1720 GCCCUGGACACCAACUAUUGC 28 AAUAGUUGGUGUCCAGGGCUC 29
(o) 1706~1726 GACACCAACUAUUGCUUCAGC 30 UGAAGCAAUAGUUGGUGUCCA 31
(p) 1778~1798 GACCUCGGCUGGAAGUGGAUC 32 UCCACUUCCAGCCGAGGUCCU 33
(q) 1806~1826 CCAAGGGCUACCAUGCCAACU 34 UUGGCAUGGUAGCCCUUGGGC 35
(r) 1887~1907 CCCUGUACAACCAGCAUAACC 36 UUAUGCUGGUUGUACAGGGCC 37

Также предпочтительные примеры химерной миРНК включают миРНК, у которой от 1 до 8 нуклеотидов на 3'-конце смысловой цепи и от 1 до 6 нуклеотидов на 5'-конце антисмысловой цепи последовательно преобразованы в ДНК в произвольном количестве. Примеры предпочтительных химерных миРНК, полученных с использованием вышеупомянутой миРНК (l) приведены ниже.

Таблица 2
No. миРНК Смысловая (5'→3') SEQ ID NO Антисмысловая (5'→3') SEQ ID NO
(l-C8a) CACUGCAAGUGGAcatcaacg 38 ttgatgUCCACUUGCAGUGUG 39
(l-C7) CACUGCAAGUGGACatcaacg 40 ttgatGUCCACUUGCAGUGUG 41
(l-C6) CACUGCAAGUGGACAtcaacg 42 ttgaUGUCCACUUGCAGUGUG 43
(l-C5) CACUGCAAGUGGACAUcaacg 44 ttgAUGUCCACUUGCAGUGUG 45
(l-C4a) CACUGCAAGUGGACAUCaacg 46 ttGAUGUCCACUUGCAGUGUG 47
(l-C3) CACUGCAAGUGGACAUCAacg 48 tUGAUGUCCACUUGCAGUGUG 49
(l-C2) CACUGCAAGUGGACAUCAAcg 50 UUGAUGUCCACUUGCAGUGUG 25
(l-C1) CACUGCAAGUGGACAUCAACg 51 UUGAUGUCCACUUGCAGUGUG 25
(l-C4b) CACUGCAAGUGGACAUCaacg 46 UUGAUGUCCACUUGCAGUGtg 56

В таблице заглавные буквы, строчные буквы и подчеркнутые буквы обозначают РНК, ДНК и выступающие положения, соответственно.

Хотя никаких специальных ограничений не накладывается на способ получения миРНК настоящего изобретения, она может быть синтезирована с помощью известного способа получения, например, химического синтеза и транскрипционного синтеза in vitro с использованием промоторов и РНК полимераз.

Химический синтез может быть осуществлен в синтезаторе нуклеиновых кислот с использованием в качестве исходного материала амидитной смолы, содержащей молекулы нуклеиновой кислоты, которые являются составным элементом миРНК.

Транскрипционный синтез может быть осуществлен путем транскрипции in vitro, которая позволяет синтезировать двухцепочечную РНК путем срезания шпильки РНК.

миРНК настоящего изобретения, полученная таким образом, может эффективно подавлять экспрессию TGF-β1 в клетках альвеолярного эпителия человека на уровне мРНК, и, кроме того, оказывает облегчающее действие на симптомы легочного фиброза в легких мышиной модели легочного фиброза, не вызывая интерфероновой реакции, как будет показано далее в Примерах.

Таким образом, миРНК настоящего изобретения и экспрессионный вектор, способный экспрессировать эту миРНК в субъектах, которым этот вектор был введен, пригодны для использования в качестве лекарственного препарата (фармацевтической композиции) для введения человеку или животному. В частности, лекарственного препарата для подавления экспрессии гена TGF-β1, лекарственного препарата для профилактики или лечения заболевания, связанного с избыточной экспрессией TGF-β1, такого как фиброз, а именно профилактического или терапевтического агента для лечения фиброза.

В настоящее время существует целый ряд заболеваний, приводящих к образованию фибрилл в легких, например, интерстициальная пневмония, кистозный фиброз, хроническая обструктивная болезнь легких (ХОБЛ), синдром острой дыхательной недостаточности (СОДН), воспаление легких, легочная инфекция, радиационный пневмонит, медикаментозная интерстициальная пневмония и связанная с коллагенозом интерстициальная пневмония; при этом, среди идиопатических интерстициальных пневмоний (ИИП) с неясной причиной идиопатический легочный фиброз (ИЛФ) является особенно предпочтительным. В качестве клинико-патологического заболевания ИИП включают идиопатический легочный фиброз (ИЛФ), неспецифическую интерстициальную пневмонию (НИП), криптогенную организующуюся пневмонию (КОП/ОБОП), острую интерстициальную пневмонию (ОИП), десквамативную интерстициальную пневмонию (ДИП), интерстициальную пневмонию, связанную с респираторным бронхиолитом, (РБ-ИЗЛ), лимфоидную интерстициальную пневмонию (ЛИП) и тому подобное.

Кроме того, имеются сообщения, о том, что TGF-β1 способствует развитию рака, в частности распространению и метастазированию аденокарциномы легких (Mol Cell Biochem (2011) 355:309-314, Cancer Genomics Proteomics 2010, 7, 217). Избыточная экспрессия TGF-β1 наблюдается в местах повреждения здоровой ткани после терапии рака, и повреждение здоровой ткани можно предотвратить путем воздействия на синтез TGF-β1 (The oncologist 2010; 15: 350-359), и т.д. Таким образом, миРНК настоящего изобретения и экспрессионный вектор, способный экспрессировать эту миРНК в субъектах, которым этот вектор был введен, пригодны для использования в качестве лекарственного препарата для профилактики или лечения рака, в частности рака легких.

При использовании миРНК настоящего изобретения в качестве лекарственного препарата, хотя она может использоваться сама по себе, она также может образовывать комплекс с сильноразветвленным циклодекстрином или циклоамилозой. В данном описании термин «сильноразветвленный циклодекстрин» относится к глюкану со степенью полимеризации от 50 до 5000, имеющему внутреннюю разветвленную циклическую структурную часть и внешнюю разветвленную структурную часть, который образуется при воздействии ветвящих ферментов на амилопектин. В данном описании термин «внутренняя разветвленная циклическая структурная часть» относится к циклической структурной части, образованной α-1,4-глюкозидной связью и α-1,6-глюкозидной связью, и термин «внешняя разветвленная структурная часть» относится к нециклической структурной части, связанной с внутренней разветвленной циклической структурной частью.

Примеры предпочтительных вариантов сильноразветвленного циклодекстрина включают циклодекстрин, у которого степень полимеризации внутренней разветвленной циклической структурной части вышеупомянутого глюкана составляет от 10 до 100, циклодекстрин, у которого степень полимеризации внешней разветвленной структурной части вышеупомянутого глюкана составляет 40 или более, и циклодекстрин, у которого средняя степень полимеризации каждой отдельной цепи вышеупомянутой внешней разветвленной структурной части составляет от 10 до 20. Кроме того, сильноразветвленный циклодекстрин является коммерчески доступным, и эти коммерческие продукты также могут быть использованы в настоящем изобретении.

Циклоамилоза представляет собой циклический α-1,4-глюкан, в котором единицы глюкозы соединены α-1,4-связью, и который имеет трехмерную глубокую полость внутри спиральной структуры. Никаких специальных ограничений не накладывается на степень полимеризации глюкозы в циклоамилозе, используемой в настоящем изобретении, например, она составляет от 10 до 500, предпочтительно от 10 до 100 и более предпочтительно от 22 до 50. Циклоамилоза также может быть получена из глюкозы при помощи ферментов, таких как амиломальтаза. Кроме того, циклоамилоза является коммерчески доступной, и эти коммерческие продукты также могут быть использованы в настоящем изобретении (см. WO2009/61003).

миРНК настоящего изобретения может быть получена в виде фармацевтической композиции с использованием одного или нескольких фармацевтически приемлемых носителей или разбавителей при помощи обычного способа. Фармацевтическая композиция может быть доставлена любым способом введения, таким как ингаляционное введение, назальное введение, пероральное введение, ректальное введение и инъекция, и это введение может быть системным или местным. Лекарственная форма фармацевтической композиции может представлять собой любую форму, пригодную для применения в способе введения, такую как жидкость, суспензия, эмульсия, таблетка, пилюля, драже, капсула, порошок, препарат с замедленным высвобождением, суппозиторий, аэрозоль и спрей.

Например, при назальном введении активный ингредиент растворяют в подходящем растворителе (таком как физиологический раствор и спирт), и получившийся раствор впрыскивают или добавляют по каплям в нос, куда активный ингредиент может быть доставлен.

В другом варианте, при ингаляционном введении или назальном введении активный ингредиент распыляют в составе аэрозоля из находящегося под давлением баллона или ингалятора с использованием подходящего пропеллента, такого как дихлордифторметан, трихлорфторметан, дихлортетрафторэтан, диоксид углерода или другие подходящие газы, при помощи которых активный ингредиент может быть легко доставлен. При использовании аэрозоля под давлением, дозирующее устройство может быть оборудовано клапаном, для того чтобы обеспечить доставку дозированного количества. Кроме того, активный ингредиент также может быть введен в виде порошкового препарата для ингаляции.

В случае инъекций, например, активный ингредиент может быть приготовлен в виде раствора для парентерального введения, чтобы вводиться путем болюсной инъекции или непрерывной инфузии (т.е. внутривенное или внутримышечное введение), и предпочтительно он готовится в виде физиологически совместимого буфера, такого как раствор Хэнкса, раствор Рингера и физиологический раствор. Этот раствор может содержать медицинские препараты, которые возможно добавить, такие как суспендирующие агенты, стабилизаторы и/или диспергирующие агенты. В другом случае, активный ингредиент может быть приготовлен в виде порошка, так чтобы быть восстановленным подходящим разбавителем, таким как стерилизованная вода, не содержащая перед использованием термогенных веществ. Инъекционный препарат может быть изготовлен, например, в виде единичной лекарственной формы в ампуле или многодозного контейнера с консервантами.

Для перорального введения терапевтический агент настоящего изобретения может быть изготовлен в виде, например, таблетки, гранулы, порошка, эмульсии, капсулы, сиропа, водной или масляной суспензии или эликсира. В случае таблетки или пилюли композиция может быть покрытой, для того чтобы замедлить диспергирование и всасывание в желудочно-кишечном тракте, и таким образом обеспечить длительное действие.

Хотя никаких ограничений не накладывается на фармацевтический приемлемый носитель или разбавитель, их примеры включают жидкости (такие как вода, масло, физиологический раствор, водный раствор декстрозы и этанол) и твердые вещества (такие как аравийская камедь, желатин, крахмал, глюкоза, лактоза, сахароза, тальк, стеарат натрия, глицеролмоностеарат, кератин, коллоидный диоксид кремния, сухое обезжиренное молоко и глицерин). Также терапевтический агент настоящего изобретения может содержать соответствующий агент, который добавляется в обычные фармацевтические композиции, такой как вспомогательное вещество, антисептик, стабилизатор, загуститель, скользящее вещество, краситель, смачивающий агент, эмульгатор и поддерживающий значение pH буфер.

Фармацевтическая композиция настоящего изобретения может содержать миРНК настоящего изобретения в количестве от 0,001 до 50 масс.%, предпочтительно от 0,01 до 10 масс.%, и более предпочтительно от 0,1 до 1 масс.%.

Доза фармацевтической композиции настоящего изобретения специально не ограничивается, при условии, что применяется эффективное количество, например она предпочтительно составляет от 0,0001 до 100 мг, и более предпочтительно от 0,002 до 1 мг на кг массы тела.

В фармацевтической композиции настоящего изобретения вместо миРНК настоящего изобретения также может использоваться экспрессионный вектор, способный экспрессировать эту миРНК в субъекте, которому этот вектор был введен.

В этом случае, экспрессионный вектор может быть сконструирован, например, путем вставки ДНК, способной кодировать миРНК настоящего изобретения, в подходящий вектор, применяемый в генной терапии, такой как аденовирусный вектор, вектор на основе аденоассоциированного вируса (ААВ) или лентивирусный вектор.

Примеры

Далее настоящее изобретение будет описано более подробно путем приведения Примеров. Однако техническая область настоящего изобретения не ограничивается этими Примерами.

Пример 1. Получение миРНК

Был произведен дизайн молекул миРНК, нацеленных на ген TGF-β1, как показано ниже в Таблице 3, и каждый миРНК олигонуклеотид был химически синтезирован. Полученные олигонуклиотиды перед использованием были очищены ВЭЖХ.

Таблица 3
No. миРНК Позиции оснований сайта-мишени Смысловая (5'→3') SEQ ID NO Антисмысловая (5'→3') SEQ ID NO
(a) 1285~1305 CCGAGAAGCGGUACCUGAACC 2 UUCAGGUACCGCUUCUCGGAG 3
(b) 1298~1318 CCUGAACCCGUGUUGCUCUCC 4 AGAGCAACACGGGUUCAGGUA 5
(c) 1398~1418 CCUGGCGAUACCUCAGCAACC 6 UUGCUGAGGUAUCGCCAGGAA 7
(d) 1434~1454 GCGACUCGCCAGAGUGGUUAU 8 AACCACUCUGGCGAGUCGCUG 9
(e) 1435~1455 CGACUCGCCAGAGUGGUUAUC 10 UAACCACUCUGGCGAGUCGCU 11
(f) 1436~1456 GACUCGCCAGAGUGGUUAUCU 12 AUAACCACUCUGGCGAGUCGC 13
(g) 1438~1458 CUCGCCAGAGUGGUUAUCUUU 14 AGAUAACCACUCUGGCGAGUC 15
(h) 1440~1460 CGCCAGAGUGGUUAUCUUUUG 16 AAAGAUAACCACUCUGGCGAG 17
(i) 1441~1461 GCCAGAGUGGUUAUCUUUUGA 18 AAAAGAUAACCACUCUGGCGA 19
(j) 1443~1463 CAGAGUGGUUAUCUUUUGAUG 20 UCAAAAGAUAACCACUCUGGC 21
(k) 1548~1568 GGGAUAACACACUGCAAGUGG 22 ACUUGCAGUGUGUUAUCCCUG 23
(l) 1557~1577 CACUGCAAGUGGACAUCAACG 24 UUGAUGUCCACUUGCAGUGUG 25
(s) 1557~1579 CACACUGCAAGUGGACAUCAACG 54 CGUUGAUGUCCACUUGCAGUGUG 55
(m) 1608~1628 CCACCAUUCAUGGCAUGAACC 26 UUCAUGCCAUGAAUGGUGGCC 27
(n) 1700~1720 GCCCUGGACACCAACUAUUGC 28 AAUAGUUGGUGUCCAGGGCUC 29
(o) 1706~1726 GACACCAACUAUUGCUUCAGC 30 UGAAGCAAUAGUUGGUGUCCA 31
(p) 1778~1798 GACCUCGGCUGGAAGUGGAUC 32 UCCACUUCCAGCCGAGGUCCU 33
(q) 1806~1826 CCAAGGGCUACCAUGCCAACU 34 UUGGCAUGGUAGCCCUUGGGC 35
(r) 1887~1907 CCCUGUACAACCAGCAUAACC 36 UUAUGCUGGUUGUACAGGGCC 37

Пример 2. Оценка подавляющего действия на экспрессию TGF-β1 (in vitro)

(1) Клетки

Линия A549 клеток альвеолярного эпителия человека (DS Pharma Biomedical Co., Ltd.) была использована.

(2) Условия культивирования

Использовали модифицированную по способу Дульбекко среду Игла (D-MEM), содержащую 10% эмбриональной бычьей сыворотки (с 100 ед./мл пенициллина и 100 мкг/мл стрептомицина), 1×105 клеток высевали на 12-луночный планшет. После культивирования при температуре 37°C в атмосфере с 5% CO2 в течение ночи клетки A549 были конфлюэнтны на 40%, и среду заменяли на бессывороточную среду.

(3) Предварительная обработка и добавление миРНК

В качестве миРНК использовали олигонуклеотиды, приведенные выше в Таблице 3, и когда клетки достигали 40% конфлюентности, олигонуклеотиды вводили в вышеупомянутые клетки, используя для этого липофектамин 2000 (Invitrogen).

В частности 2,0 мкл липофектамина 2000 добавляли к 98 мкл среды OPTI-MEM на лунку, и полученную смесь инкубировали при комнатной температуре в течение пяти минут (раствор A).

К 99,375 мкл среды OPTI-MEM добавляли 0,625 мкл 0,2 мкМ раствора миРНК (раствор B). Растворы A и B смешивали и инкубировали при комнатной температуре в течение 20 минут. После инкубации смесь AB добавляли в каждую лунку 12-луночного планшета. миРНК добавляли с таким расчетом, чтобы конечная концентрация составляла 0,1 нМ.

(4) Последующая обработка

(i) Обработка цитокинами

Через шесть часов после добавления смешанного раствора миРНК и липофектамина, среду заменяли средой D-MEM, содержащей 0,1% бычьего сывороточного альбумина (БСА) и цитокины (1 нг/мл IL-1β и 1 нг/мл TNF-α), с последующим культивированием в течение 12 часов. После культивирования отбирали супернатанты культуры.

(ii) Выделение тотальной клеточной РНК

Для выделения тотальной клеточной РНК использовали автоматизированный аппарат для экстрагирования нуклеиновых кислот QuickGene-810 (Fujifilm Corporation) и набор для выделения РНК из культуры клеток QuickGene RNA cultured cell kit S (Fujifilm Corporation), который является набором, специально созданным для QuickGene-810. Клетки промывали 1,0 мл ФСБ и добавляли к ним 0,5 мл лизирующего клеточного раствора, чтобы экстрагировать тотальную клеточную РНК. После добавления 0,5 мл лизирующего раствора (LRC, меркаптоэтанол уже был добавлен) в 12-луночный планшет, планшет встряхивали на шейкере-ротаторе в течение пяти минут. Раствор хорошо перемешивали путем пипетирования пять-шесть раз и затем переносили в пробирку Эппендорф. В пробирку Эппендорф добавляли 420 мкл этанола, и полученную смесь перемешивали на вортексе в течение 15 секунд и затем обрабатывали в QuickGene-810. Во время обработки в QuickGene-810 добавляли ДНКазу (RQ1 свободная от РНКазы ДНКаза, Promega Corporation). Полученные таким образом образцы тотальной РНК хранили в холодильнике при температуре -80°C до последующего использования.

(iii) Перевод тотальной РНК в кДНК

Концентрацию РНК (мкг/мл) в образцах тотальной РНК, выделенной из культивированных клеток, определяли по значению поглощения, измеренному при 260 нм (контроль TE буфер). Основываясь на полученных таким образом значениях, раствор каждого образца помещали в 96-луночный планшет в таком количестве, где количество РНК составляло 0,1 мкг. В каждую лунку добавляли дистиллированную воду, чтобы довести конечный объем до 12 мкл, и затем добавляли 2 мкл реагента gDNA Wipeout Buffer, входящего в набор для обратной транскрипции QuantiTect (QIAGEN). После перемешивания на вортексе образцы инкубировали при температуре 42°C в течение двух минут и затем охлаждали при температуре 4°C. К этим образцам добавляли 1 мкл обратной транскриптазы Quantiscript, 4 мкл ОТ буфера Quantiscript и 1 мкл смеси праймеров для ОТ, входящих в набор для обратной транскрипции QuantiTect (QIAGEN), затем смешивали и инкубировали при температуре 42°C в течение 15 минут. Затем образцы нагревали при температуре 95°C в течение трех минут, чтобы инактивировать обратную транскриптазу, и затем охлаждали при температуре 4°C.

Приготовленный таким образом раствор (т.е. неразбавленный раствор препарата кДНК) разбавляли в 5 раз TE буфером и использовали в качестве раствора кДНК для ПЦР амплификации гена-мишени (TGF-β1).

Также неразбавленный раствор препарата кДНК разбавляли в 50 раз TE буфером и использовали в качестве раствора кДНК для ПЦР амплификации гена GAPDH, который был выбран в качестве гена внутреннего стандарта. Следует отметить, что неразбавленный раствор препарата кДНК контрольного образца разбавляли в 1, 10, 100 и 1000 раз TE буфером и использовали в качестве образца для построения калибровочной кривой для ПЦР амплификации TGF-β1. Аналогично, неразбавленный раствор препарата кДНК контрольного образца разбавляли в 10, 100, 1000 и 10000 раз TE буфером и использовали в качестве образца для построения калибровочной кривой для ПЦР амплификации GAPDH.

(5) Способ измерения уровня экспрессии TGF-β1

К 2,5 мкл полученного с TGF-β1 кДНК продукта, который использовался в качестве образца, добавляли 12,5 мкл смеси QuantiFast SYBR Green PCR Master Mix (QIAGEN), и 2,5 мкл смеси праймеров QuantiTect Primer Assay (QIAGEN) для амплификации генов TGF-β1 и GAPDH человека. К этому раствору добавляли стерилизованную дистиллированную воду, чтобы довести конечный объем до 25 мкл, и таким образом приготовить реакционный раствор для ПЦР. Затем, используя амплификатор Applied Biosystems 7500 (Life Technologies Japan Ltd.), приготовленный таким образом раствор нагревали при температуре 95°C в течение 5 минут и затем подвергали 40 циклам ПЦР, где один цикл включал 1) 95°C в течение 10 секунд и 2) 60°C в течение 35 секунд, с последующим постепенным охлаждением с 95°C до 60°C. Полученный раствор подвергали измерению термической диссоциации. На основании значения порогового цикла (Ct), полученного в результате процесса ПЦР амплификации, интенсивность амплификации каждого целевого гена была скорректирована с учетом значения Ct для гена GAPDH, и была проведена оценка подавляющего действия на мРНК гена-мишени. Полученные таким образом результаты представлены на Фиг.1 и в Таблице 4.

Таблица 4
миРНК Интенсивность экспрессии мРНК TGF-β1 (TGF-β1/ GAPDH)
No. нМ Средняя СКО
a 0,1 24,7 7,6
b 0,1 85 8,9
c 0,1 51,8 12,3
d 0,1 58,5 6,4
e 0,1 27,5 2,2
f 0,1 52,1 4,1
g 0,1 51,8 7,5
h 0,1 29,3 8,6
i 0,1 31,5 12,5
j 0,1 40,1 6,9
k 0,1 22,2 6,6
l 0,1 12,2 6,7
s 1 50,1 4,3
m 0,1 71,6 10,4
n 0,1 39,7 4,7
o 0,1 11,7 3,1
p 0,1 55,5 4,4
q 0,1 51,3 4,4
r 0,1 53,4 7,8

Было обнаружено, что миРНК, обозначенные как d, p, r, f, c, g, q, j, n, i, h, e, a, k, l и o, обладают подавляющим действием на экспрессию TGF-β1 на уровне 40% или выше даже в концентрации 0,1 нМ. В частности, миРНК, обозначенные как l и o, обладали подавляющим действием на уровне 80% или выше даже в концентрации 0,1 нМ. Кроме того, эти последовательности проявляли заметную подавляющую активность также при 0,01 нМ.

Пример 3. Получение химерной миРНК

На основе миРНК, обозначенной как (l), был осуществлен дизайн молекул химерных миРНК, нацеленных на ген TGF-β1, как показано ниже в Таблице 5, и каждый химирный миРНК олигонуклеотид был химически синтезирован. Полученные олигонуклиотиды перед использованием были очищены ВЭЖХ.

Таблица 5
No. миРНК Смысловая (5'→3') SEQ ID NO Антисмысловая (5'→3') SEQ ID NO
(l-C8a) CACUGCAAGUGGAcatcaacg 38 ttgatgUCCACUUGCAGUGUG 39
(l-C7) CACUGCAAGUGGACatcaacg 40 ttgatGUCCACUUGCAGUGUG 41
(l-C6) CACUGCAAGUGGACAtcaacg 42 ttgaUGUCCACUUGCAGUGUG 43
(l-C5) CACUGCAAGUGGACAUcaacg 44 ttgAUGUCCACUUGCAGUGUG 45
(l-C4a) CACUGCAAGUGGACAUCaacg 46 ttGAUGUCCACUUGCAGUGUG 47
(l-C3) CACUGCAAGUGGACAUCAacg 48 tUGAUGUCCACUUGCAGUGUG 49
(l-C2) CACUGCAAGUGGACAUCAAcg 50 UUGAUGUCCACUUGCAGUGUG 25
(l-C1) CACUGCAAGUGGACAUCAACg 51 UUGAUGUCCACUUGCAGUGUG 25
(l-C4b) CACUGCAAGUGGACAUCaacg 46 UUGAUGUCCACUUGCAGUGtg 56

В таблице заглавные буквы, строчные буквы и подчеркнутые буквы обозначают РНК, ДНК и выступающие положения, соответственно.

Пример 4. Оценка подавляющего действия на экспрессию TGF-β1

Используя олигонуклеотиды, приведенные в Таблице 5 (концентрация 10 нМ или 0,1 нМ), подавляющее действие на экспрессию TGF-β1 оценивали способом, аналогичным описанному в Примере 2. Результаты представлены на Фиг.2 и в Таблице 6.

Таблица 6
миРНК Интенсивность экспрессии мРНК TGF-β1 (TGF-β1/ GAPDH)
No. нМ Средняя СКО
l 10 34,9 4,2
l-C8a 10 56,6 13,2
l-C7 10 37,5 5,1
l-C6 10 38,8 0,5
l-C5 10 35,1 6,2
l-C4a 10 37,2 8,0
l-C3 10 23,0 6,3
l-C2 10 38,4 7,9
l-C1 10 33,0 2,5
l-C4b 0,1 69,9 4,3

Пример 5. Синтез химерной миРНК, соединенной с фосфатом или тиофосфатом

На основе миРНК, обозначенной как (l), был осуществлен дизайн молекул химерных миРНК, соединенных с фосфатом или тиофосфатом и нацеленных на ген TGF-β1, как показано ниже в Таблице 7, и каждый химирный миРНК олигонуклеотид был химически синтезирован. Полученные олигонуклиотиды перед использованием были очищены при помощи ВЭЖХ.

Таблица 7
No. миРНК Смысловая (5'→3') SEQ ID NO Антисмысловая (5'→3') SEQ ID NO
(l-CP8a) CACUGCAAGUGGAcatcaacg 38 P-ttgatgUCCACUUGCAGUGUG 39
(l-CP7) CACUGCAAGUGGACatcaacg 40 P-ttgatGUCCACUUGCAGUGUG 41
(l-CP6) CACUGCAAGUGGACAtcaacg 42 P-ttgaUGUCCACUUGCAGUGUG 43
(l-CP5) CACUGCAAGUGGACAUcaacg 44 P-ttgAUGUCCACUUGCAGUGUG 45
(l-CP4a) CACUGCAAGUGGACAUCaacg 46 P-ttGAUGUCCACUUGCAGUGUG 47
(l-CP3a) CACUGCAAGUGGACAUCAacg 48 P-tUGAUGUCCACUUGCAGUGUG 49
(l-CP2) CACUGCAAGUGGACAUCAAcg 50 P-UUGAUGUCCACUUGCAGUGUG 25
(l-CP1) CACUGCAAGUGGACAUCAACg 51 P-UUGAUGUCCACUUGCAGUGUG 25
(l-CP) CACUGCAAGUGGACAUCAACG 24 P-UUGAUGUCCACUUGCAGUGUG 25
(l-CP8b) CACUGCAAGUGGAcatcaacg 38 P-UUGAUGUCCACUUGCAGUGtg 56
(l-CP4b) CACUGCAAGUGGACAUCaacg 46 P-UUGAUGUCCACUUGCAGUGtg 56
(l-CPS4b) CACUGCAAGUGGACAUCaacg 46 PS-UUGAUGUCCACUUGCAGUGtg 56
(l-CP3b) CACUGCAAGUGGACAUCAkcg 57 P-UUGAUGUCCACUUGCAGUGtg 56

В таблице заглавные буквы, строчные буквы и подчеркнутые буквы обозначают РНК, ДНК и выступающие положения, соответственно. Также P- и PS- обозначают 5'-концевое фосфорилированние или 5'-концевое тиофосфорилированние, соответственно.

Пример 6. Оценка подавляющего действия на экспрессию TGF-β1

Используя олигонуклеотиды, приведенные в Таблице 7, подавляющее действие на экспрессию TGF-β1 оценивали способом, аналогичным описанному в Примере 2. Результаты представлены на Фиг.3 и в Таблице 8.

Таблица 8
миРНК Интенсивность экспрессии мРНК TGF-β1 (TGF-β1/ GAPDH)
No. нМ Средняя СКО
l-CP8a 0,1 72,0 3,8
l-CP7 0,1 56,1 2,7
l-CP6 0,1 48,2 0,4
l-CP5 0,1 49,4 3,4
l-CP4a 0,1 45,1 3,6
l-CP3a 0,1 30,6 18,2
l-CP2 0,1 43,1 6,1
l-CP1 0,1 36,1 2,0
l-CP 0,1 44,9 2,0
l-CP8b 0,1 57,1 12,4
l-CP4b 0,1 46,4 17,4
l-CPS4b 0,1 70,8 2,2
l-CP3b 0,1 42,1 2,9

Пример 7. Синтез миРНК, содержащей ДНК в своей выступающей части

На основе миРНК, обозначенной как (l), был осуществлен дизайн молекул миРНК, содержащих ДНК в своей выступающей части и нацеленных на ген TGF-β1, как показано ниже в Таблице 9, и каждый миРНК олигонуклеотид был химически синтезирован. Полученные олигонуклиотиды перед использованием были очищены при помощи ВЭЖХ.

Таблица 9
No. миРНК Смысловая (5'→3') SEQ ID NO Антисмысловая (5'→3') SEQ ID NO
l-OHa1 CACUGCAAGUGGACAUCAACGt 58 UUGAUGUCCACUUGCAGUGUG 25
l-OHa2 CACUGCAAGUGGACAUCAACGtt 59 UUGAUGUCCACUUGCAGUGUG 25
l-OHa3 CACUGCAAGUGGACAUCAACGttt 60 UUGAUGUCCACUUGCAGUGUG 25
l-OHa4 CACUGCAAGUGGACAUCAACGtttt 61 UUGAUGUCCACUUGCAGUGUG 25
l-OHa5 CACUGCAAGUGGACAUCAACGttttt 62 UUGAUGUCCACUUGCAGUGUG 25
l-OHa6 CACUGCAAGUGGACAUCAACGtttttt 63 UUGAUGUCCACUUGCAGUGUG 25
l-OHa7 CACUGCAAGUGGACAUCAACGttttttt 64 UUGAUGUCCACUUGCAGUGUG 25
l-OHb1 CACUGCAAGUGGACAUCAACGta 65 UUGAUGUCCACUUGCAGUGUG 25
l-OHb2 CACUGCAAGUGGACAUCAACGttaa 66 UUGAUGUCCACUUGCAGUGUG 25
l-OHb3 CACUGCAAGUGGACAUCAACGtttaaa 67 UUGAUGUCCACUUGCAGUGUG 25
l-OHb4 CACUGCAAGUGGACAUCAACGttttaaaa 68 UUGAUGUCCACUUGCAGUGUG 25
l-OHb5 CACUGCAAGUGGAcatcaacgttaa 69 ttgatgUCCACUUGCAGUGUG 39
l-OHb6 CACUGCAAGUGGAcatcaacgtttaaa 70 ttgatgUCCACUUGCAGUGUG 39

В таблице заглавные буквы, строчные буквы и подчеркнутые буквы обозначают РНК, ДНК и выступающие положения, соответственно.

Пример 8. Оценка подавляющего действия на экспрессию TGF-β1

Используя олигонуклеотиды, приведенные в Таблице 9, подавляющее действие на экспрессию TGF-β1 оценивали способом, аналогичным описанному в Примере 2. Результаты представлены в Таблице 10.

Таблица 10
миРНК Интенсивность экспрессии мРНК TGF-β1 (TGF-β1/ GAPDH)
No. нМ Средняя СКО
l-OHa1 0,1 26,0 1,0
l-OHa2 0,1 34,0 6,2
l-OHa3 0,1 32,8 3,8
l-OHa4 0,1 25,4 1,9
l-OHa5 0,1 27,4 1,5
l-OHa6 0,1 40,1 6,2
l-OHa7 1,0 39,7 22,6
l-OHbl 1 24,9 1,7
l-OHb2 1 25,6 0,9
l-OHb3 1 22,8 3,5
l-OHb4 1 20,4 1,5
l-OHb5 1 48,6 7,6
l-OHb6 1 46,6 6,7

Пример 9. Оценка эффективности на модели легочного фиброза (исследование in vivo)

На основе миРНК, обозначенной как (q) (SEQ ID NOs: 34 и 35), которая представляет собой последовательность, одинаковую у мыши и человека, был осуществлен дизайн химерной миРНК (q-C8: смысловая цепь (5'→3'): CCAAGGGCUACCAtgccaact (SEQ ID NO: 52) антисмысловая цепь (5'→3'): ttggcaUGGUAGCCCUUGGGC (SEQ ID NO: 53), и химерные миРНК олигонуклеотиды были синтезированы способом, аналогичным описанному в Примере 3, и затем очищены при помощи ВЭЖХ. Используя полученные химерные миРНК олигонуклеотиды в качестве испытываемых веществ, проводили оценку эффективности на мышиной модели блеомицин-индуцированного легочного фиброза.

После внутрибрюшинного введения пентобарбитала (продукт Dainippon Sumitomo Pharma Co., Ltd.) мышам (линия C57BL/6NCrSlc (SLC), самки 13-ти недельного возраста), им под кожу на спине в условиях анестезии имплантировали осмотические насосы ALZET™ (модель 2001, DURECT Corporation), чтобы получить мышиную модель легочного фиброза. Следует отметить, что 200 мкл раствора блеомицина в физиологическом растворе с концентрацией приблизительно 10 мг/мл было заранее залито в осмотический насос ALZET™, и был использован блеомицин, представляющий собой продукт Nippon Kayaku Co., Ltd.

Через три, семь и 14 дней после имплантации осмотического насоса ALZET™ испытываемые вещества растворяли в дистиллированной воде (продукт Otsuka Pharmaceutical Co., Ltd.) и внутритрахеально вводили с помощью аэролайзера MicroSprayer™ (модель IA-1C, Penn-Century, Inc.) в дозе 100 мкг/организм. Объем дозы составлял 75 мкл/организм в дни 3 и 7 и 50 мкл/организм в день 14 после начала введения блеомицина.

Кроме того, в качестве сравнительного контроля использовали группу, которой в осмотический насос ALZET™ заливали 200 мкл только физиологического раствора и в качестве испытываемого вещества вводили дистиллированную воду, и группу, которой в осмотический насос ALZET™ заливали 200 мкл раствора блеомицина в физиологическом растворе с концентрацией приблизительно 10 мг/мл и в качестве испытываемого вещества вводили дистиллированную воду.

Через двадцать один день после имплантации осмотического насоса ALZET™ мышам в условиях анестезии внутрибрюшинно вводили пентобарбитал и удаляли кожу и мышцы шеи, чтобы обнажить трахею. Мышей умерщвляли путем обескровливания через яремную вену, и затем, используя постоянную иглу, тремя отдельными дозами вводили в трахею 2 мл физиологического раствора (Otsuka Pharmaceutical Co., Ltd.) и отбирали приблизительно 2 мл бронхоальвеолярного лаважа (БАЛ). Затем вскрывали грудную клетку и делали разрез в ушке левого предсердия и приблизительно 1 мл физиологического раствора пропускали из правого желудочка и вырезали легкие. Для гистологического исследования левую долю вырезанных легких погружали в 10% нейтральный фиксирующий буферный раствор формалина (Wako Pure Chemical Industries, Ltd.).

Отобранный таким образом БАЛ центрифугировали (2000 об./мин, 4°C, в течение 10 минут), и количество белка TGF-β1 в супернатанте измеряли с помощью твердофазного ИФА. Результаты показаны на Фиг.4. На Фиг.4 обозначения ФР, ДВ и БЛМ означают физиологический раствор, дистиллированную воду и блеомицин, соответственно.

Ткань легкого, зафиксированную 10% нейтральным фиксирующим буферным раствором формалина, заливали парафином и готовили срезы ткани, которые окрашивали гематоксилином и эозином (ГЭ) и трихромом по Массону. Изображение тканей приведено на Фиг.5.

Как показано на Фиг.4, было установлено, что в группе, получавшей испытываемое вещество (БЛМ/TGF-β1), количество TGF-β1 в БАЛ значительно снизилось. Этот эффект не наблюдался в группе, получавшей в качестве сравнительного контроля дистиллированную воду (БЛМ/ДВ). Кроме того, как показано на изображении тканей на Фиг.5, было установлено, что степень воспаления и образования фибрилл была уменьшена в группе, получавшей испытываемое вещество.

1. миРНК, имеющая полную длину от 17 до 23 нуклеотидов и нацеленная на последовательность, содержащую от 17 до 23 идущих подряд оснований, выбранных из группы, состоящей из оснований в положениях с 1285 по 1318, оснований в положениях с 1398 по 1418, оснований в положениях с 1434 по 1463, оснований в положениях с 1548 по 1579, оснований в положениях с 1608 по 1628, оснований в положениях с 1700 по 1726, оснований в положениях с 1778 по 1798, оснований в положениях с 1806 по 1826 и оснований в положениях с 1887 по 1907 последовательности SEQ ID NO: 1, для использования в ингибировании экспрессии гена TGF-β1, при гибридизации.

2. миРНК по п. 1, которая выбрана из следующих молекул миРНК (а)-(s):
(a) миРНК, содержащая смысловую последовательность SEQ ID NO: 2 и антисмысловую последовательность SEQ ID NO: 3;
(b) миРНК, содержащая смысловую последовательность SEQ ID NO: 4 и антисмысловую последовательность SEQ ID NO: 5;
(c) миРНК, содержащая смысловую последовательность SEQ ID NO: 6 и антисмысловую последовательность SEQ ID NO: 7;
(d) миРНК, содержащая смысловую последовательность SEQ ID NO: 8 и антисмысловую последовательность SEQ ID NO: 9;
(e) миРНК, содержащая смысловую последовательность SEQ ID NO: 10 и антисмысловую последовательность SEQ ID NO: 11;
(f) миРНК, содержащая смысловую последовательность SEQ ID NO: 12 и антисмысловую последовательность SEQ ID NO: 13;
(g) миРНК, содержащая смысловую последовательность SEQ ID NO: 14 и антисмысловую последовательность SEQ ID NO: 15;
(h) миРНК, содержащая смысловую последовательность SEQ ID NO: 16 и антисмысловую последовательность SEQ ID NO: 17;
(i) миРНК, содержащая смысловую последовательность SEQ ID NO: 18 и антисмысловую последовательность SEQ ID NO: 19;
(j) миРНК, содержащая смысловую последовательность SEQ ID NO: 20 и антисмысловую последовательность SEQ ID NO: 21;
(k) миРНК, содержащая смысловую последовательность SEQ ID NO: 22 и антисмысловую последовательность SEQ ID NO: 23;
(l) миРНК, содержащая смысловую последовательность SEQ ID NO: 24 и антисмысловую последовательность SEQ ID NO: 25;
(m) миРНК, содержащая смысловую последовательность SEQ ID NO: 26 и антисмысловую последовательность SEQ ID NO: 27;
(n) миРНК, содержащая смысловую последовательность SEQ ID NO: 28 и антисмысловую последовательность SEQ ID NO: 29;
(о) миРНК, содержащая смысловую последовательность SEQ ID NO: 30 и антисмысловую последовательность SEQ ID NO: 31;
(р) миРНК, содержащая смысловую последовательность SEQ ID NO: 32 и антисмысловую последовательность SEQ ID NO: 33;
(q) миРНК, содержащая смысловую последовательность SEQ ID NO: 34 и антисмысловую последовательность SEQ ID NO: 35;
(r) миРНК, содержащая смысловую последовательность SEQ ID NO: 36 и антисмысловую последовательность SEQ ID NO: 37;
(s) миРНК, содержащая смысловую последовательность SEQ ID NO: 54 и антисмысловую последовательность SEQ ID NO: 55.

3. миРНК по п. 1, в которой от 1 до 10 идущих подряд нуклеотидов, за исключением выступающего нуклеотида, на 3′-конце смысловой цепи миРНК преобразованы в ДНК.

4. миРНК по п. 1, в которой от 1 до 10 идущих подряд нуклеотидов на 5′-конце антисмысловой цепи миРНК преобразованы в ДНК.

5. миРНК по п. 1, в которой от 1 до 10 идущих подряд нуклеотидов, за исключением выступающего нуклеотида, на 3′-конце смысловой цепи миРНК преобразованы в ДНК, и от 1 до 10 идущих подряд нуклеотидов на 5′-конце антисмысловой цепи миРНК преобразованы в ДНК.

6. миРНК по п. 1, отличающаяся тем, что от 1 до 7 нуклеотидов добавлены к выступающему нуклеотиду на 3′-конце смысловой цепи миРНК.

7. миРНК по п. 1, отличающаяся тем, что миРНК обладает последовательностью, модифицированной путем замены, добавления или делеции одного основания по сравнению с последовательностью-мишенью.

8. миРНК по п. 1, отличающаяся тем, что нуклеотид миРНК является нуклеотидным аналогом с химически модифицированным сахаром, основанием и/или фосфатом.

9. миРНК по п. 1, у которой 5′-конец антисмысловой цепи является монофосфорилированным или монотиофосфорилированным.

10. Фармацевтическая композиция для использования в ингибировании экспрессии гена TGF-β1, содержащая миРНК по любому из пп. 1-9.

11. Ингибитор экспрессии гена TGF-β1, содержащий в качестве активного ингредиента миРНК по любому из пп. 1-9.

12. Профилактический или терапевтический агент для лечения фиброза, содержащий в качестве активного ингредиента миРНК по любому из пп. 1-9.

13. Профилактический или терапевтический агент для лечения легочного фиброза или рака легких, содержащий в качестве активного ингредиента миРНК по любому из пп. 1-9.

14. Применение миРНК по любому из пп. 1-9 для получения ингибитора экспрессии гена TGF-β1.

15. Применение миРНК по любому из пп. 1-9 для получения профилактического или терапевтического агента для лечения фиброза.

16. Применение миРНК по любому из пп. 1-9 для получения профилактического или терапевтического агент для лечения легочного фиброза или рака легких.

17. миРНК по любому из пп. 1-9 для применения в профилактике или лечении фиброза.

18. миРНК по любому из пп. 1-9 для применения в профилактике или лечении легочного фиброза или рака легких.

19. Способ подавления экспрессии гена TGF-β1, включающий введение миРНК по любому из пп. 1-9 человеку или животному.

20. Способ профилактики или лечения фиброза, включающий введение миРНК по любому из пп. 1-9 человеку или животному.

21. Способ профилактики или лечения легочного фиброза или рака легких, включающий введение миРНК по любому из пп. 1-9 человеку или животному.



 

Похожие патенты:

Изобретение относится к области биохимии. Заявлен набор дифференцирующих олигонуклеотидов для анализа полиморфизма в генах АВ0, HLA-DQA1, AMEL, DARC, NAT2 с помощью технологии гидрогелевых ДНК-микрочипов (биочипов).

Штаммы spnk // 2580015
Изобретения относятся к области молекулярной генетики и касаются способов преобразования продуцирующего спиносад штамма Saccharopolyspora spinosa в штамм, продуцирующий предшественника спинеторама (варианты), и генетически модифицированной клетки-хозяина Saccharopolyspora spinosa.

Группа изобретений относится к обоасти биохимии и биотехнологии. Представлены аптамер, связывающийся с химазой и ингибирующий активность химазы, содержащий нуклеотидную последовательность, представленную как X1GAUAGAN1N2UAAX2, где X1 и X2 идентичны или не идентичны друг другу и каждый означает A или G, а N1 и N2 идентичны или не идентичны друг другу и каждый означает A, G, C, U или T; комплекс, включающий аптамер и функциональное вещество, например вещество, обладающее сродством, вещество для мечения, фермент, средство доставки лекарственного средства, лекарственное средство; лекарственное средство или реагент, содержащее аптамер или комплекс; способы детекции и очистки химазы с использованием аптамера или комплекса.

Изобретение относится к биохимии. Раскрыты способы повышения экспрессии полинуклеотида PAR4, включающие осуществление контакта с по меньшей мере одним олигонуклеотидом длиной от 15 до 30 нуклеотидов, который нацелен на природную антисмысловую последовательность для полинуклеотида PAR4, и при этом указанная природная антисмысловая последовательность имеет последовательность, представленную в SEQ ID NO: 2.

Изобретение относится к биотехнологии и представляет собой выделенный вариант субтилизина Bacillus. Изобретение относится также к выделенной нуклеиновой кислоте, кодирующей вариант субтилизина, вектору экспрессии, содержащему нуклеиновую кислоту, клетке-хозяину, способной экспрессировать вариант субтилизина, а также к чистящей композиции, содержащей вариант субтилизина и способу очистки.

Изобретение относится к области биохимии, в частности к молекулам нуклеиновой кислоты для модуляции экспрессии генов-мишеней. Заявлена двухцепочечная молекула нуклеиновой кислоты для ингибирования экспрессии гена белка теплового шока 47 (hsp47).

Группа изобретений относится к области молекулярной биологии. Сущность изобретения состоит в подавлении активности активированного онкогена AML-ETO методом РНК-интерференции в злокачественных кроветворных клетках, полученных от больных лейкозом, с использованием конструкции малой шпилечной РНК, встроенной в лентивирусный вектор pLSLP-AML-ETO-shRNA, кодируемой нуклеотидной последовательностью двухцепочечной ДНК, представляющей собой: 5′-р-gatccgCCTCGAAATCGTACTGAGActtcctgcaa TCTCAGTACGATTTCGAGGtttttg-3′ (смысловая цепь), 5′-р-aattcaaaaaCCTCGAAATCGTACT GAGAttgcaggaagTCTCAGTACGATTTCGAGGcg-3′ (антисмысловая цепь).

Изобретение относится к области биохимии. Заявлен лиганд гликопротеина VI (GPVI), представляющий собой нуклеиновую кислоту, который взаимодействует с гликопротеином тромбоцитов GPVI и модулирует его активность с регуляцией функции тромбоцитов.

Группа изобретений относится к области биотехнологии, в частности к антисмысловым олигомерам, используемым в качестве активного ингредиента в фармацевтических композициях для лечения мышечной дистрофии.

Изобретение относится к биотехнологии, в частности к генетической инженерии. Предложен способ доставки нуклеиновых кислот в эукариотические клетки, предусматривающий трансфекцию методом кальций-фосфатной преципитации в присутствии гистона Н1.3 в эффективном количестве.

Изобретение относится к биохимии. Описан некодирующий ДНК конструкт для иммунномодуляции, содержащий мотив последовательности N1N2CGN3N4, где N представляет собой нуклеотид, выбранный из группы, состоящей из С, G, А и Т, а С представляет дезоксицитидин, G представляет дезоксигуанозин, А представляет дезоксиаденозин, и Т представляет дезокситимидин, и, по меньшей мере, два из пяти терминальных нуклеотидов, расположенных на 5′- и/или 3′-конце ДНК конструкта, представлены в L-конфигурации, при этом в мотиве последовательности N1N2CGN3N4 отсутствуют нуклеотиды в L-конфигурации. Также представлена вакцина, содержащая описанный конструкт. Изобретение расширяет арсенал иммуномодулирующих средств. 4 н. и 12 з.п. ф-лы, 14 ил., 3 табл.

Настоящее изобретение относится к иммуностимулирующим олигодезоксинуклеотидам общей формулы: где х = 3-20, z = 0-10, n = 2-100, и может быть использовано в медицине, конкретно в ветеринарии. Полученные иммуностимулирующие олигодезоксинуклеотиды или включающие их векторы и лекарственные средства могут быть использованы для предупреждения инфекционного заболевания у домашней птицы. Настоящее изобретение позволяет стимулировать активацию факторов транскрипции NF-kB и IRF3, а также повысить экспрессию вовлеченных в воспалительный процесс цитокинов, что способствует формированию активного иммунитета к различным инфекциям у домашней птицы. 5 н. и 4 з.п. ф-лы, 10 ил., 3 пр.

Группа изобретений относится к области биотехнологии. Двухцепочечный олигорибонуклеотид содержит последовательность антисмысловой цепи SEQ ID NO: 28: 5′ AGUAGUUUCCAUAGGUCUG 3′ и последовательность смысловой цепи SEQ ID NO: 5: 5′ CAGACCUAUGGAAACUACU 3′. При этом он способен вызывать отрицательную регуляцию экспрессии гена р53 человека, например, при использовании в фармацевтической композиции, содержащей это соединение и фармацевтически приемлемый носитель. Данный олигорибонуклеотид также может быть использован для лечения острой почечной недостаточности. 3 н. и 9 з.п. ф-лы, 7 ил., 5 табл., 4 пр.

Изобретение относится к антисмысловому олигонуклеотиду, представляющему собой фосфотиоатный аналог длиной от 19 до 30 нуклеотидов, который представляет собой соединение, гибридизующееся с природным антисмысловым полинуклеотидом гена Атонального гомолога 1 (АТОН1) и увеличивает экспрессию указанного гена АТОН1 in vivo или in vitro по сравнению с нормальным контролем. При этом указанный олигонуклеотид имеет по меньшей мере 50% идентичность последовательности с последовательностью из 19-30 последовательных нуклеиновых кислот молекулы РНК, транскрибированной с полинуклеотида АТОН1. Изобретение также относится к применению указанного олигонуклеотида для лечения заболеваний и расстройств, ассоциированных с экспрессией гена АТОН1. Изобретение расширяет арсенал средств, направленных на лечения заболеваний и расстройств, ассоциированных с экспрессией гена АТОН1. 8 н. и 18 з.п. ф-лы, 1 ил., 1 табл., 2 пр.

Изобретение относится к области молекулярной биологии и диагностической медицины. Предложен способ выделения микроРНК из биологических жидкостей. Способ включает обработку образца биологической жидкости равным объемом денатурирующего буферного раствора, содержащего 0.3÷1.35 М гуанидин изотиоцианат, 1% 2-меркаптоэтанол, осаждение нецелевых биополимеров добавлением равного объема буферного раствора, содержащего 0.8 М натрия ацетат, рН 4.0-6.0 и 0.5-2.5% октановую кислоту и центрифугированием. К полученному супернатанту добавляют равный объема 96% этанола, отмывку сорбента от несвязавшихся биополимеров осуществляют сначала буферным раствором, содержащим 0.5 М гуанидин изотиоцианат, 10 мМ Трис-ацетат рН 6.5, 50% этанол, 1% 2-меркаптоэтанол, затем буферным раствором, содержащим 10 мМ Tris-HCl рН 7.5, 0,1 М NaCl, 75% этанол. Изобретение обеспечивает повышение выхода микроРНК. 2 з.п. ф-лы, 1 ил., 5 табл., 3 пр.

Изобретение относится к области биотехнологии, конкретно к способу лечения метаболического расстройства у субъекта путем введения средств, которые модулируют активность и экспрессию микроРНК, и может быть использовано в медицине. Настоящее изобретение обеспечивает способ лечения расстройства, такого как ожирение, диабет или метаболический синдром, у субъекта путем введения субъекту ингибитора экспрессии или активности miR-378 и/или miR-378*. Изобретение позволяет проводить эффективную терапию широкого круга метаболических расстройств, обусловленных нарушением передачи сигнала с помощью лептина. 8 з.п. ф-лы, 19 ил., 6 пр.

Изобретение относится к области биотехнологии, конкретно к получению антагомиров микроРНК, и может быть использовано в медицине для лечения сосудистого заболевания, выбранного из группы, включающей периферическое сосудистое окклюзионное заболевание, коронарную болезнь сердца, цереброваскулярное заболевание, васкулит, атеросклероз, ремоделирование сосудов в ответ на повреждение или рестеноз. Получают фармацевтическую композицию с антагомиром молекулы микроРНК-100 для положительного модулирования роста кровеносных сосудов, в связи с этим для применения в модулировании пролиферации, формирования трубочек и активности по прорастанию эндотелиальных клеток или модуляции экспрессии молекул адгезии этими клетками. Изобретение позволяет повысить эффективность ангиогенной терапии. 2 н. и 5 з.п. ф-лы, 17 ил., 9 пр.

Изобретение относится к области биохимии, в частности к трансгенному растению березы вида Betula pendula, обладающему устойчивостью к действию гербицидов на основе фосфинотрицина по сравнению с аналогом дикого типа, а также к способу его получения. Изобретение позволяет эффективно получать трансгенное растение березы, обладающее устойчивостью к действию гербицидов на основе фосфинотрицина. 2 н. и 1 з.п. ф-лы, 3 ил., 3 табл., 6 пр.

Настоящее изобретение относится к области биотехнологии, конкретно к получению иммуностимулирующих олигодезоксинуклеотидов общей формулы 5′[G]х{[Т]pTTCGTC [Т]q}n[G]z 3′, где х = 3-10, z = 0-10, n = 2-100, p = 1-15, и может быть использовано в ветеринарии. Полученные иммуностимулирующие олигодезоксинуклеотиды или включающие их векторы и лекарственные средства могут быть использованы в вакцинации против инфекционных заболеваний у домашней птицы. Настоящее изобретение позволяет стимулировать активацию факторов транскрипции NF-kB и IRF3, а также повысить экспрессию вовлеченных в воспалительный процесс цитокинов. 5 н. и 9 з.п. ф-лы, 10 ил., 5 пр.

Изобретение относится к биохимии. Описаны антисмысловые олигонуклеотиды, которые увеличивают экспрессию указанного гена альфа-субъединицы потенциалзависимого натриевого канала (SCNA) in vivo или in vitro по сравнению с нормальным контролем. Олигонуклеотиды представляют собой фосфотиоатные аналоги длиной от 11 до 30 нуклеотидов, содержащие по меньшей мере одну модификацию, выбранную из: модифицированного остатка сахара; модифицированной межнуклеотидной связи; модифицированного нуклеотида и их комбинаций; при этом указанные олигонуклеотиды представляют собой соединения, которые специфически гибридизуются с комплементарной областью природного антисмыслового олигонуклеотида гена альфа-субъединицы потенциалзависимого натриевого канала (SCNA). Изобретение также относится к применению указанных олигонуклеотидов для лечения заболеваний и расстройств, ассоциированных с экспрессией гена SCNA. 6 н. и 27 з.п. ф-лы, 22 ил., 2 табл., 21 пр.
Наверх