Апоптоз раковой клетки


 


Владельцы патента RU 2592230:

Э-ТЕРАПЬЮТИКС ПиЭлСи (GB)

Изобретение относится к химиотерапии. Предложен способ лечения рака, отличающегося от меланомы, заключающийся в апоптозе раковых клеток. Способ предусматривает введение терапевтически эффективного количества дексанабинола или его соли, или сольвата, где рак представляет собой один или более из следующих: рак печени, рак пищевода, рак поджелудочной железы, мелкоклеточный рак легкого и карцинома желудка. Технический результат состоит в апоптозе раковых клеток и в их пониженной устойчивости к дексанабинолу по сравнению с применяемыми в настоящее время химиотерапевтическими агентами. 10 з.п.ф-лы, 3 пр., 1 табл.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к лекарственным средствам и способам лечения рака и, в частности, к терапии, обеспечивающей апоптоз раковых клеток. Более конкретно, изобретение относится к дексанабинолу или его производному для лечения отличающихся от меланомы раковых заболеваний с помощью апоптоза.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

Дексанабинол является 1,1-диметилгептил-(3S,4S)-7-гидрокси-Δ6-тетрагидроканнабинолом, раскрытым в патенте США № 4876276. Дексанабинол представляет собой каннабиноид без психотропных эффектов, который ранее продемонстрировал в исследованиях in vitro способность быстрого уничтожения клеток меланомы.

В международной патентной заявке WO 2009/007700 описано применение дексанабинола при лечении раковых клеток меланомы. Апоптотический эффект дексанабинола был описан, но механизм его действия ранее не был раскрыт и не понят в полной мере. Таким образом, применение лекарственного средства для использования в других раковых клетках, кроме меланомы, ранее не предвиделось. В предыдущей заявке было раскрыто, что дексанабинол действует через ингибирование ядерного фактора каппа В (NFκB) в клетках меланомы и таким образом обеспечивает лечение меланомы. Более того, было показано, что в меланоме дексанабинол индуцирует апоптоз и ингибирует пролиферацию клеток.

Авторами обнаружено, что механизм действия дексанабинола является более сложным, чем просто воздействие посредством взаимодействия с NFκB. Инновационным шагом к тому, что рассмотрено в WO '700, является установление дополнительных форм рака, в которых дексанабинол индуцирует апоптоз, в результате полученных новых знаний о механизме действия. Существует сложный профиль связываний, равно как и других непрямых эффектов. Это привело авторов к пониманию того, что дексанабинол является неожиданно функциональным в других типах рака, а не только в меланоме, и что, более того, оказывает желаемый селективный апоптотический эффект. Неожиданно авторами было обнаружено, что дексанабинол является эффективным не только при меланоме, но также при нескольких других видах рака.

Ранее не раскрытый профиль связывания и непрямые эффекты дексанабинола указывают, что он может быть эффективным при индуцировании апоптоза в других формах рака, а не только в меланоме. В ходе проведенных авторами исследований получены новые знания относительно способа его действия, в результате чего установлены формы рака, восприимчивые к индукции апоптоза дексанабинолом. На основании этого были протестированы соответствующие клеточные линии и предположение было подтверждено.

В международной патентной заявке № WO 03/077832 описано применение дексанабинола в уменьшении пролиферации раковых клеток. Более того, данное уменьшение пролиферации описано в связи с регуляцией относящихся к воспалению генов.

WO '832 содержит только подтвержденные свидетельства в отношении опухолей поджелудочной железы и колоректальных опухолей. Результаты экспериментов показывают, что "на пролиферацию Aspc-1 присутствие дексанабинола в концентрации до 15 мкМ не оказало воздействия, тогда как пролиферация клеток Panc-1 при той же концентрации была ингибирована на 26%". Также заявлено, что дексанабинол, "который действует через модуляцию про/антивоспалительных медиаторов, может быть терапевтически эффективным против определенных типов опухолей".

Таким образом, раскрыто применение дексанабинола как средства лечения рака, однако специалистам ясно, что сокращение пролиферации клеток может уменьшить воздействие рака путем предотвращения его распространения или роста, но не окажется фатальным для самого рака, и, следовательно, может потребоваться прибегнуть, например, к хирургическим способам или химиотерапии для того, чтобы вызвать апоптоз клеток рака.

Однако, хотя дексанабинол и оказывает эффект на воспаление и, следовательно, пролиферацию клеток, доказательств того, что он может иметь апоптотический эффект, не имеется.

В WO '832 признается, что механизм действия дексанабинола недостаточно хорошо понят. Фактически, на странице 1, строки 24 и 25, заявлено: "Тем не менее, механизм, лежащий в основе терапевтических эффектов каннабиноидных производных, остается неясным". Более того, в WO '832 описано, что дексанабинол и другие каннабиноиды были бы привлекательными кандидатами для лечения неврологических повреждений в результате травм спинного мозга, церебральной ишемии и нейродегенеративных заболеваний, таких как болезнь Альцгеймера или Паркинсона. Как нетрудно при этом понять, любой апоптотический эффект в таких каннабиноидах был бы нежелателен.

Знание этого вовлекает дексанабинол в лечение этих типов рака, но не через индукцию апоптоза. Эта индукция селективного апоптоза является ключевой и не предполагаемой.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение раскрывает соединение, которое вызывает апоптоз раковых клеток, что предлагает особенно предпочтительную терапию для апоптоза раковых клеток и снижает пролиферацию клеток.

Как было ранее раскрыто, дополнительно к тому, что дексанабинол является неконкурентным блокатором NMDA-рецепторов, он показал способность ингибировать NFκB. Однако в настоящее время авторами неожиданно обнаружено, что дексанабинол обладает способностью активного связывания или оказания косвенного воздействия на ряд белковых сайтов, которые до сих пор не были известны как способные взаимодействовать с дексанабинолом.

Такие белковые сайты включают рецептор N-метил-D-аспартат (NMDA), циклооксигеназу 2 (COX-2), фактор некроза опухоли альфа (TNF-α) и ядерный фактор каппа В (NFκB). Ранее сообщалось о том, дексанабинол активен на этих участках. Однако при этом не указывалось, что дополнительно к своей активности на этих участках дексанабинол также активен на следующих участках: циклин-зависимые киназы, например CDK2/A и CDK5/p25, гистон-ацетилтрансфераза (HAT) и фарнезилтрансфераза.

Механизм действия изучен далее, и в настоящее время установлено, что дексанабинол и его производные оказывают апоптотический эффект на многочисленные раковые клетки.

Таким образом, апоптоз других раковых клеток, кроме меланомы, с дексанабинолом и его производными является сам по себе новым.

Полученное заключение о том, что дексанабинол вызывает апоптоз раковых клеток, предлагает особо предпочтительную терапию, которая уменьшает пролиферацию клеток и вызывает их апоптоз.

Более подробно, известными прямыми и косвенными мишенями дексанабинола являются следующие:

Рецептор N-метил-D-аспартат (NMDA)

Дексанабинол первоначально был разработан как нейрозащитный агент. Его нейрозащитное действие было отнесено к способности блокировать рецептор NMDA. Он стереоспецифически блокирует рецепторы NMDA путем взаимодействия с участком, который близок, но отличен от участков неконкурентных антагонистов NMDA-рецептора и от участков распознавания глутамата, глюцина и полиаминов. В отличие от других неконкурентных антагонистов NMDA-рецептора, дексанабинол не образует психотропных эффектов и в общем хорошо переносится организмом человека.

Циклооксигеназа 2 (COX-2)

Дексанабинол обладает противовоспалительными и антиоксидантными свойствами, не относящимися к его способности блокировать рецепторы NMDA. Противовоспалительное воздействие связывалось со способностью дексанабинола сокращать секрецию PGE2, образованную ферментом циклооксигеназа 2 (COX-2). COX-2 является одной из циклооксигеназных изоформ, вовлеченных в метаболизм арахидоновой кислоты (AA) к простагландинам (PG) и другим эйкозаноидам, семейству веществ, известных своей способностью демонстрировать воспалительные свойства, а также принимать участие в воспалении. Более традиционные НПВП (нестероидные противовоспалительные препараты) ингибируют воздействие COX путем модифицирования ферментативно-активного участка, таким образом, предотвращая трансформацию субстрата AA в PGE2 (Hinz B. et al., J. Pharm. Exp. Ther. 300: 367-375, 2002). Было раскрыто (WO/2003/077832), что ингибиторное действие PGE2, продемонстрированное дексанабинолом, происходит не на уровне ферментативного действия COX-2, а скорее, на уровне генной регуляции.

Фактор некроза опухоли альфа (TNF-α)

Дексанабинол известен своей способностью блокировать образование или действие TNF-α. Данное ингибирование, более вероятно, происходит на посттранскрипционном уровне.

Как раскрыто в международных патентных заявках WO 97/11668 и WO 01/98289, было обнаружено, что дексанабинол блокирует образование или действие TNF-α. Согласно предположению, ингибирование цитокина происходит на посттранскрипционном уровне, поскольку в модели травмы головы дексанабинол не повлиял на уровни TNF-α мРНК (Shohami E. et al., J. Neuroimmuno. 72: 169-77, 1997).

Человеческий TNF-α вначале транслируется в трансмембранный белок-предшественник 27 кД, который разделяется с образованием секретируемой 17 кД формы с помощью TNF-α конвертирующего фермента (TACE). На основании RT-PCR экспериментов в отчете Shohami et al. сообщалось, что дексанабинол не оказывает значительного эффекта на TNF-α мРНК, где он значительно уменьшил уровни TACE мРНК, подтвердив предположение, что лекарственное средство действует на уровни ингибирования секреции.

Ядерный фактор каппа В (NFκB)

Имеется экспериментальное подтверждение того, что дексанабинол косвенно ингибирует ядерный фактор каппа В (NFκB) путем ингибирования фосфорилирования и деградации IKB2.

Juttler, E. et al. (2004) (Neuropharmacology 47(4): 580-92.) предоставил доказательство того, что дексанабинол ингибирует NFkB. Дексанабинол ингибирует (1) фосфорилирование и деградацию NF-каппа В I-kappa-B-alpha и транслокацию NF-каппа В к ядру; дексанабинол уменьшает (2) транскрипционную активность NF-каппа В и (3) мРНК аккумуляцию фактора некроза опухоли альфа генов мишени NF-каппа В и интерлейкина-6 (TNF-альфа и IL-6).

Ранее неизвестными мишенями дексанабинола являются:

Циклин-зависимые киназы CDK2/A и CDK5/p25

Дексанабинол не оказывает значительного прямого действия против CDK2 и CDK5 при прямом исследовании. Однако считается, что он косвенно влияет на CDK и при обстоятельствах, когда продолжает присутствовать большее количество внутриклеточной сети, которая может обусловливать такие эффекты.

Гистон-ацетилтрансфераза (HAT)

Известной мишенью рака является гистон-ацетилтрансфераза. Исследовательские данные относительно того, действует ли дексанабинол на эту мишень, отсутствуют, однако имеется прогнозируемое действие на эту мишень, что, таким образом, может иметь преимущества.

Фарнезилтрансфераза

Известной мишенью рака является фарнезилтрансфераза. Исследовательские данные относительно того, действует ли дексанабинол на эту мишень, отсутствуют, однако имеется прогнозируемое действие на эту мишень.

Как здесь описано, дексанабинол оказывает эффект на более чем один белок, который считается важным в различных видах рака и в терапии рака. Некоторые из этих эффектов являются прямыми, в то время как другие - косвенными. То, что дексанабинол оказывает эффект на различные мишени, очень важно, так как это делает соединение полезным для применения при лечении различных раковых заболеваний.

По данным, полученным в клеточных линиях, дексанабинол является эффективным при раке молочной железы, раке толстой кишки, раке предстательной железы, немелкоклеточном раке легкого и глиобластоме.

Таким образом, согласно первому варианту изобретения предусматривается терапевтический агент, способный оказать эффект на белки N-метил-D-аспартат (NMDA), циклооксигеназу 2 (COX-2), фактор некроза опухоли альфа (TNF-α), ядерный фактор каппа В (NFκB), циклин-зависимые киназы, например CDK2/A и CDK5/p25, гистон-ацетилтрансферазу (HAT) и фарнезилтрансферазу одновременно, последовательно или отдельно. Особое преимущество этого варианта изобретения состоит в том, что, inter alia, предусматривается единый терапевтический агент для связывания вышеупомянутых белков.

Ясно, что в отдельном варианте изобретения предусматривается оказание дексанабинолом или его производными эффекта на белки N-метил-D-аспартат (NMDA), циклооксигеназу 2 (COX-2), фактор некроза опухоли альфа (TNF-α), ядерный фактор каппа В (NFκB), циклин-зависимые киназы, например CDK2/A и CDK5/p25, гистон-ацетилтрансферазу (HAT) и фарнезилтрансферазу одновременно, последовательно или отдельно.

Так, согласно другому варианту изобретения, предусматривается терапевтический агент, способный оказать эффект на белки N-метил-D-аспартат (NMDA), циклооксигеназу 2 (COX-2), фактор некроза опухоли альфа (TNF-α), ядерный фактор каппа В (NFκB), циклин-зависимые киназы, например CDK2/A и CDK5/p25, гистон ацетилтрансферазу (HAT) и фарнезилтрансферазу одновременно, последовательно или отдельно, для апоптоза раковых клеток, где отбираются раковые клетки, выбранные из одного или более из следующих: первичный рак, рак молочной железы, рак толстой кишки, рак предстательной железы, немелкоклеточный рак легкого, глиобластома, лимфома, мезотелиома, рак печени, рак внутрипеченочного желчного протока, рак пищевода, рак поджелудочной железы, рак желудка, рак гортани, рак мозга, рак яичников, тестикулярный рак, рак шейки матки, рак полости рта, рак глотки, рак почки, рак щитовидной железы, рак матки, рак мочевого пузыря, гепатоцеллюлярная карцинома, карцинома щитовидной железы, остеосаркома, мелкоклеточный рак легкого, лейкемия, миелома, карцинома желудка и метастатический рак.

Как описано выше, тот факт, что дексанабинол оказывает прямые или косвенные эффекты на вышеупомянутые белковые сайты, делает его пригодным терапевтическим агентом для апоптоза различных раковых клеток.

Согласно другому варианту изобретения предусматривается дексанабинол или его производное для апоптоза рака у пациента, где рак выбран из одного или более из следующих: карцинома поджелудочной железы, глиобластома, карцинома желудка, карцинома пищевода, карцинома яичника, карцинома почки и карцинома щитовидной железы.

Согласно другому варианту изобретения предусматривается дексанабинол или его производное для апоптоза рака у пациента, где рак выбран из одного или более из следующих: первичный рак, рак молочной железы, рак толстой кишки, рак предстательной железы, немелкоклеточный рак легкого, глиобластома, лимфома, мезотелиома, рак печени, рак внутрипеченочного желчного протока, рак пищевода, рак поджелудочной железы, рак желудка, рак гортани, рак мозга, рак яичников, тестикулярный рак, рак шейки матки, рак ротовой полости, рак глотки, рак почки, рак щитовидной железы, рак матки, рак мочевого пузыря, гепатоцеллюлярная карцинома, карцинома щитовидной железы, остеосаркома, мелкоклеточный рак легкого, лейкемия, миелома, карцинома желудка и метастатический рак.

Таким образом, дексанабинол или его производное используется в терапевтически эффективном количестве. Согласно настоящему изобретению терапевтически эффективное количество означает апоптотически эффективное количество.

Дополнительно к апоптотическому эффекту дексанабинол или его производное может также иметь другие свойства для лечения раковых заболеваний, в зависимости, inter alia, от характера рака, такие как ингибирование опухолегенеза, ингибирование пролиферации клеток, индукция цитотоксичности.

Как ясно из описания механизма действия дексанабинола и его производных, различные виды рака могут апоптотически подвергаться лечению согласно настоящему изобретению. Отдельные виды рака включают, но без ограничения, рак молочной железы, рак толстой кишки, рак предстательной железы, немелкоклеточный рак легкого, глиобластому, лимфому, мезотелиому, рак печени, рак внутрипеченочного желчного протока, рак пищевода, рак поджелудочной железы, рак желудка, рак гортани, рак мозга, рак яичников, тестикулярный рак, рак шейки матки, рак ротовой полости, рак глотки, рак почки, рак щитовидной железы, рак матки, рак мочевого пузыря и метастатический рак. Более специфические виды рака, которые можно упомянуть, включают рак, выбранный из одного или более видов: карцинома поджелудочной железы, глиобластома, карцинома желудка, карцинома пищевода, карцинома яичника, карцинома почки и карцинома щитовидной железы. Дополнительные специфические виды рака, которые можно упомянуть, включают рак, выбранный из одного или более видов: первичный рак, рак молочной железы, рак толстой кишки, рак предстательной железы, немелкоклеточный рак легкого, глиобластома, лимфома и метастатический рак. Таким образом, раковые клетки, которые подвергаются апоптозу согласно изобретению, могут быть предраковыми, злокачественными, метастатическими или обладающими множественной лекарственной устойчивостью и их комбинациями. Авторы, в частности, считают, что дексанабинол или его производное является эффективным в апоптозе метастатических раковых клеток.

В другом варианте изобретения предусматривается применение дексанабинола или его производного при производстве лекарственного средства для апоптоза рака у пациента, где рак выбран из одного или более из следующих: первичный рак, рак молочной железы, рак толстой кишки, рак предстательной железы, немелкоклеточный рак легкого, глиобластома, лимфома, мезотелиома, рак печени, рак внутрипеченочного желчного протока, рак пищевода, рак поджелудочной железы, рак желудка, рак гортани, рак мозга, рак яичников, тестикулярный рак, рак шейки матки, рак ротовой полости, рак глотки, рак почки, рак щитовидной железы, рак матки, рак мочевого пузыря, гепатоцеллюлярная карцинома, карцинома щитовидной железы, остеосаркома, мелкоклеточный рак легкого, лейкемия, миелома, карцинома желудка и метастатический рак.

В одном предпочтительном варианте изобретения предусматривается применение дексанабинола или его производного при производстве лекарственного средства для апоптоза рака у пациента, где рак выбран из одного или более из следующих: карцинома поджелудочной железы, глиобластома, карцинома желудка, карцинома пищевода, карцинома яичника, карцинома почки и карцинома щитовидной железы. В другом предпочтительном варианте изобретения предусматривается применение дексанабинола или его производного при производстве лекарственного средства для апоптоза рака у пациента, где рак выбран из одного или более из следующих: первичный рак, рак молочной железы, рак толстой кишки, рак предстательной железы, немелкоклеточный рак легкого, глиобластома, лимфома и метастатический рак.

Согласно данному варианту настоящего изобретения предусматривается применение, как описано выше, где вводимое пациенту количество дексанабинола или его производного является достаточным для достижения концентрации дексанабинола в плазме от 10 до 20 мкМ.

Согласно другому варианту изобретения предусматривается применение, как описано выше, где вводимое пациенту количество дексанабинола или его производного является достаточным для достижения концентрации терапевтического агента в плазме по меньшей мере 10 мкМ и поддержания у пациента в течение по меньшей мере 2 часов.

Согласно еще одному варианту изобретения предусматривается способ лечения раковых заболеваний, заключающийся в апоптозе рака, который состоит из введения нуждающемуся пациенту апоптотически эффективного количества дексанабинола или его производного, где рак выбран из одного или более из следующих: первичный рак, рак молочной железы, рак толстой кишки, рак предстательной железы, немелкоклеточный рак легкого, глиобластома, лимфома, мезотелиома, рак печени, рак внутрипеченочного желчного протока, рак пищевода, рак поджелудочной железы, рак желудка, рак гортани, рак мозга, рак яичников, тестикулярный рак, рак шейки матки, рак ротовой полости, рак глотки, рак почки, рак щитовидной железы, рак матки, рак мочевого пузыря, гепатоцеллюлярная карцинома, карцинома щитовидной железы, остеосаркома, мелкоклеточный рак легкого, лейкемия, миелома, карцинома желудка и метастатический рак.

В одном предпочтительном варианте изобретения предусматривается способ лечения рака, как описано выше, где рак выбран из одного или более из следующих: карцинома поджелудочной железы, глиобластома, карцинома желудка, карцинома пищевода, карцинома яичника, карцинома почки и карцинома щитовидной железы. В другом предпочтительном варианте изобретения предусматривается способ лечения рака, как описано выше, где рак выбран из следующих: первичный рак, рак молочной железы, рак толстой кишки, рак предстательной железы, немелкоклеточный рак легкого, глиобластома, лимфома и метастатический рак.

В настоящем изобретении, в частности, предусматривается способ лечения раковых заболеваний, заключающийся в апоптозе рака, который предусматривает введение нуждающемуся пациенту апоптотически эффективного количества агента, способного оказывать прямой или непрямой эффект на белки N-метил-D-аспартат (NMDA), циклооксигеназу 2 (COX-2), фактор некроза опухоля альфа (TNF-α), ядерный фактор каппа В (NFκB), циклин-зависимые киназы, например CDK2/A и CDK5/p25, гистон-ацетилтрансферазу (HAT) и фарнезилтрансферазу одновременно, последовательно или отдельно. Этот аспект данного изобретения имеет особое преимущество в том, что, inter alia, предусматривается способ введения одного терапевтического агента для воздействия на вышеупомянутые белки.

Более конкретно, согласно этому варианту изобретения способ включает введение терапевтически эффективного количества дексанабинола или его производного пациенту, нуждающемуся в такой терапии.

Способ по изобретению может включать введение терапевтически эффективного количества дексанабинола или его производного, достаточного для ингибирования опухолегенеза раковой клетки.

Альтернативно или дополнительно способ может включать введение терапевтически эффективного количества дексанабинола или его производного, достаточного для индуцирования цитотоксичности в раковой клетке.

Количество терапевтического агента, например дексанабинола, которое может быть введено пациенту, может отличаться в зависимости, inter alia, от характера рака, его степени тяжести и т.д. Так, например, вводимое пациенту терапевтически эффективное количество дексанабинола или его производного может быть достаточным для достижения концентрации дексанабинола в плазме от 10 до 20 мкМ.

Более конкретно, способ может включать введение эффективного количества терапевтического агента, например дексанабинола или его производного, достаточного для достижения концентрации терапевтического агента в плазме по меньшей мере 10 мкМ, и поддержание у пациента в течение по меньшей мере 2 часов.

Далее, предусматривается способ одновременного, последовательного или отдельного воздействия на белки N-метил-D-аспартат (NMDA), циклооксигеназу 2 (COX-2), фактор некроза опухоли альфа (TNF-α), ядерный фактор каппа В (NFκB), циклин-зависимые киназы, например CDK2/A и CDK5/p25, гистон-ацетилтрансферазу (HAT) и фарнезилтрансферазу, который включает введение терапевтически эффективного количества дексанабинола или его производного.

Согласно еще одному дополнительному варианту изобретения предусматривается фармацевтическая композиция, содержащая дексанабинол или его производное, в которой количество дексанабинола или его производного является достаточным для достижения концентрации дексанабинола в плазме от 10 до 20 мкМ.

Далее предусматривается фармацевтическая композиция, содержащая дексанабинол или его производное, в которой количество дексанабинола или его производного является достаточным для достижения концентрации терапевтического агента в плазме по меньшей мере 10 мкМ и поддержание у пациента в течение по меньшей мере 2 часов.

В настоящем изобретении предусматривается, что раковые клетки могут быть предраковыми, злокачественными, первичными, метастатическими или обладающими множественной лекарственной устойчивостью.

Альтернативно, лечение рака может включать ингибирование цитотоксичности раковой клетки путем введения в клетку эффективного количества дексанабинола или его производного. Ингибирование цитотоксичности может также включать индуцирование цитотоксичности и/или апоптоза в раковой клетке.

Более того, способ по изобретению имеет преимущества, потому что, inter alia, он демонстрирует уменьшенную токсичность, уменьшенные побочные эффекты и/или уменьшенную устойчивость по сравнению с применяемыми в настоящее время химиотерапевтическими агентами.

Далее предусматривается, что в комбинации с дексанабинолом или его производным для лечения и/или профилактики рака может быть предложен второй терапевтический агент. Второй терапевтический агент может включать химиотерапевтический агент, иммунотерапевтический агент, геннотерапевтический агент или радиотерапевтический агент. При включении в лечение второго терапевтического агента согласно данному изобретению второй терапевтический агент может вводиться с дексанабинолом или его производным отдельно, одновременно или последовательно.

Вместе с дексанабинолом или его производным могут применяться различные вторые или дополнительные терапевтические агенты. Однако предпочтительно, чтобы такой второй или дополнительный терапевтический агент мог быть выбран из группы, состоящей из химиотерапевтического агента, иммунотерапевтического агента, геннотерапевтического агента и радиотерапевтического агента.

Термин "производное", используемый в данном документе, включает любые традиционно известные производные дексанабинола, такие как, inter alia, сольваты. Целесообразно или желательно приготовить, очистить и/или работать с соответствующим сольватом соединения, описанного здесь, которое может быть использовано в одном из описанных применений/способов. Термин "сольват" относится здесь к комплексу растворенных веществ, таких как соединение или соль соединения, и растворитель. Если растворителем является вода, сольват может обозначаться "гидрат", например "моногидрат", "дигидрат", "тригидрат" и т.д., в зависимости от числа водных молекул на молекулу субстрата. Термин "производное", в частности, включает соль. Подходящие соли дексанабинола хорошо известны и описаны в ограничительной части формулы изобретения. Соли органических и неорганических кислот могут использоваться для приготовления фармацевтически пригодных солей. Такие соли включают, без ограничения, фтористоводородную, соляную, бромистоводородную, йодистоводородную, серную, азотную, фосфорную, лимонную, янтарную, малеиновую и пальмитиновую кислоты. Основания включают такие соединения, как гидроксиды натрия и аммония. Специалистам известны четырехзамещающие агенты, которые могут применяться для приготовления фармацевтически пригодных четвертичных аммониевых производных дексанабинола. Они включают, без ограничения, метил- и этилиодиды и сульфаты.

Дексанабинол и его производные и/или комбинации известны per se и могут быть приготовлены с использованием способов, известных специалистам, или получены коммерческим путем. В частности, дексанабинол и способы его приготовления раскрыты в патенте США № 4876276.

Согласно еще одному варианту изобретения предусматривается применение дексанабинола или его производного, или здесь описанного способа, где дексанабинол или его производное вводится в смеси с фармацевтически пригодным адъювантом, разбавителем или носителем.

Дексанабинол или его производное может вводиться различными способами в зависимости, inter alia, от характера рака, который лечат. Так, дексанабинол или его производное может вводиться местно, трансдермально, подкожно, внутривенно или перорально.

В частности, предусматривается применение дексанабинола или его производного, или способ лечения, который состоит из местного введения дексанабинола или его производного.

Таким образом, в применении, способе и/или композиции согласно изобретению соединение может быть представлено в форме таблетки, капсулы, драже, свечи, суспензии, раствора, инъекции, например внутривенно, внутримышечно или внутрибрюшинно, импланта, местного средства, например трансдермального лекарственного средства, такого как гель, крем, мазь, аэрозоль или система полимера, или в форме ингаляции, например аэрозольный или порошковый состав.

Композиции, пригодные для перорального введения, включают таблетки, капсулы, драже, жидкие суспензии, растворы и сиропы.

Композиции, пригодные для местного нанесения на кожу, включают кремы, например водомасляные эмульсии типа «масло-в-воде», эмульсии типа «вода-в-масле», мази, гели, лосьоны, помады, смягчающие средства, коллоидные дисперсии, суспензии, эмульсии, масла, спреи, пенки, муссы и т.п. Композиции, пригодные для местного применения, могут также включать, например, липосомальные носители, состоящие из липидов или специальных детергентов.

Примерами других адъювантов, разбавителей или носителей являются следующие:

для таблеток и драже - наполнители, т.е. лактоза, крахмал, микрокристаллическая целлюлоза, тальк и стеариновая кислота; смазочные материалы/глиданты, например, стеарат магния и коллоидный диоксид кремния; дезинтегранты, например, натрий-крахмалгликолят и натрий-карбоксиметилцеллюлоза;

для капсул - прежелатинизированный крахмал или лактоза;

для оральных или инъецируемых растворов или клизм - вода, гликоли, спирты, глицерин, растительные масла;

для свечей - натуральные или отвержденные масла или воски.

Можно вводить соединение или производные и/или их комбинацию или назначать любой комбинированный режим, как описано выше, трансдермально через, например, средство трансдермальной доставки или подходящее средство, или, например, в масляной основе, которая для контролируемой доставки может быть добавлена в пластырь. Такие средства являются преимущественными, так как они обеспечивают продолжительный период лечения по сравнению, например, с оральным или внутривенным лекарственным средством.

Примеры трансдермальной доставки могут включать, например, пластырь, повязку, бинт или пластырь, адаптированные для выхода соединения или вещества через кожу пациента. Специалисты знакомы с материалами и способами, которые могут применяться для трансдермальной доставки соединения или вещества, и примеры средств трансдермальной доставки приведены в патентах GB2185187, US3249109, US3598122, US4144317, US4262003 и US4307717.

Далее изобретение будет проиллюстрировано только примерами.

ПОДРОБНОЕ ОПИСАНИЕ

Пример 1

Анализ in vitro для оценки эффекта дексанабинола на апоптоз в линиях клеток

Способы

Исследование проводилось в течение 24 часов на трех меланомных линиях (A375, G-361, WM266-4), двух линиях рака молочной железы (MCF7, MDA-MB-231), фибробласте (46BR.1G1), раке толстой кишки (HCT116), раке предстательной железы (PC-3), глиобластоме (U373) и немелкоклеточном раке легкого (NSCLC) (DMS-114).

Вышеназванные клеточные линии выдерживались в питательной среде RPMI 1640 (Sigma, Великобритания), содержащей 10% (об./об.) инактивированную нагреванием фетальную телячью сыворотку (Sigma, Великобритания) и 2 мМ L-глутамата при 37°C, во влажной атмосфере, содержащей 5% CO2. Клетки были собраны, промыты, ресуспендированы в среде роста и подсчитаны (Beckman-Coulter Vi-CELL XR). Клетки высевались в центре 240 лунок 384-луночных культуральных планшетов с питательной средой в концентрации от 1,6×105 до 2,4×105 клеток/мл аликвотами 12,5 мкл/лунка. В наружные лунки было внесено 50 мкл среды роста. На одну линию клеток было подготовлено 2 планшета. Планшеты инкубировали в течение ночи при 37°C во влажной атмосфере, содержащей 5% CO2.

Дексанабинол был приготовлен в среде роста при концентрации в 2 раза выше, чем окончательная концентрация исследования при 125, 31,3, 7,81, 2,00, 0,49, 0,12, 0,031 и 0,008 мкМ (концентрация DMSO поддерживалась постоянно согласно аналитическому диапазону 0,5%).

В качестве положительного контроля применяли цисплатин. Окончательные концентрации исследования составляли 10, 2,5, 0,63, 0,156, 0,039, 0,010, 0,002 и 0,0006 мкг/мл. Разбавленные растворы дексанабинола или цисплатина были добавлены 6 раз по 12,5 мкл на лунку. 12,5 мкл среды роста было добавлено в контрольные лунки со средой. Планшеты инкубировали в течение 24 часов при 37°C во влажной атмосфере, содержащей 5% CO2.

Активность каспазы измеряли с использованием набора для определения каспазы-3/7 Apo-ONE® Homogeneous Caspase-3/7. Флуоресценция измерялась с помощью микропланшетного считывателя FlexStation® II384 через 1, 2, 3 и 4 часа после добавления субстрата каспазы. Для анализа использовали 4-часовые показания.

Параллельно на том же планшете для каждой линии проводили оценку жизнеспособности клеток с использованием реагента CellTiter-Blue® (Promega). Кратко, в каждую лунку добавляли 25 мкл реагента CellTiter-Blue® (Promega). Планшеты встряхивали в течение 1 минуты при скорости 500 об/мин и затем инкубировали при 37°C, 5% CO2 в течение 4 часов. Флуоресценцию измеряли с помощью микропланшетного считывателя FlexStation® II384 (длина волны возбуждения 570 нм, длина волны эмиссии 600 нм, включение/выключение 590 нм). Кривые, показывающие цитотоксический эффект дексанабинола и цисплатина, показаны графической накладкой на том же графике.

Результаты

Индуцирование апоптоза в клетках A375, G-361, WM266-4, MCF7, MDA-MB-231, 46BR.1G1, HCT116, PC-3, U373 и DMS-114 после 24-часовой инкубации с цисплатином или дексанабинолом обобщено в Таблице 1. Дополнительно к оценке жизнеспособности клеток с использованием CellTiter-Blue® также показан анализ цитотоксичности.

В качестве положительного контроля использовали цисплатин и цитотоксическую реакцию наблюдали во всех клеточных линиях с приблизительным IC50 значением 5-20 мкг/мл, за исключением U373MG и MDA-MB231, которые показали сопротивляемость к цитотоксическому эффекту. Для клеток DMS114 и PC3 наблюдали реакции на неадекватные дозы, и таким образом значения IC50 не могли быть определены. Определить индукцию апоптоза было нелегко либо из-за кривых неадекватной дозы (G-361, WM266-4 и PC3), либо слабой индукции каспазы 3/7 (MDA-MB231, MCF-7, HCT116, DMS114 и U373MG). В общем, три меланомные клеточные линии (A375, G-361 и WM266-4), линия рака толстой кишки (HCT116) и фибробластная линия 46Br1Gl были наиболее чувствительны к цитотоксическим эффектам цисплатина, индуцируя как увеличение апоптоза, так и снижение жизнеспособности клетки.

Дексанабинол индуцировал цитотоксическую реакцию со значениями IC50 в диапазоне 10-25 мкМ в большинстве клеточных линий. Индукция апоптоза количественно не определена для всех клеточных линий либо из-за неадекватных кривых дозовой зависимости (A375, G-361, PC3, 46Br.1G1 и DMS-114), либо из-за нереагирующих клеток (MCF-HCT116 и U373MG). Пиковый уровень реакции в апоптозе происходил при 2,5 мкМ и падал при наибольшей концентрации 10 мкМ, возможно, из-за лизиса и потери клеток. В общем, три меланомные клеточные линии (A375, G-361 и WM266-4), 2 линии рака молочной железы (MDA-MB231 и MCF7) и линия предстательной железы (PC3M) были наиболее чувствительны к дексанабинолу и наименее чувствительны к DMS114 и U373.

Таблица 1
Результаты: Сводные данные
Цисплатин Дексанабинол
Клеточная линия ↓Жизнеспособность IC50 (мкМ) ↓Жизнеспособность IC50 (мкМ)
Меланома
А375 21,8** 19,16**
G-361 18,00** 10,97***
WM266-4 62,00* 20,87**
Рак молочной железы
MCF7 40,60** 16,19***
MDA-MB-231 NR* Приблизительно 10-50**
Рак толстой кишки
НСТ116 29,50** 22,34***
Рак простаты
РС-3 Приблизительно 58,00* 19,91***
Немелкоклеточный рак легкого
DMS-114 Приблизительно 40,20* Приблизительно 10-50*
Глиобластома
U373 NR* Приблизительно 10-50*
Фибробласт
46Br.1G1 21,50** 23,09***
ND - EC/IC50 не определен из-за неадекватной кривой дозовой зависимости
NR - реагирование не наблюдалось
Ранг * слабая индукция и уменьшение пролиферации (<35%)
** средняя индукция и уменьшение пролиферации (35-70%)
*** хорошая индукция и уменьшение пролиферации (>70%)

Резюме

В предыдущих исследованиях, как подробно описано в WO '700, дексанабинол уменьшал рост меланомных клеточных линий (A375, Malme-3M, UACC62) со значением IC50 в диапазоне 10-20 мкМ. Целью данного исследования является определение того, индуцирует ли дексанабинол апоптоз в панели раковых клеточных линий и фибробластной линии человека, для выяснения потенциального механизма его действия. Дополнительно к апоптозу также параллельно проводили оценку жизнеспособности клеток.

В качестве положительного контроля использовали цисплатин - стандартный агент, применяемый в клинике для лечения различных видов рака, включая рак желудочно-кишечного тракта и глиобластомы, который индуцировал эффекты в большинстве клеточных линий, за исключением U373MG, DMS114, PC3 и MDA-MB231, которые продемонстрировали определенную степень сопротивляемости. В клеточных линиях, отреагировавших на цисплатин, снижение жизнеспособности соответствовало увеличению апоптоза, за исключением MCF7, которая была описана как испытывающая дефицит каспазы 3, и, таким образом, апоптоз может быть недооценен в этой клеточной линии.

Тестируемый агент дексанабинол продемонстрировал проапоптический эффект, который полностью совпал с его эффектом на число клеток таким же образом, что и хелатирующий ДНК агент цисплатин. Эффекты проявлялись при концентрациях 10 мкМ и выше.

Дексанабинол образовал зависящее от дозы снижение жизнеспособности клеточных линий при концентрации >10-5 М, однако апоптоз не всегда соответствовал этой последовательности с возникновением пиковой реакции при концентрации 2,5 мкМ и затем исчезновением при 10 мкМ.

Однако это могло происходить вследствие 100% потери жизнеспособности клетки при наивысшей концентрации, что привело к тому, что для анализа апоптического события имелось недостаточное количество клеток. Наиболее чувствительными клеточными линиями оказались

- меланомы человека: WM366-4, G-361;

- молочная железа человека: MDA-MB-231;

- простата человека: PC3.

Пример 2

Анализ MTT

- Оценка дексанабинола плюс положительный контроль.

- Скрининг по множественным клеточным линиям, выбранным из различных типов опухолей, например:

Рак Клеточная линия
Острая миелоидная лейкемия MV4-11
Почечноклеточная карцинома 786-0
Множественная миелома OPM-2
Рак поджелудочной железы PANC-1
Рак поджелудочной железы BxPC-3
Острая лимфобластическая лейкемия MOLT-4
Рак яичника A2780
Хроническая миелоидная лейкемия K-562
Рак желудка MKN-45
Рак желудка NCI-N87
Острая промиелоцитная лейкемия HL-60
Мелкоклеточный рак легкого NCI-H69
Мелкоклеточный рак легкого NCI-H526
Медуллярная карцинома щитовидной железы TT
Карцинома пищевода OE33
Остесаркома SJSA-1
Анапластический рак щитовидной железы 8505C
Глиобластома U87MG
Глиобластома SF-295
Диффузная B-крупноклеточная лимфома WSU-DLCL2
Гепатоцеллюлярная карцинома Hep3B
Гепатоцеллюлярная карцинома Hep G2

Специфическая цель 1: Определение значения IC 50 единичных агентов

Раковые клетки человека помещают в 96-луночный планшет для микрокультуры (Costar, белый, плоскодонный, # 3917) в общем объеме 90 мкл/лунка. После 24 часов инкубации в увлажненном инкубаторе при температуре 37°C во влажной атмосфере, содержащей 5% CO2 и 95% воздуха, 10 мкл 10X, в каждую лунку добавляются серийно разбавленные тестируемые агенты в среде роста. После 96 часов нахождения культуры в CO2 инкубаторе помещенные в культуральный планшет клетки и реагенты Cell Titer-Glo (Promega #G7571) переносят в помещение с комнатной температурой для уравновешивания в течение 30 минут. В каждую лунку добавляют 100 мкл реагента Cell Titer-Glo®. Планшет встряхивают 2 минуты и затем оставляют для уравновешивания на 10 минут перед считыванием информации с помощью люминесценции в микропланшетном считывателе Tecan GENios.

Процент ингибирования роста клеток подсчитывают относительно необработанных контрольных лунок. Все испытания проводят дважды при каждом уровне концентрации.

Значение IC 50 для тестируемых агентов оценивают с помощью Prism 3.03 способом аппроксимации кривых, при помощи следующего четырехпараметрового логистического уравнения:

где Top - максимальный % контрольного поглощения, Bottom - минимальный % контрольного поглощения при наивысшей концентрации агента, Y - % контрольного поглощения, X - концентрация агента, IC 50 - концентрация агента, которая ингибирует рост клеток на 50% по сравнению с контрольными клетками, и n - угол наклона кривой.

Пример 3

Исследование ксенотрансплантата

Клетки: В зависимости от результата исследований in vitro
Мыши Бестимусные мыши-самки, возраст 6-8 недель
Опухоли Единичные отделы, имплантированные с 5 млн. клеток в матригель
Лекарственные средства Дексанабинол, i.p. раз в неделю × 4 недели цисплатин или таксол, i.p. раз в неделю × 4 недели

КРИВАЯ РОСТА: выбирают мышей с опухолью наиболее похожего размера, около 150 мм 3

Экспериментальные группы: (6 мышей на группу):

1. Одно средство i.p. раз в неделю × 4 недели;

2. Дексанабинол, i.p. раз в неделю × 4 недели;

3. Цисплатин, i.p. раз в неделю × 4 недели;

4. Дексанабинол, i.p. раз в неделю + цисплатин, i.p. раз в неделю × 4 недели.

Измерения опухоли: Два раза в неделю, пока мыши не погибнут и будут собраны опухоли.

Измерения веса: по меньшей мере два раза в неделю.

1. Способ лечения рака, отличающегося от меланомы, заключающийся в апоптозе раковых клеток, который предусматривает введение терапевтически эффективного количества дексанабинола, или его соли, или сольвата, где рак представляет собой один или более из следующих: рак печени, рак пищевода, рак поджелудочной железы, мелкоклеточный рак легкого и карцинома желудка.

2. Способ по п. 1, где раковые клетки отличаются от меланомы и выбраны из одного или более из следующих: карциномы желудка, карциномы пищевода и рака поджелудочной железы.

3. Способ по п. 1, где раковые клетки, отличающиеся от меланомы, представляют собой клетки рака поджелудочной железы.

4. Способ по п. 1, который включает введение терапевтически эффективного количества дексанабинола или его соли или сольвата, достаточного для ингибирования опухолегенеза в раковой клетке.

5. Способ по п. 1, который включает введение терапевтически эффективного количества дексанабинола, или его соли, или сольвата, достаточного для индуцирования цитотоксичности в раковой клетке.

6. Способ по п. 1, который включает введение дексанабинола, или его соли, или сольвата, где количество, введенное пациенту, является достаточным для достижения концентрации дексанабинола в плазме от 10 до 20 мкМ.

7. Способ по п. 1, который включает введение эффективного количества дексанабинола, или его соли, или сольвата, достаточного для достижения концентрации терапевтического агента в плазме по меньшей мере 10 мкМ и поддержания у пациента в течение по меньшей мере 2 часов.

8. Способ по п. 1, где раковые клетки являются злокачественными, метастатическими или обладающими множественной лекарственной устойчивостью и их комбинациями.

9. Способ по п. 1, который включает введение дексанабинола, или его соли, или сольвата в комбинации с другим терапевтическим агентом для лечения рака или его производным отдельно, одновременно или последовательно.

10. Способ по п. 9, где указанный другой терапевтический агент для лечения рака пригоден для ингибирования опухолегенеза, ингибирования пролиферации клетки или индукции цитотоксичности.

11. Способ по п. 9, где другой терапевтический агент включает химиотерапевтический агент, иммунотерапевтический агент, геннотерапевтический агент или радиотерапевтический агент.



 

Похожие патенты:

Изобретение относится к медицине, а именно к онкологии, и касается лечения рака у человека. Для этого вводят соединение формулы в интервале суточных доз от 20 мг до 1500 мг.
Изобретение относится к медицине, а именно к онкологии. Сочетают хирургический метод лечения с интраоперационной внутриартериальной химиотерапией.

Изобретение относится к соединениям формулы I и их фармацевтически приемлемым солям, где R1, R2, R3, R4, R5 и R6 имеют значения, указанные в формуле изобретения. Соединения формулы I являются ингибиторами тирозинкиназ III типа, и, в частности, cFMS.

Настоящее изобретение относится к новым трициклическим производным пиррола формулы (I) или их фармацевтически приемлемым солям, которые модулируют активность протеинкиназ, выбранных из MPS1, PIM-1 и PIM-2.

Изобретение относится к ингибиторам HDAC формулы (I) или их фармацевтически приемлемым солям, эфирам или стереоизомерам, где R1 представляет собой водород или галоген; R2 представляет собой водород, C1-4-алкил; R3 представляет собой фенил, незамещенный или замещенный один, или два, или три раза галогеном, C1-4-алкилом, C1-4-алкокси, C1-4-алкилсульфонилом, циано, трифторметилом, фенилом, фенокси, пирролилом, имидазонилом, оксазолилом или ди C1-4-алкиламино-C1-4-алкокси; нафталинил; хинолинил; C3-7-циклоалкил; фенилалкил, где фенил может быть не замещен или один или два раза замещен галогеном, C1-4-алкокси, фенилом; нафталинилалкил; фенилциклоалкил; пиримидинил; фенилсульфонил, где фенил может быть не замещен или один или два раза замещен галогеном, фенилом; или фенилкарбонил, где фенил может быть не замещен или один или два раза замещен галогеном, C1-4-алкокси; R4 представляет собой водород или C1-4-алкил; Y представляет собой -СН2- или -С=O; или R4 и Y вместе с атомом углерода, к которому R4 присоединен, могут образовывать фенильное кольцо или пиридиновое кольцо, которое может быть не замещено или дополнительно замещено галогеном; при условии, что R2 представляет собой C1-4алкил; А представляет собой -С=O, -СН2- или -СН-алкил, при условии, что А и Y одновременно не представляют собой -С=O.
Изобретение относится к медицине, онкологии, и может быть использовано для повышения эффективности комбинированного лечения операбельного немелкоклеточного рака легкого (НМРЛ) III стадии.

Изобретение относится к области биохимии. Заявлено антитело, связывающееся с рецептором клеточной поверхности DR5.

Изобретение относится к области биотехнологии, в частности к рекомбинантной плазмидной ДНК, созданной при помощи новых праймеров CTTCCATATGGAACGAAGGCGTTTGTG и TGTGGATCCAGCTAGTTAGGCATGAAA. Указанная рекомбинантная плазмидная ДНК используется для получения рекомбинантного белка PRAME-F, состоящего из пептида MGSSHHHHHHSSGLVPRGSH слитого с последовательностью природного белка PRAME, путём её экспрессии в бактериальных клетках.

Изобретение относится к новому соединению формулы 32 и к способу получения соединения формулы XLV с использованием соединения формулы 32 в качестве исходного соединения.

Изобретение относится к медицине и касается способа доставки борсодержащих препаратов (10В) для бор-нейтронозахватной терапии (БНЗТ) для доставки внутрь клетки борсодержащих препаратов с помощью пегелированных липосом.

Изобретение относится к биотехнологии, пищевой и фармацевтической промышленности, а именно к производству продуктов функционального питания для нормализации состояния организма и биологически активных добавок (БАД) к пище и лекарственных препаратов, предназначенных для нормализации состояния желудочно-кишечного тракта (удаления из организма токсичных веществ).

Группа изобретений относится к применению лиганда сигма-рецептора, представляющего собой 4-{2-[5-метил-1-(нафталин-2-ил)-1H-пиразол-3-илокси]этил}морфолин или его соль, для профилактики и/или лечения индуцированной опиоидами гипералгезии (OIH), связанной с опиоидной терапией; к применению его комбинации с опиоидным или опиатным соединением по тому же назначению; к его применению для получения лекарственного средства для профилактики и/или лечения OIH, связанной с опиоидной терапией; к способу соответствующего лечения.

Изобретение относится к средству, усиливающему противоопухолевый эффект другого противоопухолевого средства, содержащему 4-(2-фтор-4-(3-(2-фенилацетил)тиоуреидо)фенокси)-7-метокси-N-метилхинолин-6-карбоксамид и другое противоопухолевое средство, которое выбрано из группы, состоящей из паклитаксела, гемцитабина, лапатиниба, комбинированного лекарственного средства тегафура-гимерацила-отерацила калия и иринотекана.

Предложена группа изобретений, касающихся лечения злокачественных опухолей. Заявлены: применение 2-амид-1-({4-метил-5-[2-(2,2,2-трифтор-1,1-диметил-этил)пиридин-4-ил]тиазол-2-ил}амид) (S)-пирролидин-1,2-дикарбоновой кислоты или её соли для производства фармацевтических композиций для лечения злокачественной опухоли, комбинация данного соединения с EGFR-модуляторами в целях указанного использования, способ лечения указанного заболевания с помощью этого соединения, и фармацевтические композиции для лечения указанного заболевания.

Группа изобретений относится к медицине, в частности к терапевтическим композициям и способу лечения инфекционного повреждения эпителиальных тканей. Композиции включают противоинфекционное активное средство, жидкий носитель и бензокаин.

Группа изобретений касается профилактики и/или лечения боли, связанной с раком костей. Предложено применение сигма-лиганда, представляющего собой 4-{2-[5-Метил-1-(нафталин-2-ил)-1H-пиразол-3-илокси]этил}морфолин, его соль или стереоизомер для профилактики и/или лечения боли, связанной с раком костей; применение того же соединения для получения лекарственного средства того же назначения, способ лечения боли, связанной с раком костей и применение комбинации 4-{2-[5-Метил-1-(нафталин-2-ил)-1H-пиразол-3-илокси]этил}морфолина, или его соли или стереоизомера и опиоидного или опиатного соединения для профилактики и/или лечения боли, связанной с раком костей.

Изобретение касается лечения диабетической ретинопатии. Предложено применение соединения формулы (I) или его соли для профилактики, лечения и/или уменьшения отёка макулы, вызванного или связанного с диабетической ретинопатией.

Изобретение относится к области биотехнологии, конкретно к получению антиапоптозных фрагментов белка DAXX, и может быть использовано в медицине для лечения острого инфаркта миокарда (AMI), церебрального инфаркта, при трансплантации органов, операциях на сердце, острых нарушениях кровообращения, реперфузионных повреждениях и ишемии.

Изобретение относится к химико-фармацевтической промышленности и представляет собой применение производного жирной кислоты, выбранного из (-)-7-[(2R,4aR,5R,7aR)-2-(1,1-дифторпентил)-2-гидрокси-6-оксооктагидроциклопента[b]пиран-5-ил]гептановой кислоты, (-)-7-{(2R,4aR,5R,7aR)-2-[(3S)-1,1-дифтор-3-метилпентил]-2-гидрокси-6-оксооктагидроциклопента[b]пиран-5-ил}гептановой кислоты или (-)-7-[(1R,2R)-2-(4,4-дифтор-3-оксооктил)-5-оксоциклопентил]гептановой кислоты, или функционального производного любого из них, для получения фармацевтической композиции, предназначенной для лечения у млекопитающего воспаления слизистой оболочки полости рта, вызванного противоопухолевым средством; при этом субъект получает противоопухолевое средство, которое выбирают из группы, состоящей из алкилирующего агента, антиметаболита, антибиотика, растительного алкалоида, молекулярнонаправленного лекарственного средства, гормона, платинового комплекса, антисмыслового фактора, антитела и РНКи.

Изобретение относится к области медицины и предназначено для лечения больного с диагнозом ранее подвергавшегося лечению тройного негативного метастатического рака молочной железы.

Изобретение относится к производному дайдзеина, представленному формулой (I), или его фармацевтически приемлемой соли, где R1 и R2 каждый независимо представляют собой Н или C1-10алкил; n равно 1, 2, 3, 4 или 5 и производное дайдзеина не включает 7-O-N,N-диметил-аминобутирил-дайдзеин, а также к способу его получения, фармацевтической композиции на основе заявленных соединений и применению их для лечения сосудисто-сердечных заболеваний.
Наверх