Биомаркеры инфекций дыхательных путей

Авторы патента:


Биомаркеры инфекций дыхательных путей
Биомаркеры инфекций дыхательных путей
Биомаркеры инфекций дыхательных путей
Биомаркеры инфекций дыхательных путей
Биомаркеры инфекций дыхательных путей
Биомаркеры инфекций дыхательных путей
Биомаркеры инфекций дыхательных путей
Биомаркеры инфекций дыхательных путей
Биомаркеры инфекций дыхательных путей
Биомаркеры инфекций дыхательных путей

 


Владельцы патента RU 2611385:

АСЕПТИКА ЛТД (GB)

Группа изобретений относится к определению уровней активности бактерий в легких пациентов. Группа изобретений раскрывает способ предсказания усиления уровня бактериальной активности Pseudomonas aeruginosa в легких пациента, а также способ определения эффективности лечения антибиотиком бактериальной инфекции легких, вызванной Pseudomonas aeruginosa, в которых осуществляется измерение уровней маркеров процесса захвата железа бактериями (например, сидерофоров) и уровней секретированных бактериальных белков с течением времени. Способы по настоящему изобретению характеризуются надежностью и высокой чувствительностью. Настоящая группа изобретений особенно подходит для определения уровней активности P. aeruginosa в легких пациентов с муковисцидозом. 2 н. и 14 з.п. ф-лы, 13 ил., 2 табл.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к способу определения уровня активности бактерий в легких пациента. Этот способ предназначен, в частности, но не исключительно, для выявления наличия и уровня активности бактериальной инфекции в легких пациента с муковисцидозом или для предсказания обострения инфекции у таких пациентов. Другие аспекты настоящего изобретения относятся к способам определения эффективности лечения бактериальной инфекции легких.

Предпосылки изобретения

В восточной части Англии ежегодно требуется 80000-125000 больничных койко-дней для лечения пациентов с инфекциями дыхательных путей. Самыми сложными для лечения являются наиболее уязвимые пациенты: люди старшего возраста, новорожденные, а также страдающие от хронических состояний, таких как муковисцидоз (CF), хроническая обструктивная болезнь легких (COPD) или ВИЧ. Инфекции дыхательных путей у пациентов с хроническими заболеваниями могут плохо поддаваться лечению: даже инфекции, вызванные наиболее распространенными патогенами дыхательных путей, могут оказаться смертельными.

Организмы многих пациентов с CF заселены одним или несколькими патогенами, причем чаще всего встречается Pseudomonas aeruginosa. Эти грамотрицательные бактерии заселяют организмы пациентов с CF и сопротивляются любым попыткам уничтожения. У пациентов происходят многочисленные обострения (приступы) инфекции, причем воспаление, вызванное указанными патогенами, приводит к постепенной утрате функции легких. С течением времени патогены приобретают устойчивость к антибиотикам, что делает борьбу с каждой следующей инфекцией более трудной, чем с предыдущей. Таким образом, организм оказывается заселен легкоадаптирующимся, устойчивым к лечению и летальным патогеном. Задача клинического лечения пациентов с CF заключается в уменьшении числа обострений инфекции и ослаблении тяжести каждого случая. Реализация указанной задачи позволяет поддерживать деятельность легких и увеличивает ожидаемую продолжительность жизни. Для большинства пациентов с CF основной причиной смертности являются легочные инфекции, приводящие к сепсису и полиорганной недостаточности.

Инфекции, вызванные P. aeruginosa, приводят к проблемам в случае обострений, которые запускаются действием других факторов. При отсутствии немедленного лечения с применением соответствующих лекарственных средств, пациент может быть госпитализирован на 2-4 недели, прежде чем удастся подавить инфекцию. Упомянутое обострение и следующее за ним воспаление легких могут сопровождаться существенным и часто устойчивым ослаблением функции легких и увеличением выработки эндотоксинов патогенными микроорганизмами, приводящим к сепсису.

На каждом этапе лечения инфекции, пациенты с CF должны посещать клинику и встречаться с лечащим врачом в качестве амбулаторных больных для получения нескольких консультаций. Неудачный результат борьбы с инфекцией в амбулаторном режиме приводит к продолжительной госпитализации. Систематические неудачи в борьбе с часто повторяющимися инфекциями (обострения у пациентов с CF могут повторяться 4-6 раз в год) могут приносить непоправимый ущерб здоровью, который к тому же увеличивает стоимость ухода за пациентом в течение его жизни.

Важно отметить, что не только наличие инфекции наносит вред пациенту. У многих пациентов будет иметься постоянно присутствующая незначительная инфекция с периодическими обострениями. Предсказание времени наступления этих обострений имеет важное значение для выбора тактики лечения. Простое выявление присутствия или отсутствия бактерий, например секвенированием аминокислотной последовательности, само по себе не будет нести информации о вероятности наступления обострения, поскольку обострение может быть инициировано многими факторами.

В технике известны способы, в которых критерием для диагностики инфекции служит присутствие биомаркера. Например, авторы изобретения ранее разработали простой лабораторный тест для количественного определения экзотоксина A P. aeruginosa (хорошо известного маркера инфекции P. aeruginosa) в мокроте пациента.

Однако для точного определения инфекционного статуса проблематично полагаться лишь на один биомаркер. Например, продукты для определения некоторых других патогенов часто направлены лишь на обнаружение токсинов, что характерно, в частности, для многих уже имеющихся на рынке быстрых тестов, нацеленных на обнаружение C.difficile. В этих тестах определяется наличие бактериальных токсинов A и B в образцах фекалий. Хотя эти быстрые тесты выполняются за короткое время (30 минут) они имеют невысокую точность, т.к. токсины A и B могут не продуцироваться при всех инфекциях или их бывает невозможно обнаружить в данном конкретном образце - все это приводит к невысокой точности диагностики по сравнению с более медленными, но более чувствительными методиками культивирования клеток образца традиционными способами микробиологии (2-3 дня). Кроме того, считается, что популяции бактерий с течением времени могут менять профиль выработки токсинов или других белков в ответ на действие факторов окружающей среды; в данной популяции лишь некоторые клетки могут продуцировать конкретный белок, тогда как остальные клетки вносят вклад в инфекцию, но их выживание обеспечивается экзогенными белками. Также известно, что конкретная популяция бактерий у инфицированного пациента мутирует с течением времени, удаляясь от дикого типа, которым пациент был инфицирован первоначально. Соответственно, определение только одного белка может оказаться недостаточно точным в качестве средства диагностики вероятности обострения.

Чтобы избежать риска низкой точности, в настоящем изобретении авторы выявили несколько биомаркеров, содержание которых поддается количественному измерению. Кроме того, можно построить профили биомаркеров, которые демонстрируют статус реакции пациента на данный патоген. Авторы считают, что комбинация этих маркеров в совокупности может применяться для выявления обострений до ухудшения самочувствия пациента, что позволит сократить время до назначения первого антибиотика и, следовательно, уменьшить тяжесть инфекции.

В работе Martin et al., Biometals (2011) 24: 1059-1067, описано обнаружение сидерофоров, продуцируемых Pseudomonas aeruginosa, в мокроте пациентов с муковисцидозом. Авторы обнаружили зависимость между присутствием пиовердина и количеством бактерий, однако эта зависимость отсутствовала у 21 из 148 пациентов; и пришли к выводу об отсутствии корреляции между количеством бактерий и клиническим статусом. Кроме того, авторы пришли к заключению, что уровни сидерофоров не претерпевают значительных изменений во время обострения. Таким образом, в данной публикации утверждается, что анализ профиля сидерофоров не может применяться для определения уровня вирулентности микроорганизмов.

В противоположность этому, как указано ниже по тексту, авторы настоящего изобретения установили, что сидерофоры являются подходящими маркерами активизации бактерий при использовании с комбинациями с другими маркерами. В результате, авторы разработали точный и быстрый тест для определения таких обострений.

В работе Jaffar-Bandjee et al., Journal of Clinical Microbiology, Apr 1995, рр.924-929, сообщается о наличии эластазы, экзотоксина A и щелочной протеазы в мокроте при обострении легочной инфекции у пациентов с CF, хронически инфицированных Pseudomonas aeruginosa. Авторы обнаружили, что у пациентов, находящихся в лечебном учреждении (т.е. после начала обострения), концентрации экзопротеинов меняются, но три указанных белка (эластазы, экзотоксина A и щелочной протеазы) имеют примерно сходные уровни. Однако из данных, представленных в настоящей заявке, очевидно, что у различных пациентов могут иметься различные популяции бактерий, которые продуцируют различные токсины или маркеры. Кроме того, в работе не были проведены исследования, позволяющие определить уровни экзопротеинов перед обострением. Таким образом, определение профиля любого из указанных экзопротеинов, индивидуально или в комбинации, не предоставит достаточных данных для предсказания всех обострений у всех пациентов с CF.

Далее, имея в своем распоряжении объективный и количественный тест, лечащий врач получит возможность быстро определять эффективность антимикробного препарата в борьбе с инфекцией, заменяя один антибиотик на другой, если первый оказался неэффективным. Как правило, исследование различных комбинаций антибиотиков путем проб и ошибок может отнять до 3 недель, прежде чем будет найдено эффективное решение, что обычно достигается путем выдвижения «квалифицированных предположений» опытным лечащим врачом. Авторы надеются, что с помощью разработанного в изобретении диагностического теста время, которое будет отнимать этот абсолютно неизбежный путь «проб и ошибок», можно было бы сократить с 3 недель лишь до 7 дней.

У пациентов с CF инфекция приводит к воспалению легких, и чем сильнее это воспаление и дольше его продолжительность, тем больше страдает деятельность легких. Большинство пациентов с CF ежегодно переносит 4 инфекции и может проводить в клинике 50% времени. Указанное время можно сократить путем применения новых тестов, разработанных авторами и основанных на применении нескольких маркеров.

При наличии быстрого и точного теста для оценки бактериальных инфекций у индивидуума могла бы появиться возможность избежать многих случаев госпитализации. Одна из основных сложностей при исследовании пациентов с инфекциями дыхательных путей заключается в том, чтобы отличить бактериальные инфекции от вирусных. Клинические признаки часто вводят в заблуждение, и многие пациенты, которых впоследствии приходится помещать в стационар, начинают получать антибиотики с задержкой в привычной социальной среде. В США примерно каждому восемнадцатому или 5,51%, т.е. 15 миллионам человек, каждый год ставят неверный диагноз инфекции нижних дыхательных путей.

Кроме того, специалисты, осуществляющие первичное медицинское обслуживание, сталкиваются с дилеммой при выборе подходящих антибиотиков. Хотя эмпирический подбор антибиотика обычно приводит к удовлетворительным результатам, возможность выявить степень угрозы для наиболее уязвимых пациентов, инфицированных идентифицированным патогенном, могла бы позволить оптимизировать применение антибиотика. Это могло бы привести к: повышению успешности лечения на ранних стадиях, что позволит предотвратить ухудшение клинического состояния и последующую госпитализацию, а также уменьшить применение антибиотиков широкого спектра.

Сущность изобретения

Согласно первому аспекту настоящего изобретения, разработан способ определения уровня активности бактерий в легких пациента, где указанный способ включает:

осуществление первого измерения в первый момент времени уровня как минимум одного маркера процесса захвата железа бактериями и как минимум одного секретируемого бактериального белка в образце мокроты из легких;

осуществление второго измерения во второй момент времени уровней указанного маркера и указанного токсина в образце мокроты из легких; и

определение упомянутого уровня бактериальной активности по изменению с течением времени указанных измеренных уровней маркера процесса захвата железа бактериями и секретируемого бактериального токсина.

Авторы изобретения неожиданно обнаружили, что изменение уровней маркеров процесса захвата железа бактериями, например сидерофоров, может служить для предсказания обострений у некоторых, но не у всех, пациентов. Аналогично, изменения уровней бактериальных токсинов также могут иметь предсказательную силу у некоторых пациентов. Надежный тест можно получить путем комбинирования двух указанных измерений, как описано в настоящей заявке. Кроме того, из-за различий между индивидуальными пациентами, желательно измерять изменения с течением времени, а не абсолютные уровни в какой-либо один момент времени; некоторые пациенты могут жить с более высокими фоновыми уровнями, чем другие, и поэтому именно изменение уровней имеет диагностическую ценность.

Для жизни P. aeruginosa, как и других патогенов, необходимы ионы Fe (III). Легкие пациентов с CF, как правило, вырабатывают значительные количества слизи, но, кроме этого, происходит проникновение крови в воздушные объемы легких, стенки которых покрыты жидкой средой. Эта кровь служит источником железа для патогенов. P. aeruginosa имеет несколько механизмов захвата ионов Fe (III) и, по-видимому, может переходить от одного механизма к другому в зависимости от состояния организма хозяина. Однако авторы изобретения полагают, что можно использовать уровни маркеров процесса захвата железа в качестве индикатора активности бактерий.

Предпочтительно маркер процесса захвата железа представляет собой маркер процесса захвата ионов Fe (III).

Предпочтительно маркером процесса захвата железа является сидерофор. В предпочтительных вариантах осуществления настоящего изобретения сидерофоры могут, в частности, включать одно или несколько веществ из числа пиохелина, пиовердина и пиоцианина.

Указанные маркеры являются бактериальными маркерами, хотя в некоторых вариантах осуществления можно также детектировать маркеры процесса захвата железа организма хозяина. У здоровых пациентов происходит захват ионов Fe (III) организмом хозяина (например, с помощью лактоферрина, ферритина или трансферрина), который предотвращает накопление свободных ионов Fe (III), которые могут служить источником роста бактерий. Таким образом, присутствие маркеров организма хозяина может служить дополнительным индикатором для выявления активности бактерий.

Секретируемый бактериальный белок предпочтительно является токсином, причем он может представлять собой экзотоксин A. В качестве альтернативы, секретируемый белок может являться эластазой, или щелочной протеазой, или даже любым белком, секретируемым бактериями.

В предпочтительном варианте осуществления определяют уровни комбинации пиовердина и экзотоксина A.

Далее, способ по настоящему изобретению включает измерение уровней как минимум одного дополнительного маркера. Дополнительный маркер можно выбрать из бактериальных токсинов, маркеров захвата железа организма хозяина, маркеров захвата железа бактериями и маркеров воспаления организма хозяина. Авторы полагают, что определение уровней комбинации дополнительных маркеров позволяет получить более высокую чувствительность, точность и надежность анализа, по сравнению с комбинацией только маркера захвата железа и секретируемого токсина. В особенно предпочтительном варианте осуществления, производится определение уровней комбинации бактериального токсина, бактериального маркера процесса захвата железа и маркера процесса захвата железа организма хозяина. Например, можно определять экзотоксин A, сидерофор и гем или продукт распада гема.

Маркером воспаления может являться цитокин.

Бактерия может представлять собой P. aeruginosa. В некоторых вариантах осуществления имеется зависимость концентрации маркера от уровня коммуникационных сигналов между бактериями P. aeruginosa.

Пациент может являться пациентом с муковисцидозом. В других вариантах осуществления, пациент может являться пациентом с хроническими болезненными состояниями легких, например с хронической обструктивной болезнью легких (COPD).

Способ по настоящему изобретению может дополнительно включать измерение уровней нескольких маркеров процесса захвата железа и определение уровня бактериальной активности, исходя из большого количества этих измеренных уровней; упомянутые маркеры могут представлять собой бактериальные маркеры, маркеры организма хозяина или комбинацию обоих типов маркеров.

Способ по настоящему изобретению может дополнительно включать измерение уровня как минимум одного интермедиата захвата железа (III) для определения указанного уровня бактериальной активности.

Способ по настоящему изобретению может дополнительно включать стадию проведения дополнительных измерений в другие моменты времени.

В следующем аспекте, настоящее изобретение относится к способу предсказания усиления уровня бактериальной активности в легких пациента, где указанный способ включает осуществление временной последовательности измерений активности бактерий в организме указанного пациента, с использованием способа, включающего измерение уровня как минимум одного бактериального маркера процесса захвата железа и как минимум одного секретируемого бактериального белка в образце мокроты из легких; и определение упомянутого уровня бактериальной активности, исходя из измеренных уровней указанного маркера процесса захвата железа и указанного белка;

и применение указанных временных последовательностей измерений для предсказания указанного усиления бактериальной активности.

Еще один аспект настоящего изобретения относится к способу определения эффективности лечения бактериальной инфекции легких, где указанный способ включает проведение временной последовательности измерений бактериальной активности в организме указанного пациента с использованием способа, включающего проведение измерения уровня как минимум одного бактериального маркера процесса захвата железа и как минимум одного секретируемого бактериального белка в образце мокроты из легких; и определение упомянутого уровня бактериальной активности, исходя из измеренных уровней указанного маркера процесса захвата железа и указанного белка;

и определения указанной эффективности на основании временного профиля указанного уровня бактериальной активности.

Лечение предпочтительно представляет собой лечение с применением антибиотика. Предпочтительно способ по настоящему изобретению включает установление того факта, что лечение антибиотиком является неэффективным, если указанный уровень бактериальной активности не падает с течением времени.

Еще один аспект настоящего изобретения относится к устройству, предназначенному для применения в любом из способов по настоящему изобретению, где указанное устройство включает:

средства для отбора указанных образцов мокроты;

средства для осуществления измерений уровней как минимум одного бактериального маркера процесса захвата железа и как минимум одного секретируемого бактериального белка в указанном образце.

Это устройство может дополнительно включать средства для определения указанного уровня бактериальной активности на основании указанных измеренных уровней как минимум одного маркера указанного процесса захвата железа и указанного белка.

Средства для осуществления измерения уровней могут включать реагент, который связывается с соответствующим маркером, и реагент, который связывается с соответствующим белком. Например, эти реагенты могут включать антитела. Упомянутое устройство может включать полоски для проведения анализа, содержащие указанные реагенты; и дополнительно упомянутое устройство может включать индикатор, основанный на изменении цвета, для индикации уровней указанного маркера процесса захвата железа и/или белка.

Краткое описание чертежей

На фиг.1 приведена иллюстрация «ощущения кворума» (коммуникационных ощущений) у бактерий P. aeruginosa. «Ощущение кворума», возникающее между бактериями, позволяет клеткам обмениваться химической информацией. Считается, что сборка HHQ, т.е. водорастворимого предшественника PQS, происходит в периплазме (пространстве между клеточной мембраной и клеточной стенкой) из компонентов, которые синтезируются в цитоплазме клетки. HHQ из одной клетки подвергается воздействию ферментов в периплазме второй клетки. Считается, что активные молекулы, т.е. PQS, формируют пузырьки липидов из клеточной мембраны второй клетки. Если эти пузырьки взаимодействуют с клеточной мембраной первой клетки, считается, что это дает сигнал к запуску совокупности механизмов, необходимых для роста и размножения клеток, другими словами - к увеличению скорости метаболизма. Это инициирует выработку токсинов для уничтожения конкурирующих бактерий и механизмы захвата всех доступных ионов железа (III) из близлежащего пространства с помощью сидерофоров и ферроксидаз. Последние представляют собой ферменты, которые превращают ион железа (II) в ион железа (III), который необходим клеткам.

Фиг.2 представляет собой диаграмму, на которой изображен профиль фаз инфекции у пациента с CF и соответствующее этим фазам самочувствие. Обычно пациенты попадают в клинику только, когда обострение переходит в полностью развившуюся инфекцию.

На фиг.3 показана химическая структура сидерофоров, идентифицированных у P. aeruginosa - соединений, участвующих в одном из путей конкуренции этого патогена за ионы железа (III). Эти соединения, наряду с другими интермедиатами захвата иона железа (III), такими как ферроксидаза, могли бы применяться для выявления обострений инфекций у пациентов с CF.

На фиг.4 показан предполагаемый профиль экзотоксина A и пиовердина/пиоцианина/ферроксидазы из P. aeruginosa.

На фиг.5 показан предполагаемый профиль уровней экзотоксина A и пиовердина/пиоцианина/ферроксидазы в комбинации с самочувствием пациента после введения первого антибиотика. Может пройти несколько дней, прежде чем пациент сообщит об улучшении самочувствия, и это может не являться хорошим индикатором эффективности введенного лекарственного средства в борьбе с инфекцией.

На фиг.6 показано, каким образом настоящее изобретение может уменьшить продолжительность эмпирической оценки эффективности антибиотиков, имеющихся в распоряжении у лечащего врача. Настоящее изобретение способно сократить 21-дневный срок подбора нужного антибиотика до 7-дневного просто за счет ежедневного применения одноразового устройства для тестирования.

На фиг.7 показана идея устройства для применения в способе по настоящему изобретению.

На фиг.8 показан эмиссионный спектр образца типового пациента для обнаружения сидерофоров.

На фиг.9 показан другой эмиссионный спектр, на котором имеется характерный пик при 340 нм.

На фиг.10 показано изменение уровней экзотоксина A с течением времени у пациента 5.

На фиг.11 показано изменение эмиссионных пиков при 340 нм и 460 нм с течением времени у пациента 2.

На фиг.12 показано изменение уровней экзотоксина, сидерофора и маркера воспаления с течением времени у пациента 3.

На фиг.13 показано изменение уровней экзотоксина A с течением времени у пациента 3.

Подробное описание изобретения

Организм человека не является естественной средой обитания бактерий P. aeruginosa, эти бактерии живут в воде и существуют в планктонном состоянии (свободных клеток в воде) в реках и в почве. Они могут хорошо развиваться в этой среде, т.к. способны быстро адаптироваться и могут расти почти на любом источнике углеродсодержащей пищи. Даже химические соединения, токсичные для других бактерий, например метанол, могут служить источником углерода для этого опасного патогена, поддерживая его рост и размножение (1). Эти бактерии быстро адаптируются к различным условиям, экспрессируя широкий спектр генов, связанных с метаболизмом, которые подвергаются целенаправленным мутациям, происходящим с очень высокой скоростью.

При попадании в легкие человека (колонизации) P. aeruginosa адаптируется, меняя свой образ жизни. Теперь эти бактерии не образуют свободную суспензию в легких, а выделяют слизь, формируя биопленку на поверхности легких, в которой они скрываются, спасаясь от механизма иммунной защиты пациента, а также от антибиотиков. Это делает очень затруднительным избавление от P. aeruginosa, если они уже заселились в организм пациента с CF (обычно это происходит в среднем подростковом возрасте), и это означает, что указанные микроорганизмы остаются у пациента с CF до конца жизни, превращаясь в паразитов, которые часто угрожают жизни хозяина, когда они подвергаются быстрым мутациям и превращаются в еще более вирулентные формы.

Современные исследования, в которых бактериальную ДНК, изолированную непосредственно из мокроты, подвергали секвенированию (что позволяет избежать изменений, вызванных получением субкультуры), показали, что 10-20 штаммов, присутствующих в организме одного пациента, имеют одного и того же предшественника и происходят от одного клона, который впоследствии подвергался мутациям. Таким образом, бактерии P. aeruginosa адаптируются за счет мутаций, преимущественно в ответ на изменения в организме хозяина, связанные со старением пациента и изменением состава его легких с течением времени, а также с ослаблением функции легких с каждым воспалением, вызванным инфекцией. Каждый новый штамм, вероятно, имеет определенные преимущества перед своими предшественниками, которые делают его более приспособленным к произошедшим изменениям среды обитания.

По-видимому, бактерии P. aeruginosa живут в состоянии сложной кооперации с клетками своего штамма и даже других штаммов. У этих бактерий развился способ передачи информации об их метаболическом статусе другим клеткам посредством «химического языка». Многие сигнальные химические молекулы были изолированы и идентифицированы, и их совокупность именуется молекулами передачи коммуникационных сигналов Pseudomonas (PQS). Они являются сложными молекулярными структурами, часто нерастворимыми в воде, т.е. они требуют сложных лабораторных методик исследования, например ЖХ МС для обнаружения их присутствия в мокроте пациента.

Существует много идей, объясняющих цели этой межклеточной передачи сигналов, но самая популярная теория, объясняющая развитие такой способности у клеток, заключается в том, что передача сигналов позволяет клеткам ощущать, что окружающие клетки увеличивают метаболическую активность и близится период резкого увеличения их численности - в случае бактерий это именуют коммуникационными ощущениями или «ощущением кворума» (фиг.1). Возможно, польза для каждого из штаммов бактерий от способности ощущать, что популяция бактерий вступает в период быстрого увеличения численности, заключается в том, что каждый штамм может получить гарантии, что он не будет оттеснен от ресурсов другими штаммами или что он не будет отравлен за счет выработки экзотоксинов другими бактериями за счет такого же ускорения их метаболизма.

Для бактерий «ощущение кворума» предшествует быстрому размножению. Для пациента «ощущение кворума» предшествует обострению заболевания. Пусковой механизм, вызывающий этот переход бактерий из малоактивного состояния в состояние высокой активности, неизвестен, возможно его вызывают вирусные инфекции или некоторые другие изменения в состоянии организма хозяина. Но если активизация бактерий началась, а лечение не проводится, то обострение развивается в полномасштабную инфекцию в течение 2-4 дней и часто до того, как пациент почувствует себя плохо (фиг.2).

Реакция пациента на обострение инфекции может также включать воспалительную реакцию, которая может наносить такой же вред легким пациента, как и сама инфекция. Эта реакция приводит к появлению второго набора биомаркеров, которые можно использовать для объективной оценки состояния здоровья пациента с CF.

Понимание того, когда следует лечить пациента с CF антибиотиками, чтобы бороться с обострением, до того, как оно развилось в полномасштабную инфекцию, и даже до того, как пациент ощутил ухудшение самочувствия, могло бы понизить тяжесть инфекции при каждом эпизоде ее появления. Кроме этого, знание того, когда стоит вмешиваться в течение заболевания путем введения антибиотиков, является важным вопросом как для лечащего врача, так и для пациента с CF. Чрезмерное применение антибиотиков ведет к более быстрому развитию у бактерий устойчивости к антибиотикам. В случае пациентов с CF, имеется лишь 2 или 3 антибиотика, способных подавлять полностью развившуюся легочную инфекцию, поэтому следует назначать эти препараты только, когда они действительно необходимы. Это значит, что их не следует применять в профилактических целях и давать непрерывно, поскольку это могло бы лишь приблизить время, когда у патогена разовьется устойчивость к антибиотикам.

Существует несколько объективных способов определения состояния здоровья больных с CF, у которых существует возможность развития эпизода обострения без того, чтобы пациент ощущал себя больным. Классическими способами, применяемыми для неколичественного мониторинга легочных инфекций, являются: прослушивание дыхательных шумов, рентгеновское и ультразвуковое исследование, а также появление и культивирование мокроты (смеси слизи, продуктов распада и клеток, выброшенных легкими). Лечебный персонал, имеющий опыт ведения пациентов с CF, приобретает опыт оценки состояния пациента путем наблюдения за объемом, вязкостью и цветом мокроты пациента. Способность осуществлять такие субъективные наблюдения приобретается с годами работы в больничной палате и является высокопрофессиональным навыком, требующим к тому же, чтобы пациент находился в клинике.

Имеется неудовлетворенная клиническая потребность в быстром, мобильном, простом и недорогом тесте, который позволял бы количественно измерять «маркеры обострения» в мокроте, концентрация которых может использоваться для обнаружения обострения, прежде чем разовьется полномасштабная инфекция. Обнаружение самих бактерий P. aeruginosa в данном случае бесполезно, т.к. у большинства пациентов с CF они присутствуют постоянно. Например, обнаружение присутствия P. aeruginosa с помощью qRT PCR по наличию мРНК является высокочувствительным и количественным, но результаты анализа не коррелируют со степенью сепсиса, а указывают только на наличие бактерий, и данная методика является слишком сложной и дорогостоящей, чтобы каким бы то ни было образом использовать ее в домашней обстановке. Необходима именно способность обнаруживать изменения в метаболическом статусе бактерий, прежде чем обострение превратится в полномасштабное заболевание, путем наблюдения за изменением концентрации маркеров у пациента с течением времени.

Различные аспекты настоящего изобретения относятся к очень простому способу, основанному на нескольких маркерах, который до сих пор не применялся в данной области: причем могут применяться комбинации любых или всех из этих маркеров; в некоторых вариантах осуществления для первоначальной диагностики может применяться один маркер, предпочтительно маркер процесса захвата железа. Способ по настоящему изобретению включает применение следующих маркеров:

Маркер 1 - указывает на выработку токсина (например, экзотоксина A), поскольку его легко обнаружить с помощью недорогого иммуноанализа. Экзотоксин A продуцируется бактериями P. aeruginosa, находящимися в состоянии высокой активности, которые секретируют эти сложные молекулы в качестве природных ядов для уничтожения других бактерий с целью достижения преимущества в борьбе за ресурсы для собственного роста. Кроме того, экзотоксин A очень ядовит для пациента, вызывая симптомы сепсиса с поражением многих органов.

Для повышения точности теста по настоящему изобретению предпочтительно, помимо экзотоксина A, осуществлять также обнаружение других маркеров для количественного определения «бактериальной нагрузки» (показателя общего количества бактерий, присутствующих в легких, и «статуса» их активности). Молекулы, осуществляющие передачу коммуникационных сигналов, посредством которых происходит передача информации между бактериями, идеально подошли бы на роль таких маркеров, т.к. они позволили бы клиницисту «слышать разговоры клеток друг с другом», но такие молекулы нерастворимы в воде и их содержание трудно измерять без использования сложного лабораторного оборудования. Поэтому авторы изобретения предприняли поиск других возможных вторичных маркеров, уровни которых легче измерять, но которые, при этом, тесно связаны с передачей коммуникационных сигналов.

Маркер 2. Маркер захвата железа рассматриваемого патогена. Несмотря на устойчивость к неблагоприятным условиям, бактериям P. aeruginosa, как и всем живым существам, для успешного развития необходимы ионы железа (III). Эта потребность, наряду с выработкой экзотоксина A, дает возможность обнаружить новое удобное «средство» определения того, насколько активен данный патоген в данный конкретный момент времени. Это новое средство или биомаркер является маркером 2 в тесте по настоящему изобретению, показывающим насколько активно клетки захватывают ионы железа (III) или, говоря точнее, биомаркером уровня активности захвата ионов железа (III) бактериями в легких.

Легкие больных CF вырабатывают большое количество мокроты, и, кроме того, наблюдается проникновение крови в покрытые жидкостью воздушные отсеки этого жизненно важного органа. Благодаря этому избыточному поступлению ионов железа (III), бактерии P. aeruginosa способны успешно развиваться в организме пациентов с CF (2), и даже могут являться причиной анемии у больных CF (3).

P. aeruginosa имеют много механизмов захвата ионов железа (III) и, по-видимому, переходят от одного механизма к другому в ответ на любые изменения условий в организме хозяина. Поэтому подход, направленный на выбор только одного маркера, был бы слишком упрощенным, и авторы решили придерживаться комплексного подхода.

Простые и легко обнаруживамые маркеры для исследования активности захвата ионов железа (III): простейшими маркерами, доступными для количественного измерения, являются бактериальные ферментные кофакторы или «сидерофоры», которые продуцируются в больших количествах перед началом обострения в качестве «вторичного сигнала», т.е. они продуцируются в высоких концентрациях только во время периодов активного роста. P. aeruginosa секретируют ряд пигментов, в т.ч. пиоцианин (сине-зеленый), пиовердин (желто-зеленый и способный к флуоресценции) и пиорубин (красно-коричневый) (фиг.3). Под микроскопом бактерии P. aeruginosa часто обнаруживают в первую очередь по их перламутровому виду и виноградному запаху. Доказательная клиническая идентификация P. aeruginosa часто включает определение выработки пиоцианина и пиовердина, а также их способности к росту при 42°C.

Указанные сидерофоры имеют очень высокое сродство к иону железа (III) и считается, что они принимают участие в механизме поглощения железа этими бактериями, который играет решающую роль для роста (4). Способность секретировать поглотители этих ионов из среды, непосредственно окружающей клетку, дает бактерии преимущество в том, что она способна ловить и захватывать железо, которое остро необходимо для быстрого деления клеток и выработки белков. Измерение концентрации этих окрашенных молекул могло бы служить удобным биомаркером для построения профиля активности захвата железа.

Детектирование пиовердина является очень несложным, благодаря его способности к флуоресценции, причем эту флуоресценцию можно подавить добавлением ионов железа (III). Кроме того, пиовердин можно определить в мокроте с применением конкурентной реакции с другим красителем, связывающим ионы железа (III), именуемым хромазурол S (CAS), с помощью спектрофотометрического анализа (5). Сидерофоры можно также детектировать с помощью иммуноанализа, хотя такие методики до сих пор не разработаны. Количественное определение пиовердина в мокроте с применением оптических способов (основанных на поглощении или флуоресценции) требует экстракции растворителями, поскольку густая непрозрачная слизь препятствует измерению, что мешает применять простые устройства, подходящие для домашнего использования, но такие способы можно осуществлять в лабораторных условиях, что и было сделано в первоначальных исследованиях авторов изобретения.

Действительно, Huston и соавторы (6) уже провели аналогичные исследования, в которых обнаружили, что концентрация сидерофоров, продуцируемых культурами бактерий, отобранных у CF пациентов и выращенных в культуральной среде, в значительной степени меняется от пациента к пациенту. Они строили профили концентрации сидерофоров в изолятах образцов отдельных пациентов, впоследствии культивированных в лаборатории, а не определяли концентрацию сидерофоров непосредственно в мокроте, и затем строили профиль для ряда образцов одного и того же пациента. Таким образом, они не зафиксировали относительных изменений концентрации для каждого пациента, для серии образцов, отобранных перед, во время и после обострения. Проводя свои исследования без тесного сотрудничества с опытными клиницистами, Huston и соавторы пришли к выводу, что сидерофоры нельзя использовать в качестве биомаркера обострения. Этот подход является ошибочным, но с ним постоянно приходится сталкиваться в научной литературе. Причина этого заключается в том, что проводящие исследования биохимики не имеют связи с коллегами в клинике. Изучение моделей клеточного роста в тестовых пробирках приводит к сомнительным результатам: исследователь может заставить эти клетки делать почти все, что ему захочется, меняя условия их роста, без всякой связи с реалиями клинической практики, и эта информация имеет минимальное значение для разработки средств лечения. Изучаемые патогены обладают способностью к адаптации - если исследователь меняет ростовую среду, клетки меняют свое поведение. Необходимо именно непосредственное исследование клинических образцов и решение проблемы измерения содержания маркеров в мокроте, а не в клеточной культуре, выращенной в искусственной среде.

Huston и соавторы пришли к заключению, что еще один путь захвата железа (III), в котором задействован бактериальный фермент ферриоксидаза, секретируемый в периплазму бактерий, является корректным биомаркером для построения профиля. Однако указанные биохимики упустили тот факт, что именно общая активность поглощения железа (III) бактериями является наилучшим биомаркером, и для ее измерения предпочтительно требуется комплексный подход, если необходимо разработать средство, подходящее для всех пациентов, у которых имеются различные штаммы, причем все эти штаммы находятся на различных стадиях развития в организмах их носителей.

Наряду с двумя указанными предпочтительными маркерами, т.е. токсинами и маркерами захвата железа, имеется возможность включить в исследование дополнительные маркеры. В число этих маркеров входят:

Маркер 3. Маркер захвата железа организмом хозяина. В организмах здоровых людей не происходит накопления ионов железа (III) в жидкости, покрывающей поверхность легких, поэтому бактерии не могут удерживаться и расти в легких. Путем абсорбции ионов железа (III) рядом путей, включающих продуцирование белков, связывающих железо, и именуемых лактоферрином, ферритином и трансферрином, организм человека защищается, делая содержание железа недостаточным для вторжения патогенов, что является очень эффективной формой защиты от инфекции. В организме человека также происходит разрушение гема, т.е. простетической группы, которая состоит из атома железа, находящегося в центре большого органического гетероцикла, именуемого порфирином. Гемы чаще всего являются компонентами гемоглобина, т.е. красного пигмента крови, но, кроме того, они включены в структуры ряда других гемопротеинов. В целях конкуренции с бактериями, организм хозяина вырабатывает фермент гем монооксигеназу (именуемую также ферридоксиназой), которая разрушает гем до ионов железа (которые не могут поглощаться бактериями), биливердина (желтого пигмента) и монооксида углерода. Наблюдая за изменениями уровней либо фермента, либо биливердина в мокроте, можно определить активность системы естественной защиты организма от патогена.

Маркер 4. Воспалительная реакция: цитокины. Цитокиновые маркеры получили широкое освещение в литературе. В частности, такие маркеры, как TNFα и IL-8, уже применялись для создания профилей пациентов в лаборатории авторов изобретения. Заболевания дыхательных путей при муковисцидозе характеризуются непрерывным циклом хронической инфекции, и воспаление преобладает за счет нейтрофильного инфильтрата. Это воспаление характеризуется повышенной выработкой провоспалительных цитокинов в легких. Взаимосвязь между аномальным продуктом экспрессии гена CFTR, развитием воспаления и прогрессированием заболевания легких при муковисцидозе понятна не до конца. Courtney и соавторы (7) привели обзор механизмов воспаления легких при CF, профили цитокинов и медиаторов воспаления в легких при CF и механизмы, которые могут спровоцировать хроническую инфекцию P. aeruginosa. В настоящее время дисбаланс секреции цитокинов стал более понятен, благодаря последним успехам в понимании CF на молекулярном уровне, и нарастает понимание того, что нормальный воспалительный процесс нарушается на ранних стадиях развития CF, и он может иметь место при отсутствии обнаружимой инфекции.

Комбинация маркеров для повышения точности

При объединении анализов на бактериальные маркеры выработки токсинов и захвата железа в простом комбинированном тесте должна появиться возможность точной оценки метаболического статуса P. aeruginosa в реальных образцах мокроты и, следовательно, в легких пациента. Кроме того, при измерении опосредованной цитокинами реакции организма хозяина, относящейся к захвату железа и воспалению, можно получить другое объективное средство для определения статуса пациента с CF (см. таблицу 1).

Таблица 1
Сводка ряда маркеров, подходящих для построения точных продолжительных профилей пациентов с CF
Патоген Хозяин
Продуцирование токсина - Экзотоксин A Нет
Захват железа:
сидерофоры
гем монооксигеназа
Захват железа:
(b) гем монооксигеназа
(c) биливердин
Воспалительная реакция Воспалительная реакция: цитокины

Этот подход дает возможность решить проблему невысокой точности, которой страдают описанные выше быстрые тесты на C. difficile. На самом деле, подход, связанный с пониманием метаболических путей патогена и выявлением вторичных индикаторов, которые следует использовать в комбинации с детектированием бактериальных токсинов, может применяться к большому количеству разных патогенов, таких как Staphylococcus aureus, который является вторичным патогенном, часто встречающимся у пациентов с CF.

Точка зрения авторов изобретения заключается в том, что применение количественного анализа, позволяющего выявить профиль четырех классов биомаркеров на протяжении продолжительного времени у пациента, осуществляемого для необработанных образцов мокроты (а не образцов крови, отобранных инвазивным способом, или клеток, культивированных в не репрезентативной ростовой среде) с целью определения бактериальной нагрузки P. aeruginosa на организм, обладает одновременно точностью и чувствительностью (фиг.4).

Подход авторов, заключающийся в определении указанных минорных биомаркеров, гораздо легче развить и претворить в медицинское устройство, чем детектирование самих бактерий, которое потребует выделения из бактериальных клеток или клеточных мембран белков или других мишеней, что является более сложным и проблемным подходом для создания на его основе теста, применяемого дома или в больничной палате.

Далее, если, как ожидают авторы, комбинированный профиль указанных четырех классов маркеров в мокроте действительно коррелирует с состоянием легких, авторы полагают, что уже сейчас появляется простая технология скрининга, которая могла бы предсказать обострение у пациентов, для лучшего управления их состоянием в домашних условиях, и могла бы дать медицинским работникам средство, с помощью которого они могли бы заблаговременно вмешиваться в развитие обострения.

Еще одно преимущество различных вариантов осуществления настоящего изобретения заключается в том, что оно могло бы дать клиницистам возможность отслеживать эффективность применения антибиотиков в течение 2-3 дней их введения, значительно быстрее, чем в существующей медицинской практике. Если бактериальная нагрузка снижается по ходу лечения, антибиотик, по-видимому, является эффективным и наоборот. Клинические данные показывают, что даже если антибиотик подавляет инфекцию, это может случиться за несколько дней до того, как пациент сообщит об улучшении самочувствия. Хорошее самочувствие может не находиться в тесном соответствии с эффективностью вводимого антибиотика в первые и самые важные дни после начала введения (фиг.5).

Возможно, что основная польза от настоящего изобретения для лечащих врачей заключается в возможности объективного определения эффективности выбранного антибиотика путем наблюдения за изменением концентрации биомаркеров. Если уровни экзотоксина A и пиовердина/пиоцианина/ферриоксидазы не падают, это указывает на неэффективность антибиотика. Клиницист может принять решение о переходе на второй антибиотик в течение лишь 2 дней, вместо 7-дневного ожидания и наблюдения за улучшением состояния пациента, и т.д., пока не появится эффективная стратегия лечения. Потенциально это может превратить 21-дневный срок подбора антибиотика в 7-дневный, уменьшить воспаление и, тем самым, спасти легочную ткань при уменьшении частоты госпитализации и времени пребывания на больничной койке (фиг.6).

Хотя настоящее изобретение можно реализовать путем проведения отдельных анализов отдельных образцов мокроты, пользователям было бы удобнее иметь возможность проводить три теста совместно с помощью одного тестового устройства, например, имеющего вид щупа.

Идея устройства для проведения этого одновременного теста показана на фиг.7. Это тестовое устройство может включать либо биосенсор, либо тестовые полоски. Любой из этих подходов потребует наличия электронного элемента многоразового применения для количественного измерения сгенерированного сигнала.

Экспериментальные данные

В качестве подтверждения изложенных выше представлений, авторы определили профили образцов мокроты, отобранных у 5 различных пациентов. Для пациентов, являющихся носителями P. aeruginosa, обострение инфекции обнаруживали путем определения профилей уровня экзотоксина A в мокроте за 7 или более дней до того, как пациент почувствовал себя настолько плохо, что вынужден был обратиться в клинику. Авторы продемонстрировали, что эффективность лечения одним антимикробным средством по сравнению с другим можно определить путем построения долговременного профиля содержания экзотоксина A в мокроте. Авторы выявили два потенциальных флуоресцентных биомаркера, присутствующих в мокроте. Было достоверно установлено, что один из этих маркеров является сидерофором, который продуцируются бактериями в качестве молекулы, осуществляющей захват железа и/или создающей «ощущение кворума». Выработка указанной молекулы предшествует обострению у исследованных пациентов. Природа второй молекулы в настоящий момент остается неизвестной. Если эта вторая молекула обнаруживалась в высоких концентрациях, вырабатываемые бактериями сидерофоры обнаружить не удавалось. Присутствие двух этих маркеров, по-видимому, было взаимоисключающим. Авторы предполагают, что эта неизвестная молекула представляет собой соединение (или соединения), продуцируемые организмом хозяина, поскольку они присутствовали в мокроте CF пациентов, как инфицированных, так и не инфицированных P. aeruginosa.

Авторы определили профили двух дополнительных маркеров воспаления, продуцируемых организмом хозяина - цитокинов IL-8 и TNFα. Хотя маркеры воспаления приносят определенную пользу, они, по-видимому, не являются хорошими средствами для предсказания обострения, что само по себе является очень ценной информацией, но их уровни действительно демонстрируют заметное уменьшение во время успешной антимикробной терапии.

Ежедневно отбирали образцы мокроты у пяти пациентов.

Были выбраны пять биомаркеров, которые имели наибольшие шансы оказаться полезными в качестве индикаторов вирулентности колонизирующего патогена. Вирулентность определяется комбинацией количества присутствующих бактерий (общего количества, а не концентрации) и их активности in situ в легких. В качестве биомаркеров авторы выбрали молекулы, которые играют ключевые роли в способности бактерий успешно развиваться и размножаться или представляют собой молекулы, продуцируемые организмом хозяина (пациента) в ответ на инфекцию или в качестве элемента его защиты от инфекции. Таким образом, авторы попытались создать «моментальные снимки» ситуации, в которой отбирались образцы.

Эти биомаркеры перечислены в приведенной ниже таблице 2:

Таблица 2
Маркер патогена Маркер хозяина
Выработка токсина - экзотоксин A Нет
Захват железа: Захват железа:
Сидерофор Гем монооксигеназа
Биливердин/билирубин
Воспалительная реакция:
Цитокин IL-8
Цитокин TNF-α
Лактоферрин

Хорошо известны прецеденты использования бактериальных токсинов в качестве маркеров инфекций, например токсинов A и B C. difficile. В настоящее время признана недостаточность применения любого из этих токсинов в качестве единственного маркера для детектирования C. difficile: эти быстрые POC тесты обеспечивают точность обнаружения 80-85% по сравнению с тестами, основанными на клеточной культуре (которые продолжаются 78 часов и являются слишком медленными). Некоторые образцы просто не содержат токсинов A/B в обнаружимых количествах, и этот факт ограничивает точность данных тестов.

В противоположность этому, использование сидерофоров (молекул, продуцируемых бактериями, которые принимают участие в передаче клеточных сигналов и захвате ионов железа и, следовательно, имеющих важное значение для быстрого роста) было описано в качестве возможного биомаркера с разной степенью результативности. Не все изоляты P. aeruginosa из мокроты пациентов с CF продуцируют эту флуоресцентную молекулу. Объяснение этого факта авторами изобретения заключается в том, что колонизирующие бактерии мутируют с течением жизни хозяина, адаптируясь к изменениям среды. Поскольку пациент стареет, поражение легких усиливается и проникновение крови в легкие увеличивается, для бактерий уменьшается необходимость тратить энергию для захвата ионов железа, и клоны, не продуцирующие сидерофоры, получают преимущество при отборе. Эти соображения могут служить объяснением того, что некоторые пациенты имеют колонии бактерий с низкой способностью продуцировать сидерофоры - в них нет необходимости, поскольку их выработка является затратной для бактерий с метаболической точки зрения. Поэтому сидерофоры сами по себе не являются надежными маркерами для любого пациента. Соответственно, полезным является подход, в котором используется комбинация маркеров самых разных процессов, происходящих в бактериях, и такой подход дает более широкие возможности получения точной картины активности бактерий, безотносительно к степени мутации исходных бактерий дикого типа, которые заселяли организм пациента в среднем подростковом возрасте.

Для защиты легких человека от вторжения патогенов у млекопитающих развились механизмы удаления железа из слизи, которой покрыта ткань стенок легких, соприкасающаяся с воздухом. Эти механизмы (имеется целый ряд таких механизмов) разрушают гемоглобин из крови, которая может проникать в жидкость, покрывающую поверхность легких, превращая железо (III), которое необходимо для быстрого роста бактерий, в железо (II). Это делает железо недоступным для бактерий, поскольку они не способны поглощать железо в форме железа (II). Образование побочных продуктов разрушения гемоглобина, катализируемого многими ферментами, но в особенности гем монооксигеназой, приводит к появлению окрашенных пигментов биливердина и билирубина, которые чаще всего можно видеть в синяках и ушибах. Наблюдение за образованием этих пигментов или за активностью ферментов организма хозяина, которые катализируют этот процесс и, следовательно, защищают организм путем удаления железа, является еще одним маркером.

Наконец, авторы выбрали цитокины - небольшие молекулы, продуцируемые организмом хозяина в качестве элемента воспалительной реакции на вторжение патогенов и их токсины. Цитокины IL8 и TNFα были обнаружены в мокроте больных CF другими исследователями.

Разработка методик анализа

Для всех анализов необходима аналогичная подготовка образцов с целью удаления мешающей слизи. Авторы исследовали несколько методик удаления этого негомогенного материала, включая механическое разрушение, химическое расщепление и отделение ультрацентрифугированием. Комбинация химического расщепления и гомогенизации обеспечивала хорошие результаты в случае тестов, основанных на иммуноанализе. Эта стадия в комбинации с дополнительной стадией осаждения органических молекул (ДНК, жиров и белков) была необходима для определения сидерофоров.

IL8 и TNFα: Для анализа применялся коммерческий набор производства Millipore, в котором используется методика на основе гранул для иммуноанализа Luminex. Профили двух указанных биомаркеров определяли во всех образцах.

Экзотоксин A: В окончательном варианте определения экзотоксина A, цельную мокроту подвергали химическому расщеплению и в «сыром виде» исследовали с помощью иммуноанализа. Примененная методика анализа дала возможность построить профили для пациентов и продемонстрировала, что экзотоксин A может применяться в качестве маркера для предсказания обострения и наблюдения за эффективностью борьбы с инфекцией после начала антимикробной терапии.

Сидерофоры. Несколько соединений были идентифицированы и отнесены к числу сидерофоров, и эти соединения имеют целый ряд наименований, в том числе: пиоцианин (сине-зеленый), флуоресцеин (желто-зеленый и способный к флуоресценции, в настоящее время известный также как пиовердин) и пиорубин (красно-коричневый). Эти соединения имеют характерные спектры поглощения и флуоресценции. Ранее опубликованные в литературе сообщения, посвященные определению уровней этих соединений в мокроте, включали применение сложных методик хроматографической очистки и/или введения химических меток. Эти методики являются слишком дорогостоящими для широкомасштабных исследований. Авторы изобретения разработали очень простую методику отделения этих молекул от слизи, белков и ДНК с использованием простого одностадийного осаждения небольшим объемом растворителя, который затем удаляют выпариванием. Эту простую методику можно было бы легко автоматизировать. Стадия осаждения позволяет устранить зеленую окраску, часто присутствующую у образцов, отобранных у инфицированных пациентов, поэтому измеренные образцы пигментов не содержали белков, например гемоглобина, или альгинатов, но легко растворялись в воде и органических растворителях. Вероятно, они представляли собой органические молекулы с полярными боковыми группами.

Значительная оптимизация методики получения образцов будет возможна в результате дальнейших усовершенствований, тем не менее, и, несмотря на существующие ограничения, был достигнут предел обнаружения экзотоксина A в цельной мокроте 0,1 нг/мл. Значения 20 нг/мл и более хорошо коррелируют с началом заболевания у пациента и необходимостью лечения противомикробными средствами. В литературе сообщалось о верхнем пределе содержания экзотоксина A в крови 160 нг/мл. У данной методики анализа существуют значительные резервы улучшения пределов обнаружения. С применением разработанных авторами реагентов и полностью оптимизированной методики получения образцов и проведения анализа авторы ожидают достижения пределов обнаружения 1 нг/мл в 10-минутном тесте. Авторы прогнозируют, что это даст возможность обнаруживать экзотоксин A до того, как ухудшится самочувствие пациента, что позволит получить сигнал о приближающемся обострении за 7-10 дней до его начала.

Результаты

Флуоресцентные спектры регистрировали для каждого из 260 образцов для обнаружения и количественного определения относительной концентрации сидерофоров в мокроте. На фиг.8 показан эмиссионный спектр фракции, извлеченной из мокроты пациентов, соответствующий типовому спектру сидерофоров, приведенному в научной литературе. Возбуждение осуществлялось на длине волны 300 нм, и эмиссию регистрировали в диапазоне от 320 нм до 500 нм. Спектры регистрировались в относительных единицах флуоресценции (RFUs). Эти спектры регистрировались для образцов мокроты, отобранных у пациента 2 ближе к концу периода исследования.

Кроме того, авторы неожиданно обнаружили другое соединение с очень характерным видом спектра, в котором наблюдается характеристический пик при 340 нм, при длине волне возбуждения 280 нм. Концентрация этого вещества в некоторых образцах была настолько высокой, что они имели оранжевую окраску. На фиг.9 показан характеристический пик при 340 нм при возбуждении на длине волны 280 нм. Отметим незначительный след пика при 410 нм. Этот спектр был зарегистрирован для пациента 2 в начале периода исследования. Этот пик при 340 нм полностью исчез из образцов мокроты указанного пациента ближе к концу периода исследования.

Природа пика при 340 нм остается неизвестной, но такой спектр характерен для продуктов распада гема, и это позволяет предположить, что у пациентов с высокой концентрацией этого вещества наблюдается проникновение крови в легкие. Факт, что данное вещество не относится к продуктам патогена, подтверждается тем, что указанный пик содержался также в спектрах образцов мокроты пациентов с CF, не зараженных P. aeruginosa.

Профили биомаркеров пяти пациентов с CF

Авторы регистрировали профили мокроты 5 пациентов. Волонтеров просили сдавать образцы каждый день; однако были периоды, когда образцы не отбирались и поэтому имеются пропуски в данных.

Значения для каждого биомаркера наносили на графики, построенные в одной и той же шкале, для облегчения сравнения данных пациентов друг с другом. Затем на эти графики помещали комментарии, касающиеся истории болезни пациента, состояния здоровья, лечения пероральным или внутривенным введением антимикробных средств и госпитализации.

IL8 и TNFα: уровни экспрессии данных белков менялись в значительной степени. Как правило, уровни повышались во время обострения, но они не давали возможности предсказать наступающее обострение. Примечательно, что уровни обоих цитокинов понижались во время лечения антимикробными средствами, в особенности, когда пациентов лечили в клинике.

Экзотоксин A: в течение двух отрезков времени для различных пациентов были продемонстрированы экспериментальные доказательства взглядов авторов изобретения на решение основных проблем.

Пик при 460 нм: дополнительный биомаркер для подтверждения данных экзотоксина A, в частности, для пациентов, у которых наблюдалось хорошее состояние здоровья в течение продолжительных периодов, наблюдался у одного пациента, который чувствовал себя хорошо в течение периода исследования.

Пик 340: полезен для оценки предрасположенности (восприимчивости) пациентов к обострению.

Проблема 1: заблаговременное предупреждение о начале обострения

Экзотоксин A в качестве маркера. Пациент 5 продемонстрировал повышенные уровни экзотоксина A, но сообщал о хорошем самочувствии во время планового визита в клинику. Через 14 дней пациент 5 сообщил о плохом самочувствии и был помещен в клинику. На фиг.10 показан профиль экзотоксина A для этого пациента. Уровни экзотоксина A повысились до визита в клинику, где он сообщил о хорошем самочувствии. Уровни продолжали повышаться. Через 14 дней пациент 5 сообщил о плохом самочувствии, и началось IV введение антибиотиков. После IV лечения уровни экзотоксина A упали.

Сидерофор в качестве маркера

У пациента 2 было обнаружено наличие пика при 340 нм в начале периода исследования. Уровни этого пика упали до нуля при одновременном увеличении пика при 460 нм. Через 5 дней пациент сообщил о плохом самочувствии. Через 10 дней после этого началось IV введение антимикробных средств. На фиг.11 показаны результаты для этого пациента.

Проблемы 2 и 3: Быстрое принятие решения об эффективности антимикробной терапии и получение объективной информации о качестве самостоятельного лечения в домашних условиях

Отбор образцов у пациента 3 охватывал один период перорального лечения антибиотиком, три периода IV лечения и госпитализацию в клинику. Это дало большое количество информации, которая суммирована на фиг.12.

Экзотоксин A: пациент 3 почувствовал себя плохо 17-го ноября и начал пероральный прием антибиотиков 19-го ноября (см. фиг.13). 25-го ноября пероральный прием заменили на IV введение антимикробных препаратов. Уровни экзотоксина A продолжали увеличиваться во время IV лечения в домашних условиях. Пациент 3 сообщил, что «стал чувствовать себя лучше, но не хорошо» и был госпитализирован 9-го декабря. Во время пребывания в клинике начали введение другого антимикробного препарата. Уровни экзотоксина A немедленно понизились до исходного уровня.

Пики при 340 нм и 460 нм: у пациента 3 были обнаружены повышенные уровни пика при 340 нм во время всего периода исследования. Был обнаружен пик при 460 нм. Такая же ситуация наблюдалась у всех пациентов за исключением пациента 2. Все, кроме пациента 2 (мужчины в возрасте 21 года), были больны и подвергались лечению антимикробными препаратами во время исследования, включая пациента 4 (женщину 21 года, близнеца пациента 2). Указанные пациенты были отобраны для этого исследования по причине регулярных заболеваний. Авторы связали высокие уровни пика при 340 нм в течение долгого времени с тем, что пациент был болен, возможно, под угрозой обострения или имел предрасположенность к обострению. Пациент 3 подтверждает это предположение.

Выводы из исследований

Долговременное определение профилей мокроты у пациентов с CF (с учетом того, что мокрота является легко доступным жидким выделением организма и, следовательно, с большей вероятностью можно добиться приверженности пациента следованию режиму тестирования) может решить проблемы 1, 2 и 3 (не решенные в технике известного уровня):

- Определение профиля экзотоксина A может применяться для предсказания обострения за 7 или более дней, как показано на примере пациентов 3 и 5.

- Сидерофоры были обнаружены не у всех пациентов, в частности у тех, кто был постоянно болен. Но у пациентов, которые чувствовали себя хорошо (и, следовательно, у них не проявлялся пик при 340), они могли бы являться полезным дополнительным маркером для экзотоксина A (пациент 2).

- Пик при 340 нм и пик при 460 нм являлись взаимоисключающими (пациент 2).

- Более молодые пациенты (2 и 4, которые были близнецами) имели сходные (и невысокие) концентрации продукта, соответствующего пику 340 нм, тогда как остальные пациенты более старшего возраста имели более высокие уровни, которые оставались постоянно высокими на протяжении всего периода исследования. Авторы изобретения связывают постоянно высокие уровни пика 340 нм с регулярной заболеваемостью.

- Экзотоксин A может использоваться в качестве маркера эффективности антимикробной терапии. Убедительным доказательством этого является пример пациента 3, у которого изменение лекарственного средства привело к уменьшению уровней экзотоксина A примерно в течение ночи.

- Уровни цитокинов снижались по ходу лечения, но возможно демонстрировали слишком неопределенную реакцию, чтобы их профили можно было применять с целью решения проблем 1-3.

В заключении отметим, что идеальное устройство для тестирования могло бы являться комбинацией тестов на полосках, одного для экзотоксина A, одного для соединения (соединений) обусловливающего(их) пик при 340 нм, и одного для сидерофоров (соединений, обусловливающих пик при 460 нм). Пациенты с постоянно высоким уровнем соединений, обусловливающих пик 340 нм, могли бы считаться более склонными к обострению и наблюдаться более тщательно. Любое увеличение уровней экзотоксина A у этих пациентов могло бы служить сигналом для немедленного перорального введения противомикробных средств (день 1) и повторения тестирования раз в два дня. Неудача в снижении этих уровней могла бы служить сигналом для IV введения противомикробных средств в домашних условиях (день 3). Еще одна неудача в снижении уровней могла бы служить причиной для лечения в клинике, возможно, с применением альтернативных антимикробных средств (день 5). Если больной находится в клинике, тесты на экзотоксин A могли бы подтвердить эффективность выбранного способа лечения и могли бы обеспечить дополнительное подтверждение того, что борьба с инфекцией проходит успешно, давая уверенность в скорой выписке пациента из лечебного учреждения домой. Последующее лечение в домашних условиях могло бы сопровождаться мониторингом, и любой рецидив (например, вследствие плохого самостоятельного введения лекарственного препарата) мог бы быть выявлен по увеличению уровней экзотоксина A.

Список литературы

1. Auton, K. Ph. D Thesis 1988. Southampton University.

2. Lamont I.L, Konings A.F, Reid D.W. Biometals. 2009 Feb; 22(1):53-60. Epub 2009 Jan 7.

3. Reid D.W, Withers N.J, Francis L, Wilson J.W, Kotsimbos T.C, Chest. 2002 Jan; 121(1):48-54.

4. Haas, Kraut, Marks, Zanker, Casignetti INFECTION AND IMMUNITY, Nov. 1991, pp. 3997-4000.

5. Schwyn B, Neilands J.B. Anal. Biochem. 1987 Jan; 160(1):47-56.

6. Huston, Potter, Jennings, Rello, Hauser, McEwan. J Clin. Microbiol. 2004 June; 42(6): 2806-2809.

7. Courtney, J.M, Ennis, M and Elborn, J.S. Journal of Cystic Fibrosis Volume 3, Issue 4, рр. 223-231, December 2004.

1. Способ предсказания усиления уровня бактериальной активности Pseudomonas aeruginosa в легких пациента, где указанный способ включает осуществление временной последовательности измерений бактериальной активности в организме указанного пациента с применением способа, включающего:

осуществление первого измерения в первый момент времени уровня по меньшей мере одного маркера процесса захвата железа бактериями и по меньшей мере одного секретируемого бактериального белка в образце мокроты из легких;

осуществление второго измерения во второй момент времени уровней указанного маркера и указанного секретируемого белка в образце мокроты из легких; и

определение упомянутого уровня бактериальной активности по изменению с течением времени измеренных уровней указанного маркера процесса захвата железа бактериями и указанного секретируемого бактериального белка и использования указанной временной последовательности измерений для предсказания указанного усиления.

2. Способ определения эффективности лечения антибиотиком бактериальной инфекции легких, вызванной Pseudomonas aeruginosa, где указанный способ включает осуществление временной последовательности измерений бактериальной активности в организме пациента, который подвергается указанному лечению легочной инфекции, с применением способа, включающего:

осуществление первого измерения в первый момент времени уровня по меньшей мере одного маркера процесса захвата железа бактериями и по меньшей мере одного секретируемого бактериального белка в образце мокроты из легких;

осуществление второго измерения во второй момент времени уровней указанного маркера и указанного секретируемого белка в образце мокроты из легких; и

определение упомянутого уровня бактериальной активности по изменению с течением времени измеренных уровней указанного маркера процесса захвата железа бактериями и указанного секретируемого бактериального белка и определение указанной эффективности из профиля зависимости указанного уровня бактериальной активности от времени.

3. Способ по п. 1 или 2, включающий измерение уровней нескольких указанных маркеров процесса захвата железа бактериями и определения указанного уровня бактериальной активности, исходя из указанных нескольких измеренных уровней.

4. Способ по п. 1 или 2, где указанный маркер включает сидерофор.

5. Способ по п. 4, где сидерофор представляет собой пиохелин, пиовердин и пиоцианин.

6. Способ по п. 1 или 2, дополнительно включающий измерение уровня как минимум одного интермедиата захвата железа(III) для определения указанного уровня бактериальной активности.

7. Способ по п. 1 или 2, где указанный белок представляет собой токсин.

8. Способ по п. 7, где указанный токсин представляет собой экзотоксин А.

9. Способ по п. 1 или 2, где указанный маркер процесса захвата железа бактериями представляет собой сидерофор.

10. Способ по п. 1 или 2, где указанный маркер представляет собой пиовердин, и указанный белок представляет собой экзотоксин А.

11. Способ по п. 2, включающий определение того, что упомянутое лечение антибиотиком является неэффективным, поскольку указанный уровень бактериальной активности не уменьшается с течением времени.

12. Способ по п. 1 или 2, где указанный маркер имеет концентрацию, зависящую от уровня передачи коммуникативных сигналов между указанными бактериями Р. aeruginosa.

13. Способ по п. 1 или 2, дополнительно включающий стадию обнаружения маркера процесса поглощения железа организмом хозяина.

14. Способ по п. 1 или 2, дополнительно включающий измерение уровня воспалительной реакции организма указанного пациента.

15. Способ по п. 1 или 2, в котором осуществляется определение комбинации бактериального токсина, бактериального маркера процесса поглощения железа и маркера процесса поглощения железа организмом хозяина.

16. Способ по п. 15, где осуществляется определение экзотоксина А, сидерофора и гема или продукта разрушения гема.



 

Похожие патенты:

Изобретение относится к фармацевтической промышленности, а именно к способу диагностики бактериальной инфекции мочевыводящих путей in vitro. Способ диагностики бактериальной инфекции мочевыводящих путей in vitro у пациента, имеющего по меньшей мере один симптом, выбранный из группы, состоящей из повышенной температуры или гипотермии, лейкоцитоза/лейкопении, боли в пояснице и/или дизурии, признаков синдрома системной воспалительной реакции, лихорадки неизвестной природы, рецидивирующей инфекции мочевыводящих путей, включающий стадии определения концентрации прокальцитонина в пробах мочи и плазмы указанного пациента, и где величина соотношения между концентрацией прокальцитонина в моче и прокальцитонина в плазме крови более 1 является предиктором в отношении наличия инфекции мочевыводящих путей.

Изобретение относится к биохимии, в частности к способу идентификации генов клинически значимых семейств β-лактамаз у грамотрицательных микроорганизмов, например, у различных штаммов Acinetobacter baumannii, Pseudomonas aeruginosa, Klebsiella pneumoniae, Burkholderia spp., Enterobacter spp., Stenotrophomonas maltophilia, Elizabethkingia meningoseptica, Serratia marcescens.

Изобретение относится к области ветеринарной вирусологии и биотехнологии и касается штамма вируса нодулярного дерматита крупного рогатого скота (ВНД КРС). Описанный штамм выделен от коров, больных нодулярным дерматитом, и депонирован в Коллекции штаммов микроорганизмов ФГБУ «ВНИИЗЖ» под регистрационным номером - ВНД КРС/Дагестан/2015 (диагностический).

Изобретение относится к биотехнологии. Предложен способ определения безопасности пробиотических микроорганизмов, в котором в качестве тест-систем используются культуры клеток млекопитающих и человека.

Изобретение относится к санитарной микробиологии. Дифференциально-диагностическая питательная среда содержит аланин, натрия хлорид и дистиллированную воду в заданных соотношениях компонентов.

Группа изобретений относится к медицине, а именно к лабораторной диагностике, и может быть использована для in vitro прогнозирования прогрессирования ВИЧ-1 (вирус иммунодефицита человека типа 1) заболевания у пациента, инфицированного вирусом ВИЧ-1.
Группа изобретений относится к области ветеринарной биотехнологии, микробиологии и может быть использована для выявления антигена возбудителя йерсиниоза лососевых - Yersinia ruckeri в биологическом материале как для диагностики болезней рыб в ветеринарии, так и для научных исследований методом иммуноферментного анализа.

Настоящее изобретение относится к биохимии, в частности к лигандам для аффинной хроматографии на основе различных доменов белка A (SpA) Staphylococcus. Лиганд содержит либо несколько доменов C, либо несколько доменов B, либо несколько доменов Z белка SpA.

Изобретение относится к биохимии. Описано моноклональное антитело, которое специфически связывается с липоарабиноманнаном кислотоустойчивых бацилл, в частности с липоарабиноманнаном туберкулезной бациллы.

Изобретение относится к медицинской микробиологии и может быть использовано в гастроэнтерологии. Предложен способ определения чувствительности Helicobacter pylori к антибактериальным препаратам.

Предложен способ первичной идентификации микобактерий комплекса М. tuberculosis от нетуберкулезных микобактерий.

Изобретение относится к области микробиологии. Способ обнаружения кластера микроорганизмов на поверхности предусматривает этапы, на которых: а) определяют топографическое представление упомянутой поверхности; b) обнаруживают на топографическом представлении, по меньшей мере, один контур, ограничивающий область, которая может соответствовать скоплению биологических частиц.

Настоящее изобретение относится к области микробиологии и касается способа определения таких характеристик, как типирование, потенциальная устойчивость по меньшей мере к одному антимикробному средству и фактора вирулентности, по меньшей мере, одного микроорганизма из образца.

Изобретение относится к клинической микробиологии и может быть использовано при определении эффективных мер лечения хронических инфекционных заболеваний кожи и слизистых оболочек человека.

Изобретение относится к санитарной микробиологии. Дифференциально-диагностическая питательная среда содержит аланин, натрия хлорид и дистиллированную воду в заданных соотношениях компонентов.

Изобретение относится к области медицинской микробиологии и касается способа дифференциации токсигенных и атоксигенных штаммов холерных вибрионов О1 серогруппы по ингибирующей активности.

Изобретение относится к фармацевтике и микробиологии. Способ определения микробиологической чистоты фармацевтической субстанции предусматривает подготовку образца фармацевтической субстанции путем разбавления его в триптиказо-соевом бульоне или среде №8.

Изобретение относится к фармацевтике и микробиологии. Способ определения микробиологической чистоты лекарственных средств предусматривает подготовку образца лекарственного средства путем разбавления его в триптиказо-соевом бульоне или среде №8.

Изобретение относится к биотехнологии. Способ предусматривает выращивание стерильных микрорастений картофеля на среде Мурасиге-Скуга.

Изобретение относится к области медицинской биотехнологии и может быть использовано для эпидемиологических и микробиологических исследований. Штамм микроорганизма Helicobacter pylori №782, предназначенный для создания диагностических тест-систем, депонирован в Государственной коллекции патогенных микроорганизмов и клеточных культур «ГКПМ-Оболенск» под номером ГКПМ - Оболенск В-7215.

Изобретение относится к медицинской микробиологии. Описан способ идентификации подвидов возбудителя туляремии Francisella tularensis subsp. tularensis, Francisella tularensis subsp. mediasiatica и Francisella tularensis subsp. holarctica, включающий стадии выделения ДНК микроорганизма из исследуемого материала и проведение с полученной ДНК двух реакций амплификации. При этом используется набор сконструированных специфических праймеров к вариабельным участкам области RD6 туляремийного микроба, где набор состоит из трех праймеров: RD6-com ATACTAGCTTCAATCTCTGTGG СТТТ RD6-hol ATGCACTGGTTGGAATACAAATC RD6-tul CACATAGCAAATTAGTTGGATATGGA и второй из двух праймеров: RD6-del1 AACAATACCAACACTATTGAGTAAAA RD6-del2 AGCCATGCAATTATTAAAGC. Подвид возбудителя туляремии определяют по размеру специфического амплификата, в случае первой реакции амплификации если он составляет 212 п.о., а во второй 85 п.о., то регистрируют Francisella tularensis subsp. holarctica, если соответственно 425-91 п.о., то Francisella tularensis subsp. tularensis и 419-85 п.о. определяют как Francisella tularensis subsp. mediasiatica. Изобретение расширяет арсенал средств для выявления трёх основных подвидов туляремийного микроба. 2 з.п. ф-лы, 2 ил., 1 табл., 3 пр.
Наверх