Способ идентификации подвидов возбудителя туляремии francisella tularensis subsp. tularensis, francisella tularensis subsp. mediasiatica и francisella tularensis subsp. holarctica



Способ идентификации подвидов возбудителя туляремии francisella tularensis subsp. tularensis, francisella tularensis subsp. mediasiatica и francisella tularensis subsp. holarctica
Способ идентификации подвидов возбудителя туляремии francisella tularensis subsp. tularensis, francisella tularensis subsp. mediasiatica и francisella tularensis subsp. holarctica

 


Владельцы патента RU 2612137:

Федеральное казенное учреждение здравоохранения "Ростовский - на - Дону ордена Трудового Красного Знамени научно-исследовательский противочумный институт" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение относится к медицинской микробиологии. Описан способ идентификации подвидов возбудителя туляремии Francisella tularensis subsp. tularensis, Francisella tularensis subsp. mediasiatica и Francisella tularensis subsp. holarctica, включающий стадии выделения ДНК микроорганизма из исследуемого материала и проведение с полученной ДНК двух реакций амплификации. При этом используется набор сконструированных специфических праймеров к вариабельным участкам области RD6 туляремийного микроба, где набор состоит из трех праймеров:

RD6-com ATACTAGCTTCAATCTCTGTGG СТТТ RD6-hol ATGCACTGGTTGGAATACAAATC RD6-tul CACATAGCAAATTAGTTGGATATGGA

и второй из двух праймеров:

RD6-del1 AACAATACCAACACTATTGAGTAAAA RD6-del2 AGCCATGCAATTATTAAAGC.

Подвид возбудителя туляремии определяют по размеру специфического амплификата, в случае первой реакции амплификации если он составляет 212 п.о., а во второй 85 п.о., то регистрируют Francisella tularensis subsp. holarctica, если соответственно 425-91 п.о., то Francisella tularensis subsp. tularensis и 419-85 п.о. определяют как Francisella tularensis subsp. mediasiatica. Изобретение расширяет арсенал средств для выявления трёх основных подвидов туляремийного микроба. 2 з.п. ф-лы, 2 ил., 1 табл., 3 пр.

 

Предлагаемое изобретение относится к медицинской микробиологии и может быть использовано для выявления трех основных подвидов туляремийного микроба методом генной диагностики.

Согласно современным данным, вид Francisella tularensis разделен на 4 подвида, однако только представители трех подвидов возбудителя туляремии - Francisella tularensis subsp. tularensis, Francisella tularensis subsp. mediasiatica и Francisella tularensis subsp. holarctica - являются возбудителями опасного инфекционного заболевания человека - туляремии. Бактерии этих трех основных подвидов отличаются по ареалу циркуляции, биохимическим свойствам и патогенности для человека и животных (1). Для выявления возбудителя туляремии предложен ряд генодиагностических методик (3, 4).

Известен способ для выявления ДНК возбудителей чумы, сибирской язвы и туляремии методом ПЦР с гибридизационно-флюоресцентным учетом результатов (см. патент RU №2542395, кл. 12 Q 1/68, 23.10.13), заключающийся в выращивании исследуемой культуры, выделении ДНК и проведении мультиплексной ПЦР в режиме реального времени с использованием набора из шести пар специфических праймеров и трех меченных различными флюорофорами олигонуклеотидных зондов. Получение положительного сигнала по каналу HEX свидетельствует о наличии в пробе ДНК туляремийного микроба.

Однако данный способ не позволяет определять подвиды возбудителя туляремии.

Известен способ дифференциации подвидов туляремийного микроба F. tularensis subsp. tularensis, subsp. holarctica и subsp. novicida с помщью ПЦР (2), включающий выращивание исследуемой культуры, выделение ДНК и проведение мультиплексной ПЦР в режиме реального времени, для этого используют набор из восьми пар специфических праймеров и четырех меченных различными флюорофорами олигонуклеотидных зондов. В зависимости от канала, на котором зарегистирован положительный результат, идентифицируют один из трех подвидов F. tularensis subsp. tularensis, subsp. holarctica или subsp. novicida.

Использование этого способа требует дорогостоящего многоканального амплификатора для проведения ПЦР в режиме реального времени, а выявление подвида F. tularensis subsp. mediasiatica невозможно.

Наиболее близким к предлагаемому изобретению по совокупности существенных признаков является способ дифференцирования подвидов туляремийного микроба (патент RU 2478717, кл. C12Q 1/68, 10.04.13 г.), заключающийся в ПЦР-амплификации с использованием специфических для гена iglC и регионов хромосомы, содержащих Chi-последовательности, подобные E. coli, праймеров FiglC - , RiglC - и Chi1f , с последующим электрофорезом продуктов амплификации и с последующей дифференциацией путем сравнения электрофоретической подвижности полученных ампликонов с подвижностью маркерных фрагментов ДНК, причем при наличии специфической светящейся полосы на уровне 986 п.о. данные штаммы регистрируют как бактерии рода Francisella, а характер распределения полос в диапазоне 190-830 п.о. позволяет дифференцировать исследуемые образцы на уровне подвидов туляремийного микроба: 190 п.о. для subsp. novicida, 500-570 п.о. для subsp. mediasiatica, 570 п.о. для subsp. holarctica, тогда как для subsp. tularensis характерен фрагмент размером 500 п.о.

Однако используемый при проведении данного способа праймер Chi1f не является специфичным, что исключает получение традиционного специфического ампликона строго определенного размера. Поэтому амплифицированные фрагменты, полученные с представителями даже одного подвида туляремийного микроба, характеризует значительный разброс молекулярной массы. Например, для subsp. mediasiatica размер ампликона может варьировать от 500 до 570 п.о., а для subsp. holarctica характерен ампликон массой около 570 п.о., а для представителя другого подвида - subsp. tularensis характерен фрагмент размером 500 п.о.

Столь высокая вариация размеров ампликонов при осуществлении данного способа может приводить к появлению ампликонов одинакового размера в случае анализа штаммов разных подвидов туляремийного микроба, что делает маловероятным надежное определение подвидов туляремийного микроба с помощью данного способа.

Цель предлагаемого изобретения заключается в разработке простого и достоверного способа выявления трех основных подвидов туляремийного микроба - F. tularensis subsp. tularensis, F. tularensis subsp. mediasiatica и F. tularensis subsp. holarctica с помощью сконструированных праймеров.

Поставленная цель достигается тем, что способ идентификации подвидов возбудителя туляремии Francisella tularensis subsp. tularensis, Francisella tularensis subsp. mediasiatica и Francisella tularensis subsp. holarctica включает следующие стадии:

а) выделяют ДНК микроорганизма из исследуемого материала;

б) проводят с полученной ДНК две реакции амплификации, используя набор сконструированных специфических праймеров к вариабельным участкам области RD6 туляремийного микроба, при этом первый набор из трех праймеров:

и второй из двух праймеров:

в) определяют подвид возбудителя туляремии по размеру специфического амплификата, в случае первой реакции амплификации если он составляет 212 п.о, а во второй 85 п.о., то регистрируют Francisella tularensis subsp. holarctica, если соответственно 425-91 п.о., то Francisella tularensis subsp. tularensis и 419-85 п.о. определяют как Francisella tularensis subsp. mediasiatica.

При этом смесь для амплификации состоит из следующих реагентов:

- специфические праймеры для реакции первого набора праймеров (RD6-com, RD6-hol, RD6-tul) 1,5 мкМ (по 0,5 мкМ каждого праймера),

- специфические праймеры для реакции второго набора праймеров RD6-del1 RD6-del2 1,0 мкМ (по 0,5 мкМ каждого праймера),

- 1,5 мМ Mg-буфер,

- 0,2 мМ смеси дНТФ,

- 25 нг ДНК матрицы,

- 0,25 ед ДНК-полимеразы,

- вод а - остальное.

Кроме того, ПЦР реакция (амплификация) проходит с соблюдением следующих температурных режимов:

- денатурация при 95°С - 3 мин (1 цикл),

- затем 35 циклов амплификации, включающих денатурацию при 95°С - 20 с, отжиг при 60°С - 20 с,

- синтез при 72°С - 20 с,

- синтез при 72°С - 7 мин (1 цикл),

- хранение при 10°С.

Обоснование выбора праймеров

Важнейшим этапом при разработке ПЦР, обеспечивающим получение корректного результата, является правильный подбор мишеней для посадки праймеров. С помощью программного обеспечения PrimerM, разработанного ФКУЗ РостНИПЧИ Роспотребнадзора (г. Ростов-на-Дону), был проанализирован участок генома Francisella tularensis, содержащий локус RD6. В результате идентификации специфических для каждого подвида участков ДНК удалось сконструировать набор праймеров для мультиплекс-ПЦР, состоящий из одного общего (RD6-com) и двух обратных праймеров (RD6-hol и RD6-tul), позволяющих дифференцировать подвид holarctica от подвида tularensis по размеру получаемого амплификата. В случае Francisella tularensis subsp. holarctica ожидаемый размер ампликона должен составлять 212 п.о., а в случае Francisella tularensis subsp. tularensis - 425 п.о. (см. таблицу).

Помимо этого, в составе области RD6 удалось выявить второй участок, содержащий нуклеотидную делецию протяженностью шесть нуклеотидов, имеющуюся только у штаммов голарктического подвида и subsp mediasiatica. Для выявления выявленой делеции нами сконструированы праймеры RD6-del1 и RD6-del2, позволяющие проводить дополнительную дифференциацию подвидов (см. таблицу).

Предлагаемый способ идентификации подвидов возбудителя туляремии F. tularensis subsp. tularensis, subsp. mediasiatica и subsp. holarctica заключается в следующем:

1) проведении двух реакций амплификации с праймерами к вариабельным участкам области RD6 туляремийного микроба,

2) оценки полученных результатов.

На основании анализа размера полученных специфических ампликонов делается вывод о принадлежности исследуемого штамма туляремийного микроба к одному из трех основных подвидов F. tularensis subsp. tularensis, subsp. mediasiatica или subsp. holarctica.

Объектом защиты предлагаемого изобретения является два набора олигонуклеотидных праймеров - первый из трех праймеров RD6-com, RD6-hol, RD6-tul и второй из пары праймеров RD6-del1, RD6-del2, предназначенных для проведения двух реакций амплификации.

Способ осуществляется следующим образом.

Перед постановкой ПЦР проводят предварительную подготовку материала (выделение ДНК). Массу бактерий, сформировавших колонию или газон на плотной питательной среде, стерильной палочкой перемещают в микропробирку объемом 1,5 мл, содержащую 200 мкл дистиллированной воды, после чего выделяют ДНК как принято (Метод. указания МУ1.3.1791-9 «Организ. работы при исследовании методом ПЦР материала, инфицированного микроорганизмами 1 и 2 группы патогенности - М. 2003 - 38 с.»). В качестве матрицы используют геномную ДНК, полученную из разных штаммов туляремийного микроба.

С полученной ДНК далее проводят две реакции амплификации: мультиплексную со специфическими праймерами RD6-com, RD6-hol, RD6-tul и реакцию парой праймеров RD6-del1, RD6-del2.

Условия проведения реакции амлификации

Амплификация проводится по следующей схеме: денатурация при 95°С - 3 мин (1 цикл); затем 35 циклов: денатурация при 95°С - 20 с, отжиг при 60°С - 20 с, синтез при 72°С - 20 с; синтез при 72°С - 7 мин (1 цикл), хранение при 10°С.

Инкубационная смесь объемом 25 мкл содержит 1,5 мМ Mg-буфер, 0,2 мМ смеси дНТФ, для праймеров первой реакции RD6-com, RD6-hol, RD6-tul включает 1,5 (по 0,5 каждого праймера), а для праймеров второй реакции RD6-del, RD6-del2 содержит 1,0 мкМ (по 0,5 мкМ каждого праймера), 25 нг ДНК - матрицы, 0,25 ед. ДНК-полимеразы, оставшийся объем - вода. Анализ продуктов амплификации проводится с помощью электрофореза в 2% агарозном или 10% полиакриламидном геле.

Результат амплификации оценивается по появлению специфических ампликонов. В случае подвида Francisella tularensis subsp. tularensis в мультиплексной ПЦР с праймерами RD6-com, RD6-hol, RD6-tul и в реакции с парой праймеров RD6-del1, RD6-del2 регистрируют появление ампликонов 425 и 91 п.о. соответственно. При анализе представителей подвидов Francisella tularensis subsp. holarctica и Francisella tularensis subsp. mediasiatica специфические ампликоны имеют размеры 212, 85 и 419, 85 п.о. соответственно (см. таблицу).

Сущность изобретения поясняется следующими примерами.

Пример 1.

ПЦР-анализ четырех культур Francisella tularensis subsp. tularensis - штаммы Schu, Nevada, A-Cole, AE-261.

Условия проведения реакции

Амплификация проводится по следующей схеме: денатурация при 95°С - 3 мин (1 цикл); затем 35 циклов: денатурация при 95°С - 20 с, отжиг при 60°С - 20 с, синтез при 72°С - 20 с; синтез при 72°С - 7 мин (1 цикл), хранение при 10°С.

Инкубационная смесь объемом 25 мкл содержит 1,5 мМ Mg-буфер, 0,2 мМ смеси дНТФ, для праймеров первой реакции RD6-com, RD6-hol, RD6-tul включает 1,5 (по 0,5 каждого праймера), а для праймеров второй реакции RD6-del, RD6-del2 содержит 1,0 мкМ (по 0,5 мкМ каждого праймера), 25 нг ДНК - матрицы, 0,25 ед. ДНК-полимеразы, оставшийся объем – вода. В качестве матрицы используют геномную ДНК, полученную из разных штаммов бактерий туляремийного микроба.

При анализе продуктов мультиплексной амплификации со специфическими праймерами RD6-com, RD6-hol, RD6-tul выявлен специфический ампликон размером 425 п.о., а в реакции парой праймеров RD6-del1, RD6-del2 размер ампликона составил 91 п.о.

Вывод - исследуемые культуры штаммов Schu, Nevada, A-Cole AE-261 относятся к подвиду Francisella tularensis subsp. tularensis (см. фото 1, 2).

Фото 1 отображает результат электрофореза в 10% геле полиакриламида продуктов мультиплексой ПЦР с праймерами RD6-com, RD6-hol и RD6-tul. Лунки: 1-2 ДНК выделена из штаммов Francisella tularensis 543 и 240 (subsp. mediasiatica), 3-4 из штаммов Schu, Nevada (subsp. tularensis), 5-9 из штаммов 503, 250, 117, 15/10, 250 (subsp. holarctica). Стрелки указывают размер специфического амплифицированного фрагмента в п.о.

Фото 2. Электрофорез в 10% геле полиакриламида продуктов ПЦР с праймерами RD6-del1 и RD6-del2. Лунки: 1-4 ДНК выделена из штаммов Francisella tularensis Schu, Nevada, A-Cole AE-261 и Schu (subsp. tularensis); 5-6 из штаммов 503 и 15/10 (subsp. holarctica), 7-8 из штаммов 543 и 240 (subsp. mediasiatica). Стрелки указывают размер специфического амплифицированного фрагмента в п.о.

Пример 2.

ПЦР-анализ четырех штаммов Francisella tularensis subsp. holarctica 503, 117, 15/10, 250.

Условия проведения реакции как в Примере 1.

При анализе продуктов мультиплексной амплификации со специфическими праймерами RD6-com, RD6-hol, RD6-tul выявлен специфический ампликон размером 212 п.о., а в реакции парой праймеров RD6-del1, RD6-del2 размер ампликона составил 85 п.о.

Вывод - исследуемые культуры штаммов 503, 117, 15/10, 250 относятся к подвиду Francisella tularensis subsp. holarctica.

Пример 3. ПЦР-анализ трех штаммов Francisella tularensis subsp. mediasiatica 543, 240, 120.

Условия проведения реакции как в Примере 1.

При анализе продуктов мультиплексной амплификации со специфическими праймерами RD6-com, RD6-hol, RD6-tul выявлен специфический ампликон размером 419 п.о., а в реакции парой праймеров RD6-del1, RD6-del2 размер ампликона составил 85 п.о.

Вывод - исследуемые культуры штаммов 543, 240, 120 относятся к подвиду Francisella tularensis subsp. mediasiatica.

Использование предлагаемого изобретения позволяет простым и достоверным способом идентифицировать три эпидемически опасных подвида тулямийного микроба Francisella tularensis subsp. tularensis, Francisella tularensis subsp. mediasiatica и Francisella tularensis subsp. Holarctica с помощью набора сконструированных праймеров RD6-com, RD6-hol, RD6-tul, RD6-del1, RD6-del2.

Установление подвида бактерий является важным этапом лабораторной диагностики в медицине, который необходим для выбора наиболее оптимальных схем лечения больных и тактики проведения противоэпидемических мероприятий.

Источники информации

1. Олсуфьев Н.Г. Таксономия, микробиология и лабораторная диагностика возбудителя туляремии // М., Медицина. - 1975. 191 с.

2. Gunnell М.К, Lovelace С.D., Satterfield В.A., Moore Е.A., O'Neill K.L. and Robison R.A. A multiplex real-time PCR assay for the detection and differentiation of Francisella tularensis subspecies. // Journal of Medical Microbiology (2012), 61, 1525-1531.

3. Набор реагентов для выявления ДНК Francisella tularensis методом полимеразной цепной реакции с гибридизационно-флюоресцентным учетом результатов в режиме реального времени (ГЕН FRANCISELLA TULARENSIS - РГФ). Рег. уд. № ФСР 2011/12107 - 141011. ТУ 9398-035-01898109-2011.

4. Набор реагентов для выявления ДНК Francisella tularensis методом полимеразной цепной реакции с электрофоретическим учетом результатов (Ген Francisella tularensis - РЭФ). Рег. уд. № ФСР 2011/12108 - 131011. ТУ 9398-036-01898109-2011.

1. Способ идентификации подвидов возбудителя туляремии Francisella tularensis subsp. tularensis, Francisella tularensis subsp. mediasiatica и Francisella tularensis subsp. holarctica включает следующие стадии:

а) выделяют ДНК микроорганизма из исследуемого материала;

б) проводят с полученной ДНК две реакции амплификации, используя набор сконструированных специфических праймеров к вариабельным участкам области RD6 туляремийного микроба, при этом первый набор из трех праймеров:

RD6-com ATACTAGCTTCAATCTCTGTGG СТТТ
RD6-hol ATGCACTGGTTGGAATACAAATC
RD6-tul CACATAGCAAATTAGTTGGATATGGA

и второй из двух праймеров:

RD6-del1 AACAATACCAACACTATTGAGTAAAA
RD6-del2 AGCCATGCAATTATTAAAGC;

в) определяют подвид возбудителя туляремии по размеру специфического амплификата, в случае первой реакции амплификации если он составляет 212 п.о., а во второй 85 п.о., то регистрируют Francisella tularensis subsp. holarctica, если соответственно 425-91 п.о., то Francisella tularensis subsp. tularensis и 419-85 п.о. определяют как Francisella tularensis subsp. mediasiatica.

2. Способ по п. 1, отличающийся тем, что смесь для амплификации состоит из следующих реагентов:

- специфические праймеры для реакции первого набора праймеров (RD6-com, RD6-hol, RD6-tul) 1,5 мкМ (по 0,5 мкМ каждого праймера),

- специфические праймеры для реакции второго набора праймеров RD6-del1 RD6-del2 1,0 мкМ (по 0,5 мкМ каждого праймера),

- 1,5 мМ Mg-буфер,

- 0,2 мМ смеси дНТФ,

- 25 нг ДНК матрицы,

- 0,25 ед. ДНК-полимеразы,

- вода - остальное.

3. Способ по п. 1, отличающийся тем, что ПЦР реакция (амплификация) проходит с соблюдением следующих температурных режимов:

- денатурация при 95°С - 3 мин (1 цикл),

- затем 35 циклов амплификации, включающих денатурацию при 95°С - 20 с, отжиг при 60°С - 20 с,

- синтез при 72°С - 20 с,

- синтез при 72°С - 7 мин (1 цикл),

- хранение при 10°С.



 

Похожие патенты:

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для получения точных количественных данных о видовом составе микроорганизмов пародонтальных карманов.

Изобретение относится к области медицины, в частности к иммунологии и педиатрии, и предназначено для диагностики тимомегалии у детей. Проводят ПЦР в режиме реального времени с использованием соответствующих праймеров и флюоресцентно-меченого олигонуклеотида с последующим расчетом числа копий Т-рецепторных эксцизионных колец (ТРЭК) по стандартной кривой, построенной по разведениям плазмиды, представленной SEQ ID NO: 1 с известной концентрацией ДНК ТРЭК.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для прогнозирования высокого риска репродуктивных потерь в первом триместре беременности.

Изобретение относится к области медицины, в частности к молекулярной онкологии, и предназначено для прогнозирования выживаемости больных раком тела матки на основании уровня экспрессии гена ESR1.

Изобретения относятся к области определения последовательности нуклеиновой кислоты. Предложена группа изобретений, включающая устройство и способ для оптического контроля секвенирования нуклеиновой кислоты, машиночитаемый носитель с компьютерной программой и программный элемент, используемые в вышеуказанном способе, а также применение 5-метил-(2-(2-нитрофенил)пропил)карбонат-dUTP, 5-метил-(2-оксо-1,2-дифенилэтил)карбонат-dUTP в качестве блокатора в секвенировании ДНК в вышеуказанном способе.

Изобретение относится к биохимии. Описан синтетический олигонуклеотид длиной от 19 до 30 нуклеотидов, содержащий по меньшей мере одну модификацию, при этом указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного остатка сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида; и их комбинаций.

Настоящее изобретение относится к тестам микроРНК плазмы для обнаружения колоректального рака на ранних стадиях. Описан способ, включающие этапы: измерения общего профиля экспрессии или уровня содержания одной или нескольких микроРНК, полученных из одного или нескольких образцов плазмы, крови или сыворотки субъекта; и сравнение общего профиля экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от субъекта, предположительно страдающего от колоректальной неоплазии, с общим профилем экспрессии одной или нескольких микроРНК из образца плазмы, крови или сыворотки от нормального субъекта, где нормальным субъектом является здоровый человек, не страдающий от колоректальной неоплазии, где повышенная экспрессия miR15b свидетельствует о наличии колоректальной неоплазии.

Изобретение касается способа обнаружения микроделеций в области хромосомы с ДНК-маркирующим участком. Способ включает выбор области хромосомы с ДНК-маркирующим участком; получение зонда захвата, соответствующего последовательности ДНК в указанной области; гибридизацию зонда захвата со смешанной библиотекой для связывания с последовательностью из множества образцов ДНК из области с ДНК-маркирующим участком; секвенирование захваченной последовательности ДНК из области с ДНК-маркирующим участком для получения данных секвенирования и анализ результатов секвенирования с использованием метода математической статистики с получением результата, показывающего наличие или отсутствие микроделеции в области хромосомы с ДНК-маркирующим участком в каждом из множества образцов ДНК.

Изобретение относится к области биохимии. Предложен набор олигонуклеотидов для детекции мутаций c.598_612del и c.550delA гена CAPN3.

Группа изобретений относится к биотехнологии, в частности к устройству и способу для автоматического анализа биологических образцов, обеспечивающих выполнение всех необходимых операций для анализа биологических образцов в режиме реального времени.

Группа изобретений относится к определению уровней активности бактерий в легких пациентов. Группа изобретений раскрывает способ предсказания усиления уровня бактериальной активности Pseudomonas aeruginosa в легких пациента, а также способ определения эффективности лечения антибиотиком бактериальной инфекции легких, вызванной Pseudomonas aeruginosa, в которых осуществляется измерение уровней маркеров процесса захвата железа бактериями (например, сидерофоров) и уровней секретированных бактериальных белков с течением времени.

Предложен способ первичной идентификации микобактерий комплекса М. tuberculosis от нетуберкулезных микобактерий.

Изобретение относится к области микробиологии. Способ обнаружения кластера микроорганизмов на поверхности предусматривает этапы, на которых: а) определяют топографическое представление упомянутой поверхности; b) обнаруживают на топографическом представлении, по меньшей мере, один контур, ограничивающий область, которая может соответствовать скоплению биологических частиц.

Настоящее изобретение относится к области микробиологии и касается способа определения таких характеристик, как типирование, потенциальная устойчивость по меньшей мере к одному антимикробному средству и фактора вирулентности, по меньшей мере, одного микроорганизма из образца.

Изобретение относится к клинической микробиологии и может быть использовано при определении эффективных мер лечения хронических инфекционных заболеваний кожи и слизистых оболочек человека.

Изобретение относится к санитарной микробиологии. Дифференциально-диагностическая питательная среда содержит аланин, натрия хлорид и дистиллированную воду в заданных соотношениях компонентов.

Изобретение относится к области медицинской микробиологии и касается способа дифференциации токсигенных и атоксигенных штаммов холерных вибрионов О1 серогруппы по ингибирующей активности.

Изобретение относится к фармацевтике и микробиологии. Способ определения микробиологической чистоты фармацевтической субстанции предусматривает подготовку образца фармацевтической субстанции путем разбавления его в триптиказо-соевом бульоне или среде №8.

Изобретение относится к фармацевтике и микробиологии. Способ определения микробиологической чистоты лекарственных средств предусматривает подготовку образца лекарственного средства путем разбавления его в триптиказо-соевом бульоне или среде №8.

Изобретение относится к биотехнологии. Способ предусматривает выращивание стерильных микрорастений картофеля на среде Мурасиге-Скуга.

Изобретение относится к биотехнологии. Способ предусматривает забор исследуемого материала, посев его на селективные питательные среды, инкубирование посевов при заданных параметрах с последующей идентификацией выросших колоний. Из выросших колоний проводят выделение и идентификацию чистой культуры энтерококков до вида известными способами с последующим определением у выделенных энтерококков антикарнозиновой активности (АКрА). При этом энтерококки, не обладающие антикарнозиновой активностью (АКрА) или обладающие антикарнозиновой активностью (АКрА ) при уровне выраженности данного признака, равном или меньше 1,9 мг/мл, относятся к нормальной кишечной микрофлоре животных. Изобретение позволяет упростить способ и дифференцировать энтерококки кишечной микрофлоры на нормальную и патогенную микрофлору. 2 табл., 1 пр.
Наверх