Экспрессионный плазмидный вектор для экспрессии активной формы tnfr1-fc и способ получения рекомбинантного белка

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков, и может быть использовано для получения рекомбинантного белка TNFR1-Fc в клетках HEK293. Конструируют экспрессионный плазмидный вектор pFIG-hTNFr с физической картой, представленной на фиг.5, размером 6674 п.о., содержащий: а) последовательность, кодирующую рекомбинантный белок TNFR1-Fc с аминокислотной последовательностью, представленной на фиг. 6б; б) последовательность  E/Р  энхансера вируса Т-клеточной лейкемии человека и промотора фактора элонгации 1; в) последовательность SP, кодирующую сигнальный пептид CD33; е) последовательность IRES, кодирующую участок внутренней посадки рибосомы вируса энцефаломиокардита, и ж) последовательность GS, кодирующую глутаминсинтетазу. Способ получения гибридного белка TNFR1-Fc включает культивирование клеток HEK293, последовательно трансформированных введением указанного вектора pFIG-hTNFr и вектора psiRNA-h7SK-miR7 с физической картой, представленной на фиг. 7, в жидкой питательной среде с последующим выделением и очисткой белка TNFR1-Fc. Изобретение позволяет получить рекомбинантный белок TNFR1-Fc с высокой активностью ингибирования фактора некроза опухоли с высоким выходом. 3 н. и 1 з.п. ф-лы, 8 ил., 7 пр.

 

Область техники

Изобретение относится к области биотехнологии и генетической инженерии и может быть использовано при производстве препаратов-ингибиторов фактора некроза опухоли.

Уровень техники

Фактор некроза опухоли (ФНО) играет ведущую роль в патогенезе хронических воспалительных заболеваний суставов и других тканей (таких как ревматоидный и псориатический артрит, болезнь Крона, анкилозирующий спондилит и др). Действие ФНО на клетки опосредовано двумя типами рецепторов TNFR1 (p55/60) и TNFR2 (p75/80) и имеет плейотропный характер. Патологические эффекты ФНО связаны, в первую очередь, с активацией TNFR1, которая запускает синтез провоспалительных цитокинов, хемокинов , молекул адгезии и, как следствие, развитие воспалительного процесса и дегенерацию ткани. При этом растворимые формы TNFR1 и TNFR2 выступают в качестве антагонистов трансмембранного рецептора и блокируют взаимодействие ФНО и p55/p60.

Это свойство растворимых рецепторов послужило основанием для внедрения ингибиторов ФНО на основе рекомбинантного TNFR в практику противовоспалительной терапии. За последний период в организации США проходят испытания нескольких рекомбинантных белков – ингибиторов TNF.alpha. К ним относятся Etanercept (Enbrel.RTM.), разработанный фирмой Celltech, Infliximab (Remicade), Adalimumab (Humira RTM), разработанный фирмой Centocor, Certolizumab pegol (Cimzia), и Golimumab (Simponi). Наиболее известные ингибиторы-рецепторы TNFR-Ig – p75TNFRigG Etanercept (Enbrel), к другим белкам ингбиторам относятся: Humicade.TM, разработанный фирмой Abbott, разработанный фирмой Immunex/Amgen белок ABX-CBL [1, 2].

Рекомбинантный TNFR-Fc состоит из экстраклеточного домена TNFR1 и Fc фрагмента IgG1 человека. Присутствие Fc фрагмента повышает время полужизни рекомбинантного белка. Кроме этого, Fc фрагмент выступает как олигомеризационный домен и обеспечивает образование димеров белка, стабилизированных дисульфидной связью. В сравнении с мономерной формой авидность олигомеризованного рецептора выше, что позволяет использовать его в меньшей дозировке для ингибирования активности фактора некроза опухоли.

Известны патенты и заявки на изобретения, которые относятся к разработке конструкций экспрессионных векторов для получения TNFR-Fc [3-5].

В известных изобретениях для наработки конечного продукта предлагаются разные экспрессионные системы. В патентах РФ № 2513686, 2225443, 2307163 для синтеза антител человека против фактора некроза опухоли человека применяют рекомбинантные штаммы бактерий Escherichia coli [6-8].

В последний период для экспрессии, в том числе активных белков TNFR-FC, стали использовать клетки млекопитающих СНО [9-12] и клеточные линии HEK293F [13,14]. Однако стандартное использование трансгенных линий клеток млекопитающих связано с относительно низкой продуктивностью, что делает промышленную процедуру наработки белка весьма дорогостоящей.

Известна работа [15], в которой клетки HEK 293 последовательно трансфецируют двумя экспрессионными векторами, например вектором экспрессирующим водорастворимый Her2 (sHer2) и вектором psiRNA-h7SKneo, который содержит последовательность hsa-miR-7-5p. В другом примере, для трансфекции клеток вместо вектора экспрессирующего водорастворимый Her2 рассматривается применение экспрессионного вектора, который экспрессирует водорастворимый TNF-R1 (sTNFR1)совместно с вектором psiRNA-h7SKneo. В работе сделан вывод о том, что применение второго вектора экспрессирующего miR-7 в клетках HEK 293 способствует продуктивности клеток.

Посттрансляционная модификация растворимого рецептора накладывает дополнительные ограничения на выбор экспрессионной системы для наработки белка. Поэтому получение высокопродуктивных культур клеток с большим выходом биологически активного TNFR является актуальной задачей в настоящее время.

Техническая задача данного изобретения предусматривает совершенствование и расширение арсенала экспрессионных векторов для трансгенных линий клеток млекопитающих с высокой продуктивностью при изготовлении эффективных лекарственных средств направленных против фактора некроза опухоли человека.

Технический результат, обеспечивающий решение поставленной задачи, заключается в том, что за счет выбора новых элементов структуры экспрессионного вектора, достигается высокая эффективность экспрессии целевого, биологически активного белка TNFR1-Fc.

Сущность изобретения

Одним из аспектов изобретения является экспрессионный плазмидный вектор pFIG-hTNFr, для экспрессии активной формы рекомбинантного белка TNFR1-Fc в клетках HEK293, обладающий свойством экспрессионной кассеты в указанных клетках, где указанный плазмидный вектор имеет размер 6674 п.о., молекулярную массу 4,40484 MДа, уникальные сайты рестрикции: Acc65I, AgeI, AhdI, ApaBI, AsiSI, BbeI, BglII, BspEI, BspHI, BssHII, BstAPI, BstZ17I, ClaI, EcoICRI, EcoRI, FalI, FseI, HpaI, KasI, KpnI, NarI, NcoI, NdeI, PflMI, PsiI, PvuI, SacI, SalI, SanDI, SbfI, ScaI, SciI, SfoI, SnaBI, SpeI, SphI, SspI, XbaI, XcmI, XhoI, промоторы: эукариотический промотор фактора элонгации 1α (EF-1α), промотор гена легкой цепи ферритина человека (hFerL), бактериальный промотор EM2KC, энхансеры: R сегмент и часть U5 последовательности длинного концевого повтора типа 1 вируса Т-клеточной лейкемии человека, энхансер раннего гена 1 цитомегаловируса человека. В состав вектора входит экспрессионная кассета с нуклеотидной последовательностью SEQ ID NO: 1, которая содержит: а) последовательность, кодирующую рекомбинантный белок TNFR1-Fc с аминокислотной последовательностью SEQ ID NO: 2 б) последовательность E/Р (SEQ ID NO:3) энхансера вируса Т-клеточной лейкемии человека и промотора фактора элонгации 1; в) последовательность SP (SEQ ID NO:5), кодирующую сигнальный пептид CD33; г) последовательность IRES (SEQ ID NO:10) кодирующую участок внутренней посадки рибосомы вируса энцефаломиокардита; д) последовательность GS (SEQ ID NO:12) кодирующую глутаминсинтетазу.

К другому аспекту изобретения относится линия клеток HEK293 - продуцентов рекомбинантного белка, последовательно трансфицированная экспрессионным вектором pFIG-hTNFr и вектором psiRNA-h7SK-miR7.

К другому аспекту изобретения относится способ получения гибридного белка TNFR1-Fc, включающий культивирование линии клеток HEK293 последовательно трансформированных введением экспрессионного плазмидного вектора pFIG-hTNFr кодирующего синтез активного рекомбинантного белка TNFR1-Fc и дополнительно введенного в клетки вектора psiRNA-h7SK-miR7, в жидкой питательной среде с последующим выделением и очисткой белка TNFR1-Fc.

Перечень фигур

Изобретение иллюстрируется следующими фигурами:

На фиг.1 изображена схема первой стадии получения вектора pFIG-hTNFr.

На фиг.2 изображена схема второйстадии получения вектора pFIG-hTNFr.

На фиг.3 изображена карта вектора splg-hTNFr.

На фиг.4 изображена схема третьей стадии получения вектора pFIG-hTNFr.

На фиг.5. изображена карта вектора pFIG-hTNFr.

На фиг. 6 изображены аминокислотные последовательности промежуточного и конечного продукта. Где: на фиг.6А представлена аминокислотная последовательность промежуточного продукта, включающая сигнальный пептид (17 аминокислот) и TNFR1-Fc; на фиг 6Б представлена аминокислотная последовательность конечного продукта, TNFR1-Fc (SEQ ID NO:2).

Фиг.7. изображена карта вектора psiRNA-h7SK-miR7.

Фиг.8. представлены результаты анализа ингибирующей активности TNFR-Fc против ФНО in vitro.

Описание изобретения

Настоящее изобретение направлено на создание культуры-продуцента, которая позволяет наработать в больших количествах рекомбинантный белок TNFR1-Fc - ингибитор фактора некроза опухоли (ФНО) с нуклеотидной последовательностью SEQ ID NO:1. С этой целью создан новый вектор для получения белка TNFR1-Fc с аминокислотной последовательностью SEQ ID NO:2. и получена новая культура-суперпродуцента рекомбинантного TNFR1-Fc.

Поставленная задача решается путем создания ДНК-конструкции, pFIG-hTNFr, которая содержит вставку с экспрессионной кассетой считывания гена, для кодирования рекомбинантного белка TNFR1-Fc следующего состава:

5' – E/P-SP-TNFR1-L-Fc –IRES-GS - 3'

где: E/Р – последовательность E/Р (SEQ ID NO:3) энхансера вируса Т-клеточной лейкемии человека и промотора фактора элонгации 1;

SP - нуклеотидная последовательность (SEQ ID NO: 5), кодирующая сигнальный пептид CD33;

TNFR1 - нуклеотидная последовательность (SEQ ID NO: 6) экстраклеточного домена рецептора ФНО 1 типа;

L - синтетическая последовательность (SEQ ID NO:7), кодирующая линкер;

Fc – последовательность (SEQ ID NO: 8), кодирующая Fc фрагмент иммуноглобулина G1 человека;

IRES - нуклеотидная последовательность (SEQ ID NO:10) участка внутренней посадки рибосомы вируса энцефаломиокардита;

GS – нуклеотидная последовательность (SEQ ID NO: 12) глутаминсинтетазы.

При конструировании вектора pFIG-hTNFr осуществляют следующие стадии.

- Получают промежуточный вектор pFUSE I, схема получения которого представлена на Фиг 1. Для этого встраивают в коммерческий вектор pFUSE-CHIg-hG1 (Invivogen) элемент IRES, который берут из вектора pIRES (Clontech).

- Формируют промежуточный вектор pFIG, схема получения которого представлена на Фиг 2. Для этого в вектор pFUSE I встраивают элемент GS с последовательностью глутаминсинтетазы.

- Получают промежуточный вектор spIg-hTNFr, физическая карта которого представлена на Фиг 3. Для этого в коммерческий вектор signal plus Ig (Ingenius) встраивают Fc фрагмент и экстраклеточный домен TNFR.

- Формируют конечный вектор pFIG-hTNFr, схема получения которого представлена на Фиг 4. Для этого в вектор pFIG встраивают элементы SPL-TNFR1-L, которые взяли из вектора spIg-hTNFr . Физическая карта вектора pFIG-hTNFr представлена на фиг.5.

Для повышения эффективности получения целевого продукта клетки последовательно трансформируют сначала вектором pFIG-hTNFr затем вектором psiRNA-h7SK-miR7, кодирующим микроРНК miR7, который получают путем интегрирования фрагмента кодирующего miR7 в плазмиду psiRNA-h7SK (Invivogen) сайту эндонуклеазы Bbs I. При исследовании различных типов экспрессирующих векторов для синтеза рекомбинантного белка TNFR1 слитого с фрагментом Fс совместно с вектором экспрессирующим miR-7 в клетках HEK 293 было обнаружено, что повысить эффективность экспрессии возможно не только за счет последовательной трансфекции клеток HEK 293 вектором pFIG-hTNFr и вектором psiRNA-h7SK-miR7, но и за счет выбора элементов, входящих в экспрессионную кассету.

Выбор структуры вектора pFIG-hTNFr и последовательная трансфекция линии клеток HEK 293 и последующая селекция клеток с помощью метионинсульфоксимина позволяет получить синергетический результат и повысить выход биологически активного белка TNFR1-Fc.

Для лучшего понимания сущности изобретения ниже следуют примеры его конкретного выполнения. Описание, приведенное в настоящем изобретении, предназначено исключительно для описания конкретных осуществлений и не подразумевает ограничения сферы охвата настоящего изобретения, если не указано иное. Любые методы и материалы, аналогичные или идентичные приведенным в настоящем описании примеров, могут использоваться в практическом применении настоящего изобретения для получения биологически активного белка TNFR1-Fc.

Примеры конкретного осуществления предлагаемого изобретения.

При конструировании вектора pFIG-hTNFr получают ряд промежуточных векторов.

Пример 1. Конструирование промежуточного плазмидного вектора pFUSE-I

При конструировании вектора pFUSE-I в плазмиду pFUSE-CHIg-hG1 (Invivogen) интегрируют фрагмент ДНК, кодирующий участок внутренней посадки рибосомы вируса энцефаломиокардита (IRES). Для этого в плазмиду pFUSE-CHIg-hG1 вводят сайт для эндонуклеазы рестрикции PaeI путем ПЦР с использованием олигонуклеотидов:

pF-Sph_f (SEQ ID NO:17)

(5`-GTAAATGAGTCCTAGCATGCCAGACATGATAAGATAC-3`) и

pF-Sph_r (SEQ ID NO:18)

(5`-GTATCTTATCATGTCTGGCATGCTAGGACTCATTTAC-3`).

Реакцию проводят в 25 мкл реакционной смеси, содержащей 1× буфер для KOD Hot Start DNA Polymerase («Novagen»), 1,5 мМ MgSO4, 0,2 мМ раствор дНТФ, 0,3 мкМ олигонуклеотид pF-Sph_f, 0,3 мкМ олигонуклеотид pF-Sph_r, 5 нг векторной ДНК pFUSE-CHIg-hG1, 0,02 ед/мкл KOD Hot Start DNA Polymerase.

Очищенные продукты ПЦР и векторную ДНК pIRES («Clontech») обрабатывают эндонуклеазами рестрикции PaeI и KspAI. Реакционная смесь объемом 50 мкл содержала 1× буфер «B» («Thermo Fisher Scientific»), продукты ПЦР или 1 мкг векторной ДНК и по 10 ед. эндонуклеаз рестрикции PaeI и KspAI. Реакционную смесь инкубируют при 37 °С в течение 4 часов. Для выделения фрагмента ДНК, кодирующего элемент IRES, продукты гидролиза pIRES разделяют в 0,8% агарозном геле. Вырезают часть агарозного геля, содержащего фрагмент ДНК длиной приблизительно 820 п.н. и выделяют ДНК из геля.

Обработанные фрагменты ДНК эндонуклеазами рестрикции лигируют с использованием ДНК лигазы фага Т4. Реакционная смесь объемом 10 мкл содержала 1× буфер для ДНК лигазы фага Т4, 1 мМ АТФ, по 200 нг лигируемых фрагментов и 5 ед. ДНК лигазы фага Т4 («Thermo Fisher Scientific»). Реакционную смесь инкубируют при 37 °С в течение 2 часов. Продуктами лигирования трансформируют клетки E. coli штамма TOP10. Трансформированные клетки высевают на чашки с селективной агаризованной средой, содержащей 25 мкг/мл зеоцина.

Скрининг колоний, содержащих рекомбинантные плазмиды, проводят с использованием полимеразной цепной реакции. В качестве матричной ДНК используют часть колонии E. coli, ресуспендированной в 5 мкл 1% раствора Тритон Х-100. Реакционная смесь объемом 25 мкл содержит 1× буфер для Taq DNA Polymerase («Thermo Fisher Scientific»), 0,2 мМ дНТФ, 5 ед. Taq DNA Polymerase («Thermo Fisher Scientific») и по 10 пмоль олигонуклеотидов:

SV40_pAd (SEQ ID NO:19) (5`-AACTTGTTTATTGCAGCTT-3`) и

hFc_r (SEQ ID NO:20) (5`-TCCTTCTTCCTCTACAGCA-3`)

Из положительных колоний выделяют плазмидную ДНК. Правильность встраивания фрагмента проверяют секвенированием рекомбинантных векторов. Полученный вектор был обозначен как pFUSE-I (см. Фиг. 1).

Пример 2. Конструирование промежуточного вектора pFIG дополнительно кодирующего глутаминсинтазу.

Фрагмент ДНК, кодирующий глутаминсинтазу (GS) получают путем ПЦР, сопряженной с обратной транскрипцией. В качестве матрицы и используют тотальную РНК клеток линии CHO. Реакцию проводят в 20 мкл смеси, содержащей 1× буфер для обратной транскриптазы, 0,5 мМ дНТФ, 100 пмоль олигонуклеотида oligo(dT), 5 мкг образца тотальной РНК, 20 ед. ингибитора РНКаз «RiboLock RNase Inhibitor» («Thermo Fisher Scientific»), 50 ед. обратной транскриптазы «Maxima H Minus Reverse Transcriptase» («Thermo Fisher Scientific»). Реакцию синтеза кДНК проводят при 50 °C в течение 30 мин. Реакцию останавливают прогреванием реакционной смеси при 85 °С в течение 5 минут.

На следующем этапе для получения фрагмента ДНК, кодирующего глутаминсинтазу, проводят ПЦР с использованием ген-специфических олигонуклеотидов:

GS_f1 (SEQ ID NO:21) (5`-TTTGGATCCATGGCCACCTCAGCAAGTTC-3`) и

GS_r (SEQ ID NO:22) (5`-TGGTCGACTTAGTTTTTGTATTGGAAGGGCTG-3`)

В качестве матричной ДНК используют продукты реакции обратной транскрипции. Реакционная смесь объемом 25 мкл содержит 1× буфер для Pfu ДНК полимеразы («Thermo Fisher Scientific»), 0,2 мМ дНТФ, 10 пмоль олигонуклеотида GS_f1, 10 пмоль олигонуклеотида GS_r, 2 мкл реакционной смеси синтеза кДНК, 2 ед. Pfu ДНК полимеразы («Thermo Fisher Scientific»).

Очищенные продукты ПЦР и векторную ДНК pFI обрабатывают эндонуклеазами рестрикции SalI и BamHI. Реакционная смесь объемом 50 мкл содержит 2× буфер «Tango» («Thermo Fisher Scientific»), продукты ПЦР или 500 нг векторной ДНК pFUSE-I и по 10 ед. эндонуклеаз рестрикции SalI и BamHI. Реакционную смесь инкубируют при 37 °С в течение 4 часов. Продукты гидролиза очищают и лигируют с использованием ДНК лигазы фага Т4 («Thermo Fisher Scientific»). Реакционная смесь объемом 10 мкл содержит 1× буфер для ДНК лигазы фага Т4, 1 мМ АТФ, лигируемые фрагменты ДНК в молярном соотношении 1:3 (вектор:вставка) и 5 ед. ДНК лигазы фага Т4 («Thermo Fisher Scientific»). Реакционную смесь инкубируют при 37 °С в течение 2 часов. Продуктами лигирования трансформируют клетки E. coli штамма TOP10. Трансформированные клетки высевают на чашки с селективной агаризованной средой, содержащей 25 мкг/мл зеоцина.

Скрининг колоний, содержащих рекомбинантные плазмиды, проводят с использованием полимеразной цепной реакции. В качестве матричной ДНК используют часть колонии E. coli, ресуспендированной в 5 мкл 1% раствора Тритон Х-100. Реакционная смесь объемом 25 мкл содержит 1× буфер для Taq DNA Polymerase («Thermo Fisher Scientific»), 0,2 мМ дНТФ, 5 ед. Taq DNA Polymerase («Thermo Fisher Scientific») и по 10 пмоль олигонуклеотидов:

SV40 pAd (SEQ ID NO:19) (5`-AACTTGTTTATTGCAGCTT-3`) и

IRES-F (SEQ ID NO:23) (5`-TGGCTCTCCTCAAGCGTATT-3`)

ПЦР проводили в амплификаторе Master Cyclergradient («Eppendorf»). Из положительных колоний выделяют плазмидную ДНК Правильность встраивания фрагмента проверяют секвенированием рекомбинантных векторов. Полученный вектор был обозначен как pFIG (см. Фиг. 2).

Пример 3. Клонирование последовательности экстраклеточного домена TNFR1 в векторе spIg

Получают промежуточный вектор spIg-hTNFr. Для этого в коммерческий вектор signal plus Ig (Ingenius) встраивают элементы: TNFR1 и Fc фрагмент IgG1.

Фрагмент ДНК, кодирующий экстраклеточный домен рецептора фактора некроза опухоли, получают с помощью ПЦР, сопряженной с обратной транскрипцией в присутствии праймеров:

hTNFr_f (SEQ ID NO:13) 5`-CGGAAGCTTATGGGCCTCTCCACCGTGC-3`и

hTNFr_r (SEQ ID NO:14) 5`-ATCCTCGAG AACATTCTCAATCTGGGGTAGGCAC-3`.

В качестве матрицы используют тотальную РНК лейкоцитов человека.

Реакцию обратной транскрипции проводят в 20 мкл смеси, содержащей 1× буфер для обратной транскриптазы («Thermo Fisher Scientific»), 0,5 мМ дНТФ, 100 пмоль олигонуклеотида oligo(dT)18, 5 мкг образца тотальной РНК, 20 ед. ингибитора РНКаз «RiboLock RNase Inhibitor» («Thermo Fisher Scientific»), 50 ед. обратной транскриптазы «Maxima H Minus Reverse Transcriptase» («Thermo Fisher Scientific»). Реакцию синтеза кДНК проводят при 50 °C в течение 30 мин. Реакцию останавливали прогреванием реакционной смеси при 85 °С в течение 5 минут.

ПЦР проводили в смеси объемом 25 мкл содержащую 1× буфер для Pfu ДНК полимеразы («Thermo Fisher Scientific»), 0,2 мМ дНТФ, 10 пмоль олигонуклеотида hTNFr_f, 10 пмоль олигонуклеотида hTNFr_r, 2 мкл реакционной смеси синтеза кДНК, 2 ед. Pfu ДНК полимеразы («Thermo Fisher Scientific»).

Очищенные продукты ПЦР и векторную ДНК spIg (Ingenius) обрабатывают эндонуклеазами рестрикции HindIII и XhoI. Реакционная смесь объемом 50 мкл содержит 1× буфер «R» («Thermo Fisher Scientific»), продукты ПЦР или 500 нг векторной ДНК spIg и по 10 ед. эндонуклеаз рестрикции HindIII и XhoI. Реакционную смесь инкубируют при 37 °С в течение 4 часов. Продукты гидролиза очищают с помощью набора «GeneJET PCR Purification Kit» («Thermo Fisher Scientific»).

Обработанные фрагменты ДНК эндонуклеазами рестрикции лигируют с использованием ДНК лигазы фага Т4 («Thermo Fisher Scientific»). Реакционная смесь объемом 10 мкл содержит 1× буфер для ДНК лигазы фага Т4, 1 мМ АТФ, лигируемые фрагменты ДНК в молярном соотношении 1:3 (вектор: вставка) и 5 ед. ДНК лигазы фага Т4 («Thermo Fisher Scientific»). Реакционную смесь инкубируют при 37 °С в течение 2 часов. Продуктами лигирования трансформируют клетки E. coli штамма TOP10. Трансформированные клетки высевают на чашки с селективной агаризованной средой, содержащей 100 мкг/мл ампициллина.

Скрининг колоний, содержащих рекомбинантные плазмиды, проводят с использованием полимеразной цепной реакции. В качестве матричной ДНК используют часть колонии E. coli, ресуспендированной в 5 мкл 1% раствора Тритон Х-100. Реакционная смесь объемом 25 мкл содержит 1× буфер для Taq DNA Polymerase («Thermo Fisher Scientific»), 0,2 мМ дНТФ, 5 ед. Taq DNA Polymerase («Thermo Fisher Scientific») и по 10 пмоль олигонуклеотидов:

T7pr (SEQ ID NO:15) 5`-ATTAATACGACTCACTATAGGGA-3` и

hFc_f (SEQ ID NO:16) 5`-GGGAGATCATGAGGGTGT-3`.

Из положительных колоний выделяют плазмидную ДНК. Правильность встраивания фрагмента проверяют секвенированием рекомбинантных векторов. Полученный промежуточный вектор был обозначен как spIg-hTNFr. Структурная схема вектора spIg-hTNFr приведена на фиг. 3

Пример 4. Конструирование плазмидного вектора pFIG-hTNFr, кодирующего химерный белок

В промежуточый вектор pFIG был введен фрагмент ДНК, кодирующий последовательность лидерной последовательности CD33 и TNFR1.

Для этого фрагмент проводили ПЦР с использованием олигонуклеотидов:

pFI_f (SEQ ID NO:24) 5`-GACAAAACTCACACATGCCCACC-3` и

pFI_r (SEQ ID NO:25) 5`-TGCTAGAGCTCCAGATATCGAATTCAC-3`

и плазмиды pFIG в качестве матричной ДНК. Реакционная смесь объемом 25 мкл содержит 1× буфер для KOD Hot Start DNA Polymerase («Novagen»), 1,5 мМ MgSO4, 0,2 мМ раствор дНТФ, 0,3 мкМ олигонуклеотид pFI_f, 0,3 мкМ олигонуклеотид pFI_r, 5 нг векторной ДНК pFIG, 0,02 ед/мкл KOD Hot Start DNA Polymerase.

Фрагмент ДНК, кодирующий лидерную последовательность CD33 и TNFR синтезировали с помощью ПЦР. Для этого использовали олигонуклеотиды:

sp_f (SEQ ID NO:26) 5`-ACTATAGGGAGCTCCAAGCTGCTTC-3`,

фосфорилированного по 5`-концу и

sp_r (SEQ ID NO:27) Р5`-ACCACCACCACCACCACGAC-3`

и вектор spIg-hTNFr в качестве матричной ДНК. Реакционная смесь объемом 25 мкл содержала 1× буфер для Pfu ДНК полимеразы («Thermo Fisher Scientific»), 0,2 мМ дНТФ, 10 пмоль олигонуклеотида sp_f, 10 пмоль олигонуклеотида sp_r, 1 нг векторной ДНК spIg-hTNFr, 2 ед. Pfu ДНК полимеразы («Thermo Fisher Scientific»).

Очищенные продукты ПЦР обрабатывают эндонуклеазой рестрикции SacI. Реакционная смесь объемом 50 мкл содержит 1× буфер «Buffer SacI» («Thermo Fisher Scientific»), продукты ПЦР и 10 ед. эндонуклеазы рестрикции SacI. Реакционную смесь инкубировали при 37 °С в течение 4 часов.

Обработанные фрагменты ДНК эндонуклеазами рестрикции лигируют с использованием ДНК лигазы фага Т4 («Thermo Fisher Scientific»). Реакционная смесь объемом 10 мкл содержала 1× буфер для ДНК лигазы фага Т4, 1 мМ АТФ, лигируемые фрагменты ДНК в молярном соотношении 1:3 (вектор:вставка) и 5 ед. ДНК лигазы фага Т4 («Thermo Fisher Scientific»). Реакционную смесь инкубируют при 37 °С в течение 2 часов. Продуктами лигирования трансформируют клетки E. coli штамма TOP10. Трансформированные клетки высевают на чашки с селективной агаризованной средой, содержащей 25 мкг/мл зеоцина.

Скрининг колоний, содержащих рекомбинантные плазмиды, проводят с использованием полимеразной цепной реакции. В качестве матричной ДНК используют часть колонии E. coli, ресуспендированной в 5 мкл 1% раствора Тритон Х-100. Реакционная смесь объемом 25 мкл содержит 1× буфер для Taq DNA Polymerase («Thermo Fisher Scientific»), 0,2 мМ дНТФ, по 10 пмоль олигонуклеотидов

HTLV5`UTR (SEQ ID NO:28) (5`-TGCTTGCTCAACTCTACGTC-3`) и

hFc_f (SEQ ID NO:16) (5`-GGGAGATCATGAGGGTGT-3`)

и 5 ед. Taq DNA Polymerase («Thermo Fisher Scientific»). ПЦР проводят в амплификаторе Master Cyclergradient («Eppendorf»). Из положительных колоний выделяют плазмидную ДНК. Правильность встраивания фрагмента проверяют секвенированием рекомбинантных векторов. Полученный вектор был обозначен как pFIG-hTNFr.

Пример 5. Конструирование вектора, кодирующего микроРНК

Вектор, кодирующий микроРНК miR7 получают путем интегрирования фрагмента кодирующего miR7 в плазмиду psiRNA-h7SK (Invivogen) по сайту эндонуклеазы Bbs I.

Для этого синтезируют одноцепочечные фрагменты ДНК, кодирующие miR7. Дизайн фрагментов был выполнен в соответствии с рекомендациями производителя вектора (Invivogen).

7-1 (SEQ ID NO:29) 5' ACCTCTGGAAGACTAGTGATTTTGTTGTTCAAGAG ACAACAAAATCACTAGTCTTCCATT 3'

7-2 (SEQ ID NO:30) 5' CAAAAATGGAAGACTAGTGATTTTGTTGTCTCTTGAAC AACAAAATCACTAGTCTTCCAG 3'

Реакцию отжига олигонуклеотидов проводят в смеси следующего состава: олигонуклеотид 1 (25 мкМ) - 2 мкл; олигонуклеотид 2 (25 мкМ) - 2 мкл; 0.5 M NaCl - 6 мкл; H2O - 20 мкл. Смесь инкубируют в микропробирке Эппендорф на водяной бане в течение 2 мин при 80 °C , затем прекращают нагревание и инкубируют смесь в бане до тех пор, пока температура не достигла 35 °C.

Вектор линеаризируют с помощью эндонуклеазы рестрикции Bbs I (Производитель NEB), в соотношении 2 ед/мкг плазмидной ДНК в течение 2 ч при 37 °C. Разделяют смесь с помощью электрофореза в 0,8% агарозном геле. Окрашивают гель 0,005% раствором бромистого этидия. Выделяют большой фрагмент (2945 п.н.) из геля с помощью набора «GeneJET Gel Extraction Kit» («Thermo Fisher Scientific»). Определяют концентрацию и разводят деионизованной водой до конечной концентрации 0.1 мкг/мкл. Для лигирования плазмиды и полученных фрагментов ДНК готовят смесь следующего состава: линеаризованная psiRNA - 1 мкл (100 нг), фрагмент siRNA - 1 мкл, T4 ДНК лигаза - 1 мкл (1 ед), десятикратный буфер для лигирования - 2 мкл, H2O - 15 мкл. Инкубируют смесь при 22 °C в течение 2 часов. Затем продуктами лигирования трансформируют клетки E. coli штамм GT116 sbcCD. Инокулируют единичной колонией 2 мл среды LB и инкубируют 16 ч при 37°C с помощью термостатируемого шейкера. Вносят 20 мкл ночной культуры в 2 мл среды LB. Инкубируют клетки при 37°С при интенсивном перемешивании до концентрации 5·107 кл/мл (0,5 ОЕ). Клетки охлаждают во льду в течение 5-10 мин и центрифугировали (6000 g, 1 мин). Ресуспендируют в 600 мкл 0,1 М раствора СаС12 и охлаждают на льду 20 мин. Осаждают клетки центрифугированием (6000 g,, 1 мин) и ресуспендируют клеточный осадок в 180 мкл 0,1 М раствора СаСl2. Добавляли 1мкг лигазной смеси. Инкубируют на льду 30 мин. После этого термостатируют 30 с при 42°С и охлаждают 15 мин. После добавления 800 мкл LB инкубируют 90 мин при 37°С. Центрифугируют при 6000 g в течение 1 мин. Удаляют 800 мкл супернатанта, осадок ресуспендировали в оставшейся среде и переносят на поверхность чашки с агаризованной LB средой с канамицином (25 мкг/мл), ИПТГ, XGal. Инкубируют при 37°С в течение 16 ч. Переносят клетки из трех белых колоний в 5 мл LB с канамицином и инкубируют при 37°С в течение 16 ч при постоянном перемешивании. Выделяют плазмидную ДНК с помощью коммерческого набора «GeneJET™ Plasmid Miniprep Kit» («Thermo Fisher Scientific») согласно рекомендациям производителя.

Пример 6. Получение культуры-суперпродуцента

Культуру-продуцента рекомбинантного TNFR-Fc получают путем последовательной трансфекции векторами pFIG-hTNFR и psiRNA-h7SK-miR7.

Для трансфекции используют культуру клеток HEK293F (Invivogen). После размораживания клетки культивируют в среде FreeStyle™ 293 в течение 3 суток при 37°C и 5% CO2 при постоянном перемешивании со скоростью 125 об/мин. Затем клетки адаптируют к среде Гибрис (ПанЭко) в течение 7 сут.

Плазмиды (из расчета1 мкг на 106 клеток) переосаждают с помощью хлорида лития и этилового спирта в течение 16 ч при минус 20°C. Трансфекцию проводят с помощью липагента FreeStyle™ MAX Reagent. Затем клетки культивируют в течение 24 ч при 37°C и 5% CO2. Подсчитывают количество клеток в камере Горяева и оценивают жизнеспособность по окрашиванию красителем трипановым синим.

Готовят суспензию клеток (60 тыс. клеток/мл) в среде Гибрис, содержащей зеоцин в концентрации 400 мкг/мл. Вносят по 100 мкл суспензии клеток в лунки трех 96-луночных планшетов. Помещают в CO2 инкубатор и культивируют в течение 2-3 недель в условиях 37°C и 5% CO2. В процессе культивирования каждые 3-4 дня производят замену среды. После завершения селекции оценивают продуктивность клеток. Для этого в планшетах заменяют среду на Гибрис без зеоцина. Культивируют клетки в течение 24 часов. Затем центрифугируют планшеты при 400 g в течение 10 мин при 37°C.

В лунки трех 96-луночных планшетов для иммуноферментного анализа вносят рекомбинантный человеческий TNF в количестве 100 нг/лунку. После блокирования свободной поверхности лунок 1% раствором бычьего сывороточного альбумина в ФСБ добавляют по 100 мкл культуральной среды каждого клона и инкубируют 1 ч при 37°C. После тщательной промывки ФСБ с 0.05% Твин-20 в лунки вносят антитела, специфичные к Fc фрагмента иммуноглобулина G человека, конъюгированные с пероксидазой хрена (BioRad) в разведении 1:5000. Инкубируют планшеты при 37 °С в течение 1 ч. Затем планшеты промывают ФБР-Т и проявляют реакцию с помощью субстратного раствора (0,7 мг/мл ортофенилендиамин (ОФД), 0,02% Н2О2, 0,1 М цитрат-фосфатный буфер, рН 5,0). Реакцию останавливают 1 М серной кислотой и определяют оптическую плотность в каждой лунке при 490 нм (бланк или нулевое считывание по воздуху), используя фотометр для микропланшетов.

По результатам исследования были выбраны две лунки с наибольшим сигналом. Клетки из каждой лунки суспендируют в среде Гибрис содержащей зеоцин в концентрации 200 мкг/мл (5 кл/мл). По 100 мкл суспензии клеток переносят в лунки 96-луночного планшета. Помещают в CO2 инкубатор и культивируют в течение 2-3 недель в условиях 37°C и 5% CO2. Отмечают лунки с единичными клонами и оценивают продуктивность клеток, как описано выше. Выбирают клон с наибольшей продуктивностью.

Затем клетки ресуспендируют в среде Гибрис без глутамина. Вносят по 500 мкл суспензии (1/2 кл/лун) в лунки четырех 96-луночных планшетов. Добавляют в лунки концентрированный раствор метионинсульфоксимина до конечной концентрации 1 мМ. Инкубируют в течение 2 недель, каждые три дня заменяли среду на новую. Тестируют клетки с помощью ИФА, как описано выше. По результатам анализа выбрают клон с наибольшей продуктивностью.

Для дополнительного увеличения продуктивности клетки выбранного клона были трансфицированы вектором psiRNA-h7SK-miR7, как описано выше для плазмиды pFIG-hTNFR. Для получения стабильных трансфектантов проводят селекцию клеток, трансфицированных psiRNA-h7SK-miR7 в среде Гибрис, содержащей генетицин (Производитель Gibco) в концентрации 600 мкг/мл. Процедура селекции аналогична приведенной ранее для зеоцина. Продуктивность клонов была проанализирована с помощью иммуноферментного анализа. Был выбран клон с наибольшими значениями специфического ИФА-сигнала.

Пример 7. Наработка белка

Клетки в начальной плотности 4×106 кл/мл инкубируют в среде Гибрис-1-293 (ПанЭко) в течение 10 сут при 37°C и 5% CO2 при постоянном перемешивании со скоростью 125 об/мин, каждые трое суток производят замену ¼ части среды. Среду культивирования объединяют и выделяют рекомбинантный TNFR1-Fc с помощью аффинной хроматографии на белок G сефарозе (Amersham). Колонки объемом 5 мл уравновешивали рабочим буфером, содержащим 25 мМ трис-HCl, pH 7.5, 150 мМ NaCl. Супернатанты пропускают через колонку со скоростью 1 мл/мин. После промывки колонки рабочим буфером (10 V колонки) белок элюировали 0,1М раствором глицина pH 2,5 в пробирки, содержащие 100 мМ раствор трис-HCl, pH 9,0.

Концентрацию белка определяют спектрометрическим методом по поглощению света при длине волны 280 нм.

Очищенный рекомбинантный TNFR1-Fc анализируют с помощью ДСН-ПААГ электрофореза по Laemmli в 12% геле. В белковые препараты добавляют 2× буфер для образцов (1:1), содержащий 2% ДСН и 0,7М меркаптоэтанол и денатурировали образцы 7 мин при 99оС в твердотельном термостате. Пять мкл. образцов вносили в лунки геля ДСН-ПААГ с последующей постановкой электрофореза при силе тока 20 мА до достижения фронта красителя окончания геля. После разделения гель окрашивают с использованием раствора Кумасси G-250.

Для определения олигомерного статуса TNFR1-Fc анализируют с помощью гель-фильтрационной хроматографии. Рекомбинантный белок растворяют в 10 мМ Na-фосфатном буфере, pH 7,4, содержащим 150 мМ NaCl до конечной концентрации 0,3 мг/мл. На колонку Superdex™ 200 Tricorn 10/300 (GE Healthcare) наносят 100 мкл образца, содержащего 30 мкг рекомбинантного белка. Скорость элюции поддерживают равной 1 мл/мин. Регистрацию оптической плотности элюента осуществляют при длине волны 280нм.

В результате тестирования было показано, что в указанных условиях культивирования выход белка составляет 100±10 мг/л. В препарате очищенного белка TNFR1-Fc присутствует в виде олигомера.

Пример 8. Определение активности рекомбинантного TNFR1-Fc

Активность рекомбинантного TNFR1-Fc оценивают по способности ингибировать цитотоксическое действие ФНО на клетки линии L929.

В лунки 96-луночного планшета вносят по 200 мкл суспензии клеток L929 в среде DMEM c 10% эмбриональной телячьей сывороткой (50 тыс. кл/лун) и культивировали при 37°C и 5% CO2 до достижения 80% конфлюэнтности. В лунки планшета добавляли раствор ФНО до конечной концентрации 100 нг/мл (контроль) или смесь ФНО (100 нг/мл) и TNFR-Fc (100, 200, 300 нг) или смесь ФНО и Fc и инкубировали в течение 24 ч. Затем лунки промывают забуференным физиологическим раствором и вносят по 50 мкл 0,1% раствора нейтрального красного. Инкубируют в течение 20 мин при 37°C. Краситель удаляют и промывают лунки трижды забуференным физиологическим раствором. Вносят в лунки по 100 мкл 0,1% раствора додецилсульфата натрия. После растворения красителя определяют оптическую плотность в каждой лунке при 490 нм (бланк или нулевое считывание по воздуху), используя фотометр для микропланшетов.

В результате тестирования было установлено, что рекомбинантный TNFR1-Fc обладает ингибирующей активностью в отношении фактора некроза опухоли in vitro.

Промышленная применимость

В настоящем изобретении предлагается новый экспрессионный вектор для наработки биологически активного белка TNFR1-Fc. Экспрессируемый белок является водорастворимым, что позволяет существенно упростить процедуру его выделения.

Высокая эффективность вектора, позволяет использовать его при производстве препаратов-ингибиторов фактора некроза опухоли.

Перечень источников информации

1. SHAALTIEL Y. et al. TNF alpha INHIBITOR POLYPEPTIDES, POLYNUCLEOTIDES ENCODING SAME, CELLS EXPRESSING SAME AND METHODS OF PRODUCING SAME. Заявка на патент США № US20160017021 (2016-01.21).

2. Lazar G. A. et al. OPTIMIZED Fc VARIANTS. Заявка на патент США № US20150315284 (2015-05-11).

3. JACOBS C.A. et al. Methods of lowering active TNF- alpha levels in mammals using tumor necrosis factor receptor. Патент США № US5605690 (1997-02-25).

4. PATELL V. M. AN EXPRESSION VECTOR AND A METHOD THEREOF. Заявка на патент Мексики № MX2011001644 (2011-10-06).

5. XIONG S.X. et al. Gene for coding recombinant human TNFR-Fc fusion protein and application of gene. Патент Китая № CN102911958 (2014-08-06).

6. Франк Л.А. и др. РЕКОМБИНАНТНАЯ ПЛАЗМИДНАЯ ДНК pG1-Rm7, ОБЕСПЕЧИВАЮЩАЯ СИНТЕЗ ГИБРИДНОГО БЕЛКА G1-Rm7, И ГИБРИДНЫЙ БЕЛОК, СВЯЗЫВАЮЩИЙ ФАКТОРНЕКРОЗА ОПУХОЛЕЙ И ОБЛАДАЮЩИЙ БИОЛЮМИНЕСЦЕНТНОЙ АКТИВНОСТЬЮ. Патент РФ № 2513686 (27.02.2014).

7. Шмелев В.А., Чумбуридзе Г.Г. РЕКОМБИНАНТНАЯ ПЛАЗМИДНАЯ ДНК, КОДИРУЮЩАЯ СИНТЕЗ, СПОСОБ ПОЛУЧЕНИЯ И ПРЕПАРАТ РЕКОМБИНАНТНОГО ГИБРИДНОГО БЕЛКА α-ФАКТОРНЕКРОЗА ОПУХОЛЕЙ-ТИМОЗИН-α1 . Патент РФ № 2225443 (10.03.2004).

8. Батанова Т.А. и др. РЕКОМБИНАНТНАЯ ФАГМИДНАЯ ДНК pHEN-TAB, СОДЕРЖАЩАЯ ГЕН ОДНОЦЕПОЧЕЧНОГО АНТИТЕЛА ЧЕЛОВЕКА, СПОСОБНОГО СВЯЗЫВАТЬ ФАКТОРНЕКРОЗА ОПУХОЛИАЛЬФА ЧЕЛОВЕКА; РЕКОМБИНАНТНЫЙ ШТАММ БАКТЕРИЙ Escherichia coli-ПРОДУЦЕНТ ОДНОЦЕПОЧЕЧНОГО АНТИТЕЛА ЧЕЛОВЕКА ПРОТИВ ФАКТОРАНЕКРОЗА ОПУХОЛИАЛЬФА ЧЕЛОВЕКА; РЕКОМБИНАНТНОЕ РАСТВОРИМОЕ ОДНОЦЕПОЧЕЧНОЕ АНТИТЕЛО ЧЕЛОВЕКА ПРОТИВ ФАКТОРАНЕКРОЗА ОПУХОЛИАЛЬФА ЧЕЛОВЕКА. Патент РФ № 2307163 (27.03.2007).

9. BROCKHAUS M. G. et al. Human TNF receptor fusion protein. Патент США № US8063182 (2011-11-22).

10. FINCK B.K. SOLUBLE TUMOR NECROSIS FACTOR RECEPTOR TREATMENT OF MEDICAL DISORDERS. Патент США № US8722631 (2014-05-13).

11. BROWNING J. et al. METHOD FOR THE HIGH LEVEL EXPRESSION OF ACTIVE LYMPHOTOXIN-BETA RECEPTOR IMMUNOGLOBULIN CHIMERIC PROTEINS AND THEIR PURIFICATION. Патент США № US8283138 (2012-10-09).

12. WON H. S. et al. METHOD FOR PREPARING ACTIVE FORM OF TNFR-FC FUSION PROTEIN. Патент США № US9279014 (2016-03-08).

13. HILDINGER M. USE OF VALPROIC ACID FOR ENHANCING PRODUCTION OF RECOMBINANT PROTEINS IN MAMMALIAN CELLS. Заявка на патент США № US2009023186 (2009-01-22).

14. ХСИЕХ Чунг-Минг УСОВЕРШЕНСТВОВАННЫЕ ВЕКТОРЫ ЭКСПРЕССИИ МЛЕКОПИТАЮЩИХ И ИХ ПРИМЕНЕНИЕ. Патент РФ№2502800 (27.02.2012).

15. Trizina J.A. et al. Overexpression of Mir-7 has an impact on HEK 293 growth and recombinant protein productivity. 8th International Scientific Conference Science and Society London 24-29 November 2015 p51-60.

1. Экспрессионный плазмидный вектор pFIG-hTNFr, для экспрессии активной формы рекомбинантного белка TNFR1-Fc в клетках HEK293, обладающий свойством экспрессионной кассеты в указанных клетках, где указанный плазмидный вектор с физической картой, представленной на фиг.5, имеет размер 6674 п.о., молекулярную массу 4,40484 MДа, уникальные сайты рестрикции: Acc65I, AgeI, AhdI, ApaBI, AsiSI, BbeI, BglII, BspEI, BspHI, BssHII, BstAPI, BstZ17I, ClaI, EcoICRI, EcoRI, FalI, FseI, HpaI, KasI, KpnI, NarI, NcoI, NdeI, PflMI, PsiI, PvuI, SacI, SalI, SanDI, SbfI, ScaI, SciI, SfoI, SnaBI, SpeI, SphI, SspI, XbaI, XcmI, XhoI, промоторы: эукариотический промотор фактора элонгации 1α (EF-1α), промотор гена легкой цепи ферритина человека (hFerL), бактериальный промотор EM2KC, энхансеры: R сегмент и часть U5 последовательности длинного концевого повтора типа 1 вируса Т-клеточной лейкемии человека, энхансер раннего гена 1 цитомегаловируса человека, где в состав экспрессионной кассеты входит нуклеотидная последовательность SEQ ID NO: 1, которая содержит:

а) последовательность, кодирующую рекомбинантный белок TNFR1-Fc с аминокислотной последовательностью SEQ ID NO: 2, представленной на фиг. 6б.

б) последовательность E/Р (SEQ ID NO:3) энхансера вируса Т-клеточной лейкемии человека и промотора фактора элонгации 1;

в) последовательность SP (SEQ ID NO:5), кодирующую сигнальный пептид CD33;

е) последовательность IRES (SEQ ID NO:10), кодирующую участок внутренней посадки рибосомы вируса энцефаломиокардита;

ж) последовательность GS (SEQ ID NO:12), кодирующую глутаминсинтетазу.

2. Линия клеток HEK293 - продуцентов рекомбинантного белка, последовательно трансфицированная экспрессионным вектором по п. 1 и вектором psiRNA-h7SK-miR7 с физической картой, представленной на фиг. 7.

3. Линия клеток по п. 2, отличающаяся тем, что после последовательной трансфекции линии клеток HEK 293 осуществляют последующую селекцию клеток с помощью метионинсульфоксимина.

4. Способ получения гибридного белка TNFR1-Fc, включающий культивирование линии клеток HEK293 по п. 2, последовательно трансформированных введением экспрессионного плазмидного вектора pFIG-hTNFr, кодирующего синтез активного рекомбинантного белка TNFR1-Fc и дополнительно введенного в клетки вектора psiRNA-h7SK-miR7, в жидкой питательной среде с последующим выделением и очисткой белка TNFR1-Fc.



 

Похожие патенты:

Изобретение относится к области генной инженерии, конкретно к рекомбинантному получению антиангиогенных пептидов, и может быть использовано в медицине. Способ получения рекомбинантного антиангиогенного пептида Тумастина - производного модифицированного фрагмента [L69K-95] тумстатина человека с присоединенными к N- и С-концам последовательностями Ser-Gly-Ala-Met-Gly и Pro-Gly-Pro соответственно, предусматривает культивирование штамма-продуцента Е.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков, и может быть использовано для получения рекомбинантного слитого белка, состоящего из опухоль-специфического пептида и противоопухолевого пептида RL2.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков, и может быть использовано для получения рекомбинантного слитого белка, состоящего из опухоль-специфического пептида и противоопухолевого пептида RL2.

Изобретение относится к области биотехнологии, а именно к рекомбинантному получению антимикробного пептида минибактенецина ChBac7.5Nα из лейкоцитов козы Capra hircus, который может найти применение в медицинской и ветеринарной практике в качестве антибиотика широкого спектра действия.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков в Escherichia coli, и может быть использовано для получения рекомбинантного пищевого аллергена гороха посевного Pisum sativum.

Группа изобретений относится к биотехнологии и фармакологии и касается штаммов Lactobacillus brevis 47f, Lactobacillus rhamnosus 313, Lactobacillus rhamnosus 40f и Lactobacillus brevis 15f, способных синтезировать антиоксидант глутатион.

Изобретение относится к области биотехнологии, может быть использовано для получения альфа-фетопротеина (АФП) человека с использованием штаммов дрожжей Saccharomyces cerevisiae, содержащих рекомбинантный ген АФП.

Изобретения касаются способа снижения гетерогенности заряда целевого антитела, способа выработки целевого антитела со сниженной гетерогенностью заряда и способов приготовления лекарственного препарата для лечения злокачественных новообразований, содержащего антитело против глипикана 3 или антитело против IL-31RA.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков в клетках млекопитающих, и может быть использовано для получения интерлейкина-7 человека в клетках яичников китайского хомячка CHO.

Изобретение относится к генной инженерии и может быть использовано для получения зрелого аполипопротеина A-I человека. Для увеличения выхода зрелого аполипопротеина A-I человека его получают путем ферментативного гидролиза SUMO-специфичной протеазой SP2 рекомбинантного химерного белка SUMO3-апоА-I, синтезированного штаммом дрожжей Pichia pastoris.

Настоящее изобретение относится к области биотехнологии. Предложено выделенное рекомбинантное или очищенное антитело, которое специфически связывается с рецептором колониестимулирующего фактора-1 (КСФ-1R, CSF-1R), охарактеризованное аминокислотными последовательностями вариабельных доменов.

Изобретение относится к области биохимии, в частности к способу трансформации растительной клетки, где способ включает контакт растительных клеток незрелых зародышей кукурузы с клетками Agrobacterium в жидкой среде, содержащей неионное трисилоксановое поверхностно-активное вещество.

Настоящее изобретение относится к области биохимии, в частности к биспецифическому антителу, которое связывается как с фактором свертывания крови IX/активированным фактором свертывания крови IX, так и с фактором свертывания крови X и функционально заменяет фактор свертывания крови VIII.

Изобретение относится к области биотехнологии, конкретно к клеточной инженерии, и может быть использовано для определения биологической активности IFN-γ. Получают линию клеток меланомы человека PiGAS с регистрационным номером ВКПМ Н-161 путем трансфекции родительской линии клеток меланомы человека MelP плазмидой pGAS(x6)-Luc//Neo, кодирующей репортерную конструкцию 6xGAS-Luc, состоящую из последовательности SEQ ID NO: 1, включающую 6 повторов сайта связывания транскрипционного фактора STAT-1, минимального промотора SV-40 и гена люциферазы светлячка Photinus pyralis (Luc), а также последовательности SEQ ID NO: 2, включающую ген устойчивости Neo к селективному антибиотику G418 под контролем своего конститутивного промотора PGK-1.

Изобретение относится к биотехнологии. Описаны иммортализованные стволовые клетки, которые получают путем выделения стволовых клеток, выбранных из группы, состоящей из мезенхимальных клеток млекопитающих и соматических клеток, первичным культивированием клеток, с получением клеток первой стадии культуры, трансфекцией четырех видов генов в клетки первой стадии культуры, с получением трансгенных клеток, и выбором желаемых иммортализованных стволовых клеток из числа трансгенных клеток с использованием экспрессии STRO-1 в качестве индекса.

Настоящая группа изобретений относится к биотехнологии. Предложены псевдотипированная вирусная векторная частица для переноса биологического материала в гемопоэтические клетки, способ ее получения и ее применение, медикамент для лечения гемопоэтических нарушений или аутоиммунных заболеваний, содержащий указанную частицу, способ трансдукции гемопоэтический клетки и стабильная пакующая вирус клеточная линия.

Данное изобретение относится к области биотехнологии. Предложена молекула биспецифического одноцепочечного антитела, содержащая первый связывающий домен, способный связываться с эпитопом CD3ε (эпсилон)-цепи человека и обыкновенной игрунки (Callithrix jacchus), эдипова тамарина (Saguinis oedipus) или обыкновенной беличьей обезьяны (Saimiri sciureus), где указанный эпитоп содержит по меньшей мере аминокислотную последовательность Gln-Asp-Gly-Asn-Glu (QDGNE), и второй связывающий домен, способный связываться со специфическим мембранным антигеном предстательной железы (PSMA) человека и яванского макака.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков в клетках млекопитающих, и может быть использовано для получения рекомбинантного антимюллерова гормона человека в клетках СНО.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков в клетках млекопитающих, и может быть использовано для получения интерлейкина-7 человека в клетках яичников китайского хомячка CHO.

Группа изобретений относится к молекулярной биологии, биотехнологии, медицине и может быть использована для осуществления профилактики и лечения туберкулеза. Предложены гибридные белки для индукции специфичного иммунного ответа против Mycobacterium tuberculosis, включающие белки Ag85B, Tb10.4 M.tuberculosis, фрагменты флагеллина FliC S.Typhimurium, соединенные гибкими мостиками, кодирующие полинуклеотиды, генетические конструкции для экспрессии полинуклеотидов, рекомбинантные клетки и варианты вакцины для профилактики или лечения туберкулеза на основе описанного гибридного белка, потребитель разработанной вакцины - человек либо животное.

Изобретение относится к области биохимии, в частности к выделенной нуклеиновой кислоте, кодирующей полипептид слияния, обладающий активностью бета-1,4-N-ацетилглюкозаминилтрансферазы III (GnTIII) или бета-1,4-галактозилтрансферазы (GalT).

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков, и может быть использовано для получения рекомбинантного белка TNFR1-Fc в клетках HEK293. Конструируют экспрессионный плазмидный вектор pFIG-hTNFr с физической картой, представленной на фиг.5, размером 6674 п.о., содержащий: а) последовательность, кодирующую рекомбинантный белок TNFR1-Fc с аминокислотной последовательностью, представленной на фиг. 6б; б) последовательность  EР  энхансера вируса Т-клеточной лейкемии человека и промотора фактора элонгации 1; в) последовательность SP, кодирующую сигнальный пептид CD33; е) последовательность IRES, кодирующую участок внутренней посадки рибосомы вируса энцефаломиокардита, и ж) последовательность GS, кодирующую глутаминсинтетазу. Способ получения гибридного белка TNFR1-Fc включает культивирование клеток HEK293, последовательно трансформированных введением указанного вектора pFIG-hTNFr и вектора psiRNA-h7SK-miR7 с физической картой, представленной на фиг. 7, в жидкой питательной среде с последующим выделением и очисткой белка TNFR1-Fc. Изобретение позволяет получить рекомбинантный белок TNFR1-Fc с высокой активностью ингибирования фактора некроза опухоли с высоким выходом. 3 н. и 1 з.п. ф-лы, 8 ил., 7 пр.

Наверх