Способ индуцировния устойчивости к болезням у растений



Способ индуцировния устойчивости к болезням у растений
Способ индуцировния устойчивости к болезням у растений
Способ индуцировния устойчивости к болезням у растений
Способ индуцировния устойчивости к болезням у растений
Способ индуцировния устойчивости к болезням у растений
Способ индуцировния устойчивости к болезням у растений
Способ индуцировния устойчивости к болезням у растений
Способ индуцировния устойчивости к болезням у растений
Способ индуцировния устойчивости к болезням у растений
Способ индуцировния устойчивости к болезням у растений
Способ индуцировния устойчивости к болезням у растений

 

A01N49/00 - Консервирование тел людей или животных, или растений или их частей; биоциды, например дезинфектанты, пестициды, гербициды (препараты для медицинских,стоматологических или гигиенических целей A61K; способы или устройства для дезинфекции или стерилизации вообще, или для дезодорации воздуха A61L); репелленты или аттрактанты (приманки A01M 31/06; лекарственные препараты A61K); регуляторы роста растений (соединения вообще C01,C07,C08; удобрения C05; вещества, улучшающие или стабилизирующие состояние почвы C09K 17/00)

Владельцы патента RU 2596923:

СЕНТРО ДЕ ИНХЕНЬЕРИЯ ХЕНЕТИКА И БИОТЕКНОЛОХИЯ (CU)

Изобретение относится к биохимии. Описан способ стимулирования естественной защиты и индуцирования устойчивости к болезни, вызываемой Candidatus Liberibacter asiaticus, у цитрусовых растений (Huanglongbing), характеризующийся нанесением на растения соединения брассиностероида. Представлена композиция для стимулирования естественной защиты и индуцирования устойчивости к болезни, вызываемой Candidatus Liberibacter asiaticus, у цитрусовых растений (Huanglongbing), содержащая природный брассиностероид или аналог брассиностероида. Описан способ предупреждения или лечения болезни Huanglongbing (HLB) у цитрусовых, характеризующийся периодическим нанесением брассиностероида на растения. Описано применение брассиностероида для изготовления композиции, предназначенной для стимулирования естественной защиты и индуцирования устойчивости к болезни, вызываемой Candidatus Liberibacter asiaticus, у цитрусовых растений (Huanglongbing), при котором проводят периодическое нанесение указанной композиции. 4 н. и 7 з.п. ф-лы, 7 ил., 3 табл., 8 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к области сельскохозяйственной биотехнологии - конкретно, к стимулированию у растений естественной защиты и к индуцированию устойчивости растений к заболеваниям для предупреждения их заболеваний, вызываемых патогенами, и для борьбы с такими заболеваниями.

Предшествующий уровень техники

В последние десятилетия было проведено много исследований, посвященных взаимодействиям между растениями и патогенами, рассматривавших эту проблему с морфологической, физиологической и молекулярной точек зрения. Однако результаты, достигнутые к настоящему времени, остаются пока еще недостаточными, и знания, накопленные ведущими мировыми исследовательскими группами, пока еще не дали возможности добиться эффективной защиты сельскохозяйственных культур и тем самым значительно повысить их урожайность. Несмотря на многочисленные мероприятия, осуществляемые во всем мире для всеобъемлющей защиты сельскохозяйственных культур, каждый год появляются сообщения о том, что потери от болезней растений достигают 80% урожая, особенно в эпидемических ситуациях (Gao et al. (2000) Nature Biotechnol. 18: 1307-1310).

Растения и патогены совместно эволюционировали в течение миллионов лет. При этом взаимодействии появились стратегии, которые позволяют растениям распознавать потенциально инвазивные патогены и запускать успешную защиту. Аналогичным образом, у патогенов развились механизмы, позволяющие им обходить и/или подавлять защитные реакции растений. Влияние этого селекционного давления на растения вело к совершенствованию их защитных механизмов. В результате этого успех патогена в осуществлении его способности вызывать заболевание является исключением, а не правилом (Staskawicz (2001) Plant Physiology 125: 73-76).

Восприятие растениями специфических и общих элиситоров не только дает им возможность распознавать патогены, но и позволяет проводить сигналы для активации защитных механизмов. Среди разнообразных активируемых сигнальных путей имеются пути, опосредуемые такими интермедиатами, как активный кислород, салициловая кислота, этилен и жасмоновая кислота. Взаимное перекрывание сигнальных путей этих фитогормонов предоставляет регуляторный потенциал, который дает возможность активировать оптимальную комбинацию реакций в зависимости от конкретного патогена. Активируется и экспрессия генов, относящихся к патогенности (PR), а также синтез противомикробных соединений, которые, как правило, представляют собой фитоалексины, дефензины, фенольные соединения и флавоноиды, продуцируемые для прямого действия на патоген (Baker et al. (1997) Science 276: 726-733).

Имеются другие ответные механизмы, которые действуют в растениях и эффекты которых относительно долго сохраняются после инфекции. Эти механизмы называют приобретенной локализованной ответной реакцией и системной приобретенной ответной реакцией. Приобретенная локализованная ответная реакция наблюдается в кольце клеток толщиной 5-10 мм вокруг повреждений, вызванных гиперчувствительным ответом. Эта поверхность характеризуется большим накоплением белков, связанных с патогенезом - главным образом, основных (Fritig et al. (1998) Current Opinion of Immunology 10: 16-22), и стимуляцией ферментов, таких как метилтрансферазы (Legrand et al. (1978) Planta 144: 101-108), фенилпропаноидного пути, который связан с продуцированием антибиотиков, таких как скополетин, создающих неблагоприятную среду для патогенов, тем самым предотвращая их распространение по растению. Системная приобретенная ответная реакция придает растению более высокий уровень сопротивляемости против последующего инфицирования тем же патогеном. Она развивается не только в инфицированных тканях, но и во всем растении. Она характеризуется накоплением PR-белков (в частности, кислых), которые имеют отношение к сигнальному механизму салициловой кислоты (Cordelier et al. (2003) Plant Molecular Biology 51: 109-118).

Растения обладают способностью синтезировать разнообразные стероиды, которые функционируют в качестве гормонов. Однако присутствие стероидных гормонов в растениях было подтверждено лишь в 1979 году. В том году американские ученые опубликовали данные о новом стероидном лактоне, названном брассинолидом, который был выделен из пыльцы Brassica napus L. (Grove et al. (1979) Nature 281: 216-217). Брассиностероиды были признаны новым классом фитогормонов, исполняющих важную роль в регуляции роста (Azpiroz et al. (1998) Plant Cell 10: 219-230). Физиологические свойства брассиностероидов дают возможность считать их весьма перспективными для применения, безопасного для окружающей среды. Природные вещества могут быть подходящими для широкого применения для защиты растений и повышения эффективности сельскохозяйственного производства.

С самого начала брассиностероиды рассматривали как соединения, перспективные для применения в сельском хозяйстве, поскольку они показывали разные типы регуляторной активности при росте и развитии растений и обеспечивали ценный экономический эффект (Khripach et al. (2000) Ann. Botany 86: 441-447). Важной особенностью брассиностероидов является их способность действовать в исключительно низких концентрациях. Косвенным подтверждением этого феномена является низкая концентрация брассиностероидов в самих растениях. Их количество, обычное для применения в сельском хозяйстве, составляет от 5 до 50 мг на гектар растущих растений (Khripach et al. (2000) Ann. Botany 86: 441-447).

Брассиностероиды могут также играть некоторую роль в реакции растений на патогены. Устойчивость к бактериальным и грибковым патогенам индуцировалась брасиностероидами в рисе и табаке, причем эта устойчивость не коррелировала с повышенным накоплением салициловой кислоты и увеличенной экспрессией генов, ассоциированных с системной приобретенной устойчивостью (Nakashita et al. (2003) Plant Journal 33: 887-898).

По тяжести симптомов, скорости распространения и быстроте поражения коммерческих видов цитрусовых растений, наиболее вредным их заболеванием во всем мире является болезнь «Huanglongbing» (HLB) (позеленение плодов цитрусовых, «болезнь желтого дракона»), вызываемая бактерией Candidatus Liberibacter asiaticus. Это заболевание все еще остается неизлечимым (Gottwald (2010) Annu. Rev. Phytopathol. 48: 6.1-6.21). Оно было впервые зарегистрировано в Азии в конце девятнадцатого века, а затем, в начале двадцатого столетия, появились сообщение о его присутствии в Южной Африке, что с годами способствовало его распространению на обоих континентах (Gottwald (2010) Annu. Rev. Phytopathol. 48: 6.1-6.21). В настоящее время различают три варианта этого заболевания - азиатский, африканский и американский. Болезнетворным микроорганизмом является «прихотливая» грамотрицательная бактерия, которую нельзя получить в чистой культуре на искусственных средах. Среда обитания этого микроорганизма ограничена только флоэмой Rutaceae (рутовых), хотя он обладает способностью размножаться и в гемолимфе и слюнных железах листоблошек, которые и являются его переносчиками (азиатская цитрусовая листоблошка - Diaphorina citri). В организме насекомого бактерия проникает через его кишечную стенку и за 1-3 недели (в зависимости от вирулентности штамма) по гемолимфе достигает слюнных желез.

Симптомы варьируют в зависимости от разновидности и возраста пораженного растения, причем они четко наблюдаются у молодых и сильных деревьев, тогда как деревья, пораженные уже после завершения развития, демонстрируют менее выраженные симптомы. В зрелых листьях ткани вдоль средней жилки и вторичных жилок становятся желтыми, и этот хлороз распространяется на боковые жилки, приводя к опаданию листа (da Graca (1991) Annu. Rev. Phytopathol. 29: 109-36). Этот процесс является более тяжелым в молодых листьях, которые остаются мелкими по размеру. Растения показывают значительную дефолиацию с верхушечной гибелью через несколько лет после инфицирования, генерализуется и мозаичность, и пожелтение. У них возникают многочисленные побеги с мелкими листьями, бледными и мозаичными. При этой инфекции образуется мало плодовых завязей, они рано опадают, а остающиеся на дереве имеют малый размер и асимметричную форму, развивая правильную окраску только на стороне, обращенной к солнцу, тогда как другая сторона становится интенсивно оливково-зеленой (Bove J (2006) Plant Pathol. 88: 7-37). Плоды содержат мало сока и в них понижена концентрация растворимых твердых веществ и сахаров, они становятся очень кислыми и непригодными для промышленного использования (Gottwald (2010) Annu. Rev. Phytopathol. 48: 6.1-6.21).

Экономический ущерб от присутствия HLB в странах, выращивающих цитрусовые, увеличивается с каждым годом, причем потери, обусловленные снижением урожайности и низким качество плодов, оценивают на уровне 30-100%. В настоящее время в мире не осталось регионов, где HLB находилась бы под адекватным контролем или совсем отсутствовала, что вносит свой вклад в ее тяжесть и распространенность (Gottwald (2010) Annu. Rev. Phytopathol. 48: 6.1-6.21). Недавно была сделана оценка использования системной приобретенной устойчивости для поддержания деревьев, инфицированных HLB, в продуктивном состоянии при применении таких соединений, как салициловая кислота и фосфит в комбинации с питательными микроэлементами. Однако в некоторых случаях не было никаких достоверных различий между обработанными и необработанными деревьями в отношении снижения заболеваемости HLB, опадания плодов, их урожайности и качества (Gottwald (2010) Annu. Rev. Phytopathol. 48: 6.1-6.21). Поэтому важной задачей, остающейся актуальной в сельском хозяйстве, является борьба с болезнями растений, которые ежегодно ограничивают мировое производство сельскохозяйственной продукции.

Подробное описание изобретения

Настоящее изобретение помогает решать вышеуказанную задачу, предоставляя эффективный способ стимулирования естественной защиты и индуцирования устойчивости растений к болезням посредством нанесения соединений, которые одновременно активируют у них гены, относящиеся к пути салициловой кислоты, жасмоновой кислоты/этилена, и реакцию гиперчувствительности.

Индуцирование устойчивости к болезням является весьма важным способом, вызывающим в настоящее время большой интерес, поскольку этот способ дает возможность использовать биохимические и молекулярные механизмы, которые уже существуют у растения и которые само растение уже использует для борьбы с болезнями. Защита растений от болезней включает в себя ряд явлений, относящихся к распознаванию, передаче сигнала и ответной реакции, совокупность которых определяют как наследственный иммунитет у растений. Этот наследственный иммунитет может активироваться рядом факторов, которые вносят решающий вклад в борьбу с болезнями. К защитным механизмам, активируемым растением, относится синтез противомикробных фитоалексинов, дефензинов и белков, имеющих отношение к патогенезу. Эти реакции опосредуются активацией генов, связанных с салициловой кислотой, жасмоновой кислотой/этиленом и реакцией гиперчувствительности.

В настоящем изобретении впервые достигнута одновременная активация ферментов хитиназы, бета-1,3-глюканазы, глутатионпероксидазы, фенилаланин-аммиак-лиазы, супероксиддисмутазы и алленоксидсинтазы, которые являются частью сигнального пути салициловой кислоты, жасмоновой кислоты/этилена и реакции гиперчувствительности. Эта активация коррелирует с защитой от бактерий, оомицетов и грибов.

Кроме того, авторы настоящего изобретения демонстрируют одновременную активацию группы новых генов, принадлежащих к пути салициловой кислоты, жасмоновой кислоты/этилена и реакции гиперчувствительности, активация которых коррелирует с защитой от бактерий, оомицетов и грибов. Эти гены были идентифицированы и охарактеризованы с использованием техники серийного анализа экспрессии генов (Serial Analysis of Gene Expression, SuperSAGE). Оказалось неожиданным (если принять во внимание предшествующее состояние данной области), что активация генов, которые принадлежат к пути салициловой кислоты, жасмоновой кислоты/этилена и реакции гиперчувствительности, происходит одновременно с ответной реакцией на нанесение природного соединения.

В контексте настоящего изобретения указанное соединение может, среди других соединений, представлять собой фитогормон, нуклеиновую кислоту, липид или пептид.

В одном варианте осуществления настоящего изобретения стимуляция естественной защиты и индуцирование устойчивости растений к болезням посредством одновременной активации генов, ассоциированных с салициловой кислотой, жасмоновой кислотой/этиленом и реакцией гиперчувствительности, происходит после нанесения фитогормонов на такие растения. В конкретном варианте осуществления настоящего изобретения указанный фитогормон представляет собой природный брассиностероид или его аналог. В контексте настоящего изобретения, в качестве аналога брассиностероида рассматривают соединение, которое синтезируют, начиная с изменений в структуре колец природного брассиностероида, производимых для увеличения его активности.

Способ, раскрытый в настоящем изобретении, дает возможность профилактики и лечения болезней растений, вызванных бактериями, оомицетами и грибами, посредством одновременной активации генов, относящихся к пути салициловой кислоты, жасмоновой кислоты/этилена и реакции гиперчувствительности. В одном варианте осуществления настоящего изобретения, болезнь, которая является предметом лечения или профилактики, представляет собой болезнь «Huanglongbing» (HLB), вызываемую у цитрусовых бактерией Candidatus Liberibacter asiaticus. В другом варианте осуществления настоящего изобретения, болезнь, которая является предметом лечения или профилактики, представляет собой болезнь, которую вызывает Alternaria solani в культурах томатов, или болезнь, которую вызывает Phytophthora parasitica в культурах табака.

Настоящее изобретение также впервые раскрывает концентрации и частоту нанесения природных брассиностероидов (и их аналогов), дающие возможность эффективно бороться с болезнями растений. В одном варианте осуществления настоящего изобретения нанесение природного брассиностероида или его аналога в концентрационном диапазоне от 0,01 до 20 мкМ дает возможность резко уменьшить численность агентов, вызывающих болезни бактериальной и грибковой природы, посредством уменьшения числа копий бактерий, оомицетов или грибков при обработке больных растений. Способ, предложенный в настоящем изобретении, можно применять для предупреждения инфицирования здоровых растений, для чего следует периодически наносить натуральный брассиностероид и его аналог. В конкретном варианте осуществления настоящего изобретения нанесение брассиностероида на растение производят, по меньшей мере, один раз в месяц. В другом варианте осуществления настоящего изобретения нанесение брассиностероида на больные растения проводят с частотой не менее двух раз в месяц. Диапазон концентраций наносимого брассиностероида (как природного, так и аналога) может быть разным в зависимости от конкретной культуры, подвергаемой профилактической или лечебной обработке, и от технологии нанесения. Как известно квалифицированным специалистам в данной области техники, эффективные концентрации соединения можно значительно уменьшать при применении техники малообъемного или ультрамалообъемного нанесения.

В одном варианте осуществления настоящего изобретения способ стимулирования естественной защиты и индуцирования устойчивости растений к болезням включает в себя нанесение брассиностероида или аналога в комбинации с пестицидом.

Другой предмет настоящего изобретения представляет собой композицию для стимулирования естественной защиты и индуцирования устойчивости растений к болезням, содержащую соединение, которое одновременно активирует гены, относящиеся к пути салициловой кислоты, жасмоновой кислоты/этилена и реакции гиперчувствительности и в которой указанное соединение представляет собой фитогормон.

В предпочтительном варианте осуществления настоящего изобретения указанная композиция содержит природный брассиностероид или аналог брассиностероида. В конкретном варианте осуществления настоящего изобретения указанные природные брассиностероиды и их аналоги получают химическим синтезом. Для цели настоящего изобретения брассиностероиды могут быть приготовлены в виде раствора, суспензии, эмульсии, порошка, гранул, эмульгируемого концентрата, аэрозоля, пропитанных гранул, адъюванта, пасты или посредством инкапсулирования.

В одном варианте осуществления настоящего изобретения концентрация природного брассиностероида или аналога брассиностероида в указанной композиции, предназначенной для предупреждения болезней растений или для борьбы с ними, составляет от 0,01 до 20 мкМ (или эквивалентные концентрации, соответствующие малообъемному или ультрамалообъемному применению).

Другой предмет настоящего изобретения представляет собой применение брассиностероида для изготовления композиции, предназначенной для стимулирования естественной защиты и индуцирования устойчивости растений к болезням, когда применяют периодическое нанесение указанной композиции. В одном варианте осуществления настоящего изобретения болезни растения, которые можно предупреждать или лечить посредством этого нового применения брассиностероидов, являются болезнями, вызванными бактериями, грибками или оомицетами.

Другой аспект настоящего изобретения относится к способу предупреждения или лечения болезни «Huanglongbing» (HLB) у цитрусовых, согласно которому на растения периодически (не менее одного раза в месяц) наносят брассиностероид. В указанном способе брассиностероид может быть природным соединением или аналогом брассиностероида.

Краткое описание чертежей

Фигура 1. Относительная экспрессия генов, относящихся к защитным реакциям против болезней у цитрусовых растений, обработанных брассистероидным аналогом (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-оном. Данная фигура показывает относительную экспрессию генов, кодирующих хитиназу (A), β-1,3-глюканазу (B), глутатионпероксидазу (C), фенилаланин-аммиак-лиазу (D), супероксиддисмутазу (E), алленоксидсинтазу (F). Штрихи на кривых показывают стандартное отклонение среднего по 10 растениям для каждого испытанного времени. Протестированные гены относятся к устойчивости растений, обусловленной салициловой кислотой, жасмоновой кислотой/этиленом и реакцией гиперчувствительности.

Фигура 2. Относительная экспрессия новых генов, идентифицированных посредством техники SuperSAGE, активированных при обработках аналогом брассиностероида. Штрихи показывают стандартные отклонения в среднем 10 листьев на растение в каждой из временных точек. Гены были сгруппированы в следующих категориях: гены, связанные с общей защитной реакцией у растений против патогенов (А); гены, связанные с защитной реакцией у растений против бактерий (В); транскрипционные факторы, связанные с защитой растений от болезни (С); сигнальная система защитной реакции (D); и гены, связанные с биосинтезом фитоалексинов (Е).

Фигура 3. Эффект брассиностероидного аналога на ослабление HLB у развивающихся (А) и зрелых (В) цитрусовых растений, измеренный как число копий бактерий HLB, приходящихся на реакцию и определенных посредством полимеразной цепной реакции (PCR). Штрихи на кривых показывают стандартное отклонение среднего по 10 листьям для каждого протестированного времени.

Фигура 4. Электронная микроскопия листьев растений, инфицированных HLB, обработанных (А) и необработанных (В) аналогом брассиностероида. Для каждого образца, проанализированного при разных увеличениях, было сделано по двадцать электронных микрофотографий. Авторы настоящего изобретения изучили в общей сложности по 10 решеток на образец. Каждая медная решетка имела по 400 смотровых отверстий.

Фигура 5. Оценка эффекта природного брассиностероида и аналога на ослабление HLB, измеренного как число копий бактерий HLB, приходящихся на реакцию. Штрихи на кривых показывают стандартное отклонение среднего по 10 растениям для каждого протестированного времени.

Фигура 6. Эффект частоты нанесения брассиностероидного аналога (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-она на ослабление HLB, измеренный как число копий бактерий HLB, приходящихся на реакцию PCR. Штрихи на кривых показывают стандартное отклонение среднего по 10 листьям на растение для каждого протестированного времени.

Фигура 7. Эффект защиты цитрусовых от HLB брассиностероидным аналогом (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-оном, измеренный как число копий бактерий HLB, приходящихся на реакцию PCR. Штрихи на кривых показывают стандартное отклонение среднего по 10 листьям на растение для каждого протестированного времени.

ПРИМЕРЫ

Пример 1. Одновременная активация генов, связанных с естественной устойчивостью растений к болезням после обработки аналогом брассиностероида

Цитрусовые растения (Citrus sinensis) обрабатывали брассиностероидным аналогом (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-оном при 20 мкМ (Iglesias et al. (1998) Synthetic Communications 28: 75-81). Листья от пяти растений собирали в моменты времени 0, 1, 5, 10, 24 и 48 часов после нанесения аэрозоля. Из листьев, используя набор RNeasy (Qiagen, Valencia, CA), по инструкциям изготовителя, которая включает в себя обработку ДНКазой, экстрагировали общую РНК. Используя праймер олиго-dT и набор для обратной транскрипции SuperScript III (Invitrogen, Carlsbad, CA), по инструкциям изготовителя синтезировали кДНК. Количественную PCR в режиме реального времени проводили в аппарате RotorGene 3000 PCR (Corbett, Australia) с набором QuantiTect SYBR Green (Qiagen) для PCR. Все последовательности праймеров для генов, относящихся к защите от болезней цитрусовых растений, показаны в Таблице 1. Реакционные условия в PCR реального времени были следующими: 40 циклов со стадией начальной денатурации при 95°С в течение 15 мин и с последующей денатурацией при 95°С в течение 15 с, стадией отжига в течение 30 с при 60°С и стадией удлинения в течение 30 с при 72°С. Анализ осуществляли по программе RotorGene 3000 (Corbett, Australia), для каждого образца использовали по пять репликатов. Эксперименты повторяли по два раза.

Таблица 1
Список олигонуклеотидов, использованных в экспериментах
Проанализированные гены Citrus sinensis Олигонуклеотиды
Хитиназа
Бета-1,3-глюканаза
Фенилаланин-аммиак-лиаза
Супероксиддисмутаза
Алленоксидсинтаза
Глутатионпероксидаза

Фигура 1 показывает, как все проанализированные гены активировались после обработки цитрусовых растений брассиностероидным аналогом. Ген алленоксидсинтазы имел наиболее высокий уровень экспрессии через 24 ч, тогда как остальные гены демонстрировали наиболее высокую экспрессию через 5 часов после нанесения аналога. Эта группа генов играет важную роль в защите растений от патогенов.

Пример 2. Идентификация новых генов, относящихся к естественной защитной реакции, в растениях, обработанных аналогом брассиностероида

Цитрусовые растения (Citrus sinensis) обрабатывали брассиностероидным аналогом (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-оном при 20 мкМ. Листья от пяти растений собирали через 1, 5, 10, 24 и 48 ч после нанесения аэрозоля. Из листьев, используя набор RNeasy (Qiagen, Valencia, CA), по инструкциям изготовителя экстрагировали общую РНК. Используя биотинилированный праймер олиго-dT и набор для обратной транскрипции SuperScript III (Invitrogen, Carlsbad, CA), по инструкциям изготовителя синтезировали кДНК. В качестве контроля использовали образцы от пяти цитрусовых растений, обработанных водой и собранных в указанное выше время. Идентификацию и характеризацию новых генов осуществляли посредством построения двух библиотек кДНК с использованием техники SuperSAGE (Matsumura et al. (2003) PNAS 100: 15718-15723). Контрольная библиотека была из смеси листьев растений, в разное время обработанных водой, а целевой образец представлял собой смесь листьев цитрусовых растений, в разное время обработанных аналогом. Новые гены, относящиеся к защите растений от HLB и активированные посредством нанесения аналога брассиностероида, были выделены, подвергнуты секвенированию и проанализированы. Фигура 2 показывает активированные аналогом новые гены, которые относятся к естественному механизму защиты растений от болезней. Важно, что этот аналог брассиностероидов одновременно активирует гены, относящиеся к реакции гиперчувствительности, салициловой кислоте и жасмоновой кислоте/этилену, что представляет собой новый механизм, который пока еще не был описан.

Пример 3. Оценка эффекта, производимого нанесением аналога брассиностероида в отношении борьбы с HLB у цитрусовых и наблюдаемого в растениях, находящихся в фазе развития, и в зрелых растениях

a) Оценка влияния на цитрусовые растения в фазе развития

Эксперимент проводили в условиях оранжерей. Растения (Citrus sinensis) с симптомами HLB помещали в черные пластиковые мешки с адекватным режимом полива. Уровни бактерий Candidatus Liberibacter asiaticus в растениях с симптомом HLB определяли с помощью PCR в реальном времени, определяя в листьях абсолютную численность бактерий (число копий бактерий, приходящееся на реакцию) по стандартной кривой и 16S-рибосомной ДНК, амплифицированной из бактерий. Численность бактерий оценивали каждый месяц в течение 6 месяцев. Последнюю оценку проводили, собрав все листья растения и приготовив смесь перед выделением ДНК. Концентрация брассиностероидного аналога (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-она составляла 20 мкМ, нанесение осуществляли в виде аэрозоля каждые 15 дней. ДНК экстрагировали из листьев по протоколу выделения ДНК от Promega. Количественную PCR в реальном времени проводили на аппарате RotorGene 3000 (Corbett, Australia) и с набором для PCR QuantiTect 8YBR Green (Qiagen). Олигонуклеотидами, использованными для количественного подсчета бактерий, были CTAATCCCCAAAAGCCATCTC и CTTCAGGCAAAACCAACTCC. Реакционные условия в PCR реального времени были следующими: 40 циклов со стадией начальной денатурации при 95°С в течение 15 мин и последующей денатурацией при 95°С в течение 15 с, стадией отжига в течение 30 с при 60°С и стадией удлинения в течение 30 с при 72°С. Анализ проводили по программе RotorGene 3000 (Corbett, Australia), для каждого образца использовали по пять репликатов. Эксперименты повторяли по два раза. В качестве контроля использовали больные цитрусовые растения, на которые брассиностероид не наносили. Поскольку с каждым месяцем происходило значительное снижение уровней бактерий, их невыявляемые уровни достигались после четвертого месяца (последняя оценка, проведенная в конце эксперимента). Как показано на Фигуре 3А, достоверное снижение уровней бактерий, имевшее место со второго месяца, достигало невыявляемых уровней после четвертого месяца и сохранялось до проведения последней оценки в конце эксперимента. Важно, что это явление наблюдали во всех растениях, которые обрабатывали этим аналогом брассиностероида.

b) Оценка эффекта на зрелых цитрусовых растениях

Эксперимент проводили в природных условиях. Уровни бактерий Candidatus Liberibacter asiaticus у 30 растений с симптомами HLB определяли с помощью PCR в реальном времени, определяя в листьях абсолютную численность бактерий (число копий бактерий, приходящееся на реакцию) по стандартной кривой и 16S-рибосомной ДНК, амплифицированной из бактерий. Численность бактерий оценивали каждый месяц в течение года. Последнюю оценку проводили, собрав все листья растения и приготовив смесь перед выделением ДНК. Концентрация брассиностероидного аналога (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-она составляла 20 мкМ, нанесение осуществляли в виде аэрозоля каждые 15 дней. ДНК экстрагировали из листьев по протоколу выделения ДНК от Promega. Количественную PCR в реальном времени проводили так же, как описано в Примере 3а. В качестве контроля использовали больные цитрусовые растения, на которые брассиностероид не наносили. Как показано на Фигуре 3В, достоверное снижение уровней бактерий, имевшее место с третьего месяца, достигало невыявляемых уровней после восьмого месяца и сохранялось до момента проведения последней оценки в конце эксперимента. Все растения, обработанные этим аналогом брассиностероида, снижали уровни бактерий.

c) Электронная микроскопия обработанных цитрусовых растений

Целью этого эксперимента было диагностическое определение бактерии Candidatus Liberibacter asiaticus, осуществляемое посредством ультраструктурного исследования с использованием трансмиссионной электронной микроскопии в цитрусовых растениях (Citrus sinensis), инфицированных HLB и обработанных тем же аналогом брассиностероида. Образцы листьев собирали с цитрусовых растений, инфицированных HLB (Candidatus Liberibacter asiaticus) и обрабатывавшихся в течение одного года. В качестве контроля собирали образцы листьев с инфицированных растений, на которые продукт не наносили. Разные образцы фиксировали 5%-ным глутаровым альдегидом в течение ночи в вакууме при 4°С, после чего фиксировали в 1%-ном тетроксиде осмия в течение 12 часов при 4°С. Затем образцы промывали в какодилатном буфере рН 7,4 и дегидратировали в увеличивающихся концентрациях ацетона (20, 30, 40, 50, 60, 70, 80, 90 и 100%) в течение 15 минут каждый раз при 4°C, за исключением 100%-ного ацетона, в котором образцы выдерживали при комнатной температуре в течение 1 часа. Включение выполняли с низкой вязкостью. На ультрамикротоме (NOVA, LKB) получали ультратонкие срезы толщиной 40-50 нм, которые помещали на медные решетки, имевшие по 400 отверстий. После этого решетки контрастировали насыщенным уранилацетатом и цитратом свинца и исследовали на приборе JEOL JEM 2000 EX (JEOL). Для каждого образца, проанализированного при разных увеличениях, было сделано по двадцать электронных микрофотографий. Авторы настоящего изобретения изучили всего по 10 решеток на образец. Каждая медная решетка имела по 400 смотровых отверстий. В обработанных образцах присутствие бактерий не наблюдали (Фигура 4A), тогда как в необработанных листьях цитрусовых (контроль) на ультраструктурном уровне наблюдали присутствие продолговатых и поперечных изображений бактерий Candidatus Liberibacter asiaticus.

Пример 4. Оценка эффектов разных концентраций брассиностероидного аналога (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-она в борьбе с болезнью HLB у цитрусовых

Целью этого эксперимента была оценка минимальной концентрации брассиностероидного аналога (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-она, необходимой для борьбы с болезнью HLB у цитрусовых. Для каждой концентрации аналога использовали по пять цитрусовых растений (Citrus sinensis) с HLB. Испытанные концентрации составляли 0,001, 0,01, 0,1, 1, 5, 10, 20, 40, 60 мкМ, их наносили в виде аэрозоля каждые 15 дней в течение 6 месяцев. Оценку проводили через 6 месяцев после обработки. Уровни бактерий Candidatus Liberibacter asiaticus определяли так же, как в Примере 3а. Как показано в Таблице 2, при концентрациях брассиностероидного аналога, составлявших от 0,01 до 60 мкМ, происходило резкое снижение уровней бактерий.

Таблица 2
Влияние разных концентраций брассиностероидного аналога (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-она на бактерии
Концентрация брассиностероидного аналога (мкМ) Абсолютная концентрация бактерий после 6 месяцев обработки (число копий бактерий, определяемых посредством реакции)
0 2788
0,001 522
0,01 29
1 1
5 0
10 0
20 0
40 0
60 0

Пример 5. Оценка эффекта нанесения природного брассиностероида (брассинолида) и брассиностероидного аналога в борьбе с болезнью HLB у цитрусовых

Для того чтобы оценить в одном и том же эксперименте эффект природного брассиностероида (брассинолида) (Khripach et al. (2000) Ann. Botany 86: 441-447) и брассиностероидного аналога (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-она в борьбе с HLB, для каждой обработки использовали по 10 цитрусовых растений, инфицированных HLB. Оба соединения наносили в виде аэрозоля при концентрации 1 мкМ каждые 15 дней в течение 6 месяцев. Уровни бактерий Candidatus Liberibacter asiaticus определяли так же, как в Примере 3а. Фигура 5 показывает, что как природное, так и аналоговое соединение имели положительный эффект в достижении значительного снижения уровней бактерий в течение оцениваемого периода.

Пример 6. Оценка эффекта частоты нанесения брассиностероидного аналога в борьбе с болезнью HLB у цитрусовых

Целью этого эксперимента было определение влияния частоты аэрозольного нанесения брассиностероидного аналога (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-она в борьбе с HLB у больных цитрусовых растений. Использовали пять растений на обработку, частота нанесения составляла 1, 2 и 4 раза в месяц. Применявшаяся концентрация аналога составляла 1 мкМ, определения уровня бактерий проводили каждый месяц до шести месяцев. Уровни бактерий Candidatus Liberibacter asiaticus определяли так же, как в Примере 3а. Как показано на Фигуре 6, уменьшение численности бактерий наблюдали во всех испытанных вариантах. По сравнению с нанесением один раз в месяц, нанесение дважды в месяц и еженедельно снижало уровни бактерий достоверно на более ранних сроках.

Пример 7. Оценка профилактического эффекта брассиностероидного аналога в отношении HLB у цитрусовых

Этот эксперимент был разработан для определения профилактического эффекта нанесения аналога, представляющего собой (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-он, дважды в месяц в концентрации 1 мкМ на цитрусовые растения без HLB в регионе с зараженными HLB цитрусовыми растениями и с большой популяцией насекомых-переносчиков (азиатская цитрусовая листоблошка - Diaphorina citri). На десять листьев растения аэрозольно наносили указанный аналог, другие десять листьев оставляли без нанесения продукта. Уровни бактерий Candidatus Liberibacter asiaticus определяли так же, как в Примере 3а. Как показано на Фигуре 7, нанесение указанного аналога на цитрусовые растения без HLB давало возможность защищать их от инфекции бактериями, распространяемыми переносчиком, тогда как на растениях, на которые этот аналог не наносили, с течением времени происходило повышение уровней бактерий и появлялись симптомы HLB. Это было еще одним удивительным и неожиданным результатом, дающим возможность применять этот способ для защиты цитрусовых от этой важной болезни.

Пример 8. Оценка эффекта нанесения природного брассиностероида и аналога в борьбе с другими болезнями растений

Для того чтобы оценить эффект брассиностероидного аналога (25R)-3-гидрокси-C-гомо-11-окса-5-эспиростан-12-она и природного брассиностероида (брассинолида) в борьбе с другими болезнями растений, были проведены эксперименты с растениями табака и томатов, зараженными Phytophthora parasitica и Alternaria solani, соответственно. Как природный брассиностероид, так и аналог наносили аэрозольно в концентрации 1 мкМ каждые 15 дней в течение 3 месяцев. Смертность растений определяли через 3 месяца. Таблица 3 показывает, что оба брассиностероида оказывали заметный эффект в снижении заболеваемости, обусловленной этими патогенами. Для каждой обработки использовали по сто растений. В качестве контроля использовали необработанные растения.

Таблица 3
Эффект природного брассиностероида и аналога в борьбе с болезнями, вызываемыми оомицетами и грибками
Патоген/растение Контроль* Природный брассиностероид Аналог брассиностероида
Alternaria solani/томат 84 12 9
Phytophthora parasitica/табак 81 13 11
* указанные значения представляют собой проценты смертности при болезнях, вызванных этими патогенами

1. Способ стимулирования естественной защиты и индуцирования устойчивости к болезни, вызываемой Candidatus Liberibacter asiaticus, у цитрусовых растений (Huanglongbing), характеризующийся нанесением на растения соединения брассиностероида.

2. Способ по п. 1, в котором указанный брассиностероид наносят на растение периодически, по меньшей мере, один раз в месяц.

3. Способ по п. 2, в котором на растение дополнительно наносят пестицид.

4. Композиция для стимулирования естественной защиты и индуцирования устойчивости к болезни, вызываемой Candidatus Liberibacter asiaticus, у цитрусовых растений (Huanglongbing), содержащая природный брассиностероид или аналог брассиностероида.

5. Композиция по п. 5, в которой указанный природный брассиностероид или указанный аналог брассиностероида получают химическим синтезом.

6. Композиция по п. 5, в которой концентрация указанного природного брассиностероида или указанного аналога брассиностероида находится в диапазоне 0,01-20 мкМ.

7. Применение брассиностероида для изготовления композиции, предназначенной для стимулирования естественной защиты и индуцирования устойчивости к болезни, вызываемой Candidatus Liberibacter asiaticus, у цитрусовых растений (Huanglongbing),
при котором проводят периодическое нанесение указанной композиции.

8. Применение по п. 7, в котором брассиностероид представляет собой природное соединение или аналог брассиностероида.

9. Применение по п. 8, в котором натуральный брассиностероид или аналог наносят в концентрации 0,01-20 мкМ.

10. Способ предупреждения или лечения болезни Huanglongbing (HLB) у цитрусовых, характеризующийся периодическим нанесением брассиностероида на растения.

11. Способ по п. 10, в котором брассиностероид представляет собой природное соединение или аналог и в котором их наносят, по меньшей мере, один раз в месяц.



 

Похожие патенты:
Изобретение относится к фармацевтической промышленности, в частности к применению ланохолестероловой фракции из шерстного жира в качестве биоэмульгатора для косметических антивозрастных средств.

Изобретение относится к способам сохранения целостности пептидов в пищеварительном канале путем применения хенодезоксихолевой кислоты, урсодезоксихолевой кислоты, гликодезоксихолевой кислоты, гликохенодезоксихолевой кислоты или бигуанида, которые ингибируют одну или более сериновые протеазы кишечника.

Изобретение относится к безопасному для окружающей среды «зеленому» способу непрерывной очистки триацилглицеролов с использованием порошкообразного, гранулированного или прессованного адсорбента, который применяют или в процессе химической, или в процессе физической очистки пищевых масел и жиров, каждый из которых обычно используется для очистки триацилглицеролов.

Изобретение относится к антиоксиданту, содержащему производное циклоланостана, выбранного из 9,19-циклоланостан-3-ола и 24-метилен-9,19-циклоланостан-3-ола, и производное лофенола, выбранного из 4-метилхолест-7-ен-3-ола, 4-метилэргост-7-ен-3-ола и 4-метилстигмаст-7-ен-3-ола, в концентрации по меньшей мере 0,0001% масс.

Изобретение относится к новым соединениям или его фармацевтически приемлемым солям, где соединение имеет формулу I, которые обладают активностью в отношении вируса гепатита С ("HCV").

Изобретение относится к области органической химии и химии природных соединений, конкретно - химии экдистероидов (гормонов линьки и метаморфоза насекомых и ракообразных).

Изобретение относится к химии природных соединений, конкретно - к улучшенному синтезу экдистероидов - гормонов линьки насекомых. .

Изобретение относится к холестерил-6-O-ацил- -D-галактопиранозиду, предназначенному для индуцирования у млекопитающего-хозяина иммунной реакции против В.burgdorferi, где (i) ацильный остаток представляет собой группу, выделенную из органических жирных кислот, содержащих 1-25 атомов углерода; (ii) галактопиранозидная кольцевая структура необязательно включает в любом положении кольца ацильную группу, выделенную из жирной кислоты.

Изобретение относится к новым 4-окса- и 4-аза-16 ,17 -циклогексанопрегнанам (4-окса- и 4-аза-прегна-D -пентаранам), которые могут найти применение в медицине для лечения злокачественных опухолей, общей формулы I где Х=0 или NR, R=R1=R 2=R4=H, при этом R1+R3 образуют связь.

Изобретение относится к диацетату рацемического 3,17 -дигидрокси-7 ,18-диметил-6-оксаэстра-1,3,5(10),8(9)-тетраена формулы обладающему остеопротекторным, гипохолестеринемическим и антиоксидантным действием при пониженной утеротропной активности.

Изобретение относится к получению новых меченых аналогов физиологически активных соединений - тритерпеновых гликозидов голотурий Cucumaria формулы: Изобретение относится к области органической химии и может найти применение в аналитической химии, биоорганической химии, биохимии и прикладной медицине.

Изобретение относится к улучшенному способу получения химических соединений из ряда стероидов и конкретно касается получения эпибрассинолида [(22R, 23R, 24R)-2, 3, 22, 23-тетрагидрокси-В-гомо-7-окса-5-эргостан-6-она, относящегося к биологически активному веществу - фитостимулятору, регулирующему рост растений.
Изобретение относится к способам выделения и очистки тритерпеновых глюкозидов из растительного сырья, в частности сапонинов из свеклы и отходов сахарного производства, в частности из жома свеклы, и может быть применено в пищевой, фармакологической и косметической промышленности.

Изобретение относится к усовершенствованному способу выделения и очистки сапонинов. .

Изобретение относится к технологии переработки пантов марала, изюбра, северного оленя для получения биологически активного концентрата в виде порошка и может быть использовано в медицине и ветеринарии.
Наверх