Аптамер к химазе и его применение



Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение
Аптамер к химазе и его применение

 

C12N15/115 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2579667:

РИБОМИК ИНК. (JP)
ОЦУКА ФАРМАСЬЮТИКАЛ КО., ЛТД. (JP)

Группа изобретений относится к обоасти биохимии и биотехнологии. Представлены аптамер, связывающийся с химазой и ингибирующий активность химазы, содержащий нуклеотидную последовательность, представленную как X1GAUAGAN1N2UAAX2, где X1 и X2 идентичны или не идентичны друг другу и каждый означает A или G, а N1 и N2 идентичны или не идентичны друг другу и каждый означает A, G, C, U или T; комплекс, включающий аптамер и функциональное вещество, например вещество, обладающее сродством, вещество для мечения, фермент, средство доставки лекарственного средства, лекарственное средство; лекарственное средство или реагент, содержащее аптамер или комплекс; способы детекции и очистки химазы с использованием аптамера или комплекса. 9 н. и 7 з.п. ф-лы, 8 ил., 9 табл., 9 пр.

 

Область техники

Настоящее изобретение относится к аптамеру к химазе, способу использования его и ему подобных.

Уровень техники

Химаза человека (EC.3.4.21.39), химотрипсин-подобная сериновая протеаза, аккумулируется в секреторных гранулах тучных клеток. В ответ на внешний стимул тучные клетки претерпевают дегрануляцию, которая приводит к высвобождению химазы человека вне клеток, наряду с множеством медиаторов воспаления. Высвобожденная химаза человека специфически распознает ароматические аминокислоты, такие как фенилаланин и тирозин, в составе субстратов - белков и пептидов - и расщепляет пептидную связь рядом с этими аминокислотами. Типичным субстратом химазы человека является ангиотензин I (AngI). В результате расщепления AngI химазой человека получается ангиотензин II (AngII), который является фактором вазоконстрикции.

Химазы млекопитающих по филогенетическим признакам относят к двум семействам: α и β. У приматов, включая человека, экспрессируется только один вид химазы, принадлежащей к семейству α. В то же время у грызунов экспрессируются химазы, принадлежащие как к семейству α, так и к семейству β. У мышей экспрессируются различные виды химаз, из которых протеаза 4 тучных клеток мыши (mMCP-4), принадлежащая к семейству β, считается наиболее близкородственной химазе человека, исходя из ее субстратной специфичности и экспрессии в тканях. У хомяков химазе человека соответствует химаза хомяков 1, также принадлежащая к семейству β. В то же время mMCP-5 и химаза хомяков 2, принадлежащие, как и химаза человека, к семейству α, обладают эластазоподобной активностью и отличаются от химазы человека по субстратной специфичности.

Химаза тесно ассоциирована с активацией трансформирующего фактора роста β (TGF-β). TGF-β присутствует в латентной форме (латентный TGF-β) во внеклеточных матриксах вокруг эпителиальных и эндотелиальных клеток и удерживается во внеклеточных матриксе посредством большого белка, связывающего латентный TGF-β (large latent TGF-β binding protein, LTBP). По мере необходимости TGF-β высвобождается из внеклеточных матриксов и активируется, а активированный TGF-β - цитокин, имеющий огромное значение для живых организмов, участвующий, как было показано, в пролиферации и дифференцировке клеток, заживлении тканей и регенерации тканей после повреждения. Прекращение сигнала TGF-β приводит к возникновению и развитию различного рода заболеваний. Считается, что в этом процессе химаза задействована на этапе высвобождения латентного TGF-β из внеклеточных матриксов и превращения латентного TGF-β в активный TGF-β.

Известно, что химаза ассоциирована с широким спектром заболеваний, включая фиброз, сердечно-сосудистые заболевания, воспаление, аллергические заболевания и адгезию органов. Фиброз представляет собой заболевание, характеризующееся аномальным метаболизмом внеклеточных субстратов в легких, сердце, печени, почках, коже и т.д., что приводит к избыточному отложению соединительнотканных белков. Например, при легочном фиброзе белки соединительной ткани, такие как коллаген, в избытке откладывается в легких, что приводит к сильному сжатию легочных альвеол, что, в свою очередь, является причиной дыхательной недостаточности. Было показано, что причиной легочного фиброза может являться пневмокониоз, возникающий из-за воздействия большой концентрации пыли, лекарственная пневмония, возникающая из-за воздействия лекарств, таких как противоопухолевые агенты, аллергическая пневмония, туберкулез легких, аутоиммунные заболевания, такие как коллагеновые болезни и т.д. Однако в немалом количестве случаев причина фиброза легких остается невыясненной.

Механизм возникновения фиброза на молекулярном уровне изучен недостаточно. Обычно в норме, пролиферация и функционирование фибробластов находятся под жестким контролем. Однако в случае сильного или персистирующего воспаления или травмы механизм заживления тканей работает с избыточной интенсивностью, что приводит к ненормальной пролиферации фибробластов и избыточной продукции белков соединительной ткани. Известно, что фактор TGF-β является причиной этих явлений. В качестве фактов, свидетельствующих о роли TGF-β, на модели фиброза у экспериментальных животных было показано, что введение нейтрализующих антител к TGF-β снижало экспрессию коллагена и значительно ослабляло фиброз. У пациентов с идиопатическим легочным фиброзом наблюдаются повышенный уровень TGF-β и повышенное количество химаза-положительных тучных клеток.

В то же время ассоциация химазы с фиброзом была показана в экспериментах с использованием экспериментальных животных. На модели легочного фиброза хомяков, индуцированного блеомицином, ингибиторы химаз ослабляли повышенную активность химаз, повышенную экспрессию мРНК коллагена III, фиброз тканей и другие явления. На модели легочного фиброза мышей, индуцированного блеомицином, наблюдались те же эффекты; введение ингибиторов химаз подавляло активность химаз и снижало содержание гидроксипролина.

Учитывая эти свойства, ингибиторы химаз можно использовать как профилактические или терапевтические лекарственные средства против заболеваний, относящихся к химазам, таких как фиброз. Ранее разработанные ингибиторы химаз включают низкомолекулярные соединения, такие как TPC-806, SUN-13834, SUN-C8257, SUN-C8077 и JNJ-10311795 (патентный документ 1)

В последнее время привлекает внимание применение РНК-аптамеров в качестве терапевтических лекарственных средств, диагностических реагентов и реагентов для тестирования; некоторые РНК-аптамеры уже находятся на стадии клинического исследования или применяются на практике. В декабре 2004 г. первое в мире лекарственное средство на основе РНК-аптамеров, Macugen, было одобрено в качестве терапевтического лекарственного средства для лечения возрастной дегенерации желтого пятна в США. РНК-аптамером называется РНК, специфически связывающаяся с молекулой-мишенью, такой как белок, и которую можно получить с использованием способа SELEX (Systematic Evolution of Ligands by Exponential Enrichment) (патентные документы 2-4). В способе SELEX РНК, специфически связывающуюся с молекулой-мишенью, выбирают из пула РНК, включающего примерно 1014 различных нуклеотидных последовательностей. Используемая РНК имеет случайную последовательность длиной примерно 40 нуклеотидов, фланкированную последовательностями праймеров. Этот пул РНК смешивают с молекулой-мишенью, и РНК, связавшуюся с молекулой-мишенью, отделяют с использованием фильтра или подобного способа. Отделенную РНК амплифицируют с помощью RT-PCR и используют в качестве матрицы для следующего раунда. Путем повторения этой операции примерно 10 раз можно получить РНК-аптамер, специфически связывающийся с молекулой-мишенью.

Аптамерные лекарственные средства, как и лекарственные средства, основанные на антителах, могут быть специфичными к внеклеточным белкам. Судя по данным, опубликованным в большом количестве научных публикаций и других справочных материалов, находящихся в свободном доступе, в некоторых отношениях аптамерные лекарственные средства могут превзойти лекарственные средства, основанные на антителах. Например, аптамеры часто имеют более высокие сродство и специфичность к молекулам-мишеням, чем антитела. Маловероятно, что иммунная система будет элиминировать аптамеры, и значит, маловероятно, что использование аптамеров приведет к побочным реакциям, характерным для антител, таким как антитело-зависимая клеточная цитотоксичность (ADCC) и комплемент-зависимая цитотоксичность (CDC). С точки зрения доставки лекарственных средств, малая молекулярная масса аптамеров (одна десятая молекулярного веса антител) способствует их проникновению в ткани и облегчает доставку лекарственных средств к сайтам-мишеням. Химический синтез, с помощью которого получают аптамеры, позволяет применять сайт-селективные химические модификации, а также снизить затраты с помощью массового производства. Другие преимущества аптамеров включают стабильность при длительном хранении, устойчивость к нагреванию и растворителям. В то же время, время полужизни аптамеров в крови обычно короче, чем у антител; однако иногда это может оказаться преимуществом ввиду токсичности. Эти факты позволяют сделать вывод, что даже при одной и той же молекуле-мишени, аптамерные лекарственные средства могут превзойти лекарственные средства, основанные на антителах.

Патентный документ 1 USB6500835

Патентный документ 2 WO91/19813

Патентный документ 3 WO94/08050

Патентный документ 4 WO95/07364

Сущность изобретения

Задачи, решаемые изобретением

Настоящее изобретение направлено на получение аптамера к химазе и способа использования его и ему подобных.

Способы решения задач

Авторы настоящего изобретения провели всесторонние исследования, направленные на решение вышеописанной проблемы, и им удалось получить аптамер к химазе хорошего качества, что и привело к завершению настоящего изобретения.

Соответственно, в настоящем изобретении представлено следующее:

[1] аптамер, связывающийся с химазой и ингибирующий активность химазы.

[2] аптамер по п. [1], содержащий нуклеотидную последовательность, представляемую в виде X1GAUAGAN1N2UAAX2 (SEQ ID NO: 21; каждый из X1 и X2, идентичных или не идентичных, обозначает A или G, а каждый из N1 и N2, идентичных или не идентичных, обозначает A, G, C, U или T).

[3] аптамер по п. [2], где N1N2 обозначает GA, GU, GC, UU, GT или CU.

[4] аптамер по п. [2], где X1 и Х2 оба обозначают А или оба обозначают G.

[5] аптамер по пп. [3] или [4], где по меньшей мере один пиримидиновый нуклеотид был изменен или модифицирован.

[6] аптамер по п. [1], включающий любую из нуклеотидных последовательностей (a), (b) и (c), приведенных ниже:

(а) аптамер, содержащий нуклеотидную последовательность, выбираемую из SEQ ID NO: 4-34, 38-57, 59-65 и 69-72 (при условии, что урацил может представлять собой тимин);

(b) аптамер, содержащий нуклеотидную последовательность, выбираемую из SEQ ID NO: 4-34, 38-57, 59-65 и 69-72 (при условии, что урацил может представлять собой тимин), в которой могут быть заменены, делетированы, вставлены или добавлены от 1 до 5 нуклеотидов; и

(с) нуклеотидная последовательность, идентичная на 70% или более нуклеотидной последовательности, выбираемой из SEQ ID NO: 4-34, 38-57, 59-65 и 69-72 (при условии, что урацил может представлять собой тимин).

[7] аптамер по п. [6], где по меньшей мере один нуклеотид, содержащийся в аптамере, был изменен или модифицирован.

[8] аптамер по п. [1], включающий любую из нуклеотидных последовательностей (a'), (b') и (c'), приведенных ниже:

(а') нуклеотидная последовательность, выбираемая из SEQ ID NO: 56(1)-56(7), 56(9), 56(11), 56(12), 56(15)-56(52), 61(1), 69(1), 69(2) и 72(1)-72(8) (при условии, что урацил может представлять собой тимин);

(b') нуклеотидная последовательность, выбираемая из SEQ ID NO: 56(1)-56(7), 56(9), 56(11), 56(12), 56(15)-56(52), 61(1), 69(1), 69(2) и 72(1)-72(8) (при условии, что урацил может представлять собой тимин), в которой могут быть заменены, делетированы, вставлены или добавлены от 1 до 5 нуклеотидов; и

(с') нуклеотидная последовательность, идентичная на 70% или более нуклеотидной последовательности, выбираемой из SEQ ID NO: 56(1)-56(7), 56(9), 56(11), 56(12), 56(15)-56(52), 61(1), 69(1), 69(2) и 72(1)-72(8) (при условии, что урацил может представлять собой тимин).

[9] аптамер по п. [1], где все гидроксильные группы в 2'-положениях соответствующих пиримидиновых нуклеотидов, содержащихся в аптамере, идентичных или не идентичных, могут заменяться на атом или группу, выбираемые из группы, состоящей из атома водорода, атома фтора и метоксигруппы.

[10] аптамер по п. [1], где все гидроксильные группы во 2'-положениях соответствующих пуриновых нуклеотидов, содержащихся в аптамере, идентичных или не идентичных, могут заменяться на атом или группу, выбираемые из группы, состоящей из атома водорода, атома фтора и метоксигруппы.

[11] Комплекс, включающий любой из аптамеров [1]-[10] и функциональное вещество.

[12] Комплекс по п. [11], где функциональное вещество представляет собой вещество, обладающее сродством, вещество для мечения, фермент, средство доставки лекарственного средства или лекарственное средство.

[13] Лекарственное средство, включающее любой из аптамеров [1]-[10] или комплекс [11] или [12].

[14] Лекарственное средство по п. [13], использующееся для профилактики или лечения сердечно-сосудистого заболевания или фиброза.

[15] Диагностический реагент, включающий любой из аптамеров [1]-[10] или комплекс [11] или [12].

[16] Зонд для детекции химазы, включающий любой из аптамеров [1]-[10] или комплекс [11] или [12].

[17] Твердофазный носитель для очистки химазы, включающий любой из аптамеров [1]-[10] или комплекс [11] или [12].

[18] Способ детекции химазы, включающий использование любого из аптамеров [1]-[10] или комплекса [11] или [12].

[19] Способ очистки химазы, включающий использование любого из аптамеров [1]-[10] или комплекса [11] или [12].

Эффект изобретения

Аптамер или комплекс согласно настоящему изобретению может использоваться в качестве лекарственного средства или реагента, такого как диагностический реагент для различных заболеваний, вызываемых химазой, таких как фиброз и сердечно-сосудистые заболевания. Аптамер или комплекс согласно настоящему изобретению также может использоваться для очистки и концентрации химазы, а также для детекции и количественного анализа химазы.

На фиг.1 приведена вторичная структура аптамера, представленного SEQ ID NO:4, 5, 12-14, 18, предсказанная программой MFOLD, где часть, обведенная кружком, означает общую последовательность, представленную SEQ ID NO:21.

На фиг.2 приведена вторичная структура аптамера, представленного SEQ ID NO: 22-27, предсказанная программой MFOLD, где часть, обведенная кружком, означает общую последовательность, представленную SEQ ID NO:21.

На фиг.3 приведена вторичная структура аптамера, представленного SEQ ID NO: 28-34, предсказанная программой MFOLD, где часть, обведенная кружком, означает общую последовательность, представленную SEQ ID NO:21.

На фиг.4 показано, как аптамеры, представленные SEQ ID NO:12 и 13, связываются с химазой, где 40N означает пул РНК, содержащий случайную последовательность длиной 40 нуклеотидов. Для использования в качестве молекулы захвата каждый аптамер или отрицательный контроль иммобилизовали; химазу человека инъецировали в качестве анализируемого вещества. Измерения проводили с помощью Biacore T100 (производство GE Helthcare).

На фиг.5 приведена вторичная структура аптамера, представленного SEQ ID NO:38-40, 43, 48, предсказанная программой MFOLD, где часть, обведенная кружком, означает общую последовательность, представленную SEQ ID NO:21.

На фиг. 6 приведена вторичная структура аптамера, представленного SEQ ID NO:49, 51, 55-57, предсказанная программой MFOLD, где часть, обведенная кружком, означает общую последовательность, представленную SEQ ID NO:21.

На фиг. 7 показано, как аптамеры, представленные SEQ ID NO:13, 55 и 56, связываются с химазой, где 40N означает пул РНК, содержащий случайную последовательность длиной 40 нуклеотидов. Химазу иммобилизовали на поверхности чипа; инъецировали каждый аптамер или отрицательный контроль в качестве анализируемых веществ. Измерения проводили с помощью Biacore T100 (производство GE Helthcare).

На фиг. 8 приведены результаты Вестерн-блоттинга, показывающие деградацию LTBP-1 химазой и ингибирование деградации LTBP-1 аптамерами, приведенными в таблице 9. Полосы 1, 8, 9, 23 и 31 содержат маркеры; полосы 6, 21 и 29 содержат отрицательный контроль (без ингибитора); полосы 7, 22 и 30 содержат контроли без химазы.

Предпочтительный способ осуществления изобретения

В настоящем изобретении представлен аптамер, обладающий способностью связываться с химазой. Аптамеры согласно настоящему изобретению способны ингибировать активности химазы.

Аптамер означает молекулу нуклеиновой кислоты, обладающую сродством связывания к определенной молекуле-мишени. Аптамер также может ингибировать активность определенной молекулы-мишени путем связывания с определенной молекулой-мишенью. Аптамер согласно настоящему изобретению обладает сродством связывания к химазе и способен ингибировать активность химазы. Аптамер согласно настоящему изобретению может представлять собой РНК, ДНК, модифицированную нуклеиновую кислоту или их смесь. Аптамер согласно настоящему изобретению также может иметь линейную или круговую форму.

Химаза, известная сериновая протеаза, запасается в секреторных гранулах тучных клеток. Химаза тесно ассоциирована с множеством различных биологических реакций, опосредуемых тучными клетками, включая, например, продукцию и деградацию биореактивных пептидов, перестройку внеклеточного матрикса, сигналы цитокинов и иммунитет. Аптамер согласно настоящему изобретению может проявлять ингибиторную активность по отношению к химазе, полученной из любого млекопитающего. Такие млекопитающие включают приматов (например, человека, обезьян), грызунов (например, мышей, крыс, морских свинок, хомяков) и животных-компаньонов, домашних животных и рабочих животных (например, собак, кошек, лошадей, коров, коз, овец, свиней); предпочтительным млекопитающим является человек. Аминокислотная последовательность химазы человека имеет номер доступа AAB26828, и может представлять собой последовательность, содержащую один или несколько мутированных остатков, ее домен или пептид. Химаза человека может находиться не только в мономерной форме, но также в димерной и полимерной.

Аптамер согласно настоящему изобретению связывается с химазой в физиологических буферных растворах. Ограничений на выбор буферного раствора нет, однако предпочтительно, если pH буферного раствора находится в пределах от 5,0 до 10,0. Такие буферные растворы включают, например, раствор А и раствор С, описанные ниже (см. Примеры 1 и 2). Силу связывания аптамера согласно настоящему изобретению с химазой можно измерить с помощью любого из тестов, описанных ниже.

Силу связывания измеряют с помощью Biacore T100 (производство GE Healthcare). В способе измерения вначале аптамер иммобилизуют на сенсорном чипе, причем количество иммобилизованного аптамера составляет примерно 1000 RU. Для анализа инъецируют 20 мкл раствора химазы с концентрацией 0,2 мкМ и детектируют связывание химазы с аптамером. Отрицательным контролем служит РНК, включающая случайную последовательность нуклеотидов длиной от 30 до 40 нуклеотидов. Если химаза связывается с аптамером эквивалентно или со значительно большей силой, чем с контрольной РНК, считается, что аптамер обладает способностью связываться с химазой.

В другом способе вначале химазу иммобилизуют на сенсорном чипе, причем количество иммобилизованной химазы составляет примерно 4000 RU. Для анализа инъецируют 20 мкл раствора аптамера с концентрацией 0,01 мкг/мкл, и детектируют связывание химазы с аптамером. Отрицательным контролем служит РНК, содержащая случайную последовательность нуклеотидов длиной от 30 до 40 нуклеотидов. Если химаза связывается с аптамером эквивалентно или со значительно большей силой, чем с контрольной РНК, считается, что аптамер обладает способностью связываться с химазой.

Ингибиторная активность по отношению к химазе означает ингибиторный потенциал по отношению к любой активности химазы. Например, ингибируется способность фермента гидролизовать и расщеплять пептидные цепи, что является одной из функций химазы. Приемлемые субстраты для ферментативной активности не ограничиваются белками и биоактивными пептидами, присутствующими в живых организмах (например, AngI, латентный TGF-β и т.п.), но включают пептиды, содержащие частичные аминокислотные последовательности вышеуказанных пептидов, конъюгированные с хромогенным веществом или флуоресцентным веществом. Хромогенные вещества и флуоресцентные вещества известны специалистам в области техники. Явления, имеющие место при расщеплении белков или биоактивных пептидов, включают повышенную экспрессию коллагена I/III, повышенное содержание гидроксипролина, повышенную экспрессию IgE и т.п.; подавление этих явлений также включается в понятие ингибиторной активности в отношении химазы. Кроме того, ингибиторная активность по отношению к миграции нейтрофилов, моноцитов и эозинофилов к химазе также включается в понятие ингибиторной активности по отношению к химазе. Далее, эффекты подавления вызываемых химазой высвобождения гистамина, повышения количества тучных клеток, повышения проницаемости сосудов, фиброза тканей, воспаления, ангиогенеза, утолщения сосудистой интимы и т.п. также включаются в понятие ингибиторной активности в отношении химазы.

Субстрат химазы означает пептид, белок или подобное вещество, которое подвергается гидролитическому расщеплению химазой. Известные субстраты для химазы, содержащиеся в живых организмах, включают пептиды и белки такие как AngI, латентный TGF-β, фактор стволовых клеток (SCF), проколлаген, проколлагеназа, фибронектин, проматриксная металлопротеаза-1 (pro-MMP-1), pro-MMP-9, тканевой ингибитор матриксной металлопротеазы-1 (TIMP-1), аполипопротеин A-I (apoA-I), apoE, белок переноса фосфолипидов, предшественник IL-1β, большой эндотелин-1 (big-ET-1), big-ET-2, пептид, активирующий соединительную ткань III, предшественник IL-18, вещество P, вазоактивный кишечный пептид (VIP), каллидин, брадикинин и С3а. В настоящем документе субстраты химазы не ограничиваются вышеперечисленными, но включают искусственно сконструированные модельные пептиды, содержащие аминокислотные остатки, специфически узнаваемые химазой, такие как Phe и Tyr, а также такие пептиды, конъюгированные с хромогенным веществом или флуоресцентным веществом.

Происходит ли ингибирование ферментативной активности химазы аптамером, можно определить, например, с помощью трех способов анализа, описанных ниже.

В первом способе используется синтетический субстрат. Пригодным субстратом для химазы является Suc-Ala-Ala-Pro-Phe-MCA (4-метилкумарин-7-амидная группа) (производство Peptide Institute, Inc.), включающий пептид из 4 аминокислот «Ala-Ala-Pro-Phe» - стандартный субстрат для химотрипсин-подобных протеаз.

Тест проводится с использованием 96-луночного планшета (F16 Black Maxisorp Fluoronunc, производство Nunc), в объеме реакционной смеси 100 мкл, в буферном растворе (раствор С; см. Пример 2 ниже). Вначале готовят по 50 мкл растворов всех нуклеиновых кислот в растворе С. Далее добавляют по 10 мкл 1мМ раствора субстрата в растворе С и помещают планшет в считыватель микропланшетов SpectraMax190 (производство Molecular Devices Corporation) и инкубируют при 37°С в течение 5 минут. В отдельной пробирке 0,05 мкг химазы (рекомбинантный белок производства Sigma) разводят в растворе С, и 40 мкл этого разведения инкубируют при 37°С в течение 5 минут. Раствор химазы добавляют к смеси нуклеиновой кислоты и субстрата для начала ферментативной реакции. Планшет с реакционной смесью помещают в считыватель микропланшетов SpectraMax190 (производство Molecular Devices Corporation) и анализируют изменения флуоресценции в зависимости от времени при 37°С в течение 5 минут (возбуждение при длине волны 380 нм, детекция при длине волны 460 нм). Строят линейную аппроксимацию усиления флуоресценции AMC (7-амино-4-метилкумарина), высвобождаемого из субстрата активностью химазы, и ее наклон принимают за начальную скорость реакции. Для контроля образцы обрабатывают и анализируют одинаковым способом в двух случаях: использование пула нуклеиновых кислот, содержащего случайную последовательность длиной в 30-40 нуклеотидов (отрицательный контроль), и использование химостатина, известного ингибитора химотрипсин-подобных сериновых протеаз (положительный контроль). Начальную скорость реакции без нуклеиновой кислоты и ингибитора принимают за 100% активности фермента, рассчитывают степень ингибирования для каждого анализируемого вещества и определяют концентрацию ингибитора, необходимую для 50% ингибирования ферментативной активности (IC50). Считается, что аптамер, имеющий IC50 ниже, чем известный ингибитор химостатин, обладает прекрасной ингибиторной активностью.

Во втором способе оценки используется нативный субстрат. Пригодным нативным субстратом для химазы является ангиотензин I. В этом случае, пептидный фрагмент His-Leu, высвобождающийся при расщеплении ангиотензина I, флуоресцентно дериватизуют и измеряют активность его флуоресценции.

В ходе теста проводится ферментативная реакция в 50 мкл раствора С. Вначале 0,3-0,75 нг химазы (рекомбинантный белок, производство Sigma; или нативный белок, производства Calbiochem) разводят в 5 мкл раствора С. Каждую нуклеиновую кислоту растворяют в 25 мкл раствора С. Смешивают 5 мкл каждого разведения химазы и 25 мкл раствора каждой нуклеиновой кислоты и далее смесь инкубируют при 37°С в течение 5 минут. В отдельной пробирке готовят 20 мкл раствора ангиотензина I (производство Peptide Institute, Inc.) с концентрацией 125 мкМ в растворе С и инкубируют при 37°С в течение 5 минут. Раствор ангиотензина I добавляют к смеси химазы и нуклеиновой кислоты, и начинается ферментативная реакция. Реакцию проводят в течение 90 минут при 37°С, после чего добавляют 25 мкл ледяной 30% трихлоруксусной кислоты для остановки реакции. Смесь центрифугируют при 4°С и 14000 об/мин в течение 10 минут и 30 мкл полученного супернатанта используют для следующей реакции флуоресцентной дериватизации.

После добавления 30 мкл супернатанта в 96-луночный планшет (Black, производства Costar), в каждую лунку добавляют 15 мкл 2% раствора о-фталальдегида (производство Sigma) в метаноле и 170 мкл 0,3М раствора NaOH, и планшет оставляют на 10 минут при комнатной температуре. Далее добавляют 25 мкл 3М раствора HCl для остановки реакции. Планшет помещают в ридер микропланшетов SpectraMax190 (производство Molecular Devices Corporation) и определяют интенсивность флуоресценции при длине волны возбуждения 355 нм и длине волны флуоресценции 460 нм.

Для контроля образцы обрабатывают и анализируют аналогичным образом в двух случаях: использование SEQ ID NO:58 (отрицательный контроль) и использование химостатина, известного ингибитора химотрипсин-подобных сериновых протеаз (положительный контроль). В обоих случаях, интенсивность флуоресценции, полученная в момент времени реакции 0 минут, используется в качестве контрольного определения. За 100% в ферментативной реакции химазы принимают интенсивность флуоресценции, детектируемую при добавлении равного объема раствора С вместо каждой нуклеиновой кислоты, рассчитывают степень ингибирования для каждого анализируемого вещества и определяют концентрацию ингибитора, необходимую для 50% ингибирования ферментативной активности (IC50). Считается, что аптамер, имеющий IC50 ниже, чем известный ингибитор химостатин, обладает прекрасной ингибиторной активностью.

В третьем способе оценки используется нативный субстрат, содержащийся в супернатанте клеточной культуры. В этом случае расщепление субстрата химазы LTBP-1 определяют с помощью Вестерн-блоттинга. Замороженные клетки NHLF (производство Cambrex Bio Science) быстро размораживают в водяной бане при 37°С и суспендируют в среде (10% FBS/F-12). После центрифугирования при 1200 об/мин в течение 5 минут удаляют супернатант, а клетки ресуспендируют в среде. К отцентрифугированным клеткам добавляют среду до общего объема 10 мл и полученную суспензию переносят в культуральную чашку и культивируют при 37°С в присутствии 5% С02. За морфологией и пролиферативным статусом клеток наблюдают в микроскоп. При достижении клетками конфлюентности среду заменяют на бессывороточную среду (0,2% BSA/F-12). Через два дня после смены среды культуральный супернатант собирают, разливают и хранят в морозильнике при -30°С.

40 мкл культурального супернатанта NHLF, свежеразмороженного перед употреблением, добавляют в пробирку и добавляют 5 мкл раствора нуклеиновой кислоты, разведенной раствором С. Для положительного контроля химостатин разводят раствором С и это разведение добавляют тем же способом. Для отрицательного контроля добавляют только раствор С. Далее добавляют 5 мкл разведения химазы в растворе Е с концентрацией 100 нг/мл (раствор С + 0,1% BSA, 0,05% азида натрия). Для контроля готовят пробирку, не содержащую химазу. Образец перемешивают и инкубируют при 37°С в течение 1 часа и смешивают с равным объемом лизисного буфера для электрофореза для остановки реакции. LTBP-1 в образце определяют с помощью Вестерн-блоттинга, описанного ниже.

Образец, смешанный с лизисным буфером, кипятят в течение 3 минут и 10 мкл образца подвергают электрофорезу в 5-20% акриламидном геле. После завершения электрофореза образец переносят на нитроцеллюлозный фильтр, после чего фильтр забивают 5% обезжиренного молока, 50 мМ Tris-HCl (pH 8,0) и 0,05% азида натрия. К фильтру добавляют раствор моноклонального антитела к LTBP-1 с концентрацией 2 мкг/мл в 2% BSA, PBS и 0,05% азида натрия и инкубируют при комнатной температуре в течение ночи. Фильтр промывают три раза и инкубируют с раствором вторых антител (антитела к мышиным IgG, помеченные HRP, разведенные в 10000 раз в 0,1%BSA/PBS) при комнатной температуре в течение 2 часов. Фильтр промывают пять раз, и проявляют с использованием хемилюминесцентного субстрата.

По плотности и положению (молекулярному весу) полосы LTBP-1 очевидно, что полоса, соответствующая образцу без химазы, может служить хорошим положительным контролем (+), а полоса, соответствующая отрицательному контролю, может служить хорошим отрицательным контролем (-). Ингибиторная активность каждого анализируемого вещества оценивается с помощью визуального контроля.

На аптамер согласно настоящему изобретению не накладывается никаких ограничений, при условии, что он может связываться с любой частью химазы и ингибировать ее активность.

Длина аптамера согласно настоящему изобретению не ограничена, и обычно может составлять от примерно 10 до примерно 200 нуклеотидов, и может составлять, например, не более 100 нуклеотидов, предпочтительно не более 50 нуклеотидов, более предпочтительно не более 40 нуклеотидов, наиболее предпочтительно не более 30 нуклеотидов. При меньшем общем числе нуклеотидов облегчается химический синтез и массовое производство, и также обеспечивается выигрыш в стоимости. Также считается, что меньшее общее число нуклеотидов обеспечивает легкость химической модификации, высокую стабильность в теле и низкую токсичность.

Каждый нуклеотид, содержащийся в аптамере согласно настоящему изобретению, идентичный или не идентичный, может представлять собой нуклеотид, содержащий гидроксильную группу во 2' положении рибозы (например, рибозы пиримидинового нуклеотида, рибозы пуринового нуклеотида) (т.е. незамещенный нуклеотид) или нуклеотид, содержащий замещающий атом или группу во 2' положении рибозы. Примерами таких атомов или групп могут служить нуклеотид, замещенный атомом водорода, атомом фтора или -О-алкильной группой (например, группой -O-Me), -О-ацильной группой (например, группой -O-COMe) или аминогруппой (например, группой -NH2).

Аптамер согласно настоящему изобретению имеет последовательность, обозначаемую X1GAUAGAN1N2UAAX2 (SEQ ID NO: 21; где каждый из X1 и X2, идентичных или не идентичных, представляет собой A или G, а каждый из N1 и N2, идентичных или не идентичных, представляет собой A, G, C, U или T; при условии, что урацил может представлять собой тимин). Аптамер, имеющий такую последовательность, прочно связывается с химазой и ингибирует активность химазы.

В вышеприведенной формуле предпочтительно, если Х1 и Х2 оба представляют собой А или оба представляют собой G; предпочтительно, если N1N2 представляет собой GA, GU, GC, GT или CU (при условии, что урацил может представлять собой тимин).

Аптамер согласно настоящему изобретению также может представлять собой нуклеотид, где по меньшей мере один тип нуклеотидов (например, 1, 2, 3 или 4 типа) содержит гидроксильную группу или любой вышеописанный атом или группу, например, по меньшей мере два типа групп (например, 2, 3 или 4 типа), выбранных из группы состоящей из атома водорода, атома фтора, гидроксильной группы и метоксигруппы, во 2'-положении рибозы.

В аптамере согласно настоящему изобретению все пиримидиновые нуклеотиды могут представлять собой нуклеотиды, замещенные атомом фтора, или нуклеотиды, замещенные любым вышеупомянутым атомом или группой, предпочтительно, атомом или группой, выбираемыми из атома или группы, состоящих из атома водорода, гидроксильной группы и метоксигруппы, идентичных или не идентичных, во 2'-положении рибозы.

В аптамерах согласно настоящему изобретению все пуриновые нуклеотиды могут представлять собой нуклеотиды, содержащие гидроксильную группу, или нуклеотид, замещенный любым вышеупомянутым атомом или группой, предпочтительно, атомом или группой, выбираемыми из группы, состоящей из атома водорода, метоксигруппы и атома фтора, идентичных или не идентичных, во 2'-положении рибозы.

В аптамере согласно настоящему изобретению также все нуклеотиды могут идентичным образом содержать гидроксильную группу или любой вышеупомянутый атом или группу, например, идентичную группу, выбираемую из группы, состоящей из атома водорода, атома фтора, гидроксильной группы и метоксигруппы, во 2'-положении рибозы.

В настоящем документе, в описании модификаций сахарных групп в составе нуклеотидов подразумевается, что нуклеотиды, составляющие аптамер, представляют собой РНК (т.е., подразумевается, что сахарные группы представляют собой рибозу). Однако, это не означает, что ДНК исключается из нуклеотидов, составляющих аптамер, и где это возможно, модификация РНК означает также модификацию ДНК. Например, если нуклеотид, составляющий аптамер, представляет собой ДНК, замещение гидроксильной группы во 2'-положении рибозы на Х означает замещение одного из водородных атомов во 2'-положении дезоксирибозы на Х.

Аптамер согласно настоящему изобретению также может представлять собой:

(а) аптамер, содержащий нуклеотидную последовательность, выбираемую из SEQ ID NO: 4-34, 38-57, 59-65 и 69-72 (при условии, что урацил может представлять собой тимин);

(b) аптамер, содержащий нуклеотидную последовательность, выбираемую из SEQ ID NO: 4-34, 38-57, 59-65 и 69-72 (при условии, что урацил может представлять собой тимин), в которой могут быть заменены, делетированы, вставлены или добавлены от 1 до 5 нуклеотидов; и

(с) аптамер, содержащий нуклеотидную последовательность, идентичную на 70% или более (предпочтительно на 80% или более, более предпочтительно на 90% или более, наиболее предпочтительно на 95% или более) нуклеотидной последовательности, выбираемой из SEQ ID NO: 4-34, 38-57, 59-65 и 69-72 (при условии, что урацил может представлять собой тимин). Аптамер согласно настоящему изобретению также включает:

(d) конъюгат, выбираемый из группы, состоящей из конъюгата множества аптамеров (а), описанных выше, конъюгата множества аптамеров (b), описанных выше, конъюгата множества аптамеров (c), описанных выше, и конъюгата множества аптамеров (а), (b) и (с), описанных выше.

Способностью связываться с химазой и/или ингибировать активность химазы (ферментативную активность химазы и т.п.) обладает не только аптамер (а), описанный выше, но и аптамеры (b)-(d).

Аптамер согласно настоящему изобретению может также представлять собой: (a') аптамер, содержащий нуклеотидную последовательность, выбираемую из SEQ ID NO: 56(1)-56(7), 56(9), 56(11), 56(12), 56(15)-56(52), 61(1), 69(1), 69(2) и 72(1)-72(8) (при условии, что урацил может представлять собой тимин);

(b') аптамер, содержащий нуклеотидную последовательность, выбираемую из SEQ ID NO: 56(1)-56(7), 56(9), 56(11), 56(12), 56(15)-56(52), 61(1), 69(1), 69(2) и 72(1)-72(8) (при условии, что урацил может представлять собой тимин), в которой заменены, делетированы, вставлены или добавлены от 1 до 5 нуклеотидов; или

(с') аптамер, содержащий нуклеотидную последовательность, идентичную на 70% или более нуклеотидной последовательности, выбираемой из SEQ ID NO: 56(1)-56(7), 56(9), 56(11), 56(12), 56(15)-56(52), 61(1), 69(1), 69(2) и 72(1)-72(8) (при условии, что урацил может представлять собой тимин). Аптамер согласно настоящему изобретению также включает:

(d') конъюгат, выбираемый из группы, состоящей из конъюгата множества аптамеров (а'), описанных выше, конъюгата множества аптамеров (b'), описанных выше, конъюгата множества аптамеров (c'), описанных выше, и конъюгата множества аптамеров (а'), (b') и (с'), описанных выше. Кроме того, аптамер согласно настоящему изобретению также включает:

(е) конъюгат, состоящий из одного или более аптамеров, выбираемых из группы, состоящей из (a), (b) и (с), описанных выше, и одного или более аптамеров, выбираемых из группы, состоящей из (a'), (b') и (c').

Вышеописанные аптамеры (a')-(d') и (e) также способны связываться с химазой и/или ингибировать активность химазы (ферментативную активность химазы и т.п.).

В случаях (b) и (b'), описанных выше, количество замещенных, делетированных, вставленных или добавленных нуклеотидов не ограничено, при условии, что аптамер обладает способностью связываться с химазой и/или ингибировать активность химазы (ферментативную активность химазы и т.п.). Количество нуклеотидов может быть, например, не более 30, предпочтительно не более 20, более предпочтительно не более 10, еще более предпочтительно не более 5, наиболее предпочтительно 4, 3, 2 или 1.

В случаях (c) и (c'), описанных выше, «идентичность» означает процентное соотношение идентичных остатков нуклеотидов ко всем перекрывающимся остаткам нуклеотидов в оптимальном выравнивании, при котором две нуклеотидные последовательности выравнивают с использованием математического алгоритма, известного из уровня техники (предпочтительно, если алгоритм учитывает введение делеций в одну или другую последовательность для лучшего выравнивания).

Идентичность нуклеотидной последовательности в настоящем описании можно рассчитать, например, при выравнивании двух нуклеотидных последовательностей с использованием алгоритма расчета гомологии NCBI BLAST-2 (National Center for Biotechnology Information Basic Local Alignment Search Tool) со следующими условиями (штрафа за открытие разрыва, равного 5, и штрафа за удлинение разрыва, равного 2, x_ dropoff=50; ожидание=10; фильтр=включен).

В случаях (d), (d') и (е), описанных выше, конъюгацию можно достичь тандемным связыванием. При конъюгации может использоваться линкер. В качестве линкера можно использовать нуклеотидные цепи (например, длинной от 1 до 20 нуклеотидов) и ненуклеотидные цепи (например, линкер -(CH2)n-, линкер -(CH2CH2O)n-, гексаэтиленгликольный линкер, линкер TEG, пептидосодержащий линкер, линкер, содержащий связь -S-S-, линкер, содержащий связь -CONH-, линкер, содержащий связь -OPO3-. Множество, указанное выше во множестве конъюгатов, не ограничено, при условии, что оно составляет два или более, так, множество может представлять собой 2, 3 или 4. Все вышеописанные нуклеотиды в (a)-(d), (a')-(d') и (е), идентичные или не идентичные, могут представлять собой нуклеотиды, содержащие гидроксильную группу во 2'-положении рибозы или нуклеотиды, замещенные любыми группами (например, атом водорода, атом фтора или группа -O-Me) во 2'-положении рибозы (например, рибозы пиримидинового нуклеотида).

Аптамер согласно настоящему изобретению может представлять собой аптамер, в котором остаток сахара (например, рибозы) каждого нуклеотида модифицирован для повышения активности связывания с химазой, стабильности, облегчения доставки лекарственного средства и т.д. В качестве примеров сайта модификации в составе остатка сахара можно привести замену атома кислорода в положениях 2'-, 3'- и/или 4'-остатка сахара на другой атом, и т.п. В качестве примера модификации можно привести фторирование, О-алкилирование (например, О-метилирование, О-этилирование), О-арилирование, S-алкилирование (например, S-метилирование, S-этилирование), S-арилирование и аминирование (например, -NH2). Для таких изменений остатка сахара может использоваться способ, известный из уровня техники (см., например, Sproat et al., (1991) Nucl. Acid. Res. 19, 733-738; Cotton et al., (1991) Nucl. Acid. Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145).

Аптамер согласно настоящему изобретению может также содержать нуклеотидное основание (например, пурин или пиримидин) (измененное, например, химическим замещением) для усиления связывания с химазой и т.п. В качестве примеров таких изменений можно привести изменения в 5 положении пиримидинов, 6 и/или 8 положении пуринов, добавление амина вне цикла, замещение 4-тиоуридином и замещение 5-бром- или 5-йодурацилом.

Фосфатную группу, содержащуюся в аптамере согласно настоящему изобретению, можно замещать для придания аптамеру устойчивости против нуклеазы и гидролиза. Например, группу Р(О)О можно замещать группой P(O)S (тиоат), P(S)S (дитиоат), P(O)NR2 (амидат), P(O)CH3, P(O)BH3, P(O)R, R(O)OR', CO или CH2 (формацетат) или 3'-амин (-NH-CH2-CH2-) (где каждый из R и R' независимо представляет собой Н или замещенный или незамещенный алкил (например, метил, этил)).

Соединяющая группа, посредством которой нуклеотид может присоединяться к соседнему нуклеотиду, может представлять собой, например, -O-, -N- или -S-.

Изменения также могут включать кэпирование на 3'-конце и 5'-конце.

Далее, изменения могут включать присоединение к концу аптамера полиэтиленгликоля, аминокислоты, пептида, инвертированного dT, нуклеиновой кислоты, нуклеозидов, миристоила, литохолик-олеила, докозанила, лауроила, стеароила, пальмитоила, олеоила, линолеоил, других липидов, стероидов, холестерина, кофеина, витаминов, пигментов, флуоресцентных веществ, противораковых агентов, токсина, ферментов, радиоактивного вещества, биотина и т.п. Примеры таких изменений описаны, например, в патентах США №№ 5660985 и 5756703.

Аптамер согласно настоящему изобретению можно синтезировать как описано в настоящем документе, а также способом, известным из уровня техники. В способе синтеза используется РНК-полимераза. С помощью химического синтеза получают ДНК, имеющую желаемую последовательность и промотерную последовательность РНК-полимеразы, и транскрибируют ее известным способом для получения желаемой РНК. Аптамер согласно настоящему изобретению также можно синтезировать с использованием ДНК-полимеразы. С помощью химического синтеза получают ДНК с желаемой последовательностью и далее ее амплифицируют известным способом, известным как полимеразная цепная реакция (PCR). Нити разделяют известным способом электрофореза в полиакриламидном геле или ферментативной обработкой. При синтезе модифицированного аптамера эффективность реакции элонгации может быть повышена путем использования полимеразы, несущей мутацию в определенном положении. Аптамер, полученный таким способом, можно легко очистить с помощью известного способа.

Аптамер можно синтезировать в больших количествах с помощью способов химического синтеза, таких как амидитный способ и фосфорамидитный способ. Эти хорошо известные способы описаны в Nucleic Acids (т. 2) [1] Synthesis and Analysis of Nucleic Acid (ред. Yukio Sugiura, изд. Hirokawa Publishing Company) и др. На практике используют синтезатор, такой как OligoPilot100 или OligoProcess (производство GE Healthcare Bioscience). Аптамер, полученный таким способом, можно легко очистить с помощью известного способа, таким как хроматография.

При условии, что активная группа, такая как аминогруппа, вводится в аптамер в процессе химического синтеза фосфорамидитным способом или подобным ему, функциональное вещество можно добавлять после окончания синтеза. Например, при введении аминогруппы в конец аптамера возможно конденсировать полиэтиленгликолевую цепь, содержащую карбоксильную группу.

Аптамер связывается с молекулой-мишенью множеством различных способов, таким как ионные связи, обусловленные отрицательными зарядами фосфатных групп, гидрофобные связи и водородные связи, обусловленные рибозой, и водородные связи и стэкинг, обусловленные нуклеотидными основаниями. В частности, ионные связи, обусловленные отрицательными зарядами фосфатных групп, присутствующих в количестве, равном количеству составляющих аптамер нуклеотидов, являются сильными и связываются с лизином и аргинином на поверхности белка, имеющими положительный заряд. Поэтому можно заменять нуклеиновые основания, не участвующие напрямую в связывании с молекулой-мишенью. В частности, поскольку в области стеблевой структуры уже сформировались пары оснований, маловероятно, что нуклеотиды, смотрящие внутрь двуспиральной структуры, будут связываться напрямую с молекулой-мишенью. Таким образом, даже при замене пары оснований на другую пару оснований, зачастую активность аптамера не снижается. В структурах, где пары оснований не образуются, таких как петлевые структуры, возможна замена основания при условии, что нуклеиновое основание не принимает прямого участия в связывании молекулы-мишени. Что касается модификаций 2'-положения рибозы, функциональная группа в 2'- положении рибозы редко напрямую взаимодействует с молекулой-мишенью, во многих случаях не имеет особого значения и может заменяться другой модифицированной молекулой. Таким образом, аптамер часто сохраняет свою активность, если не заменяется или не удаляется функциональная группа, напрямую задействованная в связывании с молекулой-мишенью. Также важно, чтобы не слишком сильно менялась общая трехмерная структура аптамера.

Аптамер можно получить с использованием способа SELEX или его улучшенной версии (см., например, Ellington et al., (1990) Nature, 346, 818-822; Tuerk et al., (1990) Science, 249, 505-510). В способе SELEX путем ужесточения критериев селекции путем увеличения числа раундов или с использованием конкурентного вещества можно отобрать и сконцентрировать аптамер, обладающий более сильным потенциалом связывания с молекулой-мишенью. Таким образом, путем изменения числа раундов SELEX и/или изменения условий конкуренции, в некоторых случаях можно получить аптамеры с различной силой связывания, аптамеры с различными способами связывания и аптамеры с одинаковой силой связывания и способом связывания, но различными нуклеотидными последовательностями. Способ SELEX включает процесс амплификации с помощью PCR; используя ионы магния и другие способы, приводящие к мутациям, можно добиться более высокого разнообразия в SELEX.

Аптамеры, полученные с помощью SELEX, представляют собой нуклеиновые кислоты, обладающие высоким сродством к молекуле-мишени, однако, это ничего не говорит об ингибировании биоактивности молекулы мишени. Химаза представляет собой основной белок, с которым нуклеиновые кислоты могут связываться неспецифично, однако аптамеры, не связывающиеся сильно с определенным сайтом в составе химазы, не влияют на активность молекулы-мишени. РНК, содержащая случайную последовательность, используемая как отрицательный контроль, фактически не ингибировала ферментативную активность химазы, хотя и слабо связывалась с химазой.

Исходя из активного аптамера, выбранного таким образом, можно использовать SELEX для получения аптамера, обладающего более высокой активностью. В частности, SELEX повторяют, используя матрицу, где аптамер с заданной последовательностью частично рандомизован или матрицу, со введенными примерно 10-30% случайных последовательностей.

Аптамер, полученный с помощью SELEX, имеет длину примерно 80 нуклеотидов, и в таком виде сложен для получения его в виде лекарственного средства. Таким образом, необходимо повторять попытки с помощью проб и ошибок добиться укорочения аптамера до примерно 50 нуклеотидов или менее, что упрощает химический синтез. Легкость этого последующего процесса минимизации зависит от дизайна праймера для аптамера, полученного с помощью SELEX. При неудачном дизайне праймера дальнейший процесс будет невозможен даже при выборе аптамера, обладающего активностью, с помощью SELEX. В настоящем изобретении был получен аптамер, сохраняющий активность, длиной 23 нуклеотида.

Аптамеры легко модифицировать, поскольку для их получения используется химический синтез. Путем предсказания вторичной структуры аптамеров с использованием программы MFOLD или предсказания их стерической структуры путем рентгеноструктурного анализа или ЯМР возможно до некоторой степени предсказать, какой нуклеотид можно заменить или делетировать, и в каком месте можно вставить новый нуклеотид. Предсказанный аптамер с новой последовательностью легко синтезировать химическим путем и проверить, сохраняет ли аптамер свою активность, используя существующую тестовую систему.

Если с помощью многократных проб и ошибок удалось идентифицировать область, важную для связывания полученного аптамера с молекулой-мишенью, как описано выше, во многих случаях активность не меняется даже при добавлении новой последовательности к обоим концам последовательности. Длина новой последовательности сильно не ограничена.

Специалист в области техники может разработать множество дизайнов или изменений модификаций, например, последовательностей.

Как указано выше, возможно множество дизайнов или изменений модификаций аптамеров. В настоящем изобретении также представлен способ получения аптамера, делающий возможным множество дизайнов или изменений аптамера, содержащего определенную последовательность (например, последовательность, соответствующую области, выбираемой из стеблевых областей, областей внутренних петель, областей петель, областей шпилек и однонитевых областей: далее по необходимости обозначаемых «фиксированная последовательность»).

Например, способ получения такого аптамера включает получение аптамера, содержащего фиксированную последовательность с использованием одного вида молекул нуклеиновой кислоты или множества видов молекул нуклеиновой кислоты (например, библиотеки молекул нуклеиновой кислоты с разными числами «а» и «b»), состоящего из нуклеотидной последовательности, обозначаемой формулой:

Последовательность праймера (i)-(N)a - фиксированная последовательность - N(b) - последовательность праймера (ii)

где (N)a означает нуклеотидную цепь, состоящую из «а» единиц N; (N)b означает нуклеотидную цепь, состоящую из «b» единиц N; все единицы N, идентичные или не идентичные, представляют собой нуклеотиды, выбираемые из группы, состоящей из A, G, C, U и Т (предпочтительно A, G, C, и U). «а» и «b», идентичные или неидентичные, могут представлять собой любые числа и могут находиться в пределах, например, от 1 до примерно 100, предпочтительно от 1 до примерно 50, более предпочтительно от 1 до примерно 30, еще более предпочтительно от 1 до примерно 20 или от 1 до примерно 10], и пар праймеров, соответствующих последовательностям праймеров (i) и (ii), соответственно.

В настоящем изобретении также представлен комплекс, включающий аптамер согласно настоящему изобретению и функциональное вещество, связанное с ним. Связь между аптамером и функциональным веществом в комплексе согласно настоящему изобретению может быть ковалентной или нековалентной. В комплексе согласно настоящему изобретению могут быть связаны аптамер согласно настоящему изобретению и одно или более (например, 2 или 3) функциональных веществ одного вида или разных видов. Вид функционального вещества не ограничен, при условии, что оно добавляет аптамеру согласно настоящему изобретению определенную функцию или способно изменить (например, улучшить) определенную характеристику аптамера согласно настоящему изобретению. В качестве примеров функционального вещества можно привести белки, пептиды, аминокислоты, липиды, сахара, моносахариды, полинуклеотиды и нуклеотиды. В качестве примеров функционального вещества можно привести вещества, обладающие сродством (например, биотин, стрептавидин, полинуклеотиды, обладающие сродством к комплементарной последовательности-мишени, антитела, глютатион-сефароза, гистидин), вещества для мечения (например, флуоресцентные вещества, люминесцентные вещества, радиоизотопы), ферменты (например, пероксидазу хрена, щелочную фосфатазу), вещества для доставки лекарственного средства (например, липосома, микросферы, пептиды, полиэтиленгликоли), лекарственные средства (например, средства, используемые в адресной терапии, такие как калихеамицин и дуокармицин; аналоги азотистого иприта, такие как циклофосфамид, мелфалан, ифосфамид или трофосфамид; этиленимины, такие, как тиотепа; нитрозомочевины, такие как кармустин; алкилирующие агенты, такие как темозоломид или дакарбазин; фолатоподобные антагонисты обмена веществ, такие как метотрексат или ралтитрексед; аналоги пуринов, такие как тиогуанин, кладрибин или флударабин; аналоги пиримидинов, такие как фторурацил, тегафур или гемцитабин; алкалоиды винка, такие как винбластин, винкристин или винорелбин и их аналоги; производные подофиллотоксина, такие как этопозид, таксаны, доцетаксел или паклитаксел; антрациклины, такие как доксорубицин, эпирубицин, идарубицин и митоксантрон и их аналоги; другие цитотоксические антибиотики, такие как блеомицин и митомицин; соединения платины, такие как цисплатин, карбоплатин и оксалиплатин; пентостатин, милтефосин, эстрамустин, топотекан, иринотекан и бикалутамид) и токсины (например, токсин рицин, лиатоксин и веротоксин). В некоторых случаях, в конце эти функциональные молекулы удаляют. Далее, молекулы могут представлять собой пептиды, которые могут распознаваться и расщепляться ферментами, такими как тромбин, матриксная металлопротеаза (MMP) и фактор Х, и могут представлять собой полинуклеотиды, которые могут отщепляться нуклеазами или рестрикционной эндонуклеазой.

Аптамер или комплекс согласно настоящему изобретению могут использоваться, например, в качестве лекарственного средства или диагностического реагента, реагента или реагентов для тестирования.

Аптамер и комплекс согласно настоящему изобретению могут обладать активностью ингибировать функцию химазы. Как указано выше, химаза тесно ассоциирована с фиброзом и сердечно-сосудистыми заболеваниями. Таким образом, аптамер и комплекс согласно настоящему изобретению пригодны в качестве лекарственных средств для лечения или профилактики заболеваний, сопровождающихся фиброзом или сердечно-сосудистыми заболеваниями.

Аптамер и комплекс согласно настоящему изобретению обладают способностью специфически связываться с химазой. Таким образом, аптамер и комплекс согласно настоящему изобретению пригодны в качестве зондов для детекции химазы. Пробы пригодны для визуализации химазы in vivo, измерения концентрации химазы в крови, окраски тканей, ELISA и т.п. Зонды также пригодны в качестве диагностических реагентов, реагентов для тестирования, аналитических реагентов и т.п. для заболеваний, связанных с химазой (заболеваний, сопровождающихся фиброзом или сердечно-сосудистыми заболеваниями и т.п.).

Благодаря своему специфическому связыванию с химазой, аптамер и комплекс согласно настоящему изобретению могут использоваться в качестве лигандов для очистки химазы.

Аптамер и комплекс согласно настоящему изобретению могут использоваться в качестве веществ для доставки лекарственного средства.

Заболевания, связанные с фиброзом органов или тканей включают легочный фиброз, гиперплазию простаты, фиброз миокарда, скелетно-мышечный фиброз, миелофиброз, гистеромиома, склеродерма, спайки после хирургических операций, послеоперационные рубцы, ожоговые рубцы, гипертрофические рубцы, келоиды, атопический дерматит, перитонеальный склероз, астму, цирроз печени, хронический панкреатит, скиррозный рак желудка, фиброз печени, фиброз почек, фиброзные сосудистые заболевания, ретинит, обусловленный фиброзным микроваскулитом как осложнение диабета, невроз, нефропатии, гломерулонефрит, тубулоинтерстициальный нефрит, наследственные заболевания почек, артериосклеротический периферический артериит и т.п.

Сердечно-сосудистые заболевания включают ангиопатии, аневризмы аорты, почечную недостаточность, гипертонию, артериосклероз, инфаркт миокарда, гипертрофию сердца, сердечную недостаточность, рестеноз после ангиопатий, обусловленный подкожной транслюминальной коронарной ангиопластикой и т.п., диабетические и недиабетические нефропатии, нарушения периферической кровеносной системы и т.п.

Химаза обладает ферментативной активностью и может расщеплять биоактивные вещества, являющиеся ее субстратами. Примеры известных на сегодняшний день субстратов включают AngI, латентный TGF-β, SCF, проколлаген, проколлагеназу, про-MMP-9, предшественник IL-1β и т.п. Химаза оказывает биологическое воздействие путем реакций продукции или деградации этих биоактивных пептидов, включая перестройки внеклеточного матрикса, сигналы цитокинов, иммунитет и вазоконстрикцию. В то же время действие химазы активирует тучные клетки и стимулирует высвобождение гистамина, и тесно ассоциировано с воспалением. Таким образом, аптамер и комплекс согласно настоящему изобретению не ограничены вышеописанными субстратами и могут использоваться в качестве лекарственных средств или диагностических реагентов, реагентов для тестирования и аналитических реагентов для заболеваний, относящихся к биологическим функциям, опосредованным субстратами химазы и заболеваний, относящихся к самой химазе.

Рецептура лекарственного средства согласно настоящему изобретению может включать фармацевтически приемлемый носитель. В качестве примеров фармацевтически приемлемых носителей можно привести наполнители, такие как сахароза, крахмал, маннит, сорбит, лактоза, глюкоза, целлюлоза, тальк, фосфат кальция и карбонат кальция; связующие вещества, такие как целлюлоза, метилцеллюлоза, гидроксипропилцеллюлоза, полипропилпирролидон, желатин, гуммиарабик, полиэтиленгликоль, сахароза и крахмал; дезинтегрирующие средства, такие как крахмал, карбоксиметилцеллюлоза, гидроксипропилкрахмал, натрий гликоль крахмал, гидрокарбонат натрия, фосфат кальция и цитрат кальция; смазки, такие как стеарат магния, аэросил, тальк и лаурилсульфат натрия; вкусовые средства, такие как лимонная кислота, ментол, глицирризин аммониевая соль, глицин и апельсиновый порошок; консерванты, такие как бензоат натрия, гидросульфит натрия, метилпарабен и пропилпарабен; стабилизаторы, такие как лимонная кислота, цитрат натрия и уксусная кислота; суспендирующие агенты, такие как метилцеллюлоза, поливинилпирролидон и стеарат алюминия; диспергирующие агенты, такие как поверхностно-активные вещества; разбавители, такие как вода, физиологический раствор и апельсиновый сок; базисные воски, такие как масло какао, полиэтиленгликоль и керосин; и т.п., но вышеприведенные примеры не являются ограничивающими.

На путь введения лекарственного средства согласно настоящему изобретению ограничений нет, так, например, лекарственное средство согласно настоящему изобретению можно вводить перорально и парентерально.

Средства, пригодные для перорального введения, представляют собой раствор, получаемый путем растворения эффективного количества лиганда в разбавителе, таком как вода, физиологический раствор соли или апельсиновый сок; капсулы, пакетики или таблетки, содержащие эффективное количество лиганда в виде твердого вещества или гранул; суспензию, получаемую путем суспендирования эффективного количества активного ингредиента в соответствующем диспергирующем агенте; эмульсию, получаемую путем диспергирования и эмульгирования раствора эффективного количества активного ингредиента в соответствующем диспергирующем агенте; С10, стимулирующий абсорбцию водорастворимых веществ и т.п.

Лекарственное средство согласно настоящему изобретению по необходимости можно покрывать известным способом для маскировки вкуса, растворимости в кишечнике, замедленного высвобождения и т.п.. В качестве примеров покрывающих агентов, использующихся для покрывания, можно привести гидроксипропилметилцеллюлозу, этилцеллюлозу, гидроксиметилцеллюлозу, гидроксипропилцеллюлозу, полиоксиэтиленгликоль, Tween 80, Pluronic F-68, ацетат фталат целлюлозы, фталат гидроксипропилметилцеллюлозы, ацетатсукцинат гидроксиметилцеллюлозы, эудрагит (производство Rohm, Германия, сополимер метакриловой кислоты/акриловой кислоты), пигменты (например, красная окись железа, диоксид титана и т.п.) и т.п. Лекарственное средство может быть средством быстрого высвобождения или замедленного высвобождения.

В качестве лекарственных средств, пригодных для парентерального введения (например, внутривенное введение, подкожное введение, внутримышечное введение, местное введение, внутрибрюшинное введение, интраназальное введение и т.п.) доступны водные и не водные изотонические стерильные жидкости, пригодные для инъекций, которые могут содержать антиоксидант, буферный раствор, бактериостатический агент, изотонирующий агент и т.п. Также можно упомянуть водные и не водные стерильные суспензии, которые могут содержать суспендирующий агент, солюбилизатор, загуститель, стабилизатор, антисептик и т.п. Препарат может находиться в контейнере, таком как ампула или флакон, в объеме однократной дозировки или в нескольких разделенных дозировках. Активный ингредиент и фармацевтически приемлемый носитель также могут находиться в лиофилизированной форме, пригодные к растворению или суспендированию непосредственно перед употреблением.

Также пригодны препараты замедленного высвобождения. Лекарственные формы препаратов замедленного высвобождения включают замедленное высвобождение из носителей или контейнеров, внедренных в тело, таких как искусственные кости, биоразлагаемые основы или не биоразлагаемые губки, пакеты и т.п. Приспособления для постоянной или прерывистой, системной или местной подачи снаружи тела, такие как лекарственный насос и осмотический насос, также входят в препараты замедленного высвобождения. Биоразлагаемые основы включают липосомы, катионные липосомы, сополимеры полимолочной и полигликолиевой кислот (PLGA), атероколлаген, желатин, гидроксиапатит, полисахарид сизофиран.

Помимо жидких инъекций, суспензий и препаратов замедленного высвобождения, пригодны средства для ингаляций, пригодные для транспульмонального введения, мази, пригодные для чрескожного введения и т.п.

В случае средства для ингаляций, активный ингредиент в лиофилизированной форме микронизируют и вводят путем ингаляции с помощью пригодного прибора для ингаляций. В состав средства для ингаляций по необходимости могут входить общеупотребимые поверхностно-активное вещество, масло, вкусовое вещество, циклодекстрин или его производное и т.п. Средство для ингаляций может быть получено с помощью общеупотребимых способов. В частности, средство для ингаляций можно получить путем измельчения в порошок или сжижения аптамера или комплекса согласно настоящему изобретению, смешения с ингаляционным пропеллентом и/или носителем и заполнения подходящего сосуда для ингаляции. Если вышеописанный аптамер или комплекс согласно настоящему изобретению представляет собой порошок, может использоваться обычный механический ингалятор для порошков; в случае жидкости может использоваться ингалятор, такой как небулайзер. В таком случае в качестве пропеллента могут использоваться широко употребимые вещества; например, такие как соединения хлорфторкарбоновой серии, такие как хлорфторуглерод-11, хлорфторуглерод-12, хлорфторуглерод-21, хлорфторуглерод-22, хлорфторуглерод-113, хлорфторуглерод-114, хлорфторуглерод-123, хлорфторуглерод-142с, хлорфторуглерод-134а, хлорфторуглерод-227, хлорфторуглерод-С318 и 1,1,1,2-тетрафторэтан, углеводороды, такие как пропан, изобутан и n-бутан, эфиры, такие как диэтиловый эфир, сжатые газы, такие как газообразный азот и газообразный диоксид углерода и т.п.

В качестве примеров поверхностно-активного вещества можно привести олеиновую кислоту, лецитин, диэтиленгликоль диолеат, тетрагидрофлуфурил олеат, этилолеат, изопропил миристат, глицерил триолеат, глицерил монолаурат, глицерил моноолеат, глицерил моностеарат, глицерил монолизиноат, цетиловый спирт, стеариловый спирт, полиэтиленгликоль 400, цетилпиридин хлорид, сорбитан триолеат (торговая марка Span 85), сорбитан моноолеат (торговая марка Span 80), сорбитан монолаурат (торговая марка Span 20), полиоксиэтилен гидрогенизированное касторовое масло (торговая марка HCO-60), полиоксиэтилен (20) сорбитан монолаурат (торговая марка Tween 20), полиоксиэтилен (20) сорбитан моноолеат (торговая марка Tween 80), лецитин природного происхождения (торговая марка EPICLON), олеиловый эфир полиоксиэтилена (2) (торговая марка Brij 92), стеариловый эфир полиоксиэтилена (2) (торговая марка Brij 72), лауриловый эфир полиоксиэтилена (4) (торговая марка Brij 30), олеиловый эфир полиоксиэтилена (2) (торговая марка Genapol 0-020), блок-сополимер оксиэтилена и оксипропилена (торговая марка Synperonic) и т.п. В качестве примеров масла можно привести кукурузное масло, оливковое масло, хлопковое масло, подсолнечное масло и т.п. В случае мази, пригодную фармацевтически приемлемую основу (желтый вазелин, белый вазелин, парафин, Plastibase, силикон, белая мазь, пчелиный воск, лярд, растительные масла, гидрофильная мазь, гидрофильный вазелин, очищенный ланолин, гидролизованный ланолин, мазь, поглощающая воду, гидрофильный Plastibase, мазь на основе макрогола и т.п.) смешивают с аптамером согласно настоящему изобретению, который является активным ингредиентом и используют как препарат.

Доза лекарственного средства согласно настоящему изобретению варьирует в зависимости от вида и активности активного ингредиента, серьезности заболевания, биологического вида животного-субъекта введения, толерантности к лекарственному средству субъекта введения, веса, возраста, и т.д. Обычная дозировка из расчета количества активного ингредиента в день для взрослого может составлять от примерно 0,0001 до примерно 100 мг/кг, например, от примерно 0,0001 до примерно 10 мг/кг, предпочтительно от примерно 0,005 до примерно 1 мг/кг.

В настоящем изобретении также представлен твердофазный носитель, на котором иммобилизован аптамер или комплекс согласно настоящему изобретению. В качестве примеров твердофазного носителя можно привести субстрат, смолу, планшет (например, многолуночный планшет), фильтр, картридж, колонку и пористый материал. Субстрат может использоваться в ДНК-чипах, протеиновых чипах и т.п.; в качестве примеров можно привести субстраты на основе никеля-ПТФЭ (политетрафторэтилена), стеклянные субстраты, апатитовые субстраты, силиконовые субстраты, глиноземные субстраты и т.п. и субстраты, получаемые путем покрытия этих субстратом полимером и т.п. В качестве примеров смол можно привести агарозные частицы, кремниевые частицы, сополимер акриламида и N,N'-метиленбисакриламида, частицы из полистирена, поперечно сшитого с дивинилбензолом, частицы из декстрана, поперечно сшитого с эпихлоргидрином, целлюлозное волокно, поперечно сшитые полимеры арилдекстрана и N,N'-метиленбисакриламида, монодиспергированные синтетические полимеры, монодиспергированные гидрофильные полимеры, сефарозу, Toyopearl и т.д., а также смолы, полученные путем присоединения различных функциональных групп к этим смолам. Твердофазный носитель согласно настоящему изобретению может применяться, например, при очистке, детекции и количественном анализе химазы.

Аптамер и/или комплекс согласно настоящему изобретению можно иммобилизовать на твердофазном носителе известным способом. Например, может использоваться способ, при котором в аптамер и/или комплекс согласно настоящему изобретению вводят вещество, обладающее сродством (например, описанные выше) или определенная функциональная группа, и далее аптамер и/или комплекс согласно настоящему изобретению иммобилизуют на твердофазном носителе посредством вещества, обладающего сродством, или определенной функциональной группы. В настоящем изобретении также представлены подобные способы. Определенная функциональная группа может представлять собой функциональную группу, которая может образовывать связь; например, аминогруппа, тиоловая группа, гидроксильная группа или карбоксильная группа. В настоящем изобретении также представлен аптамер с введенной функциональной группой.

В настоящем изобретении также представлен способ очистки и концентрации химазы. В частности, с помощью настоящего изобретения возможно отделить химазу от белков других белковых семейств. Способ очистки и концентрации согласно настоящему изобретению может включать адсорбцию химазы на твердофазном носителе согласно настоящему изобретению и элюции химазы элюентом. Адсорбировать химазу на твердофазном носителе согласно настоящему изобретению возможно с помощью известного способа. Например, образец, содержащий химазу (например, культуру бактерий или клеток или культуральный супернатант, кровь) вводят в твердофазный носитель согласно настоящему изобретению или в содержащую его композицию. Химазу можно элюировать с помощью элюента, например, нейтрального раствора. Ограничений на выбор нейтрального элюента нет, pH элюента может равняться, например, от примерно 6 до примерно 9, предпочтительно от примерно 6,5 до примерно 8,5 и более предпочтительно от примерно 7 до примерно 8. Нейтральный раствор может также включать, например, мочевину, хелирующий агент (например, ЭДТА), соль натрия (например, NaCl), соль калия (например, KCl), соль магния (например, MgCl2), поверхностно-активное вещество (например, Tween 20, Triton, NP40) и глицерин. Способ очистки и концентрации согласно настоящему изобретению может далее включать промывку твердофазного носителя раствором для промывки после адсорбции химазы. Примеры растворов для промывки включают растворы, содержащие мочевину, хелирующий агент (например, ЭДТА), Tris, кислоту, щелочь, транспортную РНК, ДНК, поверхностно-активные вещества, такие как Tween 20, соли, такие как NaCl, и т.п. Способ очистки и концентрации согласно настоящему изобретению может также далее включать нагревание твердофазного носителя. Эта стадия обеспечивает регенерацию и стерилизация твердофазного носителя.

В настоящем изобретении также представлен способ детекции и количественного анализа химазы, в частности, настоящее изобретение делает возможными детекцию и количественный анализ химазы отдельно от белков других белковых семейств. Способ детекции и количественного анализа согласно настоящему изобретению может включать измерение концентрации химазы с использованием аптамера согласно настоящему изобретению (например, путем использования комплекса и твердофазного носителя согласно настоящему изобретению). Способ детекции и количественного анализа химазы можно выполнять так же, как и иммунологический способ, за исключением того, что вместо антитела используется аптамер согласно настоящему изобретению. Таким образом, с использованием аптамера согласно настоящему изобретению в качестве зонда вместо антитела можно выполнять детекцию и количественный анализ так же, как и при использовании таких способов, как иммуноферментный анализ (ИФА), (например, прямой конкурентный ELISA, непрямой конкурентный ELISA, сэндвич-ELISA), радиоиммунный анализ (РИА), флуоресцентный иммуноанализ (ФИА), вестерн-блот, способ иммуногистохимического окрашивания и способ сортинга клеток. Аптамер согласно настоящему изобретению также может использоваться в качестве молекулярного зонда для PET и т.п. Эти способы могут быть пригодными, например, для измерения содержания химазы в живых организмах или биологических образцах и для диагностики заболевания, ассоциированного с химазой.

Раскрытия во всех публикациях, упомянутых в настоящем документе, включая патенты и описания заявок на патенты, включены в настоящий документ полностью путем ссылки так же, как если бы каждая отдельная публикация была бы по отдельности включена в настоящий документ путем ссылки.

Далее в настоящем документе настоящее изобретение описано более детально с помощью нижеследующих Примеров, которые, однако, не ограничивают настоящее изобретение.

Примеры

Пример 1: Получение РНК-аптамеров, специфически связывающихся с химазой (1)

РНК-аптамеры, специфически связывающиеся с химазой, получали с помощью способа SELEX. SELEX проводили согласно усовершенствованному способу по Ellington et al. (Ellington and Szostak, Nature 346, 818-822, 1990) и способу Tuerk et al. (Tuerk and Gold, Science 249, 505-510, 1990). В качестве молекулы-мишени использовали химазу из кожи человека (производство Calbiochem), иммобилизированную на сефарозе 4 Fast Flow (производство GE Healthcare), активированной NHS. Иммобилизацию химазы на носителе проводили согласно инструкции GE Healthcare. Количество иммобилизованного белка подтверждали с помощью анализа раствора химазы до иммобилизации и супернатанта сразу после иммобилизации с помощью SDS-PAGE. В результате SDS-PAGE полосы, соответствующей химазе, в супернатанте обнаружено не было, что подтверждает, что практически вся использованная химаза оказалась связанной. Это означает, что примерно 167 пмоль химазы было иммобилизовано на примерно 3 мкл смолы.

РНК, используемую в первом раунде (40 нуклеотидов), получали путем транскрипции химически синтезированной ДНК с использованием набора реагентов для транскрипции DuraScribeTM T7 (производство Epicentre). В РНК, полученной данным способом, 2'-положение рибозы пиримидинового нуклеотида замещено фтором. В качестве ДНК-матрицы использовалась следующая молекула ДНК длиной 70 нуклеотидов, состоящая из случайной последовательности длиной 40 нуклеотидов и последовательностей праймеров на обоих ее концах. Используемые ДНК-матрицу и праймеры получали с помощью химического синтеза.

ДНК-матрица: 5'-GCGGCCGCTCTTCTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATTCCTACCGT-3' (SEQ ID NO: 1)

Прямой праймер: 5'-TAATACGACTCACTATAGGGACGGTAGGAATTC-3' (SEQ ID NO: 2)

Обратный праймер: 5'-GCGGCCGCTCTTCTATG-3' (SEQ ID NO: 3)

Последовательность из N, входящая в последовательность в составе ДНК-матрицы (SEQ ID NO:1) представляет собой 40 нуклеотидов (каждый представляет собой A, G, C или T) в любых комбинациях, что позволяет получить область последовательности, уникальную для каждого полученного аптамера. Прямой праймер содержит промоторную последовательность для РНК-полимеразы Т7. Вариация пула РНК, используемого в первом раунде, теоретически составляла 1014.

Пул РНК добавляли к химазе, иммобилизованной на носителе, и оставляли при комнатной температуре на 30 минут. Далее смолу промывали раствором А для удаления РНК, не связанной с химазой. Раствор А представлял собой смешанный раствор 145 мМ хлорида натрия, 5,4 мМ хлорида калия, 1,8 мМ хлорида кальция, 0,8 мМ хлорида магния и 20 мМ Tris. РНК, связанную с химазой, нагревали до 95°С в течение 10 минут в присутствии элюента - раствора В - и выделяли из супернатанта. Раствор В представлял собой смесь 7М мочевины, 3мМ ЭДТА и 100 мМ Tris-HCl (pH 6,6). Выделенную РНК амплифицировали с помощью RT-PCR, транскрибировали с помощью набора реагентов для транскрипции DuraScribeTM T7 и использовали в качестве пула для следующего раунда. Вышеописанную процедуру, называемую 1 раундом, повторяли несколько раз. После завершения SELEX продукт PCR клонировали в вектор pGEM-T Easy (производство Promega) и этим вектором трансфицировали штамм DH5α Escherichia coli (производство Toyobo). После выделения плазмиды из одной колоны, последовательность нуклеотидов клонов определяли с помощью ДНК-секвенатора (3130xl Genetic Analyzer, производство ABI).

После 8 раундов SELEX секвенировали последовательности 44 клонов; наблюдали конвергенцию последовательностей. Последовательности некоторых клонов представлены SEQ ID NO: 4-20. Среди этих последовательностей присутствовали 6 последовательностей, представленных SEQ ID NO: 4, 2 последовательности, представленных SEQ ID NO: 5, и 1 последовательность, представленная SEQ ID NO: 6-20. SEQ ID NO: 6 и 8 различаются всего на 1 нуклеотид. Последовательности SEQ ID NO: 4, 13 и 14 содержат общую последовательность, представленную SEQ ID NO: 21, присутствующую в 9 из 44 клонов. Вторичные структуры этих последовательностей предсказывали с помощью программы MFOLD (M. Zuker, Nucleic Acids Res. 31(13), 3406-3415, 2003); области, образованные общей последовательностью, имели сходную петлевую структуру. Предполагаемые вторичные структуры аптамеров с последовательностями, представленными SEQ ID NO: 4, 5, 12-14 и 18 приведены на фиг. 1, причем области, образованные общей последовательностью, обведены кружками.

Ниже приведены соответствующие нуклеотидные последовательности. Если не указано иначе, индивидуальные последовательности приведены в направлении от 5' к 3', причем пуриновые основания (A и G) находятся в форме 2'-OH, а пиримидиновые основания (U и С) в модифицированной форме 2'-F. Все нуклеотиды N1 и N2 в составе последовательностей означают любые нуклеотиды из A, G, C и U, а Х1 и Х2 оба означают А или оба означают G.

SEQ ID NO: 4:

GGGACGGUAGGAAUUCGUCCAUUCUACAGAUAGAGAUAAAGUAGAAUUUAACAAAACAUAGAAGAGCGGCCGC

SEQ ID NO: 5:

GGGACGGUAGGAAUUCCCACUUGUCUUUGAGGCAAGAAAUUGUAUUCCGAAGAAGCAUAGAAGAGCGGCCGC

SEQ ID NO: 6:

GGGACGGUAGGAAUUCUACGGUCUGUGUGAAAUUGAAACACACAAAGAACAAUAGACAUAGAAGAGCGGCCGC

SEQ ID NO: 7:

GGGACGGUAGGAAUUCACCUUUCCAAUUGUGAAAGAAACACAAAAAGAAAUGACAUCAUAGAAGAGCGGCCGC

SEQ ID NO: 8:

GGGACGGUAGGAAUUCUACGGUCUGUGUGAAAUUGAAACACACAAAGAACAAUAAACAUAGAAGAGCGGCCGC

SEQ ID NO: 9:

GGGACGGUAGGAAUUCCCGAAAAGCAACAAGCUUGCUAAAAUGAUUCCGAAAAAACACAUAGAAGAGCGGCCGC

SEQ ID NO: 10:

GGGACGGUAGGAAUUCCGCCGCCUAAAAAACGACGAUAUUACAGAAACGUCAAAUACAUAGAAGAGCGGCCGC

SEQ ID NO: 11:

GGGACGGUAGGAAUUCCCGACACGAAAUGUGUGAUUAAUUCCGAACAACAAAGUAACAUAGAAGAGCGGCCGC

SEQ ID NO: 12:

GGGACGGUAGGAAUUCGCCGUCAACGUUACAUAAUGUAUAUACCAGGGUAACUAAACAUAGAAGAGCGGCCGC

SEQ ID NO: 13:

GGGACGGUAGGAAUUCCGCAACCAUCCCGUAACUAUGGUUAGAUAGAGUUAAAAACCAUAGAAGAGCGGCCGC

SEQ ID NO: 14:

GGGACGGUAGGAAUUCUCGUUCCUGACAGCAUUUGAGAUAGAUUUAAACAAACGCACAUAGAAGAGCGGCCGC

SEQ ID NO: 15:

GGGACGGUAGGAAUUCCCAGAAAAUAAAUUCCGAAGAAAACAACAAUUUUUGCAAACAUAGAAGAGCGGCCGC

SEQ ID NO: 16:

GGGACGGUAGGAAUUCCCAUGACUGAAAAACGUCAGUAAAAUCCGAAAAUCAUAUCAUAGAAGAGCGGCCGC

SEQ ID NO: 17:

GGGACGGUAGGAAUUCCGUUCGCAGAAACGAACUUUUAAAAAAUGUACGUGGGAGCACAUAGAAGAGCGGCCGC

SEQ ID NO: 18:

GGGACGGUAGGAAUUCGAACGACAAAUUAUAGAACUUCGUUUGACAUUCCACACCACAUAGAAGAGCGGCCGC

SEQ ID NO: 19:

GGGACGGUAGGAAUUCCCACUGCAAUUCAGCAGAAAAAAUUCCGAAAAACACACACCAUAGAAGAGCGGCCGC

SEQ ID NO: 20:

GGGACGGUAGGAAUUCAAAAUCAGCUGAUUUGUAAUUUUUUUACACAGGCAAAACACAUAGAAGAGCGGCCGC

SEQ ID NO: 21:

X1GAUAGAN1N2UAAX2

По окончанию вышеописанных 8 раундов продолжали проводить SELEX в сходных условиях. По завершению 11 раунда секвенировали последовательности 93 клонов. Некоторые последовательности клонов представлены SEQ ID NO:22-27. Несколько последовательностей совпадали с некоторыми последовательностями, полученными после 8 раундов; были получены 22 последовательности, представленные SEQ ID NO:4, и 4 последовательности, представленные SEQ ID NO:14, что означает, что общая последовательность, представленная SEQ ID NO:21, сконцентрировалась. Также была получена 1 последовательность, представленная SEQ ID NO:5, 3 последовательности, представленные SEQ ID NO:22 и 2 последовательности, представленные SEQ ID NO: 23 и 24. Одна последовательность представлена SEQ ID NO:25-27. SEQ ID NO: 22 и 11 различались всего на 1 нуклеотид. SEQ ID NO:26 и 4 различались всего на 1 нуклеотид. Общая последовательность, представленная SEQ ID NO:21, присутствовала в 35 из 93 клонов. Из последовательностей, полученных после 11 раунда, последовательности, представленные SEQ ID NO:25 и 26, содержали общую последовательность, представленную SEQ ID NO:21. Предполагаемые вторичные структуры аптамеров с последовательностями, представленными SEQ ID NO:22-27, приведены на фиг. 2, причем области, образованные общей последовательностью, представленной SEQ ID NO: 21, обведены кружками. Все эти области имели характерную петлевую структуру, как и на фиг. 1.

Ниже приведены соответствующие нуклеотидные последовательности. Если не указано иначе, индивидуальные последовательности приведены в направлении от 5' к 3', причем пуриновые основания (A и G) находятся в форме 2'-OH, а пиримидиновые основания (U и С) в модифицированной форме 2'-F.

GGGACGGUAGGAAUUCCCGACACAAAAUGUGUGAUUAAUUCCGAACAACAAAGUAACAUAGAAGAGCGGCCGC

SEQ ID NO: 23:

GGGACGGUAGGAAUUCAUAUGUACUCCGUCCUGACAAAAUGUCAAUGACAAACGUUCAUAGAAGAGCGGCCGC

SEQ ID NO: 24:

GGGACGGUAGGAAUUCCCUUCAUAGUAGAAUGUUGGUUUCUACAAAAGCGACAAGCAUAGAAGAGCGGCCGC

SEQ ID NO: 25:

GGGACGGUAGGAAUUCAGCUGACUCCAAUGCACACGUAGAUAGAGUUAAAACGUUGCAUAGAAGAGCGGCCGC

SEQ ID NO: 26:

GGGACGGUAGGAAUUCGUCGAUUCUACAGAUAGAGAUAAAGUAGAAUUUAACAAAACAUAGAAGAGCGGCCGC

SEQ ID NO: 27:

GGGACGGUAGGAAUUCCGUCAUCGGUUGCAAAUUGAAAAUACAAAACAAGGACAACCAUAGAAGAGCGGCCGC

После вышеописанных 8 раундов SELEX, SELEX продолжали, используя в качестве молекулы-мишени химазу из кожи человека (производство Calbiochem), иммобилизированную на носителе - сефарозе 6 Fast Flow (производство GE Healthcare). Раствор химазы добавляли к носителю и оставляли при комнатной температуре на 30 минут, по истечению которых химаза была иммобилизована на носителе. Количество иммобилизованного белка подтверждали с помощью анализа раствора химазы до иммобилизации и супернатанта сразу после иммобилизации с помощью SDS-PAGE. В результате SDS-PAGE полосы, соответствующей химазе, в супернатанте обнаружено не было, что подтверждает, что практически вся использованная химаза оказалась иммобилизована. Это означает, что примерно 100 пмоль химазы было иммобилизовано на примерно 3 мкл смолы.

На 11 раунде пул клонировали и определяли последовательности 79 клонов. Последовательности некоторых из этих клонов представлены SEQ ID NO:28-34. Несколько последовательностей были идентичны последовательностям, полученным после вышеописанных 8 раундов; было получено 9 последовательностей, представленных SEQ ID NO:4, и 1 последовательность, представленная SEQ ID NO:19. Несколько последовательностей были идентичны последовательностям, полученных в результате вышеописанных 11 раундов; были получены 2 последовательности, представленные SEQ ID NO:27. Кроме того, были получены 4 последовательности, представленные SEQ ID NO:28, 2 последовательности, представленные SEQ ID NO:28, 2 последовательности, представленные SEQ ID NO:29 и 1 последовательность, представленная SEQ ID NO:30-34. SEQ ID NO:30 и 31 отличались всего на одно основание. SEQ ID NO:32 представляет собой последовательность, получающуюся при делеции одного основания в SEQ ID NO:31. Общая последовательность, представленная SEQ ID NO:21, присутствовала в 14 из 79 клонов. Из новых последовательностей, обнаруженных к 11 раунду, SEQ ID NO:30-32 и 34 содержали общую последовательность, представленную SEQ ID NO:21. Предполагаемые вторичные структуры аптамеров с последовательностями, представленными SEQ ID NO:28-34, приведены на фиг. 3, причем области, образованные общей последовательностью, представленной SEQ ID NO:21, обведены кружками. Все эти области, кроме клона, представленного SEQ ID NO:34, имели характерную петлевую структуру как на фиг. 1.

Ниже приведены нуклеотидные последовательности, представленные SEQ ID NO:28-34 соответственно. Если не указано иначе, индивидуальные последовательности приведены в направлении от 5' к 3', причем пуриновые основания (A и G) находятся в форме 2'-OH, а пиримидиновые основания (U и С) в модифицированной форме 2'-F.

SEQ ID NO: 28:

GGGACGGUAGGAAUUCAAUUUCUUUCUAUUCUCACCUGAGUAUAUCAGGCACAGUACAUAGAAGAGCGGCCGC

SEQ ID NO: 29:

GGGACGGUAGGAAUUCACGACCGCCCAAAAAAUGGUGACAUUUUAGAAACACCGAACAUAGAAGAGCGGCCGC

SEQ ID NO: 30:

GGGACGGUAGGAAUUCGUCCCUCUUGUCUAUUUUGCAGAUAGACUUAAAGCAAACAUAGAAGAGCGGCCGC

SEQ ID NO: 31:

GGGACGGUAGGAAUUCGUCCCUCAUGUCUAUUUUGCAGAUAGACUUAAAGCAAACAUAGAAGAGCGGCCGC

SEQ ID NO: 32:

GGGACGGUAGGAAUUCGUCCUCAUGUCUAUUUUGCAGAUAGACUUAAAGCAAACAUAGAAGAGCGGCCGC

SEQ ID NO: 33:

GGGACGGUAGGAAUUCCUGUCUUUUCCCACGCAACAAAUUACAGAGCUUUGCAAAACAUAGAAGAGCGGCCGC

SEQ ID NO: 34:

GGGACGGUAGGAAUUCUGCCGCAACCCAAUGAAAACGAAGAUAGAGAUAAAUCGAACAUAGAAGAGCGGCCGC

Активность связывания с химазой нуклеиновых кислот, представленных SEQ ID NO:4-20 и 22-34, определяли способом поверхностного плазмонного резонанса с использованием Biacore T100 (производство GE Healthcare). Используемый сенсорный чип представлял собой SA-чип, на котором был иммобилизован стрептавидин. К чипу было присоединено 1500 RU поли-dT длиной 16 нуклеотидов, к 5'-концу которого был присоединен биотин. На 3'-конце нуклеиновой кислоты-лиганда имелась цепочка поли-А длиной 16 нуклеотидов; посредством отжига Т и А лиганд иммобилизовывали на SA-чипе. Впрыскивали 20 мкл каждой нуклеиновой кислоты при скорости потока 20 мкл/мин и иммобилизовывали примерно 1000 RU нуклеиновой кислоты. Впрыскивали 20 мкл химазы в концентрации 0,2 мкМ в качестве анализируемого вещества. В качестве электродного буфера использовали раствор А.

Было обнаружено, что все исследованные последовательности способны связываться с химазой (табл. 1). Однако у пула нуклеиновых кислот (40N), используемого в 1 раунде, содержащего случайную последовательность, используемую в качестве отрицательного контроля, также была обнаружена слабая способность связываться с химазой. Таким образом, в таблице 1 аптамеры с более сильной активностью связывания, чем 40N, отмечены «++», а аптамеры с эквивалентной активностью связывания по сравнению с 40N отмечены «+». Сенсограмма, показывающая, как аптамеры, представленные SEQ ID NO:12 и 13, связывались с химазой, приведена на фиг. 4.

Вне зависимости от присутствия или отсутствия общей последовательности, представленной SEQ ID NO:21, у некоторых последовательностей наблюдалась повышенная активность связывания по сравнению с 40N. У SEQ ID NO: 4, 13, 14, 25, 26 и 30, включающих общую последовательность, наблюдалась повышенная активность связывания по сравнению с 40N, в то время как у SEQ ID NO: 31, 32 и 34, содержащих ту же общую последовательность, наблюдалась активность связывания, эквивалентная активности связывания 40N. Было обнаружено, что N1N2, содержащиеся в последовательности SEQ ID NO:21, могут представлять собой GA, GU, UU или CU, а X1 и X2, содержащиеся в последовательности SEQ ID NO:21, могут оба представлять собой А.

Таблица 1
Активность связывания химазы
SEQ ID NO: Длина Активность связывания по данным Biacore
4 73 ++
5 72 ++
67 73 ++
8 73 ++
9 74 ++
10 73 ++
11 73 ++
12 73 ++
13 73 ++
14 73 ++
15 73 ++
16 72 ++
17 74 ++
18 73 ++
19 73 ++
20 73 +
22 73 +
23 73 ++
24 72 ++
25 73 ++
26 73 ++
27 73 ++
28 73 +
29 73 ++
30 71 ++
31 71 +
32 70 +
33 73 +
34 73 +
«++» обозначает последовательность, связывающуюся с химазой значительно сильнее отрицательного контроля 40N, «+» означает последовательность, связывающуюся с химазой эквивалентно отрицательному контролю 40N. В данном случае 40N означает пул нуклеиновых кислот, использованный в 1 раунде, включающий случайную последовательность из 40 нуклеотидов

Пример 2: Получение РНК-аптамеров, специфически связывающихся с химазой (2)

SELEX проводили так же, как в Примере 1, однако в качестве матрицы использовали случайную последовательность длиной 30 нуклеотидов и последовательности праймеров, отличающиеся от использованных в Примере 1. Молекулой-мишенью, использовавшейся в SELEX, была химаза (рекомбинантый, производство Sigma) иммобилизованная на носителе Sepharose 4 Fast Flow (производство GE Healthcare), активированной NHS. Последовательности матрицы и праймеров приведены ниже. ДНК-матрица и праймеры получали с помощью химического синтеза.

ДНК-матрица: 5'-TCACACTAGCACGCATAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCTGACCTCTCTCCTGCTCCC-3' (SEQ ID NO: 35)

Прямой праймер: 5'-TAATACGACTCACTATAGGGAGCAGGAGAGAGGTCAGATG-3' (SEQ ID NO: 36)

Обратный праймер: 5'-TCACACTAGCACGCATAGG-3' (SEQ ID NO: 37)

Последовательность N в составе ДНК-матрицы (SEQ ID NO:35) означает 30 нуклеотидов в любых комбинациях (30N, где каждый N представляет собой A, G, C или T), что позволяет получить уникальную последовательность для каждого полученного аптамера. Прямой праймер содержит промоторную последовательность для РНК-полимеразы Т7. Вариация РНК-пула, использованного в первом раунде, теоретически представляла собой 1014.

Пул РНК добавляли к носителю с иммобилизованной на нем химазой и оставляли при комнатной температуре на 30 минут, после чего промывали смолу раствором С для удаления РНК, не связанной с химазой. Раствор С представлял собой смешанный раствор, содержащий 145 мМ хлорида натрия, 5,4 мМ хлорида калия, 1,8 мМ хлорида кальция, 0,8 мМ хлорида магния, 20 мМ Tris (pH 7,6) и 0,05% Tween 20. РНК, связанную с химазой, выделяли путем добавления элюента - раствора D - и перемешивания раствора при комнатной температуре в течение 10 минут. Раствор D готовили путем добавления 6М гуанидина гидрохлорида к раствору С до pH=7,6. Элюцию проводили в три цикла. Выделенную РНК амплифицировали с помощью RT-PCR и переносили с использованием набора реагентов для транскрипции DuraScribeTM T7 для использования в качестве пула в следующем раунде. Каждый раунд, состоящий из этих стадий, повторяли несколько раз. После завершения SELEX продукт PCR клонировали в вектор pGEM-T Easy vector (производство Promega) и этим вектором трансформировали штамм DH5α (производство Toyobo) Escherichia coli. После выделения плазмиды из одной колонии клоны секвенировали с использованием секвенатора ДНК (3130xl Genetic Analyzer, производство ABI).

По завершению 8 раундов SELEX определяли последовательности; конвергенции последовательностей не наблюдалось. Добавляли 2 мг/мл гепарина в качестве конкурирующего агента и продолжали SELEX до 11 раунда. Определяли последовательность 40 клонов, у которых наблюдалась конвергенция последовательностей; было обнаружено, что последовательности всех 40 клонов содержат общую последовательность, представленную SEQ ID NO:21. Последовательности некоторых их этих клонов представлены SEQ ID NO: 38-48. Было обнаружено 6 последовательностей, представленных SEQ ID NO:38, 2 последовательности, представленных SEQ ID NO:39 и 1 последовательность, представленная SEQ ID NO: 40-48.

Предполагаемые вторичные структуры аптамеров с последовательностями, представленными SEQ ID NO:38-40, 43 и 48, приведены на фиг. 5, причем все области, образованные общей последовательностью, представленной SEQ ID NO:21, обведены кружками. В многих этих областях общая последовательность, представленная SEQ ID NO:21, образовывала характерную петлевую структуру, подобную приведенной на фиг. 1.

Ниже приведены нуклеотидные последовательности, представленные SEQ ID NO:38-48 соответственно. Если не указано иначе, индивидуальные последовательности приведены в направлении от 5' к 3', причем пуриновые основания (A и G) находятся в форме 2'-OH, а пиримидиновые основания (U и С) в модифицированной форме 2'-F.

SEQ ID NO: 38:

GGGAGCAGGAGAGAGGUCAGAUGGAUAGAGUUAAGAUCUGGCUGGCGCAUUAGCCUAUGCGUGCUAGUGUGA

SEQ ID NO: 39:

GGGAGCAGGAGAGAGGUCAGAUGGUUACGGAUAGAGUUAAGGUAACGGUACGGCCUAUGCGUGCUAGUGUGA

SEQ ID NO: 40:

GGGAGCAGGAGAGAGGUCAGAUGAACGGAUAGAGCUAAGAGUUCGUCAGAGGGGCCUAUGCGUGCUAGUGUGA

SEQ ID NO: 41:

GGGAGCAGGAGAGAGGUCAGAUGGUGAGAUAGAGUUAAACACCACAAUAGUAGCCUAUGCGUGCUAGUGUGA

SEQ ID NO: 42:

GGGAGCAGGAGAGAGGUCAGAUGCGUGAUCGUGCAAGGCGGAUAGAGUUAAGGCCUAUGCGUGCUAGUGUGA

SEQ ID NO: 43:

GGGAGCAGGAGAGAGGUCAGAUGAUGCCAAGAUAGAUUUAAAUGGCGUUUGGGCCUAUGCGUGCUAGUGUGA

SEQ ID NO: 44:

GGGAGCAGGAGAGAGGUCAGAUGUUAGACCAAAGCAUAGGAGAUAGAGUUAAACCUAUGCGUGCUAGUGUGA

SEQ ID NO: 45:

GGGAGCAGGAGAGAGGUCAGAUGGACCACCGAUGGGCAAGAUAGAGUUAAAUGCCUAUGCGUGCUAGUGUGA

SEQ ID NO: 46:

GGGAGCAGGAGAGAGGUCAGAUGGGACAGAUAGAGUUAAAGUCCGUUACGUGGCCUAUGCGUGCUAGUGUGA

SEQ ID NO: 47:

GGGAGCAGGAGAGAGGUCAGAUGGUGAUAGAUAGAGUUAAAAUCGCUGAAUGGCCUAUGCGUGCUAGUGUGA

SEQ ID NO: 48:

GGGAGCAGGAGAGAGGUCAGAUGUGAAGAUAGAGAUAAAUCACAUACAGUCGGCCUAUGCGUGCUAGUGUGA

Активность связывания с химазой нуклеиновых кислот, представленных SEQ ID NO:38-48, оценивали способом поверхностного плазмонного резонанса. При оценке SEQ ID NO:38-48 измерения проводили аналогично Примеру 1. В качестве электродного буфера использовали раствор C. Результаты измерений приведены в таблице 2.

Нуклеиновые кислоты, представленные SEQ ID NO:38-48 оказались аптамерами, способными специфично связываться с химазой значительно сильнее, чем 30N. Было обнаружено, что X1 и X2, содержащиеся в общей последовательности SEQ ID NO:21, могут оба представлять собой А или оба представлять собой G, а N1N2, содержащиеся в общей последовательности, могут представлять собой GU, GC, GA или UU.

Таблица 2
Активность связывания с химазой
SEQ ID NO: Длина Активность связывания по данным Biacore
38 72 ++
39 72 ++
40 73 ++
41 72 ++
42 72 ++
43 72 ++
44 72 ++
45 72 ++
46 72 ++
47 72 ++
48 72 ++
«++» означает последовательность, связывающуюся с химазой значительно сильнее, чем отрицательный контроль 30N. В данном случае 30N означает пул нуклеиновых кислот, использованный в 1 раунде, содержащий случайную последовательность длиной 30 нуклеотидов

Пример 3: Определение активности ингибирования химазы с использованием синтетического субстрата.

Определяли способность нуклеиновых кислот, представленных SEQ ID NO: 4-20, 22-34 и 38-48 ингибировать ферментативную активность химазы как описано ниже. В качестве субстрата химазы использовали Suc-Ala-Ala-Pro-Phe-MCA (производство Peptide Institute, Inc.), содержащий пептид из 4 аминокислот Ala-Ala-Pro-Phe - стандартный субстрат для химотрипсин-подобных протеаз. В данном случае Suc означает защитную сукциниловую группу, а MCA означает метилкумарил-7-амидную группу; после расщепления по С-концу фенилаланина высвобождается AMC (7-амино-4-метилкумарин). Ферментативную активность химазы можно определить путем детекции флуоресценции высвобожденного AMC. Тест проводили с использованием 96-луночного планшета (F16 Black Maxisorp Fluoronunc, производство Nunc), в объеме реакционной смеси 100 мкл, в растворе С в качестве буферного раствора. Вначале каждую нуклеиновую кислоту серийно разводили в растворе С для получения 50 мкл растворов с концентрацией 0.0027-2 мкМ. Далее к этому раствору добавляли 10 мкл 1мМ раствора субстрата в растворе С, планшет помещали в ридер микропланшетов SpectraMax190 (производство Molecular Devices Corporation) и инкубировали при 37°С в течение 5 минут. Раствор химазы добавляли к смеси нуклеиновой кислоты и субстрата для начала ферментативной реакции. Конечная концентрация химазы в реакционной смеси составляла 16,7 нМ (или 1,67 нМ), а конечная концентрация субстрата составляла 100 мкМ. Планшет, содержащий реакционную смесь, помещали в ридер микропланшетов SpectraMax190 (производство Molecular Devices Corporation). Наблюдали изменения интенсивности флуоресценции в зависимости от времени при 37°С в течение 5 минут (или 30 минут) (возбуждение при длине волны 380 нм, детекция при длине волны 460 нм). Строили линейную аппроксимацию усиления флуоресценции AMC, высвобождаемого из субстрата активностью химазы, и ее наклон принимали за начальную скорость (Vmax). Для контроля аналогично обрабатывали и анализировали образцы в двух случаях: при использовании пула нуклеиновых кислот 30N или 40N (нуклеотид из 30 или 40 последовательных оснований, обозначаемых N; N может представлять A, G, C или T) (отрицательный контроль) и использовании химостатина, известного ингибитора химотрипсин-подобных сериновых протеаз (положительный контроль). Принимая начальную скорость реакции без нуклеиновой кислоты и ингибитора (V0) за 100% активность фермента, степень ингибирования реакции каждым анализируемым веществом рассчитывали по следующей формуле:

Степень ингибирования (%)=(1-Vmax/V0)Ч100

Определяли концентрацию ингибитора, необходимую для достижения 50% ингибирования ферментативной активности (IC50). Результаты приведены в таблице 3.

Таблица 3
Активность ингибирования химазы (IC50)
«>0,5» указывает, что при концентрации до 0,5 мкМ ингибиторной активности не наблюдалось. Каждая величина IC50 представляет собой среднее по 2 или 3 измерениям.

У отрицательного контроля 30N или 40N не наблюдалось ингибиторной активности (IC50>0,5 мкМ). Величина IC50 положительного контроля (химостатина) составляла 0,1-0,2 мкМ.

По итогам результатов, у многих аптамеров, перечисленных в таблице 3, наблюдалась активность ингибирования химазы. В частности, прекрасный ингибиторный эффект продемонстрировали аптамеры со значениями IC50 0,1 мкМ или менее. Все аптамеры, содержащие общую последовательность, представленную SEQ ID NO:21, обладали ингибиторной активностью. Эти данные показывают, что X1 и X2, содержащиеся в обей последовательность, могут оба представлять собой А или оба представлять собой G, а N1N2 могут представлять собой любую комбинацию из GA, GU, GC, UU и CU.

Пример 4: Укорочение аптамера

Укорачивали аптамеры, представленные SEQ ID NO: 4, 12, 13 и 14. Аптамеры, представленные в SEQ ID NO:4, 13 и 14, содержат общую последовательность, представленную SEQ ID NO:21. SEQ ID NO:12 представляет собой аптамер, не содержащий общую последовательность. Последовательности укороченных аптамеров представлены SEQ ID NO:49-57. Предполагаемые вторичные структуры аптамеров, представленных в SEQ ID NO:49, 51 и 55-57, приведены на фиг.6, причем области, образованные общей последовательностью, представленной SEQ ID NO:21, обведены кружками.

Ниже приведены нуклеотидные последовательности, представленные в SEQ ID NO:49-57 соответственно. Если не указано иначе, индивидуальные последовательности приведены в направлении от 5' к 3', причем пуриновые основания (A и G) находятся в форме 2'-OH, а пиримидиновые основания (U и С) в модифицированной форме 2'-F.

SEQ ID NO: 49:

(последовательность, полученная путем укорочения клона, представленного SEQ ID NO:4, до длины 29 нуклеотидов, включая общую последовательность)

GGUUCUACAGAUAGAGAUAAAGUAGAACC

SEQ ID NO: 50:

(последовательность, полученная путем укорочения клона, представленного SEQ ID NO:4, до длины 35 нуклеотидов, включая общую последовательность)

GGCAUUCUACAGAUAGAGAUAAAGUAGAAUUUAAC

SEQ ID NO: 51:

(последовательность, полученная путем укорочения клона, представленного SEQ ID NO:12, до длины 45 нуклеотидов)

CGUUACAUAAUGUAUAUACCAGGGUAACUAAACAUAGAAGAGCGG

SEQ ID NO: 52:

(последовательность, полученная путем укорочения клона, представленного SEQ ID NO:12, до длины 26 нуклеотидов)

CCGUAUAUACCAGGGUAACUAAACGG

SEQ ID NO: 53:

(последовательность, полученная путем укорочения клона, представленного SEQ ID NO:13, до длины 42 нуклеотида, включая общую последовательность)

GGGUAACUAUGGUUAGAUAGAGUUAAAAACCAUAGAAGACCC

SEQ ID NO: 54:

(последовательность, полученная путем укорочения клона, представленного SEQ ID NO:13, до длины 36 нуклеотидов, включая общую последовательность)

UAACUAUGGUUAGAUAGAGUUAAAAACCAUAGAAGA

SEQ ID NO: 55:

(последовательность, полученная путем укорочения клона, представленного SEQ ID NO:13, до длины 29 нуклеотидов, включая общую последовательность)

CUAUGGUUAGAUAGAGUUAAAAACCAUAG

SEQ ID NO: 56:

(последовательность, полученная путем укорочения клона, представленного SEQ ID NO:13, до длины 23 нуклеотида, включая общую последовательность)

GGGUUAGAUAGAGUUAAAAACCC

SEQ ID NO: 57:

(последовательность, полученная путем укорочения клона, представленного SEQ ID NO:14, до длины 27 нуклеотидов, включая общую последовательность)

GCAUUUGAGAUAGAUUUAAACAAACGC

Все нуклеиновые кислоты SEQ ID NO: 49-57 были получены путем химического синтеза.

Связывание с химазой этих нуклеиновых кислот оценивали способом поверхностного плазмонного резонанса. Анализ проводили с использованием Biacore T100 (производство GE Healthcare) как описано ниже. Около 4000 RU химазы (рекомбинантный белок производства Sigma) иммобилизовывали на поверхности сенсорного чипа CM5 с использованием набора реагента для связывания амина. В качестве анализируемого вещества вводили 20 мкл раствора каждой нуклеиновой кислоты с концентрацией 0,3 мкМ при скорости потока 20 мкл/мин. В качестве электродного буфера использовали раствор С. Результаты анализа приведены в таблице 4. Способ оценки аналогичен используемому в Примере 1.

В результате анализа было показано, что все нуклеиновые кислоты за исключением SEQ ID NO:52 являются аптамерами, способными связываться с химазой значительно более сильно, чем контроль 40N (табл. 4). Сенсограмма, показывающая, как аптамеры, представленные SEQ ID NO:13, 55 и 56, связываются с химазой, приведена на фиг. 7.

Активность ингибирования химазы определяли аналогично Примеру 3. Соответствующие величины IC50 приведены в таблице 4.

Нуклеиновые кислоты за исключением SEQ ID NO:52 обладали сильной ингибиторной активностью (табл. 4). Результаты для SEQ ID NO:51 и SEQ ID NO:52 показывают, что аптамер, представленный SEQ ID NO:12, не содержащий общей последовательности, сохранял свою активность при укорочении до 45 нуклеотидов и терял свою активность при укорочении до 26 нуклеотидов.

В то же время результаты для SEQ ID NO:56 показывают, что аптамер, представленный SEQ ID NO:13, содержащий общую последовательность, может быть укорочен до 23 нуклеотидов. Это показывает, что общая последовательность, представленная SEQ ID NO:21, является критической для активности связывания и ингибирования химазы.

Поскольку у SEQ ID NO:49 и 57 также наблюдалась ингибиторная активность, было показано, что N1N2, содержащиеся в общей последовательности, не ограничиваются GU, и что не существует ограничений на последовательность, содержащуюся в стеблевой структуре SEQ ID NO: 56 на фиг. 6 при условии сохранения стеблевой структуры.

Таким образом, эти аптамеры пригодны в качестве ингибиторов химазы.

Таблица 4
Активность связывания и ингибирования химазы (IC50)
SEQ ID NO: ID-номер последовательности родительского клона Длина Активность связывания по данным Biacore IC50 (мкМ)
49 4 29 ++ 0,117±0,066
50 4 35 ++ 0,138±0,093
51 12 45 ++ 0,024±0,009
52 12 26 + >1
53 13 42 ++ 0,066±0,024
54 13 36 ++ 0,051±0,03
55 13 29 ++ 0,055±0,023
56 13 23 ++ 0,046±0,031
57 14 27 ++ 0,09±0,013
«++» означает последовательность, связывающуюся с химазой значительно более сильно, чем отрицательный контроль 40N. «+» означает последовательность, связывающуюся с химазой эквивалентно отрицательному контролю 40N. В данном случае 40N означает пул нуклеиновых кислот, используемый в 1 раунде примера 1, содержащий случайную последовательность из 40 нуклеотидов. «>1» указывает, что при концентрации до 1 мкМ ингибиторной активности не наблюдалось. Каждая величина IC50 представляет собой среднее по 2 или 3 измерениям.

У отрицательного контроля 40N не наблюдалось ингибиторной активности при концентрация до 1 мкМ (IC50>1 мкМ). Величина IC50 положительного контроля (химостатина) составляла 0,1-0,2 мкМ.

Из полученных результатов видно, что нуклеиновые кислоты, перечисленные в таблице 4, за исключением SEQ ID NO: 52 обладали активностью ингибирования химазы. В частности, прекрасный ингибиторный эффект продемонстрировали нуклеиновые кислоты со значениями IC50 0,1 мкМ или менее.

Пример 5: Эффект замены, делеции основания (оснований) укороченного аптамера.

В аптамер, представленный SEQ ID NO:56, вводили мутацию или делецию и исследовали влияние на активность связывания и ингибирования. Последовательности представлены SEQ ID NO:58-68.

Ниже приведены нуклеотидные последовательности соответствующих аптамеров, представленные SEQ ID NO:58-68. Если не указано иначе, индивидуальные последовательности приведены в направлении от 5' к 3', модификация 2'-положения рибозы (например, U(F) обозначает модификацию 2'-положения рибозы урацила F) указана в скобках, а F представляет собой атом фтора.

SEQ ID NO: 58:

(последовательность, содержащая расположенные случайным образом 13 нуклеотидных оснований, содержащихся в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)GAAGAU(F)AU(F)U(F)AAAGAAC(F)C(F)C(F)

SEQ ID NO: 59:

(последовательность, у которой заменен N2, содержащийся в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AGAGAU(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 60:

(последовательность, у которой заменен N2, содержащийся в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AGAGC(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 61:

(последовательность, у которой заменен N1, содержащийся в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AGAU(F)U(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 62:

(последовательность, у которой заменены Х1 и Х2, содержащиеся в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)GGAU(F)AGAGU(F)U(F)AAGAAC(F)C(F)C(F)

SEQ ID NO: 63:

(последовательность, у которой заменена последовательность оснований, содержащаяся в клоне, представленном SEQ ID NO:56, кроме общей последовательности)

GC(F)U(F)AC(F)AGAU(F)AGAGU(F)U(F)AAAGU(F)AGC(F)

SEQ ID NO: 64:

(последовательность, у которой заменена последовательность оснований, содержащаяся в клоне, представленном SEQ ID NO:56, кроме общей последовательности)

GU(F)C(F)AC(F)AGAU(F)AGAGU(F)U(F)AAAGU(F)GAC(F)

SEQ ID NO: 65:

(последовательность, у которой частично заменена и частично делетирована последовательность оснований, содержащаяся в клоне, представленном SEQ ID NO:56, кроме общей последовательности)

GGC(F)AGAU(F)AGAGU(F)U(F)AAAGC(F)C(F)

SEQ ID NO: 66:

(последовательность, у которой пуриновое основание, содержащееся в общей последовательности клона, представленного SEQ ID NO: 56, заменено на пиримидиновое основание)

GGGU(F)U(F)AGAU(F)CGAGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 67:

(последовательность, у которой пуриновое основание, содержащееся в общей последовательности клона, представленного SEQ ID NO: 56, заменено на пиримидиновое основание)

GGGU(F)U(F)AGAU(F)ACAGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 68:

(последовательность, у которой пуриновое основание, содержащееся в общей последовательности клона, представленного SEQ ID NO: 56, заменено на пиримидиновое основание)

GGGU(F)U(F)AGAU(F)AGUGU(F)U(F)AAAAAC(F)C(F)C(F)

Все нуклеиновые кислоты SEQ ID NO: 58-68 были получены путем химического синтеза. Связывание этих нуклеиновых кислот с химазой оценивали способом поверхностного плазмонного резонанса аналогично Примеру 4. Активность ингибирования химазы определяли аналогично Примеру 3. Результаты приведены в таблице 5.

Было обнаружено, что из нуклеиновых кислот, приведенных в таблице 5, нуклеиновые кислоты, представленные SEQ ID NO: 59-65 сохраняли большую силу связывания и высокую ингибиторную активность.

Поскольку активность связывания и ингибирования у SEQ ID NO: 58 снизилась до практически того же уровня, что у 40N/30N, использованных в Примерах 1 и 2, было показано, что общая последовательность, представленная SEQ ID NO:21, важна для активности связывания и ингибирования химазы. Исходя из этих результатов, SEQ ID NO:58 использовали в качестве отрицательного контроля к укороченным аптамерам в нижеследующих Примерах (Примеры 5-9).

По результатам для SEQ ID NO:59-61 было показано, что N1 и N2, содержащиеся в общей последовательности, могут представлять собой любые нуклеотиды, но предпочтительно представляют собой GU, GA, GC и UU. По результатам для SEQ ID NO:62, было показано, что X1 и X2 могут представлять собой любые нуклеотиды, но предпочтительно представляют собой A и G, более предпочтительно оба представляют собой А или оба представляют собой G.

По результатам для SEQ ID NO: 63-65 было показано, что последовательность пар оснований стеблевой структуры, содержащейся в последовательности (например SEQ ID NO 56 на фиг. 6), может быть включать любые нуклеотиды при условии сохранения стеблевой структуры, а ее длина предпочтительно представляет 3 пары оснований или более.

По результатам для SEQ ID NO: 66-68 еще раз была показана важность общей последовательности, поскольку введение мутаций в общую последовательность снижает активность.

Таблица 5
Активность связывания химазы и активность ингибирования химазы (IC50). Для активности связывания «++» означает значительно более сильное связывание, чем у SEQ ID NO:58, служащего отрицательным контролем, а «+» - уровень связывания, сходный с SEQ ID NO: 58, служащего отрицательным контролем. Для ингибиторной активности «>1» указывает, что при концентрации до 1 мкМ ингибиторной активности не наблюдалось.
SEQ ID NO: Активность связывания по данным Biacore IC50 [мкМ]
58 + >1
59 ++ 0,038±0,009
60 ++ 0,026±0,006
61 ++ 0,023±0,006
62 ++ 0,029±0,004
63 ++ 0,023±0,003
64 ++ 0,020±0,005
65 ++ 0,056±0,046
66 + >1
67 + >1
68 + >1

Каждая величина IC50 представляет собой среднее по 2 измерениям.

У SEQ ID NO:58 не наблюдалось ингибиторной активности при концентрациях до 1 мкМ (IC50>1 мкМ). Кроме того, величина IC50 для химостатина (положительного контроля) составляла 0,1-0,2 мкМ. Из вышеприведенных результатов становится ясно, что среди аптамеров, приведенных в таблице 5, аптамеры, представленные SEQ ID NO:59-65 обладают сильной активностью ингибирования химазы (IC50<0,1 мкМ).

Пример 6: изменение укороченного аптамера - 1

Для повышения устойчивости к нуклеазам аптамера, представленного SEQ ID NO:56, были получены измененный аптамер с модифицированным концом, измененный аптамер, в котором 2'-положение рибозы пуринового основания в составе последовательности модифицировано О-метильной группой или F и измененный аптамер с введенным фосфоротиоатом. Их последовательности представлены SEQ ID NO: 56(1)-56(14), 56(17)-56(19). Кроме того, получали измененный аптамер, в котором модификация пиримидинового нуклеотида, содержащегося в общей последовательности аптамера, представленного SEQ ID NO: 56 (2'-F, модификация 2-положения рибозы F) заменена на исходный тип (2'-ОН), и оценивали необходимость модификации. Последовательности этих аптамеров представлены SEQ ID NO: 56(15), 56(16).

Ниже приведены соответствующие нуклеотидные последовательности. Если не указано иначе, соответствующие последовательности, приведенные ниже, приведены в направлении от 5' к 3', модификация 2'-положения рибозы указана в скобках, F означает атом фтора, а М означает О-метильную группу. На соответствующих концах последовательностей idT означает модификацию инвертированным dT, а PEG означает модификацию разветвленным полиэтиленгликолем с молекулярной массой 40 кДа. S в последовательностях означает фосфоротиоацию фосфатной группы между нуклеотидами.

SEQ ID NO: 56(1):

(последовательность, в которой оба конца клона, представленного SEQ ID NO:56, модифицированы idT)

idT-GGGU(F)U(F)AGAU(F)AGAGU(F)U(F)AAAAAC(F)C(F)C(F)-idT

SEQ ID NO: 56(2):

(последовательность, в которой модифицировано 3 положения в последовательности за исключением общей последовательности клона, представленного SEQ ID NO:56)

G(M)G(M)G(M)U(F)U(F)AGAU(F)AGAGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(3):

(последовательность, в которой модифицировано 2 положения в последовательности за исключением общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AGAGU(F)U(F)AAAA(M)A(M)C(F)C(F)C(F)

SEQ ID NO: 56(4):

(последовательность, в которой модифицировано 1 положение в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)A(M)GAGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(5):

(последовательность, в которой модифицировано 2 положения в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AGAGU(F)U(F)A(M)A(M)AAAC(F)C(F)C(F)

SEQ ID NO: 56(6):

(последовательность, в которой модифицировано 1 положение в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AG(M)AU(F)AGAGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(7):

(последовательность, в которой модифицировано 1 положение в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGA(M)U(F)AGAGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(8):

(последовательность, в которой модифицировано 1 положение в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AG(M)AGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(9):

(последовательность, в которой модифицировано 1 положение в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AGA(M)GU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(10):

(последовательность, в которой модифицировано 1 положение в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)A(M)GAU(F)AGAGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(11):

(последовательность, в которой модифицировано 1 положение в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AGAGU(F)U(F)AAA(M)AAC(F)C(F)C(F)

SEQ ID NO: 56(12):

(последовательность, в которой модифицировано 1 положение в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AGAG(M)U(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(13):

(последовательность, в которой модифицировано 1 положение в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AG(F)AGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(14):

(последовательность, в которой модифицировано 1 положение в общей последовательности клона, представленного SEQ ID NO:56)

GGGU(F)U(F)AGAU(F)AGA(F)GU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(15):

(последовательность, в которой 9 нуклеотид U(F) клона, представленного SEQ ID NO:56, заменен на U)

GGGU(F)U(F)AGAUAGAGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(16):

(последовательность, в которой 15 нуклеотид U(F) клона, представленного SEQ ID NO:56, заменен на U)

GGGU(F)U(F)AGAU(F)AGAGU(F)UAAAAAC(F)C(F)C(F)

SEQ ID NO: 56(17):

(последовательность, в которой концы клона, представленного SEQ ID NO:56, модифицированы PEG и idT)

PEG-GGGU(F)U(F)AGAU(F)AGAGU(F)U(F)AAAAAC(F)C(F)C(F)-idT

SEQ ID NO: 56(18):

(последовательность, в которой одна фосфатная группа в общей последовательности клона, представленного SEQ ID NO:56, фосфоротиоирована)

GGGU(F)U(F)sAGAU(F)AGAGU(F)U(F)AAAAAC(F)C(F)C(F)

SEQ ID NO: 56(19):

(последовательность, в которой одна фосфатная группа в общей последовательности клона, представленного SEQ ID NO:56, фосфоротиоирована)

GGGU(F)U(F)AsGAU(F)AGAGU(F)U(F)AAAAAC(F)C(F)C(F)

Все нуклеиновые кислоты SEQ ID NO: 56(1)-56(19) были получены путем химического синтеза. Связывание с химазой этих нуклеиновых кислот оценивали способом поверхностного плазмонного резонанса аналогично Примеру 4. Результаты измерений приведены в таблице 6.

Было обнаружено, что нуклеиновые кислоты за исключением SEQ ID NO: 56(8), 56(10), 56(13), 56(14), обладали значительно большей активностью связывания с химазой, чем отрицательный контроль SEQ ID NO:58.

Активность ингибирования химазы измеряли аналогично Примеру 3. Величины IC50 приведены в таблице 6. Было обнаружено, что нуклеиновые кислоты за исключением SEQ ID NO: 56(8), 56(10), 56(13), 56(14), обладали активностью ингибирования химазы, однако уровень ингибиторной активности различался. При сравнении величин IC50 видно, что ингибиторная активность SEQ ID NO: 56(1)-56(7), 56(11), 56(12) сохранялась практически на том же уровне, что и SEQ ID NO:56. В то же время, ингибиторная активность SEQ ID NO: 56(9), 56(15), 56(16), 56(17) была понижена по сравнению с SEQ ID NO: 56, а ингибиторная активность SEQ ID NO: 56(8), 56(10), 56(13), 56(14) была полностью утрачена. Далее, ингибиторная активность SEQ ID NO: 56(18), 56(19) была повышена по сравнению с SEQ ID NO: 56.

Из результатов для SEQ ID NO: 56(1) и 56(17) можно сделать вывод, что модификация концов слабо влияет на активность. Из результатов для SEQ ID NO: 56(2) и 56(3) можно сделать вывод, что модификация стеблевой структуры не влияла на активность. Что касается нуклеотидов в составе общей последовательности, в результате модификации ингибиторная активность сохранялась у 56(4)-56(7), 56(11), 56(12) и уменьшалась (или утрачивалась) у SEQ ID NO: 56(8), 56(9), 56(10), 56(13), 56(14).

Из вышеперечисленного становится ясно, что по меньшей мере один нуклеотид аптамера, представленного SEQ ID NO:56, можно модифицировать для повышения стабильности аптамера. Примером модификации помимо 2'-метил модификации может служить, например, 2'-амино модификация и подобные ей.

В то же время, из результатов для SEQ ID NO: 56(15) и 56(16) можно сделать вывод, что ингибиторная активность снижается при изменении любого (9 или 15) модифицированного нуклеотида (U(F)), содержащегося в общей последовательности клона, представленного SEQ ID NO:56, на нативный рибонуклеотид (U). В целом, модификация нуклеотида повышает устойчивость аптамера к нуклеазе. Таким образом, предпочтительно, если по меньшей мере один из пиримидиновых нуклеотидов (9 U или 15 U клона, представленного SEQ ID NO:56), содержащийся в общей последовательности, представляет собой модифицированный нуклеотид.

Кроме того, из результатов для SEQ ID NO: 56(8), 56(9), 56(10), 56(13), 56(14) можно сделать вывод, что предпочтительно, если по меньшей мере одно из нативных пуриновых оснований 6 A, 11 G и 12 A в составе общей последовательности клона, представленного SEQ ID NO: 56 представляет собой нативный рибонуклеотид, поскольку модификация этих нуклеотидов снижает ингибиторную активность.

Далее из результатов для SEQ ID NO: 56(18) и 56(19) можно сделать вывод, что ингибиторная активность повышается при введении фосфоротиоата по меньшей мере в одно положение в качестве модификации фосфатной группы, в дополнение к модификации остатка сахара.

Таблица 6
Активность связывания химазы и активность ингибирования химазы (IC50).
SEQ ID NO: Активность связывания по данным Biacore IC50 [мкМ]
56 ++ 0,027±0,002
56(1) ++ 0,026±0,007
56(2) ++ 0,024±0,003
56(3) ++ 0,025±0,002
56(4) ++ 0,027±0,005
56(5) ++ 0,029±0,001
56(6) ++ 0,031±0,001
56(7) ++ 0,038±0,001
56(8) + >1
56(9) ++ 0,111±0,003
56(10) + >1
56(11) ++ 0,028±0,003
56(12) ++ 0,035±0,003
56(13) + >1
56(14) + >1
56(15) ++ 0,061±0,014
56(16) ++ 0,058±0,002
56(17) Н.о. 0,058±0,000
56(18) ++ 0,012±0,001
56(19) ++ 0,008±0,001

Для активности связывания «++» означает значительно более сильное связывание и химазой, чем у отрицательного контроля SEQ ID NO:58, а «+» означает силу связывания, сходную с таковой у отрицательного контроля SEQ ID NO:58. «Н.о.» означает не определялось. «>1» означает отсутствие ингибиторной активности при концентрациях до 1 мкМ. Величина IC50 представляет собой среднюю величину по двум измерениям.

У отрицательного контроля SEQ ID NO:58 не наблюдалось ингибиторной активности при концентрациях до 1 мкМ (IC50>1 мкМ). Кроме того, величина IC50 положительного контроля химостатина составляла 0,1-0,2 мкМ.

Исходя из вышеизложенных результатов, среди нуклеиновых кислот, приведенных в таблице 6, одна нуклеиновая кислота с величиной IC50, равной 0,1 мкМ или менее, обладала сильной активностью ингибирования химазы и предположительно могла бы использоваться в качестве ингибитора химазы.

Пример 7: изменение укороченного аптамера - 2

Аптамер, представленный SEQ ID NO:56, изменяли далее, основываясь на результатах Примера 6. Синтезировали измененные аптамеры, подвергнутые введению 2'-О-метильной группы, различным модификациям концов, введению фосфоротиоата, замещению рибонуклеотида на ДНК и т.п., а также комбинации этих модификаций. Последовательности представлены в SEQ ID NO: 56(20)-56(47), 61(1), 69, 69(1), 69(2), 70-74, 74(1), 75-77, 77(1), 77(2), 78-82.

Ниже приведены соответствующие нуклеотидные последовательности. Если не указано иначе, соответствующие последовательности, приведенные ниже, приведены в направлении от 5' к 3', прописными буквами обозначена РНК, а строчными буквами обозначена ДНК. Модификация 2'-положения рибозы указана в скобках, F означает атом фтора, а М означает О-метильную группу. На соответствующих концах последовательностей idT означает модификацию инвертированным dT, PEG означает модификацию разветвленным полиэтиленгликолем с молекулярной массой 40 кДа, Cho означает модификацию холестерином, а B означает модификацию биотином. Пептид 1 означает конъюгацию Phe-Cys на С-конце, Пептид 2 означает конъюгацию Cys-Phe на N-конце, и каждый пептид конъюгирован с 5'-концом нуклеиновой кислоты с помощью дисульфидной связи. S в последовательностях означает фосфоротиоацию фосфатной группы между нуклеотидами.

SEQ ID NO: 56(20):

G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAGU(F)U(F)A(M)A(M)AA(M)A(M)C(F)C(F)C(F)

SEQ ID NO: 56(21):

G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)

SEQ ID NO: 56(22):

G(M)G(M)G(M)U(F)U(F)sAG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)

SEQ ID NO: 56(23):

G(M)G(M)G(M)U(F)U(F)AsG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)

SEQ ID NO: 56(24):

idT-G(M)G(M)G(M)U(F)U(F)AGAU(F)AGAGU(F)U(F)AAAA(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(25):

idT-GGGU(F)U(F)AG(M)A(M)U(F)A(M)GAGU(F)U(F)AAAAAC(F)C(F)C(F)-idT

SEQ ID NO: 56(26):

idT-G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(27):

PEG-G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(28):

idT-G(M)G(M)G(M)U(F)U(F)AsG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(29):

idT-G(M)G(M)G(M)U(F)U(F)sAsG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(30):

idT-G(M)G(M)G(M)U(F)U(F)AGA(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(31):

idT-

G(M)G(M)G(M)U(F)U(F)AG(M)AU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(32):

idT-G(M)G(M)G(M)U(F)U(F)AGAU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(33):

idT-G(M)G(M)G(M)U(F)U(F)AsGA(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(34):

idT-G(M)G(M)G(M)U(F)U(F)AsG(M)AU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(35):

idT-G(M)G(M)G(M)U(F)U(F)AsGAU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(36):

idT-G(M)G(M)G(M)U(F)U(F)AGsAU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(37):

idT-G(M)G(M)G(M)U(F)U(F)AsGsAU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(38):

idT-G(M)G(M)G(M)U(F)U(F)sAsGAU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(39):

PEG-GG(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(40):

idT-GG(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(41):

idT-GG(M)G(M)U(F)U(F)AsG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(42):

Cho-G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(43):

Пептид 1-G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(44):

Пептид 2-G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(45):

idT-G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-PEG

SEQ ID NO: 56(46):

B-idT-G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(47):

idT-G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT-B

SEQ ID NO: 56(48):

idT-G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)ccc-idT

SEQ ID NO: 56(49):

idT-G(M)G(M)G(M)U(F)U(F)aG(M)AU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(50):

idT-G(M)G(M)G(M)U(F)U(F)AG(M)aU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(51):

B-idT-G(M)G(M)G(M)U(F)U(F)AG(M)aU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 56(52):

idT-G(M)G(M)G(M)U(F)U(F)AgaU(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 61(1):

G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAU(F)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)

SEQ ID NO: 69:

PEG-A(M)A(M)A(M)G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 69(1):

idT-A(M)A(M)A(M)G(M)G(M)G(M)U(F)U(F)AsG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 69(2):

idT-A(M)A(M)A(M)G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 70:

idT-G(M)G(M)G(M)ttAG(M)A(M)U(F)A(M)GAG(M)U(F)U(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 71:

idT-G(M)G(M)G(M)U(F)U(F)AG(M)A(M)U(F)A(M)GAG(M)tU(F)A(M)A(M)A(M)A(M)A(M)C(F)C(F)C(F)-idT

SEQ ID NO: 72:

idT-G(M)G(M)G(M)ttAG(M)A(M)U(F)A(M)GAG(M)tU(F)A(M)A(M)A(M)A(M)A(M)ccc-idT

SEQ ID NO: 72(1):

idT-G(M)G(M)G(M)ttAG(M)aU(F)A(M)GAG(M)tU(F)A(M)A(M)A(M)A(M)A(M)ccc-idT

SEQ ID NO: 72(2):

idT-G(M)G(M)G(M)ttAsG(M)aU(F)A(M)GAG(M)tU(F)A(M)A(M)A(M)A(M)A(M)ccc-idT

SEQ ID NO: 72(3):

idT-G(M)G(M)G(M)ttAG(M)A(M)U(F)A(M)GAgtU(F)A(M)A(M)A(M)A(M)A(M)ccc-idT

SEQ ID NO: 72(4):

idT-G(M)G(M)G(M)ttAG(M)A(M)U(F)A(M)GAG(M)tU(F)aA(M)A(M)A(M)A(M)ccc-idT

SEQ ID NO: 72(5):

idT-G(M)G(M)G(M)ttAG(M)A(M)U(F)A(M)GAG(M)tU(F)A(M)aA(M)A(M)A(M)ccc-idT

SEQ ID NO: 72(6):

idT-G(M)G(M)G(M)ttAG(M)A(M)U(F)A(M)GAG(M)tU(F)A(M)A(M)aA(M)A(M)ccc-idT

SEQ ID NO: 72(7):

idT-G(M)G(M)G(M)ttAG(M)aU(F)A(M)GAG(M)tU(F)A(M)A(M)A(M)A(M)A(M)ccc-PEG

SEQ ID NO: 72(8):

B-idT-G(M)G(M)G(M)ttAG(M)aU(F)A(M)GAG(M)tU(F)A(M)A(M)A(M)A(M)A(M)ccc-idT

Все нуклеиновые кислоты 56(20)-56(52), 61(1), 69, 69(1), 69(2), 70-72, 72(1)-72(8) получали путем химического синтеза. Связывание с химазой этих нуклеиновых кислот оценивали способом поверхностного плазмонного резонанса аналогично Примеру 4. Результаты приведены в таблице 7.

Исходя из результатов, все нуклеиновые кислоты (за исключением не оцененных нуклеиновых кислот) связывались с химазой значительно сильнее, чем отрицательный контроль.

Активность ингибирования химазы измеряли аналогично примеру 3. Величины IC50 приведены в таблице 7. Как видно из таблицы, все нуклеиновые кислоты, приведенные в таблице 7, обладали сильной ингибиторной активностью.

Из результатов для SEQ ID NO: 56(27) и 56(45) можно сделать вывод, что для модификации конца, например, PEG, подходит как 3'-конец, так и 5'-конец.

Далее, из результатов для SEQ ID NO: 56(43), 56(44), 56(46) и 56(47) можно сделать вывод, что модификации концов могут представлять собой пептид, аминокислоту или соединение, такое как биотин и т.п., помимо idT и PEG, описанных в Примере 6.

Из результатов для SEQ ID NO: 56(26) и 69(2), 56(27) и 69, и 56(28) и 69(1) можно сделать вывод, что модификация концов, такая как idT и PEG через полипептидную цепь, не влияет на ингибиторную активность. В качестве такого спейсера может использоваться любая полипептидная цепь и, например, алкиловый спейсер.

Также было обнаружено, что ингибиторная активность повышается при замене части F-формы на ДНК-форму.

Таблица 7
Активность связывания химазы и активность ингибирования химазы (IC50)
SEQ ID NO: Активность связывания по данным Biacore IC50 [мкМ] SEQ ID NO: Активность связывания по данным Biacore IC50 [мкМ]
56(20) ++ 0,102±0,009 56(44) ++ 0,042±0,007
56(21) ++ 0,045±0,006 56(45) Н.о. 0,059±0,006
56(22) ++ 0,052±0,002 56(46) ++ 0,049±0,002
56(23) ++ 0,032±0,003 56(47) ++ 0,037±0,006
56(24) ++ 0,038±0,003 56(48) ++ 0,036±0,003
56(25) ++ 0,070±0,009 56(49) ++ 0,069±0,000
56(26) ++ 0,054±0,002 56(50) ++ 0,027±0,002
56(27) Н.о. 0,084±0,006 56(51) ++ 0,029±0,003
56(28) ++ 0,044±0,002 56(52) ++ 0,052±0,001
56(29) ++ 0,036±0,003 61(1) ++ 0,078±0,004
56(30) ++ 0,034±0,003 69 Н.о. 0,091±0,019
56(31) ++ 0,023±0,001 69(1) ++ 0,044±0,002
56(32) ++ 0,017±0,000 69(2) ++ 0,048±0,002
56(33) ++ 0,035±0,002 70 ++ 0,027±0,004
56(34) ++ 0,031±0,006 71 ++ 0,028±0,005
56(35) ++ 0,024±0,005 72 ++ 0,020±0,002
56(36) ++ 0,097±0,017 72(1) ++ 0,013±0,003
56(37) ++ 0,046±0,007 72(2) ++ 0,014±0,002
56(38) ++ 0,019±0,005 72(3) ++ 0,050±0,004
56(39) н,о, 0,086±0,018 72(4) ++ 0,065±0,002
56(40) ++ 0,051±0,001 72(5) ++ 0,027±0,002
56(41) ++ 0,053±0,013 72(6) ++ 0,041±0,002
56(42) ++ 0,071±0,001 72(7) Н.о. 0,055±0,002
56(43) ++ 0,035±0,003 72(8) Н.о. 0,018±0,001
Для активности связывания «++» означает значительно более сильное связывание и химазой, чем у отрицательного контроля SEQ ID NO:58. «Н.о.» означает не определялось. Величина IC50 представляет собой среднюю величину по двум измерениям.

У отрицательного контроля SEQ ID NO: 58 не наблюдалось ингибиторной активности при концентрациях до 1 мкМ (IC50>1 мкМ). Кроме того, величина IC50 положительного контроля химостатина составляла 0,1-0,2 мкМ.

Исходя из вышеизложенных результатов, все нуклеиновые кислоты, приведенные в таблице 7, обладали сильной активностью ингибирования химазы и предположительно могли бы использоваться в качестве ингибитора химазы.

Обобщая результаты вышеприведенных Примеров 1-7, можно сделать вывод, что аптамер, эффективно ингибирующий химазу, полностью удовлетворяет по меньшей мере одному из следующих условий.

(1) Аптамер содержит общую последовательность (X1GAUAGAN1N2UAAX2), представленную SEQ ID NO: 21.

(2) Пиримидиновый нуклеотид, содержащийся в общей последовательности, может представлять собой нативный нуклеотид, однако, предпочтительно, если часть пиримидинового нуклеотида представляет собой модифицированный нуклеотид или ДНК.

(3) N1N2 могут представлять собой любой нуклеотид, однако, предпочтительно, если они представляют собой GU, GA, GC, UU, CU или GT.

(4) X1 и Х2 могут представлять собой любые нуклеотиды, однако предпочтительно, если они, будучи идентичными или не идентичными, представляют собой А или G, более предпочтительно, если они оба представляют собой А или оба представляют собой G.

(5) Последовательность нуклеотидов стеблевой структуры (например, SEQ ID NO: 56 на фиг. 6) может быть любой при условии, что стеблевая структура сохраняется; предпочтительно, если длина этой последовательности составляет 3 пары оснований или более.

(6) За исключением некоторых нуклеотидов (6 А, 11 G и 12 A из SEQ ID NO: 56), каждый нуклеотид частично модифицирован или частично заменен на ДНК.

(7) Конец модифицирован.

(8) Часть фосфатных групп между нуклеотидами может быть фосфоротиоирована.

Пример 8: Измерение активности ингибирования химазы с использованием ангиотензина I в качестве субстрата

Для дальнейшей оценки ингибиторной активности нуклеиновой кислоты согласно настоящему изобретению ферментативную активность химазы измеряли с использованием нативного субстрата химазы ангиотензина I согласно следующему способу. Химаза превращает ангиотензин I в ангиотензин II, в результате чего высвобождается пептид His-Leu. Поскольку пептид His-Leu флуоресцентно дериватизовали о-фталальдегидом, интенсивность его флуоресценции можно количественно измерить.

Ферментативную реакцию проводили в общем объеме 50 мкл, реакцию проводили в буферном растворе С. Вначале 0,3-0,75 нг химазы (рекомбинантной (производство Sigma) или нативной (производство Calbiochem)) разводили буфером С до 5 мкл. В данном случае рекомбинантную химазу экспрессировали в дрожжах, а нативную химазу выделяли из тучных клеток кожи человека. Нуклеиновую кислоту серийно разводили раствором С для получения 25 мкл раствора с концентрацией 0,0027-2 мкМ. Раствор химазы (5 мкл) и раствор нуклеиновой кислоты (25 мкл) смешивали и смесь инкубировали при 37°С в течение 5 мин. Также готовили 20 мкл раствора ангиотензина I в растворе С с концентрацией 125 мМ (производство Peptide Institute, Inc.) и инкубировали при 37°С в течение 5 мин. Раствор ангиотензина I добавляли к смеси химазы и нуклеиновой кислоты для начала ферментативной реакции. Конечная концентрация химазы в реакционном растворе составляла 0,2-0,5 нМ, а конечная концентрация субстрата составляла 50 мкМ. Реакцию проводили при 37°С в течение 90 мин, после чего для остановки реакции добавляли ледяной 30% раствор трихлоруксусной кислоты (25 мкл). Смесь центрифугировали при 4°С в течение 10 мин при 14 000 об/мин, и супернатант (30 мкл) использовали для следующей реакции индукции флуоресценции.

По 30 мкл вышеописанного супернатанта переносили в лунки 96-луночного планшета (black, производство Costar), также в каждую лунку добавляли по 15 мкл 2% раствора о-фталальдегида (производство Sigma) в метаноле и 170 мкл 0,3 М раствора NaOH и смесь инкубировали при комнатной температуре в течение 10 мин. Далее добавляли 25 мкл 3М раствора HCl для остановки реакции. Планшет помешали в ридер микропланшетов SpectraMax190 (производство Molecular device) и измеряли интенсивность флуоресценции при длине волны возбуждения 355 нм и длине волны флуоресценции 460 нм.

Аналогичную процедуру и измерение проводили с SEQ ID NO:58 (отрицательный контроль) и химотрипсином (положительный контроль). Интенсивность флуоресценции в момент времени реакции 0 в каждом случае принимали за контроль. Интенсивность флуоресценции, детектируемой после добавления такого же количества раствора С вместо нуклеиновой кислоты в ферментативную реакцию химазы принимали за 100%, и вычисляли степень ингибирования для каждого тестируемого вещества по следующей формуле.

Степень ингибирования (%)=[1-{(интенсивность флуоресценции с тестируемым веществом - интенсивность флуоресценции контроля с тестируемым веществом)/(интенсивность флуоресценции без тестируемого вещества - интенсивность флуоресценции контроля без тестируемого вещества)}]×100

Определяли концентрацию ингибитора, необходимую для 50% ингибирования ферментативной активности (IC50). Результаты приведены в таблице 8.

Таблица 8
Активность ингибирования химазы (IC50) при использовании ангиотензина I в качестве субстрата. IC50 представляет собой величину, полученную в одном измерении.
SEQ ID NO: IC50 [мкМ] для нативной химазы IC50 [мкМ] для рекомбинантной химазы SEQ ID NO: IC50 [мкМ] для нативной химазы IC50 [мкМ] для рекомбинантной химазы
4 0,031 0,003 56(34) 0,162 0,057
13 0,074 0,041 56(35) 0,120 0,039
14 0,063 0,022 56(42) 0,601 0,687
53 0,764 0,446 56(43) 0,591 0,328
54 0,614 0,397 56(44) 0,643 0,414
55 0,606 0,354 56(45) 0,303 0,377
56 0,508 0,235 56(46) 0,742 0,426
65 0,878 0,274 56(47) 0,542 0,419
56(1) 0,404 0,207 56(48) 0,621 0,394
56(17) 0,613 0,456 56(50) 0,325 0,153
14 0,063 0,022 56(42) 0,601 0,687
53 0,764 0,446 56(43) 0,591 0,328
54 0,614 0,397 56(44) 0,643 0,414
55 0,606 0,354 56(45) 0,303 0,377
56 0,508 0,235 56(46) 0,742 0,426
65 0,878 0,274 56(47) 0,542 0,419
56(1) 0,404 0,207 56(48) 0,621 0,394
56(17) 0,613 0,456 56(50) 0,325 0,153
56(18) 0,174 0,108 56(51) 0,429 0,310
56(19) 0,130 0,055 69 >1 0,628
56(21) 0,722 0,361 69(1) 0,480 0,125
56(22) 0,563 0,237 69(2) 0,752 0,289
56(23) 0,360 0,119 70 0,478 0,239
56(26) 0,743 0,326 71 0,341 0,161
56(27) >1 0,724 72 0,120 0,065
56(28) 0,410 0,137 72(1) 0,103 0,036
56(29) 0,366 0,080 72(2) 0,076 0,037
56(30) 0,521 0,210 72(5) 0,377 0,201
56(31) 0,266 0,089 72(6) 0,573 0,370
56(32) 0,185 0,078 72(7) 0,312 0,158
56(33) 0,291 0,085 72(8) 0,097 0,043

У отрицательного контроля SEQ ID NO: 58 не наблюдалось ингибиторной активности (IC50>1 мкМ). Величины IC50 положительного контроля химостатина составляли 0,35-0,5 мкМ (нативная химаза) и 0,45-0,6 мкМ (рекомбинантная химаза). Активность аптамера, конъюгированного с PEG, относительно низка по сравнению с аптамером, не связанным с PEG. Это распространенное явление, обусловленное тем, что молекула PEG больше по размеру (молекулярный вес примерно 40000), чем аптамер (молекулярный вес примерно 10000). Поскольку конъюгирование с PEG заметно улучшает фармакокинетику in vivo, можно ожидать эффекта in vivo даже при некотором уменьшении эффективности in vitro.

Исходя из вышеприведенных данных, можно сделать вывод, что все нуклеиновые кислоты, перечисленные в таблице 8, потенциально могут использоваться в качестве лекарственного средства для профилактики и/или лечения различных заболеваний, связанных с ангиотензином, поскольку у них наблюдается сильная активность ингибирования химазы даже при использовании нативного субстрата ангиотензина.

Пример 9: измерение активности ингибирования деградации LTBP-1 с использованием нормальных легочных фибробластов человека (Normal Human Lung Fibroblast: NHLF)

Химаза тесно ассоциирована с активацией TGF-β, одного из важнейших факторов возникновения фиброза. Предполагается, что в процессе активации TGF-β химаза расщепляет LTBP-1, в результате чего высвобождается TGF-β, присутствующий в латентной форме во внеклеточной матриксе, а также она задействована в реакции превращения латентного TGF-β в активный TGF-β. С помощью способа, описанного ниже, оценивали способность нуклеиновых кислот согласно настоящему изобретению ингибировать деградацию LTBP-1.

Замороженные клетки NHLF (производство Cambrex Bio Science) помещали в водяную баню с температурой 37°С для быстрого оттаивания и далее суспендировали в среде (10% FBS/F-12). После центрифугирования (1200 об/мин, 5 мин), супернатант удаляли, а клетки ресуспендировали в среде. Добавляли среду до конечного объема 10 мл, смесь помещали в культуральную чашку Петри, и культивировали клетки при 37°С и 5% СО2. Форму и количество клеток наблюдали под микроскопом и по достижению клетками конфлюентности меняли среду на среду без сыворотки (0.2% BSA/F-12). Через 2 дня после смены среды культуральный супернатант собирали, разливали и замораживали при -30°С.

40 мкл размороженного культурального супернатанта разливали в пробирки и добавляли 5 мкл раствора нуклеиновой кислоты, получаемого путем разведения в растворе С до концентрации 50 мкМ. Для положительного контроля аналогично разводили раствором С и добавляли химостатин. Для отрицательного раствора аналогично добавляли раствор С. Далее добавляли 5 мкл химазы, разведенной раствором Е (раствор С + 0,1% BSA + 0,05% азида натрия) до 100 нг/мкл. Конечная концентрация химазы в реакционном растворе составляла 10 нг/мл (0,33 нМ), а конечная концентрация нуклеиновой кислоты составляла 5 мкМ. В качестве контроля использовали пробирку, не содержащую химазы. Образцы пипетировали и далее инкубировали при 37°С в течение 1 часа и смешивали с равным количеством лизисного буфера для электрофореза для остановки реакции. Далее детектировали LTBP-1 в образце с помощью описанного ниже Вестерн-блоттинга.

Образец, полученный путем смешивания с лизисным буфером, кипятили в течение 3 мин, и 10 мкл образца подвергали электрофорезу путем нанесения на 5-20% акриламидный гель. После окончания миграции смесь переносили на нитроцеллюлозный фильтр и забивали фильтр 5% обезжиренным молоком, 50мМ Tris-HCl (pH 8,0) и 0,05% азида натрия. Фильтр инкубировали с моноклональными антителами к LTBP-1, разведенными 2% BSA, PBS и 0,05% азида натрия до 2 мкг/мл, при комнатной температуре в течение ночи. Фильтр промывали 3 раза и инкубировали с раствором вторых антител (антитела к мышиным IgG, помеченные HRP и разведенные в 10000 раз 0,1% BSA/PBS) при комнатной температуре в течение 2 часов. Фильтр промывали 5 раз и проявляли химическим люминесцентным субстратом.

О присутствии или отсутствии ингибиторной активности каждого тестируемого вещества судили по плотности и положению полосы LTBP-1 (определяемой по молекулярному весу). Результаты анализа были получены в ходе трех независимых экспериментов. Полоса, соответствующая лунке, не содержащей химазы, служила положительным (+) контролем, полоса, соответствующая лунке с отрицательным контролем, считалась отрицательной (-), и присутствие или отсутствие ингибиторной активности каждого тестируемого вещества определяли визуально по полосе, соответствующей каждой лунке с тестируемым веществом. Результаты Вестерн-блоттинга приведены на фиг. 8, а результаты определения ингибиторной активности приведены в таблице 9.

Таблица 9
Присутствие или отсутствие активности ингибирования деградации LTBP-1.
SEQ ID NO: Номер полосы на фиг. 8 Ингибиторная активность
56 4, 10, 16, 24 +
56(1) 2 +
56(17) 12 +
56(19) 14 +
56(23) 15 +
56(26) 13, 25 +
56(27) 11 +
56(28) 17 +
56(29) 19 +
58 3, 27 -
69(1) 18 +
72(1) 26 +
Другие Номер полосы на фиг. 8 Ингибиторная активность
маркер 1, 8, 9, 23, 31
химостатин 5, 20, 28 +
Отрицательный 6, 21, 29 -
контроль
Контроль (без добавления химазы) 7, 22, 30 +
«+» означает детекцию полосы с плотностью, сходной с плотностью полосы LTBP-1 в контроле, а «-» означает отсутствие детекции полосы LTBP-1, сравнимой по четкости с отрицательным контролем.

У SEQ ID NO:58 не наблюдалось ингибиторной активности (-). У положительного контроля химостатина наблюдалась ингибиторная активность (+). У всех аптамеров, приведенных в таблице 9 за исключением SEQ ID NO:58, наблюдалась активность ингибирования деградации LTBP-1.

Из вышеприведенных результатов можно сделать вывод, что аптамер согласно настоящему изобретению ингибирует деградацию LTBP-1 химазой. Таким образом, было показано, что аптамер может использоваться для профилактики и/или лечения различных заболеваний, включающих активацию TGF-β, таких как фиброз.

Промышленная применимость

Аптамер и комплекс согласно настоящему изобретению могут применяться как лекарственные средства, диагностические агенты или реагенты для заболеваний, таких как сердечно-сосудистые заболевания, фиброз и т.п. Аптамер и комплекс согласно настоящему изобретению также могут применяться для очистки и концентрации химазы, а также для детекции и количественного анализа химазы.

Настоящая заявка основана на заявке на японский патент № 2009-140585, содержание которой полностью включено в настоящий документ путем ссылки.

1. Аптамер, связывающийся с химазой и ингибирующий активность химазы, содержащий нуклеотидную последовательность, представленную как X1GAUAGAN1N2UAAX2 (SEQ ID NO: 21; каждый из X1 и X2, идентичных или не идентичных, обозначает A или G, а каждый из N1 и N2, идентичных или не идентичных, обозначает A, G, C, U или T).

2. Аптамер по п.1, где N1N2 обозначает GA, GU, GC, UU, GT или CU.

3. Аптамер по п.1, где X1 и Х2 оба обозначают А или оба обозначают G.

4. Аптамер по п. 2 или 3, где по меньшей мере один пиримидиновый нуклеотид был модифицирован или изменен, где модификация выбрана из группы, состоящей из фторирования, О-алкилирования, О-арилирования, S-алкилирования, S-арилирования и аминирования в 2'-положении, 3'-положении и/или 4'-положении остатка сахара нуклеотида; и
где изменение выбрано из следующих (а)-(е):
(а) изменение нуклеотидного основания, выбранное из группы, состоящей из изменения в 5 положении пиримидинов, добавления амина вне цикла, замещения 4-тиоуридином и замещения 5-бром- или 5-йодурацилом;
(b) замещение группы Р(О)О нуклеотида группой, выбранной из группы, состоящей из P(O)S (тиоат), P(S)S (дитиоат), P(O)NR2 (амидат), P(O)CH3, P(O)BH3, P(O)R, R(O)OR', CO или CH2 (формацеталь) или 3'-амин (-NH-CH2-CH2-) (где каждый из R и R' независимо представляет собой Н или замещенный или незамещенный алкил);
(с) изменение посредством соединяющей группы, выбранной из группы, состоящей из -O-, -N- или -S-;
(d) кэпирование на 3'-конце и 5'-конце; и
(е) присоединение к концу аптамера полиэтиленгликоля, аминокислоты, пептида, инвертированного dT, нуклеиновой кислоты, нуклеозидов, миристоила, литохолик-олеила, докозанила, лауроила, стеароила, пальмитоила, олеоила, линолеоила, других липидов, стероидов, холестерина, кофеина, витамина, пигмента, флуоресцентного вещества или биотина.

5. Аптамер по п. 1, содержащий любую из нуклеотидных последовательностей (a), (b) и (c), приведенных ниже:
(а) нуклеотидная последовательность, выбираемая из SEQ ID NO: 4, 13, 14, 25, 26, 30-32, 34, 38-50, 53-57, 59-65, 69-72 (при условии, что урацил может представлять собой тимин);
(b) нуклеотидная последовательность, выбираемая из SEQ ID NO: 4, 13, 14, 25, 26, 30-32, 34, 38-50, 53-57, 59-65, 69-72 (при условии, что урацил может представлять собой тимин), в которой заменены, делетированы, вставлены или добавлены от 1 до 5 нуклеотидов; и
(с) нуклеотидная последовательность, идентичная на 70% или более нуклеотидной последовательности, выбираемой из SEQ ID NO: 4, 13, 14, 25, 26, 30-32, 34, 38-50, 53-57, 59-65, 69-72 (при условии, что урацил может представлять собой тимин).

6. Аптамер по п. 5, где по меньшей мере один из нуклеотидов, содержащихся в аптамере, был модифицирован или изменен,
где модификация выбрана из группы, состоящей из фторирования, О-алкилирования, О-арилирования, S-алкилирования, S-арилирования и аминирования в 2'-положении, 3'-положении и/или 4'-положении остатка сахара нуклеотида; и
где изменение выбрано из следующих (а)-(е):
(а) изменение нуклеотидного основания, выбранное из группы, состоящей из изменения в 5 положении пиримидинов, добавления амина вне цикла, замещения 4-тиоуридином и замещения 5-бром- или 5-йодурацилом;
(b) замещение группы Р(О)О нуклеотида группой, выбранной из группы, состоящей из P(O)S (тиоат), P(S)S (дитиоат), P(O)NR2 (амидат), P(O)CH3, P(O)BH3, P(O)R, R(O)OR', CO или CH2 (формацеталь) или 3'-амин (-NH-CH2-CH2-) (где каждый из R и R' независимо представляет собой Н или замещенный или незамещенный алкил);
(с) изменение посредством соединяющей группы, выбранной из группы, состоящей из -O-, -N- или -S-;
(d) кэпирование на 3'-конце и 5'-конце; и
(е) присоединение к концу аптамера полиэтиленгликоля, аминокислоты, пептида, инвертированного dT, нуклеиновой кислоты, нуклеозидов, миристоила, литохолик-олеила, докозанила, лауроила, стеароила, пальмитоила, олеоила, линолеоила, других липидов, стероидов, холестерина, кофеина, витамина, пигмента, флуоресцентного вещества или биотина.

7. Аптамер по п. 1, содержащий любую из нуклеотидных последовательностей (a'), (b') и (c'), приведенных ниже:
(а') нуклеотидная последовательность, выбираемая из SEQ ID NO: 56(1)-56(7), 56(9), 56(11), 56(12), 56(15)-56(52), 61(1), 69(1), 69(2) и 72(1)-72(8) (при условии, что урацил может представлять собой тимин);
(b') нуклеотидная последовательность, выбираемая из SEQ ID NO: 56(1)-56(7), 56(9), 56(11), 56(12), 56(15)-56(52), 61(1), 69(1), 69(2) и 72(1)-72(8) (при условии, что урацил может представлять собой тимин), в которой заменены, делетированы, вставлены или добавлены от 1 до 5 нуклеотидов; и
(с') нуклеотидная последовательность, идентичная на 70% или более нуклеотидной последовательности, выбираемой из SEQ ID NO: 56(1)-56(7), 56(9), 56(11), 56(12), 56(15)-56(52), 61(1), 69(1), 69(2) и 72(1)-72(8) (при условии, что урацил может представлять собой тимин).

8. Аптамер, связывающийся с химазой и ингибирующий активность химазы, содержащий любую из нуклеотидных последовательностей (a), (b) и (c), приведенных ниже:
(а) нуклеотидная последовательность, выбираемая из SEQ ID NO: 5, 6, 8, 9, 11, 12, 15, 17-20, 22-24, 28, 33 и 51 (при условии, что урацил может представлять собой тимин);
(b) нуклеотидная последовательность, выбираемая из SEQ ID NO: 5, 6, 8, 9, 11, 12, 15, 17-20, 22-24, 28, 33 и 51 (при условии, что урацил может представлять собой тимин), в которой заменены, делетированы, вставлены или добавлены от 1 до 5 нуклеотидов; и
(с) нуклеотидная последовательность, идентичная на 70% или более нуклеотидной последовательности, выбираемой из SEQ ID NO: 5, 6, 8, 9, 11, 12, 15, 17-20, 22-24, 28, 33 и 51 (при условии, что урацил может представлять собой тимин).

9. Аптамер по любому из пп.1-3, 5-8, где каждая гидроксильная группа в 2'-положениях соответствующих пиримидиновых нуклеотидов или пуриновых нуклеотидов, содержащихся в аптамере, идентичных или неидентичных, может заменяться на атом или группу, выбираемые из группы, состоящей из атома водорода, атома фтора и метоксигруппы.

10. Комплекс, содержащий аптамер по любому из пп.1-9 и функциональное вещество, выбранное из группы, состоящей из вещества, обладающего сродством, вещества для мечения, фермента, средства доставки лекарственного средства или лекарственного средства.

11. Лекарственное средство для профилактики или лечения сердечно-сосудистого заболевания или фиброза, содержащее аптамер по любому из пп.1-9 или комплекс по п.10.

12. Реагент для диагностирования сердечно-сосудистого заболевания или фиброза, содержащий аптамер по любому из пп. 1-9 или комплекс по п.10

13. Зонд для детекции химазы, содержащий аптамер по любому из пп.1-9 или комплекс по п.10.

14. Твердофазный носитель для очистки химазы, содержащий аптамер по любому из пп.1-9 или комплекс по п.10.

15. Способ детекции химазы, включающий применение аптамера по любому из пп.1-9 или комплекс по п.10.

16. Способ очистки химазы, включающий использование аптамера по любому из пп.1-9 или комплекс по п.10.



 

Похожие патенты:
Изобретение относится к области медицины и предназначено для прогнозирования ответа на стандартную двухкомпонентную противовирусную терапию у пациентов с хроническим гепатитом С (ХГС), генотипом 1в.

Изобретение относится к биотехнологии, а именно к способу селективного подавления амплификации в ходе ПЦР фрагментов ДНК. Добавляют в реакционную смесь блокирующий олигонуклеотид в концентрации, которая превышает концентрацию праймеров, используемых для ПЦР, не менее чем в 2 раза.

Изобретение относится к области биотехнологии, а именно к набору последовательностей праймеров и аллель-специфических зондов для одновременной генодиагностики двух мутантных аллелей, вызывающих комплекс аномалий позвоночника (CVM) и дефицит лейкоцитарной адгезии (BLAD) у крупного рогатого скота.

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования у пациента с влажной возрастной дегенерацией желтого пятна (AMD) повышенной вероятности эффекта от лечения высокоаффинным антителом против VEGF, в частности, ранибизумабом.

Изобретение относится к области биохимии, в частности к способу определения зиготности растения кукурузы, содержащего трансгенную конструкцию, содержащую ген арилоксиалканоатдиоксигеназы, где указанный способ включает: получение образца геномной ДНК от указанного растения кукурузы; получение приведенного в контакт образца посредством контактирования указанного образца ДНК с первым праймером и вторым праймером и флуоресцентным зондом, определение зиготности указанного растения кукурузы, а также к набору для его осуществления.

Изобретение относится к области биотехнологии, а именно к способу поиска белков-мишеней, запускающих процесс канцерогенеза, в образцах тканей индивидуального пациента, для последующей противоопухолевой фармакотерапии.

Изобретение относится к области медицины и предназначено для ПЦР-диагностики гена резус-фактора плода по крови беременной женщины. Предложен набор с лиофилизированными праймерами, содержащий готовые к амплификации реакционные пробирки с лиофилизированными праймерами и праймерами-зондами для экзонов RHD-5 и RHD-7 гена RHD.

Изобретение относится к биохимии. Описан способ получения кукурузного растения с улучшенной оптимизаций водопотребления и растение, полученное таким способом.

Настоящее изобретение относится к биотехнологии и представляет собой способ мониторинга экспрессии представляющего интерес гена полипептида CADM1, Rb, ZMYND10, RASSF5, PTEN, SERPINB5, EPB41L3 или DAPK1 для определения терапевтического эффекта соединения при лечении заболевания, связанного с экспрессией указанного представляющего интерес гена полипептида.

Изобретение относится к области биотехнологии, а именно к способу выявления РНК вируса бешенства и набору, который используется в данном способе. Способ включает проведение ОТ-ПЦР с олигонуклеотидными праймерами.

Изобретение относится к биохимии. Раскрыты способы повышения экспрессии полинуклеотида PAR4, включающие осуществление контакта с по меньшей мере одним олигонуклеотидом длиной от 15 до 30 нуклеотидов, который нацелен на природную антисмысловую последовательность для полинуклеотида PAR4, и при этом указанная природная антисмысловая последовательность имеет последовательность, представленную в SEQ ID NO: 2.

Изобретение относится к биотехнологии и представляет собой выделенный вариант субтилизина Bacillus. Изобретение относится также к выделенной нуклеиновой кислоте, кодирующей вариант субтилизина, вектору экспрессии, содержащему нуклеиновую кислоту, клетке-хозяину, способной экспрессировать вариант субтилизина, а также к чистящей композиции, содержащей вариант субтилизина и способу очистки.

Изобретение относится к области биохимии, в частности к молекулам нуклеиновой кислоты для модуляции экспрессии генов-мишеней. Заявлена двухцепочечная молекула нуклеиновой кислоты для ингибирования экспрессии гена белка теплового шока 47 (hsp47).

Группа изобретений относится к области молекулярной биологии. Сущность изобретения состоит в подавлении активности активированного онкогена AML-ETO методом РНК-интерференции в злокачественных кроветворных клетках, полученных от больных лейкозом, с использованием конструкции малой шпилечной РНК, встроенной в лентивирусный вектор pLSLP-AML-ETO-shRNA, кодируемой нуклеотидной последовательностью двухцепочечной ДНК, представляющей собой: 5′-р-gatccgCCTCGAAATCGTACTGAGActtcctgcaa TCTCAGTACGATTTCGAGGtttttg-3′ (смысловая цепь), 5′-р-aattcaaaaaCCTCGAAATCGTACT GAGAttgcaggaagTCTCAGTACGATTTCGAGGcg-3′ (антисмысловая цепь).

Изобретение относится к области биохимии. Заявлен лиганд гликопротеина VI (GPVI), представляющий собой нуклеиновую кислоту, который взаимодействует с гликопротеином тромбоцитов GPVI и модулирует его активность с регуляцией функции тромбоцитов.

Группа изобретений относится к области биотехнологии, в частности к антисмысловым олигомерам, используемым в качестве активного ингредиента в фармацевтических композициях для лечения мышечной дистрофии.

Изобретение относится к биотехнологии, в частности к генетической инженерии. Предложен способ доставки нуклеиновых кислот в эукариотические клетки, предусматривающий трансфекцию методом кальций-фосфатной преципитации в присутствии гистона Н1.3 в эффективном количестве.

Изобретение относится к области генной инженерии и генной терапии и может быть использовано для стимуляции роста и регенерации нервов и восстановления иннервации ишемизированных тканей.

Изобретение относится к области молекулярной биологии и генетической инженерии. Предложен способ получения представляющего интерес белка, включающему введение вектора экспрессии белка, который включает генный фрагмент, содержащий ДНК, кодирующую представляющий интерес белок, и ген селектируемого маркера, а также транспозонные Tol1 или Tol2 последовательности на обоих концах генного фрагмента, в суспензионную клетку млекопитающего СНО, адаптированную к суспензионному культивированию, или клетку PER.C6, клетки крысиной миеломы YB2/3HL.Р2.G11.16Ag.20 (или также называемой YB2/0), или клетку мышиной миеломы NS0, адаптированную к суспензионному культивированию; интегрирование генного фрагмента, вставленного между парой транспозонных последовательностей, в хромосому клетки млекопитающего для получения клетки млекопитающего, способной экспрессировать представляющий интерес белок; и суспензионное культивирование клетки млекопитающего; при этом суспензионная клетка млекопитающего способна экспрессировать представляющий интерес белок, а также предложены способ получения клетки млекопитающего, соответствующая рекомбинантная клетка и применение вектора экспрессии.

Изобретение относится к области биохимии, в частности к соединениям и композициям для ослабления экспрессии гентингтина. Заявлены варианты одноцепочечного модифицированного олигонуклеотида, ингибирующего экспрессию гентингтина.

Данное изобретение относится к области иммунологии. Предложено выделенное антитело или его фрагмент, которые связываются с Axl человека и охарактеризованные последовательностями гипервариабельных участков (CDR).
Наверх