Препарат экзосом - онкосом и способ иммунотерапии солидных опухолей с его использованием



Препарат экзосом - онкосом и способ иммунотерапии солидных опухолей с его использованием
Препарат экзосом - онкосом и способ иммунотерапии солидных опухолей с его использованием
Препарат экзосом - онкосом и способ иммунотерапии солидных опухолей с его использованием

 


Владельцы патента RU 2593003:

Сивов Игорь Геннадьевич (RU)
Голубков Сергей Петрович (RU)

Изобретение относится к области медицины, в частности к способу иммунотерапии солидных опухолей. Способ иммунотерапии солидных опухолей, заключающийся в вакцинации пациента комбинацией препарата экзосом и олигодезоксинуклеотида Р-типа, при этом препарат включает экзосомы, выделенные культурой клеток K562/i-S9, и содержит белок, антигены CEA, 5Т4, лиганды FasL и TRAIL, а олигодезоксинуклеотид Р-типа представляет собой последовательность нуклеотидов GGGGCGCCGTGATGGCGAGCGCGCC, указанную комбинацию вводят подкожно в течение не менее 2 месяцев и не реже 1 раза в неделю в эффективном количестве, предпочтительно в дозах 0,01-0,04 мг/кг каждый. Препарат экзосом, выделенных культурой клеток K562/i-S9, содержащий, по данным иммуноферментного анализа, белок, антигены СЕА и 5Т4, лиганды FasL и TRAIL в определенном количестве. Применение вышеописанного препарата повышает уровень иммунного ответа и снижает титр онкомаркёров у добровольцев. 2 н. и 1 з.п. ф-лы, 4 ил., 2 табл., 7 пр.

 

Область техники, к которой относится изобретение

Изобретение относится к области медицины, в частности к онкологии, и может быть использовано для получения высокоэффективного средства для лечения солидных опухолей, предопухолевых состояний и профилактики злокачественных новообразований.

Уровень техники

Для лечения отдельных видов злокачественных новообразований и профилактики рецидивов был предложен эмбриональный противоопухолевый модулятор «ЭПОМ» (RU 2240810 С2, опуб. 27.11.2004). Препарат содержит набор нормальных фетальных протеогликанов, в котором обнаружены раковые эмбриональные антигены или ассоциированные с опухолями антигены (tumor associated antigens - TAAs), из которых значительное количество составляют раковоэмбриональный антиген - РЭА, трофобластический β-гликопротеин (ТВГ) и α-фетопротеин (АФП).

РЭА - англоязычное обозначение СЕА, а также СЕАСАМ5 или CD66e, - представляет собой гликопротеид 180-kDa, сверхактивно образуемый клетками рака ободочной и прямой кишки, а также при эпителиальных опухолях (Hammarstrom S. The carcinoembryonic antigen (СЕА) family: structures, suggested function sand expression nin normal and malignant tissues // Semin Cancer Biol 1999, v. 9, рр. 67-81). Это обстоятельство делает РЭА привлекательным для иммунотерапии (S. Dai, Tao W., Baomei W., Xiangyang Z., Fangming X., Taoyong С., Yanfeng W., Xuetao C. More Efficien tInduction of HLA-A*0201-Restricted and Carcinoembryonic Antigen (CEA) - Specific CTL Response by Immunization with Exosomes Prepared from Heat-Stressed CEA-Positive Tumo rCells // Clin Cancer Res 2005; 11(20): 7554-7563).

ТВГ - англоязычное обозначение «5Т4» - представляет собой гликопротеид, образуемый эпителиальным опухолями (Myers K.А. Isolation of a cDNA Encoding 5T4 Oncofetal Trophoblast Glycoprotein // The Journal of Biological Chemistry, vol. 269, No. 12, Mar. 25, 1994, p. 9319-9324). Антиген - член семейства трансмембранных гликопротеидов с молекулярной массой 72-kDa, внеклеточная часть полипептидной цепи которого включает два богатых лейцином повторяющихся домена, отделенные «промежутком» гидрофильных аминокислот с 7 местами N-гликозилирования и эндоплазматическим «хвостом» из 44 аминокислотных остатков (Starzynska, Т., Wiechowska Kozlowska, A., Marlicz, K., Bromley, М., Roberts, S.A., Lawniczak, М., Kolodziej, В., Zyluk, A., Stern, P.L. 5T4 oncofetal antigen in gastric carcinoma and its clinical significance // Eur. J. Gastroenterol. Hepatol. 1998, v. 10(1), pp. 479-484). Антиген 5T4 сконцентрирован на внешней поверхности цитоплазматической мембраны микроворсинки, а его чрезмерная экспрессия в эпителиоцитах связана с изменениями в морфологии и увеличенной подвижности. Так же, как и СЕА, антиген 5Т4 найден в экзосомах, которые выделяют клетки опухоли (US Patent Application 20140141986) путем отпочковывания от цитоплазматической мембраны, подобно процессу созревания вируса иммунодефицита человека (ВИЧ). Таким образом, можно рассмотреть вопрос о замене источника двух важнейших антигенов опухолей (как правило, солидных), коим в настоящее время является ЭПОМ, на линию клеток опухоли человека, продуцирующую экзосомы, содержащие СЕА и 5Т4.

Однако среди белков, находящихся в составе экзосом, зачастую находятся обладающие мощным иммуносупрессивным свойством. Такими проапоптотическими молекулами являются FasL и TRAIL (Valenti R., V. Huber, P. Filipazzi, L. Pilla, G. Sovena, A. Villa, A. Corbelli, S. Fais, G. Parmiani, L. Rivoltini. Human Tumor-Released Microvesicles Promote the Differentiation of Myeloid Cells with Transforming Growth Factor-B-Mediated Suppressive Activity on T-Lymphocytes // Cancer Res 2006; 66(18): 9290-9298). Для преодоления иммуносупрессивного действия экзосом in vivo (G. Andreola, L. Rivoltini, С. Castelli, V. Huber, P. Perego, P. Deho, P. Squarcina, P. Accornero, F. Lozupone, L. Lugini, A. Stringaro, A. Molinari, G. Arancia, M. Gentile, G. Parmiani, S. Fais. Induction of Lymphocyte Apoptosis by Tumor Cell Secretion of FasL-bearing Microvesicles // J. Exp. Med. May 20 2002, Volume 195, №10, 1303-1316) в настоящее время используют два методических подхода: использование ингибиторов образования экзосом in vivo с помощью ингибиторов обратной транскриптазы (ревертазы - RT) и применение адъювантов, таких как неметиллированные олигодезоксинуклеотиды (ОДН). Использование ингибиторов RT известных специалистам, работающим с ВИЧ-инфицированными, позволяет значительно уменьшить образование экзосом (US Patent Application 2007269878).

Другим способом повышения эффективности иммунотерапии опухолей является применение адъювантов, среди которых своей активностью выделяются НК-адъюванты, представляющие собой неметиллированные ОДН (US Patents 8129351 и 8158592). Уникальная способность неметиллированных ОДН активировать иммунотерапии опухолей (Hartmann, G., G.J. Weiner, А.М. Krieg. 1999. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proc. Natl. Acad. Sci. USA 96:9305), связана со способностью ОДН проникать в клетки человека и связываться с TLR рецепторами врожденного иммунитета (GiordaniL., М. Sanchez, I. Libri, М.G. Quaranta, В. Mattioli, М. Viora. IFN-α amplifies human naive В cell TLR-9-mediated activation and Ig production // J. Leukoc. Biol. 86: 261-271; 2009). Кроме того, неметиллированные ОДН сами по себе способны оказывать супрессирующее действие на рост опухолевых клеток (Krieg A.M. Development of TLR9 agonists for cancert herapy // J. Clin. Invest. (2007) 117(5): 1184-1194).

Ранее был описан адъювант на основе вирусных частиц (Кириллова И.В., Сивов И.Г., Самохвалов Е.И., Кулиш Д.М. Препарат «Исвак», основанный на рекомбинантных вирусподобных частицах вируса гепатита С, индуцирует интерферон-альфа и стимулирует В-клетки // Технология производства биопрепаратов 2009, т. 1(2), с. 25-36). Однако дальнейшие исследования показали, что действующим началом препарата «Исвак» были ОДН с оригинальной структурой, но относящиеся к Р-типу (Bode С., G. Zhao, F. Steinhagen, Т. Kinjo, D.M. Klinman. CpG DNA as a vaccine adjuvant // Expert Rev Vaccines 2011 April; 10(4): 499-511).

Способ получения препарата ЭПОМ (RU 2240810 С2) заключается в том, что эмбриональную нативную ткань извлекают, промывают, выдерживают в спирте, измельчают, замораживают в жидком азоте, гомогенизируют до порошкообразного состояния, разбавляют водой и дезинтегрируют в охлажденной шаровой мельнице до выявления рексированных клеточных ядер (более 80%), мельчайших цитоплазматических обрывов и фрагментов волокнистых структур, обрабатывают полученный гомогенат ультрафиолетом, центрифугируют и обрабатывают полученный супернатант спиртом для выделения в осадок гликопротеидов, обрабатывают осадок гликопротеидов в шаровой мельнице и отделяют их в осадок при центрифугировании и затем проводят стерилизирующую фильтрацию и лиофилизацию целевого продукта.

Способ профилактики и лечения предопухолевых патологических состояний с помощью препарата ЭПОМ (RU 2240810 С2) характеризуется тем, что включает вакцинацию лиц, относящихся к группам высокого онкологического риска по результатам тестирования, путем подкожного введения ЭПОМ 1 раз в год в эффективном количестве, предпочтительно в дозе 0,01-0,04 мг/кг.

Сущность изобретения

Таким образом, задачей настоящего изобретения является расширение арсенала средств для эффективного лечения и профилактики злокачественных новообразований с помощью нового препарата экзосом - ОНКОСОМа в комбинации с ОДН Р-типа (ОДНП).

Задача решается препаратом экзосом, выделенных культурой клеток K562/i-S9, и содержащим, по данным иммуноферментного анализа, белок в количестве 0,9-1,5 мкг/106 клеток, антигены СЕА в количестве 0,045-0,075 мкг/106 клеток и 5Т4 - 0,03-0,05 мкг/106 клеток, а также лиганды FasL - менее 0,005 мкг/106 клеток и TRAIL - менее 0,004 мкг/106 клеток.

Задача также решается способом иммунотерапии солидных опухолей, заключающимся в вакцинации пациента комбинацией препарата экзосом ОНКОСОМ и олигодезоксинуклеотида Р-типа ОДНП, представляющего собой последовательность GGGGCGCCGTGATGGCGAGCGCGCC, которые вводят подкожно в течение не менее 2 месяцев и не реже 1 раза в неделю в эффективном количестве, предпочтительно в дозах 0,01-0,04 мг/кг каждый и предпочтительно 3-8 раз в течение 2 месяцев.

Для повышения эффективности лечения в течение периода вакцинации можно перорально вводить препарат - ингибитор ревертазы. Ингибиторы ревертазы подавляют образование собственных экзосом опухолевых клеток пациента, которые маскируют действие антител к опухолевым антигенам. Можно использовать любые известные препараты - ингибиторы ревертазы (Ставудин, Фосфазид, Ламивудин и другие) и применять их по известным специалистам схемам.

Технический результат изобретения заключается в повышении уровня иммунного ответа (гуморального и клеточного) и снижении титров онкомаркеров у добровольцев.

В качестве продуцента ОНКОСОМа предлагается клеточная линия K562/i-S9, известная специалистам как мощный продуцент антигенов СЕА и 5Т4, со сниженной способностью к продукции FasL и TRAIL. В рамках этого аспекта предлагается совместное введение ОНКОСОМ и ОДНП подкожно в дозах 0,01-0,04 мг/кг каждый, предпочтительно в дозе 0,03 мг/кг и 0,02 мг соответственно. Еще лучшие результаты дает сочетанная терапия с использованием введения ингибиторов RT по схемам, известным специалистам.

Одним из аспектов указанной задачи является разработка и использование олигодезоксинуклеотида (ОДН) Р-типа (ОДНП), отличительной чертой которых являются два палиндрома. Они позволяют сформировать дуплекс, который активирует В- и плазмацитоидные дендритные клетки, а также вызывают существенно большее количество IFN-α по сравнению с С-типом ODNs (Samulowitz U., Weber М., Weeratna R. A novel class of immune-stimulatory CpG oligodeoxynucleotides unifies high potency in type Interferon induction with preferred structural properties // Oligonucleotides 2010; 20(2): 93-101).

Достичь решения поставленной задачи позволяет использование в предлагаемом способе ОНКОСОМ, ОДНП и предпочтительно ингибиторов RT. Предлагаемый в изобретении ОДНП (ОДН Р-типа) обладает мощным антимутагенным, антикластогенным эффектом, интерфероногенным и иммуномодулирующим действием, а также антивирусной активностью.

Не претендуя на исчерпывающее и окончательное научное обоснование положительного влияния на организм предлагаемой композиции, считается (на основании существующего знания в данной области), что в механизме реализации противоопухолевого действия ОДНП ключевую роль играет специфическая активация иммунной реакции.

Основанием для такого вывода являются полученные авторами данные о стимуляции выработки α- и γ-интерферонов, IL-6.

Позитивный иммуномодулирующий эффект выявлен также у вакцинированных ОНКОСОМом добровольцев, страдающих опухолевой патологией, с параллельным лечением ингибиторами RT.

Далее изобретение поясняется неисчерпывающими примерами вариантов выполнения и чертежами, которые предназначены только для демонстрации осуществимости изобретения, но не для ограничения.

Краткое описание чертежей

На фиг. 1 представлены электронные фото препаратов ОНКОСОМ и ЭПОМ, в которых присутствуют частицы бактериофага MS2.

На фиг. 2 представлены результаты иммуноферментного анализа (ИФА). На осях: абсцисса - антигены (указаны название), ордината - величина оптической плотности при 435 нм (OD435). Первые двенадцать столбцов - ЭПОМ, вторые двенадцать столбцов - ОНКОСОМ.

На фиг. 3 представлены результаты ИФА ОНКОСОМа с помощью анти-ЭПОМ IgG.

На фиг. 4 представлены результаты индукции интерферона-α ряда ОДНП.

Подробное раскрытие изобретения

Способ получения ОНКОСОМа

Чтобы получить из клеток K562/i-S9 экзосомы методом теплового шока, клетки сначала культивировали при 37°С в течение 43 ч, затем переносили в 43°С (водяная баня) на 1 ч, а затем регенерировали при 37°С в течение 4 ч. Затем клетки замораживали с помощью жидкого азота и гомогенизировали до порошкообразного состояния. Гомогенат облучали УФ-светом 25 минут, а затем осаждали клеточные фрагменты 15 мин при 6000 об/мин. В прозрачный супернатант добавляли 96° этиловый спирт до концентрации 84°. Осадок, полученный осаждением при 60000 g в течение 20 мин, растворяли в дистиллированной воде и после ультрафильтрации сушили лиофильно. Чистоту полученного препарата ОНКОСОМ препарата проверяли электронно-микроскопическим методом. Концентрацию частиц определяли в мкг на 106 клеток. Присутствие антигенов СЕА и 5Т4, а также FasL и TRAIL, определяли при помощи ИФА с коммерческими наборами.

Токсичность препарата определяли в Lal-тесте.

Способ получения ОДНП.

ОДНП синтезируется в направлении от 3′- к 5′-концу. В ходе синтеза 3′-концевой олигонуклеотид ковалентно связан с твердофазным носителем - CPG (controlled poreglass). Мономерами при синтезе служат фосфорамидиты нуклеозидов, и синтез начинается с деблокирования нуклеозида, находящегося на 5′-конце синтезируемого ОДНП, при этом с 5′-ОН группы удаляется диметокситритильная (DMTr) защитная группа (стадия 1).

Следующая стадия - конденсация, при которой активированный фосфорамидит нуклеозида ковалентно присоединяется к свободной 5′-гидроксильной группе концевого детритилированного нуклеозида (стадия 2). Эффективность такого присоединения составляет около 99%. Для того, чтобы не накапливалось ошибочных олигонуклеотидов за счет оставшегося 1% непрореагировавших 5′-концевых гидроксильных групп, их блокируют ("кэпируют") с помощью реакции ацетилирования. Минимальное количество молекул, которые оказались незаблокированными в процессе реакции "кэпирования", продолжают участвовать в синтезе, и в результате после последнего цикла синтеза образуются более короткие продукты (олигонуклеотиды с пропущенными основаниями).

После реакции конденсации и "кэпирования" два концевых основания синтезируемого ОДНП оказываются связанными нестабильной фосфитной три-эфирной связью. Перевод ее в стабильную фосфотриэфирную связь осуществляется за счет реакции окисления (стадия 3), которая завершает цикл присоединения одного основания. Далее вновь следует стадия детритилирования (стадия 4) и цикл повторяется. После присоединения последнего основания олигонуклеотид снимается с твердой фазы и с него удаляются оставшиеся защиты, что приводит к получению целевого ОДНП.

Выход целевого продукта в процессе синтеза равен эффективности реакции конденсации в степени (n-1), где n - длина олигодезоксинуклеотида. Эффективность конденсации в течение реакции находится на уровне 99-99,5%. Таким образом, выход, к примеру, олигодезоксинуклеотида длиной 25 нуклеотидов равен 80-90%.

Хранение ОДНП. Для длительного хранения или длительной транспортировки ОДНП рекомендуется лиофилизировать. В таком состоянии при температуре -20°С ОДНП могут храниться в течение нескольких лет, при комнатной температуре - от нескольких месяцев до нескольких лет. Растворять ОДНП рекомендуется в стерильной деионизованной воде или в стерильном ТЕ-буфере (10 мМ Tris рН 8.0, 1 мМ EDTA).

Определение концентрации ОДНП.

Концентрацию ОДНП (в пмоль /мкл) определяют по формуле:

[С]=ОД260·100/1,54·А+0,75·С+1,17·G+0,92·Т

где А, С, G, Т - количество соответствующих нуклеотидов в последовательности ОДНП. При использовании указанных количеств реагентов оптическая плотность обычно составляет 18-20. Расчет концентрации ОДНП показывает, что эта величина колеблется от 65 до 75 пмоль/мкл. Исходя из того, что конечная концентрация олигодезоксинуклеотидов в составе набора равна 2,5 пмоль/мкл, а расход каждого олигодезоксинуклеотида на реакцию составляет 2 мкл, полученного количества ОДНП достаточно для комплектации 70-80 наборов, в зависимости от выхода синтезированных ОДНП.

Полученный препарат хранят в холодильнике при температуре минус (20+5)°С. В этих условиях препарат сохраняет свою активность до 1 года.

Биологическая активность ОДНП.

Исследование интерферон-индуцирующей активности ОДНП проводили прямой индукцией в донорской крови. Гепаринизированная кровь была получена от 10 анонимных здоровых доноров различного возраста, пола и комплекции. Для каждого эксперимента 250 мкл сыворотки крови смешивались с 250 мкл среды RPMI-1640 (Sigma, США), а также с 50 мкл PBS, содержащего различные количества препарата ОДНП. Смесь инкубировалась 20 ч при 37°С, а затем использовалась для определения интерферона. Определение интерферона-α проводили методом твердофазного иммуноферментного анализа (ИФА) с помощью ИФА-набора (ООО «Цитокин», Россия) согласно рекомендациям производителя. Клеточный интерфероновый тест проводили в НИИ эпидемиологии и микробиологии имени Н.Ф. Гамалеи РАМН по методике обработки VSV культуры фибробластов человека. Статистический анализ экспериментов продемонстрировал удовлетворительную достоверность, не требующую дальнейшего увеличения количества экспериментов.

На фиг. 4 представлен график, иллюстрирующий индукцию интерферона при введении ОДНП.

Изучение стимуляции В-клеток препаратом ОДНП проводили в ГП «ГНЦ Институт Иммунологии ФМБА России» (Москва) по стандартной методике. Исследовали влияние ОДНП на гуморальный тимусзависимый иммунный ответ, оцениваемый по количеству антителообразующих клеток в селезенке мышей, иммунизированных эритроцитами барана. Для эксперимента использовались 4 группы мышей, состоящие из 10 животных каждая. Каждой группе проводилась инъекция, представляющая соответственно отрицательный контроль (PBS), положительный контроль (полиакрилат 80 кДа) и две концентрации ОДНП, растворенные в PBS. Через 3 ч после инъекции мыши были иммунизированы 5·106 эритроцитов барана. Количество антителообразующих клеток (АОК) на селезенку мыши было определено методом локального гемолиза в агаре по Ёрне и Нордину. Параллельно определялось количество мононуклеаров на селезенку. Статистический анализ экспериментов продемонстрировал удовлетворительную достоверность, не требующую дальнейшего увеличения количества экспериментов.

Пример 1. Получение ОДНП.

Автоматический синтез олигонуклеотидных блоков основан на твердофазном методе, который позволяет на программируемом синтезаторе проводить синтез многочленных олигонуклеотидов. Для этого готовят растворы фосфорамидитных производных каждого нуклеотида и тетразол. Процедура состоит из этапов приготовления навески каждого препарата в пенициллиновых флаконах (предварительно очень хорошо промытых и стерилизованных сухим жаром), сушки каждого фосфорамидитного производного и тетразола под вакуумом в течение 2 ч при давлении в эксикаторе не более 0,2-0,3 атм. Для большей эффективности обезвоживания на дно эксикатора помещают предварительно прокаленный сорбент (например, CaCl2).

Приготовление растворов тетразола и фосфорамидитов A, G, С, Т (для одной пары олигонуклеотидов). К 280 мг тетразола во флаконе с помощью мерной пипетки на 20 мл добавляют 20 мл ацетонитрила. К 150 мг осушенного фосфорамидита во флаконах добавляют с помощью мерных пипеток на 5 и 10 мл ацетонитрил в следующих количествах:

для получения раствора фосфорамидита А - 4,6 мл;

для получения раствора фосфорамидита G - 4,7 мл;

для получения раствора фосфорамидита С - 4,8 мл;

для получения раствора фосфорамидита Т - 5,3 мл.

Подготовку к работе ДНК-синтезатора, заправку емкостей исходными растворами, входящими в комплект прибора, а также растворами тетразола, фосфорамидитов A, G, С, Т и ацетонитрилом, подключение двух кассет с полимерным носителем, содержащим первые нуклеотиды синтезируемых олигонуклеотидов ОДНП (в каждой кассете - один из пары олигонуклеотидов) и синтез выполняют в соответствии с Инструкцией по эксплуатации синтезатора.

Кассеты, в которых находятся синтезированные олигонуклеотиды, переносят из ДНК-синтезатора каждую в отдельную пробирку типа Eppendorf на 1,5 мл с крышкой. Пробирки уравновешивают на технических весах, помещают в ротор центрифуги и центрифугируют при 2000 об/мин в течение 1 мин. После остановки ротора каждую из кассет переносят в аналогичную чистую пробирку. Надосадочную жидкость отбрасывают.

В пробирки с осушенными кассетами добавляют по 1 мл 35% нашатырного спирта, уравновешивают на технических весах, помещают в ротор центрифуги и центрифугируют при 2000 об/мин в течение 1 мин. После остановки ротора каждую из пробирок с кассетой переносят в отдельный флакон, плотно закрывают крышкой и помещают в термостат на 16 ч при 4°С.

Флаконы, содержащие пробирки с кассетами, вынимают из термостата и оставляют в помещении на 1 ч, чтобы охладить до комнатной температуры. Затем каждую из кассет переносят в аналогичную чистую пробирку. Оставшуюся в каждой пробирке жидкость, содержащую один из синтезированных олигонуклеотидов, сохраняют. Пробирки с кассетами уравновешивают на технических весах, помещают в ротор центрифуги и центрифугируют при 2000 об/мин в течение 2 мин. После остановки ротора кассеты извлекают, а оставшуюся жидкость, также содержащую синтезированные олигонуклеотиды, объединяют с предыдущими порциями, полученными после термостатирования кассет.

Процесс очистки олигонуклеотидов состоит из освобождения олигонуклеотидов от полимерной основы, на которой происходит синтез олигонуклеотидов. Олигонуклеотиды переводят в раствор нашатырного спирта, освобождают от последнего и низкомолекулярных примесей посредством хроматографии на колонке с сефадексом G-25. При использовании указанных количеств реагентов получают по 0,7 мл раствора каждого олигонуклеотида в деионизованной воде. Восемь хроматографических колонок объемом по 5 мл каждая, заполненные сефадексом G-25, уравновешивают стерильной деионизованной водой. На поверхность сефадекса каждой колонки наносят с помощью шприца жидкость, собранную при выполнении операции (каждый олигонуклеотид - на отдельную колонку). После полного вхождения нанесенной жидкости в сефадекс на поверхность вновь наслаивают с помощью шприца по 0,7 мл стерильной деионизованной воды. После прохождения свободного объема (5 мл) собирают по 0,7 мл элюата с каждой колонки.

Отбирают по 10 мкл раствора каждого олигонуклеотида, полученного при выполнении. Каждую пробу элюата с сефадекса G-25 переносят в отдельную пробирку типа Eppendorf на 1,5 мл и доводят объем стерильной деионизованной водой до 1 мл. Каждую пробу переносят в кварцевую кювету, помещают в спектрофотометр и проводят определение оптической плотности (ОД) проб при 260 нм.

Полученные ОДНП имеют обобщенную структуру:

GGGGCGCCGXGXXGGCGXGCGCGCC

Пример 2. Определение концентрации белка в препарате ОНКОСОМ

Для определения концентрации белка препарат ОНКОСОМ, полученный из 106 клеток, суспендировали в 20 мМ Трис-HCl буфере с 1% тритоном-X100. Содержание белка было измерено спектрофометрически (при 280 нм), используя в качестве стандартного контроля раствор бычьего сывороточного альбумина (BSA) в аналогичном буфере.

Пример 3. Определение концентрации антигенов в препарате ОНКОСОМ

Для определения концентрации антигенов в препарате ОНКОСОМа, полученного из 106 клеток СЕА, 5Т4, FasL и TRIAL использованы коммерческие наборы, известные специалистам.

На фиг. 2 показаны результаты ИФА. На осях: абсцисса - антигены (указаны название), ордината - величина оптической плотности при 435 нм (OD435). Первые 12 столбцов - ЭПОМ (три серии препаратов), вторые 12 столбцов - ОНКОСОМ (три серии препаратов).

На фиг. 3 тредставлены результаты торможения иммуноферментного анализа (ИФА) ОНКОСОМа с помощью анти-ЭПОМ IgG, истощенных антигенами ТВГ; РЭА; FasL и TRIAL.

Ряды В-Е (горизонтальные) представляют результаты торможения ИФА четырех определений одного и того же препарата ОНКОСОМ с помощью четырех различных препаратов анти-ЭПОМ IgG. Контролем служили результаты определения РЭА в препарате ЭПОМ с помощью анти-ЭПОМ IgG (F ряд).

Вертикальные ряды (обозначены ТВГ; РЭА; FasL и TRIAL) образованы лунками, в которых находится стандартный препарат ОНКОСОМа, с которым взаимодействуют IgG, истощенные соответствующими антигенами. Результаты с неокрашенными или слабоокрашенными лунками указывают на присутствие в препарате анти-ЭПОМ IgG лишь соответствующего антигена или очень малую концентрацию других трех антигенов. Тем самым представленный результат показывает, что лишь один препарат анти-ЭПОМ IgG содержит высокие концентрации антител против всех указанных выше антигенов. Препарат ОНКОСОМ в тех же экспериментах показал присутствие всех указанных видов антигенов (онкомаркеров) в высокой концентрации.

Пример 5. Определение количества экзосом в препарате ОНКОСОМ

На покрытые фамваром сетки для микроскопии (200 или 300 ячеек) помещали капли конценрированного препарата ОНКОСОМа (5 мкл), разбавленного в PBS1:10 и 1010 частиц фага MS2. Смесь окрашивали 1%-ным уранил ацетатом и сетки наблюдали в JEM-100C (ускоряющее напряжение 120 кВ). Размер и количество экзосом рассчитывали из соотношения размеров частиц фага MS2 и экзосом.

Из электронных фото на фиг. 1 препаратов ОНКОСОМ (слева) и ЭПОМ (справа) видно, что структуры, идентифицированные как экзосомы, присутствуют в обоих препаратах (типичные структуры обведены кружками пунктирной линии), однако размеры экзосом в препарате ОНКОСОМ имеют большую регулярность (для сравнения приведен отрезок базовой линии длиной 100 мкм и большую электронную плотность (более темные), что указывает на большую концентрацию белка, включенного в структуры.

В таблице 1 приведены результаты применения комбинации ОНКОСОМа и ОДНП с ингибиторами ревертазы для лечения.

Оценка количества ДНК ретротранспозонов человека в крови больных (титр retroDNA) осуществлялась методом количественного ПЦР с праймерами, структура которых известна специалистам (проводит ООО «Инвитро»).

Оценка QL100 (показатель качества жизни) осуществлялась путем опроса, проводимого лечащим врачом, по Вопроснику ВОЗКЖ - 100 (Анкета Всемирной организации здравоохранения).

Из таблицы 1 видно снижение у всех пациентов показателя онкомаркера FasL(TRIAL) и повышение качества жизни.

В таблице 2 приведены результаты применения комбинации ОНКОСОМа и ОДНП для профилактики. Также видно снижение у пациента показателя онкомаркера FasL(TRIAL) и повышение содержания интерферона.

Ниже приведены дополнительные примеры лечения с использованием изобретения.

Пример 6.

Пациент Г-в, 57 лет. Не курит, питание правильное, преподаватель, регулярные занятия спортом, до последнего времени большое количество половых партнеров (женщины), употребляет «Виагру» (100 мг), страдает аденомой предстательной железы 15 лет (после постановки диагноза, количество ПСА (связанного) в крови - 47,8 нг/мл, свободного - 140 нг/мг).

Проведена кратная (раз в две недели) вакцинация ОНКОСОМом (доза - 0,3 мг) на фоне введения ОДНП адъюванта (доза - 2 мг) в течение 3 месяцев. Положительная кожная реакция появилась после третьей вакцинации (5 недель после начала вакцинации; легкая инфильтрация). Через 7 недель кожная реакция усилилась и держалась 10 недель. Образ жизни не изменился, показатели приблизились к норме (14 недель после вакцинации, количество ПСА (связанного) в крови - 4,2 нг/мл, свободного - 14 нг/мг).

Пример 7.

Пациент М-ов, 59 лет, бизнесмен, холерический тип, питание неправильное и нерегулярное, анализ крови в норме. Выявлен рак желудка (метастазирующий).

Проводили еженедельные вакцинации ОНКОСОМом (доза - 0,3 мг) на фоне введения ОДНП адъюванта (доза - 2 мг). Вакцинацию проводили кратно в течение 3 месяцев. Одновременно принимался препарат Ставудин по 0,03 г 2 раза в день в течение первых 1,5 месяцев. Образ жизни не изменился. Через 1,5 года наблюдений выявлены положительные сдвиги (см. таблицу 1). Через 2 года после начала вакцинации пациент выехал на ПМЖ за границу.

Таблица 1

Пациент Возраст диагноз (стадия) Лечение, период Качество экзосом/мкл; до/после лечения Титр (pg) FasL(TRIAL); до/после лечения Титр retroDNA (геном-эквивалентов); до/после лечения QL100-качество жизни; до/после лечения
Г-в А. 57; рак предстательной железы (3) Введение ОНКОСОМ и ОДНП; 4 месяца 1 р/нед 103/<10 7(12)/2(4) 105/<102 73/91
М-в Л. 59; рак желудка (4) После операции, введение ОНКОСОМ и ОДНП; 3 месяца 1 р/нед; Ставудин 104/<10 14(23)/4(5) 107/<103 63/79 (уехал за границу на ПМЖ через 1,5 года наблюдения)
Г-о В. 58; рак поджелудочной железы (3) Введение ОНКОСОМ и ОДНП; 4 месяца 1 р/нед 103/<10 9(11)/2(5) 106/<102 70/92 (после выписки из ОНЦ пациент жил ещё 2,5 года)

Таблица 2

Пациент Возраст диагноз (стадия) Лечение, период Качество экзосом/мкл; до/после лечения Титр (pg) FasL(TRIAL); до/после лечения Титр retroDNA (геном-эквивалентов); до/после лечения QL100-качество жизни; до/после лечения
С-в И. 65; аденома предстательной железы (3) Введение ОНКОСОМ и ОДНП; раз в год 10/<10 5(8)/3(2) 102/<101 83/92

1. Способ иммунотерапии солидных опухолей, заключающийся в вакцинации пациента комбинацией препарата экзосом и олигодезоксинуклеотида Р-типа, при этом препарат включает экзосомы, выделенные культурой клеток K562/i-S9, и содержит, по данным иммуноферментного анализа, белок в количестве 0,9-1,5 мкг/106 клеток, антигены CEA в количестве 0,045-0,075 мкг/106 клеток и 5Т4 - 0,03-0,05 мкг/106 клеток, а также лиганды FasL - менее 0,005 мкг/106 клеток и TRAIL - менее 0,004 мкг/106 клеток, а олигодезоксинуклеотид Р-типа представляет собой последовательность нуклеотидов GGGGCGCCGTGATGGCGAGCGCGCC, указанную комбинацию вводят подкожно в течение не менее 2 месяцев и не реже 1 раза в неделю в эффективном количестве, предпочтительно в дозах 0,01-0,04 мг/кг каждый.

2. Способ по п. 1, отличающийся тем, что в течение периода вакцинации перорально вводят препарат - ингибитор ревертазы в эффективных дозах.

3. Препарат экзосом для использования в способе по п. 1 или 2, включающий экзосомы, выделенные культурой клеток K562/i-S9, и содержащий, по данным иммуноферментного анализа, белок в количестве 0,9-1,5 мкг/106 клеток, антигены CEA в количестве 0,045-0,075 мкг/106 клеток и 5Т4 - 0,03-0,05 мкг/106 клеток, а также лиганды FasL - менее 0,005 мкг/106 клеток и TRAIL - менее 0,004 мкг/106 клеток.



 

Похожие патенты:

Изобретение относится к медицине, а именно к иммунологии, и может быть использовано для применения производного олигохитозана в качестве адъюванта для вакцин. Производное олигохитозана состоит из звеньев глюкозамина 91-98% и (N-ацил)глюкозамина 2-9% с молекулярной массой от 5 до 15 кДа.

Группа изобретений относится к медицине, фармакологии и касается способов снижения продолжительности или тяжести воспалительного иммунного ответа у субъекта, а также фармацевтической композиции, содержащей как таковые карбоксилированные частицы.

Изобретение относится к биохимии. Описано применение антител или их фрагментов, которые специфично связывают hDH4 и блокируют взаимодействие между Dll4 и Notch-рецептором для предупреждения, лечения или ослабления сахарного диабета 1-го типа у субъекта.

Данное изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5 человека, охарактеризованное последовательностями гипервариабельных участков (HVR), и его антигенсвязывающий фрагмент.

Изобретение относится к области иммунологии и медицины. Предложено применение антитела или его антиген-связывающего фрагмента, которые специфически связываются с дельта-подобным лигандом 4 (Dll4) человека, в предупреждении рецидивирования рассеянного склероза или снижении развития данного заболевания при его рецидивировании у субъекта.

Изобретение относится к новым соединениям общей формулы (I), где каждый из m и n независимо представляет собой 0 или 1; R1 и R2, вместе с атомом углерода, к которому они присоединены, образуют гетероциклическое кольцо, содержащее один или два гетероатома, выбранных из кислорода, серы, -S(O)- и -S(O)2-; R3 представляет собой -CHF2, -CF3, -OCHF2, -OCF3, -SCHF2 или -SCF3; или их фармацевтически приемлемым солям, гидратам или сольватам, а также к фармацевтическим композициям на их основе, а также к способу лечения воспалительных заболеваний, так как эти соединения проявляют активность ингибирования PDE4 и могут быть полезными при лечении воспалительных заболеваний и расстройств.

Изобретение относится к соединению формулы (1), где R1 выбирают из группы, состоящей из гидроксигруппы и ее физиологически гидролизуемых сложных эфиров и -NR8R9, где R8 и R9 независимо выбирают из группы, состоящей из водорода и незамещенного (С1-С3)алкила; R2 и R3 независимо выбирают из группы, состоящей из водорода или незамещенного (С1-С3)алкила; каждый из R4 независимо выбирают из группы, состоящей из галогена и незамещенного (С1-С3)алкила, а n представляет собой целое число от 0 до 4; каждый из R5 независимо выбирают из группы, состоящей из галогена и незамещенного (С1-С3)алкила, a m представляет собой целое число от 0 до 3; R6 представляет собой незамещенный циклогексил или циклогексил, замещенный (С1-С6)алкилом, галогеном или трифторметилом; и его фармацевтически приемлемые соли.

Настоящее изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5, охарактеризованное последовательностями HVR.

Изобретение относится к соединениям формулы (I), где Y означает 6-членный гетероарил, содержащий 1-2 атома азота; R2 выбирают из OR14 и NR6R7; каждый из R6 и R7 независимо выбирают из H, C1-C12 алкила, C3-C12 циклоалкила, 6-членного гетероцикла, содержащего 1 атом азота, или бензила, где указанные алкил, циклоалкил или бензил необязательно замещены одной или более группами, независимо выбираемыми из -F, -OR8, -NR12SO2R13, -C(=O)NR12R13, или R6 и R7, вместе с атомом азота, к которому присоединены, образуют 5-6 членное гетероциклическое кольцо, содержащее 1 атом азота, и указанное 5-6 членное гетероциклическое кольцо необязательно замещено одним или более -ОН; R8 выбирают из водорода и C1-C12 алкила, и каждый из R12, R13 и R14 независимо выбирают из H и C1-C12 алкила, где указанный алкил необязательно замещен -OH; или их таутомерам, энантиомерам или фармацевтически приемлемым солям.
Изобретение относится к медицине, а именно к терапии и иммунологии, и касается лечения системной красной волчанки. Для этого осуществляют комплексное лечение, состоящее из двух десятидневных этапов.

Группа изобретений относится к комбинированной терапии солидной опухоли или рака. Предложены: фармацевтический продукт в виде комбинированного препарата указанного назначения, содержащий в качестве активного агента {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его фармацевтически приемлемую соль и пег-интерферон альфа-2а; набор того же назначения, включающий вышеперечисленные активные агенты; применение {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его соли и пег-интерферона альфа-2а в лечении солидной опухоли или рака; применение {3-[5-(4-хлор-фенил)-1H-пирроло[2,3-b]пиридин-3-карбонил-2,4-дифтор-фенил]-амид}пропан-1-сульфоновой кислоты или его соли и пег-интерферона альфа-2а для производства лекарственного средства для лечения солидной опухоли или рака.

Изобретение относится к новым соединениям формулы 10 и способу их получения. Соединения обладают свойствами ингибиторов рецепторной тирозинкиназы типа I и могут быть использованы при лечении гиперпролиферативных нарушений.

Данное изобретение относится к соединениям или их фармацевтически приемлемым солям общей формулы I, где R1 представляет собой ;R2 выбирают из группы, состоящей из замещенного или незамещенного фенила и , и ; и R3, R4, R5 и R6 все представляют собой Н, также к соединениям II и III.

Изобретение относится к химиотерапии. Предложен способ лечения рака, отличающегося от меланомы, заключающийся в апоптозе раковых клеток.

Изобретение относится к медицине, а именно к онкологии, и касается лечения рака у человека. Для этого вводят соединение формулы в интервале суточных доз от 20 мг до 1500 мг.
Изобретение относится к медицине, а именно к онкологии. Сочетают хирургический метод лечения с интраоперационной внутриартериальной химиотерапией.

Изобретение относится к соединениям формулы I и их фармацевтически приемлемым солям, где R1, R2, R3, R4, R5 и R6 имеют значения, указанные в формуле изобретения. Соединения формулы I являются ингибиторами тирозинкиназ III типа, и, в частности, cFMS.

Настоящее изобретение относится к новым трициклическим производным пиррола формулы (I) или их фармацевтически приемлемым солям, которые модулируют активность протеинкиназ, выбранных из MPS1, PIM-1 и PIM-2.

Изобретение относится к ингибиторам HDAC формулы (I) или их фармацевтически приемлемым солям, эфирам или стереоизомерам, где R1 представляет собой водород или галоген; R2 представляет собой водород, C1-4-алкил; R3 представляет собой фенил, незамещенный или замещенный один, или два, или три раза галогеном, C1-4-алкилом, C1-4-алкокси, C1-4-алкилсульфонилом, циано, трифторметилом, фенилом, фенокси, пирролилом, имидазонилом, оксазолилом или ди C1-4-алкиламино-C1-4-алкокси; нафталинил; хинолинил; C3-7-циклоалкил; фенилалкил, где фенил может быть не замещен или один или два раза замещен галогеном, C1-4-алкокси, фенилом; нафталинилалкил; фенилциклоалкил; пиримидинил; фенилсульфонил, где фенил может быть не замещен или один или два раза замещен галогеном, фенилом; или фенилкарбонил, где фенил может быть не замещен или один или два раза замещен галогеном, C1-4-алкокси; R4 представляет собой водород или C1-4-алкил; Y представляет собой -СН2- или -С=O; или R4 и Y вместе с атомом углерода, к которому R4 присоединен, могут образовывать фенильное кольцо или пиридиновое кольцо, которое может быть не замещено или дополнительно замещено галогеном; при условии, что R2 представляет собой C1-4алкил; А представляет собой -С=O, -СН2- или -СН-алкил, при условии, что А и Y одновременно не представляют собой -С=O.
Изобретение относится к медицине, онкологии, и может быть использовано для повышения эффективности комбинированного лечения операбельного немелкоклеточного рака легкого (НМРЛ) III стадии.
Изобретение относится к фармацевтическим композициям из сырья животного происхождения и может быть использовано для лечения и реабилитации различных видов эндометриоза и некоторых онкологических заболеваний.
Наверх