Плазмидный вектор pet-ppsltp, штамм бактерии escherichia coli bl21(de3)star/ pet-ppsltp - продуцент пищевого аллергена гороха pis s 3 и способ получения указанного аллергена



Плазмидный вектор pet-ppsltp, штамм бактерии escherichia coli bl21(de3)star/ pet-ppsltp - продуцент пищевого аллергена гороха pis s 3 и способ получения указанного аллергена
Плазмидный вектор pet-ppsltp, штамм бактерии escherichia coli bl21(de3)star/ pet-ppsltp - продуцент пищевого аллергена гороха pis s 3 и способ получения указанного аллергена
Плазмидный вектор pet-ppsltp, штамм бактерии escherichia coli bl21(de3)star/ pet-ppsltp - продуцент пищевого аллергена гороха pis s 3 и способ получения указанного аллергена
Плазмидный вектор pet-ppsltp, штамм бактерии escherichia coli bl21(de3)star/ pet-ppsltp - продуцент пищевого аллергена гороха pis s 3 и способ получения указанного аллергена
Плазмидный вектор pet-ppsltp, штамм бактерии escherichia coli bl21(de3)star/ pet-ppsltp - продуцент пищевого аллергена гороха pis s 3 и способ получения указанного аллергена
Плазмидный вектор pet-ppsltp, штамм бактерии escherichia coli bl21(de3)star/ pet-ppsltp - продуцент пищевого аллергена гороха pis s 3 и способ получения указанного аллергена
Плазмидный вектор pet-ppsltp, штамм бактерии escherichia coli bl21(de3)star/ pet-ppsltp - продуцент пищевого аллергена гороха pis s 3 и способ получения указанного аллергена

 


Владельцы патента RU 2618840:

Федеральное государственное бюджетное учреждение науки Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук (ИБХ РАН) (RU)

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков в Escherichia coli, и может быть использовано для получения рекомбинантного пищевого аллергена гороха посевного Pisum sativum. Конструируют плазмидный вектор pET-pPsLTP для экспрессии Pis s 3 в клетках Escherichia coli в составе гибридного белка His8-TrxL-Pis s 3. Трансформируют предложенным вектором родительский штамм Escherichia coli BL21(DE3)Star, получая штамм-продуцент гибридного белка His8-TrxL-Pis s 3. Затем проводят культивирование и последующий лизис клеток штамма-продуцента, аффинную очистку гибридного белка His8-TrxL-Pis s 3 на металлохелатном носителе, расщепление гибридного белка His8-TrxL-Pis s 3 бромцианом по остатку метионина, введенному между последовательностями аллергена Pis s 3 и тиоредоксина, повторную металлохелатную хроматографию и очистку целевого пептида с помощью обращенно-фазовой ВЭЖХ. Изобретение позволяет получить особо чистый пищевой аллерген Pis s 3, способный связывать специфические антитела. 3 н.п. ф-лы, 5 ил., 4 пр.

 

Изобретение относится к области биотехнологии, а именно к получению Pis s 3-пищевого аллергена гороха посевного Pisum sativum, относящегося к классу липид-транспортирующих белков (Lipid transfer proteins, LTP), который может найти широкое применение в диагностике аллергических заболеваний для создания современных тест-систем, предназначенных для компонентной аллергодиагностики, а также в медицине с целью создания аллерговакцин для проведения более эффективной и безопасной аллерген-специфической иммунотерапии (АСИТ).

Липид-транспортирующие белки составляют один из наиболее клинически значимых классов растительных аллергенов, участвующих в развитии аллергических реакций различной степени тяжести на пыльцу, растительные продукты и латекс. Компактная пространственная структура этих белков, стабилизированная четырьмя дисульфидными связями, позволяет им достигать кишечника человека в нативной, иммуногенной форме и вызывать сенсибилизацию [Hauser М. et al. Panallergens and their impact on the allergic patient. // Allergy Asthma. Clin. Immunol. 2010. T.6. №1. С. 1]. Наличие у растительных LTP устойчивой к тепловой, химической денатурации и ферментативному расщеплению структуры также объясняется то, что они выступают в роли основных аллергенов в различных прошедших обработку продуктах (соках, джемах, пиве, вине и др.) [Crespo J.F. et al. Frequency of food allergy in a pediatric population from Spain // Pediatr. Allergy Immunol. 1995. T. 6. №1. C. 39-43].

Липид-транспортирующий белок гороха посевного Pisum sativum Pis s 3 (SEQ ID No. 1) является важным пищевым аллергеном семян гороха, который был внесен в международную базу данных по аллергенам (www.allergen.org) Международного союза иммунологических обществ (WHO/IUIS). Данный белок состоит из 95 аминокислотных остатков и включает в себя характерный для аллергенных надсемейств растительных липид-транспортирующих белков и проламинов октацистеиновый мотив. Данный белок с различной эффективностью связывает широкий спектр липидных молекул, включая жирные кислоты, лизолипиды и регулятор роста растений - жасмоновую кислоту. Он обладает также антимикробной активностью в отношении ряда фитопатогенных организмов, главным образом, плесневых грибов - представителей рода Fusarium. Показана высокая стабильность данного аллергена к перевариванию ферментами желудочно-кишечного тракта и термической обработке, благодаря чему данный аллерген сохраняет свою нативную конформацию в прошедших обработку продуктах, содержащих горох. Pis s 3 способен связывать специфические антитела IgE из сывороток пациентов с пищевой аллергией на фрукты, бобовые и орехи, что может приводить к системным аллергическим реакциям при попадании данного аллергена в организм сенсибиллизованных пациентов. В связи с этим данный аллерген может найти широкое применение для диагностики IgE-опосредованной пищевой аллергии на горох, а также для проведения аллерген-специфической иммунотерапии с целью снижения иммунореактивности организма к продуктам, содержащим гороховые бобы и муку, и для лечения аллергических реакций у чувствительных к нему пациентов.

Известен наиболее близкий к заявляемому изобретению способ получения рекомбинантного аналога пищевого аллергена класса LTP - Pha v 3 стручковой фасоли. Данный способ основан на сверхэкспрессии данного аллергена в дрожжах Pichia pastoris, дальнейшей его очистке из культуральной жидкости с помощью последовательных стадий осветления центрифугированием, фильтрации через фильтр с диаметром 0,45 мкм, ультрафильтрации через фильтр с MWCO 3 кДа, ионообменной и эксклюзионной хроматографии [Zoccatelli G. et al. Identification and characterization of the major allergen of green bean (Phaseolus vulgaris) as a non-specific lipid transfer protein (Pha v 3) // Mol. Immunol. - 2010. - Vol. 47(7-8). - PP. 1561-1568]. Предложенный в данном изобретении метод получения рекомбинантного аллергена гороха Pis s 3 основан на его сверхэкспрессии в прокариотической системе кишечной палочки E.coli. Среди преимуществ использования E.coli для гетерологичной экспрессии являются простота условий культивирования, быстрый рост культуры, высокие уровни экспрессии, а также более низкая себестоимость целевых белков.

Изобретение решает задачу расширения ассортимента аллергенных белков, предназначенных, главным образом, для компонентной аллергодиагностики и превентивной иммунотерапии, за счет получения пищевого аллергена гороха Pis s 3.

Поставленная задача решается за счет:

- генно-инженерного конструирования плазмидного вектора pET-pPsLTP, несущего нуклеотидную последовательность SEQ ID No. 2 для экспрессии в клетках Escherichia coli гена пищевого аллергена гороха Pis s 3, кодирующую гибридный полипептид His8-TrxL-Pis s 3, включающий аминокислотные последовательности белков Pis s 3 и тиоредоксина TrxL, а также октагистидиновую аффинную метку;

- создания штамма-продуцента данного гибридного полипептида Escherichia coli BL21(DE3)Star/pET-pPsLTP, сконструированного на основе штамма E.coli BL21(DE3)Star путем трансформации его вектором pET-pPsLTP;

- способа получения целевого белка - пищевого аллергена Pis s 3 - путем экспрессии гена содержащего его гибридного полипептида His8-TrxL-Pis s 3 в клетках указанного штамма, разрушения бактериальных клеток, аффинной очистки гибридного полипептида His8-TrxL-Pis s 3 на металлохелатном носителе, расщепления гибридного белка по сайту, расположенному между последовательностями Pis s 3 и тиоредоксина А, и очистки целевого белка Pis s 3 с помощью обращенно-фазовой ВЭЖХ.

Для получения гетерологичных рекомбинантных белков с клонированной эукариотической кДНК зачастую используются прокариотические системы экспрессии. Однако в некоторых случаях эукариотические белки, синтезированные в бактериях, оказываются неаутентичными и биологически неактивными. Неспособность прокариот синтезировать аутентичные варианты белков обусловлена, в основном, отсутствием у них адекватных механизмов внесения специфических посттрансляционных модификаций. Однако, несмотря на их значительные недостатки, прокариотические системы находят самое широкое применение, поскольку себестоимость полученных в этих системах рекомбинантных белков ниже, а производительность штаммов-продуцентов выше. Получение рекомбинантных аллергенов класса липид-транспортирующих белков, полностью идентичных природным, в бактериях является вполне осуществимой задачей, поскольку структура большинства из них не требует осуществления посттрансляционных модификаций, кроме замыкания дисульфидных связей.

Предложенная плазмида наряду с геном гибридного белка TrxL содержит маркерный ген устойчивости к ампициллину bla, а также ген-регулятор lad, кодирующий белок-репрессор. Наличие гена lad в структуре плазмиды является одним из факторов, обеспечивающих подавление базальной экспрессии гена гибридного белка, находящегося под контролем промотора бактериофага Т7. Ввиду чрезвычайно высокой активности Т7 РНК-полимеразы даже сравнительно невысокий уровень «протечки» данного промотора может отрицательно сказаться на жизнеспособности клеток штамма-продуцента, поскольку промежуточные и конечные продукты экспрессии часто обладают цитотоксическим действием [Marley J., Lu М., Bracken С. A method for efficient isotopic labeling of recombinant proteins // Journal of Biomolecular NMR. - 2001. - Vol. 20. - PP. 71-75]. В отсутствие индуктора белок-репрессор, синтезирующийся конститутивно, связывается с lac-оператором, тем самым препятствуя взаимодействию РНК-полимеразы с Т7-промотором, что приводит к резкому снижению уровня транскрипции клонированного гена. При добавлении индуктора сайт связывания Т7 РНК-полимеразы освобождается и начинается синтез матричной РНК. Ген Т7 РНК-полимеразы встроен в бактериальную хромосому штамма Е. coli BL21(DE3)Star и контролируется промотором lacUV5. Индукция экспрессии подобного лактозного оперона проводится с помощью β-галактозидов, которые при связывании с одной из субъединиц репрессора блокируют его связывание с оператором. Наиболее часто используемым индуктором экспрессии является изопропилтио-β-D-галактопиранозид (IPTG) - синтетический аналог природного индуктора алло-лактозы. Наличие атома серы в IPTG предотвращает разложение индуктора, таким образом, предлагаемый индуктор характеризуется необратимостью действия.

Конструирование предложенного плазмидного вектора pET-pPsLTP, экспрессирующего ген гибридного белка His8-TrxL-Pis s 3, содержащий аминокислотную последовательность целевого аллергенного белка Pis s 3, может быть осуществлено путем лигирования фрагмента плазмиды, содержащего область инициации репликации и маркерный ген, со вставкой, кодирующей ген гибридного белка. В свою очередь, искусственный ген, который кодирует гибридный белок His8-TrxL-Pis s 3, может быть получен химическим синтезом набора олигонуклеотидных фрагментов с последующей сборкой и амплификацией промежуточных и конечного продуктов при помощи полимеразной цепной реакции (ПЦР). Матрицей для амплификации последовательности тиоредоксина может служить бактериальный геном либо плазмида рЕТ-32а(+). Продуктами лигазной реакции трансформируют компетентные клетки Е. coli штамма с выключенной системой рекомбинации и рестрикции ДНК, например DH10B.

В качестве белка-партнера предлагаемая конструкция содержит тиоредоксин А Escherichia coli, который обеспечивает экспрессию гибридного белка преимущественно в растворимой (нативной) форме. Кроме того, сам тиоредоксин А является природным компонентом цитоплазмы Е. coli и в высоких концентрациях не оказывает токсического действия на бактериальные клетки. Гибридные белки, содержащие тиоредоксин А, очень часто характеризуются теми же свойствами. С целью дальнейшего высвобождения целевого белка Pis s 3 из молекулы гибридного белка His8-TrxL-Pis s 3 между последовательностями Pis s 3 и тиоредоксина вводят, как минимум, один сайт, позволяющий проводить избирательное расщепление гибридного полипептида химическим или ферментативным способом.

Наличие N-концевой октагистидиновой последовательности в составе гибридного белка, кодируемого предложенной плазмидой, обеспечивает возможность проведения аффинной очистки. Данный метод очистки белков основан на способности аминокислот (в основном, остатков гистидина) образовывать мультидентатные комплексы с катионами переходных металлов (Со2+, Ni2+, Cu2+, Zn2+), фиксированными в виде хелатов на нерастворимой матрице, представляющей собой поперечносшитую агарозу, и содержащую такие хелатирующие группы, как иминодиацетат (IDA), нитрилотриацетат (NTA) или карбоксиметиласпартат (СМА, TALON). Сила связывания между белком и ионами металла зависит от некоторых факторов, включая длину и положение аффинной метки в белке, тип используемых ионов металла и рН буфера. Элюцию гибридного белка проводят путем подкисления буфера до рН 4,5-5,5 (при этом остатки гистидина, рКа которых составляет около 6,0, переходят в протонированную форму), пропускания через колонку градиента имидазола, который конкурирует с гистидином за связывание с ионами металлов либо хелатированием ионов металла с помощью ЭДТА.

В случае использования химического метода расщепления гибридного белка His8-TrxL-Pis s 3 бромцианом наиболее целесообразным является использование в качестве белка-партнера для гетерологичной экспрессии модифицированного тиоредоксина А, содержащего замену внутреннего остатка метионина на остаток другой аминокислоты, такой как, например, лейцин (Met37Leu). Известно, что подобное незначительное изменение первичной структуры не оказывает влияния на пространственную структуру и свойства тиоредоксина [Rudresh et al. Structural consequences of replacement of an alpha-helical Pro residue in Escherichia coli thioredoxin // Protein Eng. - 2002. - Vol. 15(8). - PP. 627-633]. Реакцию с бромцианом проводят в стандартных условиях: растворяют белок в 60-90% трифторуксусной кислоте с добавлением 0,1 М соляной кислоты, вносят бромциан в 10-200-кратном стехиометрическом избытке по отношению к числу остатков метионина в образце, инкубируют в темноте в течение 16-20 ч.

После этого проводят очистку продуктов реакции расщепления гибридного белка с помощью повторной металлохелатной хроматографии, разделяя таким образом целевой белок, белок-носитель и нерасщепленный гибридный белок. Целевой полипептид очищают методом высокоэффективной жидкостной хроматографии в системе растворителей ацетонитрил:вода с добавлением 0,1% ТФУ.

Гомогенность полученного аллергена Pis s 3 и его идентичность природному белку устанавливают методами SDS-электрофореза в ПААГ, MALDI-TOF масс-спектрометрии, микросеквенированием N-концевой аминокислотной последовательности по методу Эдмана, КД-спектроскопии, тестированием иммуноглобулин-связывающих свойств.

Изобретение иллюстрируют следующие чертежи:

На фиг. 1 отображена физическая карта рекомбинантной плазмиды pET-pPsLTP: pBR322 origin - участок инициации репликации плазмиды; blа - ген устойчивости к β-лактамным антибиотикам; lad - ген lac-репрессора; Т7 promoter - промотор транскрипции; Т7 terminator - терминатор транскрипции; lac operator - сайт связывания lac-репрессора; RBS - сайт связывания рибосомы; His8-TrxL-Pis s 3 - последовательность, кодирующая гибридный белок, включающий участок из восьми остатков гистидина (His8), модифицированный (Met37Leu) тиоредоксин A (TrxL) и модифицированный (Metl lLeu) аллерген Pis s 3.

Фиг. 2 отражает контроль экспрессии (А), очистки (Б) и расщепления (В) гибридного белка His8-TrxL-Pis s 3: смесь белков-стандартов молекулярных масс (М); суммарный клеточный лизат до индукции (1); суммарный клеточный лизат после индукции (2,3) в отсутствие и в присутствии 2-меркаптоэтанола; растворимая (4) и нерастворимая (5) фракции клеточного белка; проскок с металлохелатной колонки (6); элюат (7), диализат (8) и продукты расщепления гибридного белка бромцианом (9) соответственно.

На фиг. 3 изображены: хроматограмма повторной ОФ-ВЭЖХ очистки на колонке Luna С18 (Phenomenex) (A); MALDI-TOF масс-спектрометрия фракции 1, содержащей рекомбинантный Pis s 3 (Б); КД-спектры природного и полученного в соответствии с предложенной схемой рекомбинантного Pis s 3 (В).

На фиг. 4 изображена электрофореграмма (А) и иммунохимический анализ (Б) рекомбинантных аллергенов. Детекцию проводили, используя поликлональные кроличьи антитела к Len с 3: 1,2,3 - рекомбинантные Len с 3, Pru р 3 и Pis s 3 в присутствии 2-меркаптоэтанола, соответственно; 4 - суммарный экстракт гороха в присутствии 2-меркаптоэтанола.

Фиг. 5 отражает результаты твердофазного иммуноферментного анализа с использованием поликлональных кроличьих антител к Len с 3 (А), а также ингибирование рекомбинантным Pis s 3 и аллергеном Pru р 3 связывания аллергена чечевицы с кроличьими антителами к Len с 3 (Б).

Изобретение иллюстрируют примеры.

Пример 1.

Конструирование плазмидного вектора pET-pPsLTP.

Нуклеотидную последовательность (SEQ ID No. 2, нуклеотиды 12-797), содержащую промотор транскрипции Т7 РНК-полимеразы, lac-оператор, участок связывания рибосомы и участок, кодирующий гибридный полипептид, содержащий последовательно расположенные гистидиновый октамер, тиоредоксин с заменой Met37Leu, сайт расщепления бромцианом и Pis s 3, получают химико-ферментативным синтезом с помощью полимеразной цепной реакции (ПНР). Олигонуклеотиды, используемые в ПЦР, синтезируют твердофазным фосфоамидитным методом с наращиванием олигонуклеотидной цепи в направлении от 3'-конца к 5'-концу с помощью защищенных фосфамидитов - 5'-диметокситритил-N-ацил-2'-дезоксинуклеозид-3'-О-(β-цианэтилдиизопропиламино)-фосфитов, активированных тетразолом. Фрагмент, кодирующий белок-носитель тиоредоксин (Met37Leu) получают методом ПЦР-амплификации и направленного мутагенеза с помощью ген-специфических праймеров, используя в качестве исходной матрицы плазмиду рЕТ32а(+), содержащую ген тиоредоксина. Остальные участки последовательности pET-pPsLTP получают путем последовательного отжига и элонгации взаимно перекрывающихся олигонуклеотидов, а также отжига, элонгации и амплификации промежуточных продуктов синтеза.

Фрагмент, кодирующий зрелый Pis s 3, получают методом ПЦР-амплификации, сопряженной с обратной транскрипцией. Для получения данного фрагмента из проращенных семян гороха Pisum sativum выделяют суммарную РНК, проводят реакцию обратной транскрипции с олиго-dT праймером, после чего проводят ПЦР с прямым мутагенизирующим (Met11 Leu)(GCGGGATCCATGGCTTTGTCTTGTGGAACTGTATCCGCTGATTTGGCTCCATGCGTT АС) и обратным (GCGGAATTCTCAAAACCTAACAGTGTTACAGTTGG) праймерами, несущими на 5'-концах сайты узнавания рестриктаз EcoRI и BamHI. С целью предотвращения расщепления целевого аллергена Pis s 3 во время реакции фрагментации полипептидной цепи гибридного белка бромцианом, единственный остаток метионина в составе целевого белка заменяют на лейцин (Met11Leu). На завершающей стадии синтеза последовательность, содержащую данный фрагмент, амплифицируют с помощью праймеров, несущих на 5'-концах сайты узнавания рестриктаз BglII и XhoI. Продукт амплификации гидролизуют указанными рестриктазами, очищают электрофорезом в 1,5% агарозном геле, элюируют набором «Cleanup Mini» (Евроген) и лигируют с фрагментом ДНК размером 5,25 тыс. п. н., полученным в результате обработки плазмиды pET31b(+) рестриктазами BglII и XhoI. В результате лигазной реакции получают кольцевую ковалентно замкнутую ДНК размером 6033 п. н. (фиг. 1).

Продуктами лигазной реакции трансформируют компетентные клетки E.coli DH10B, приготовленные с помощью 0,1 М хлорида кальция. После трансформации суспензию бактерий смешивают с питательной средой LB, растят 1 ч при 37°С и высевают на чашки Петри с LB-агаром, содержащим 100 мкг/мл ампициллина. Отбор клонов, содержащих нужную плазмиду, осуществляют методом «ПЦР с клонов» с использованием праймеров на плазмидный остов и вставку. Отобранные клоны подращивают в жидкой питательной среде и выделяют плазмидную ДНК, которую подтверждают определением нуклеотидной последовательности с помощью секвенирования по Сэнгеру. По данным секвенирования отбирают плазмиду со вставкой, нуклеотидная последовательность которой полностью соответствует SEQ ID No. 2.

Пример 2.

Получение рекомбинантного аллергена гороха Pis s 3.

Трансформацией клеток Е. coli штамма BL21(DE3)Star сконструированной плазмидой получают штамм-продуцент рекомбинантного белка. Клетки штамма-продуцента культивируют в богатой питательной среде LB при температуре 26°С. В качестве индуктора экспрессии используют 0,2 мМ изопропилтио-β-D-галактопиранозид, который добавляют в логарифмической фазе роста клеток. Контроль экспрессии гибридного белка His8-TrxL-Pis s 3 проводят методом SDS-электрофореза в ПААГ (фиг. 2А).

Выделение и очистку гибридного белка, содержащего Pis s 3, проводят с помощью металлохелатной хроматографии на Ni2+-сефарозе, используя растворимую клеточную фракцию (фиг. 2Б). Клеточный осадок, полученный в результате центрифугирования, ресуспендируют в буферном растворе А (50 мМ трис-HCl, 0,5 М NaCl, 20 мМ имидазол, рН 7,8), содержащем ингибитор сериновых протеаз фенилметилсульфонилфторид, и гомогенизируют на льду с помощью ультразвука. Полученный лизат центрифугируют (осветляют) при 25000 g в течение 20 мин. Все работы по получению осветленного лизата проводят при температуре 4°С. Осветленный лизат наносят на колонку и элюируют связавшийся с носителем гибридный белок буфером В (50 мМ трис-HCl, 0,5 М NaCl, 0,5 М имидазол, рН 7,8). Детектирование ведут при длине волны 280 нм. Элюат, содержащий гибридный белок, диализируют относительно подкисленной воды в течение 16 ч через мембрану с размером пор 12 кДа и лиофильно высушивают.

Расщепление гибридного белка проводят бромцианом в кислой среде по пептидной связи, образованной карбоксильной группой остатка метионина (фиг. 2В). Для этого гибридный белок растворяют в 80% (v/v) ТФУ в концентрации 20 мг/мл, добавляют равную массу бромциана и инкубируют в темноте 18 ч при температуре 25°С. Реакцию останавливают добавлением трехкратного объема воды, после чего упаривают образцы на вакуумном концентраторе SpeedVac.

После расщепления продукты реакции разделяют с помощью повторной металлохелатной хроматографии в денатурирующих условиях в системе буферов с 6М гуанидина гидрохлоридом. Дальнейшую очистку рекомбинантного аллергена осуществляют методом ОФ-ВЭЖХ на колонке Reprosil-Pur C18-AQ (Dr. Maisch GmbH). Разделение проводят в линейном градиенте концентрации ацетонитрила от 5 до 80% за 60 мин в присутствии 0,1% ТФУ при скорости потока 2 мл/мин. Финальным этапом очистки является повторная ОФ ВЭЖХ на колонке Luna С18 (Phenomenex) в тех же условиях при скорости потока 0,7 мл/мин (фиг. 3А).

Гомогенность полученного рекомбинантного Pis s 3 и его идентичность природному аллергену подтверждают с помощью методов SDS-электрофореза в ПААГ, MALDI-TOF масс-спектрометрии (фиг. 3Б) и автоматического микросеквенирования по Эдману. Исследование вторичной структуры полученного рекомбинантного белка проводят с помощью метода КД-спектроскопии. Спектр кругового дихроизма рекомбинантного Pis s 3 представляет собой кривую, характерную для белков с высоким содержанием а-спиральной структуры, и идентичен таковой природного аллергена Pis s 3, выделенного из гороха посевного Pisum sativum (фиг. 3В).

Пример 3.

Сравнительный иммунохимический анализ с анти-Len с 3 антителами кролика методом иммуноблоттинга.

Проведение сравнительного исследования иммунологических свойств рекомбинантных аллергенов Pis s 3, Len с 3 и Pru р 3 с кроличьими анти-Len с 3 антителами осуществляют методом иммуноблоттинга. После проведения SDS-электрофореза в 15% ПААГ (фиг. 4А) осуществляют электроперенос рекомбинантных аллергенов и белков суммарного экстракта семян гороха на нитроцеллюлозную мембрану в течение 50 мин в буфере, содержащем 25 мМ NaHCO3, 20% метанола и 0,1% SDS. Свободные сайты связывания предварительно блокируют, инкубируя мембрану при комнатной температуре в течение 1 ч в 1% растворе обезжиренного сухого молока в буфере, содержащем 20 мМ Трис-HCl, 150 мМ NaCl, рН 7,4 (TBS). После трехкратного промывания мембраны тем же буфером, содержащим 0,05% твин 20 (TBS-T), ее инкубируют при комнатной температуре в течение 2 ч в растворе кроличьих анти-Len с 3 антител в 1% молоке/TBS (разведение 1:200). Далее мембрану снова промывают три раза буфером TBS-T, после чего инкубируют ее при комнатной температуре в растворе конъюгированных с пероксидазой хрена козьих антивидовых антител к IgG кролика в 1%-м молоке/TBS. Отмытую буфером TBS-T мембрану обрабатывают раствором 3,3',5,5'-тетраметилбензидина (ТМВ). Ферментативную реакцию останавливают, промывая мембрану водой для удаления остатков субстрата. По результатам иммуноблоттинга поликлональные кроличьи анти-Len с 3 антитела связываются со всеми тремя рекомбинантными аллергенами, а также с природным Pis s 3 из суммарного экстракта гороха (фиг. 4Б).

Пример 4.

Твердофазный иммуноферментный анализ с анти-Len с 3 антителами кролика.

Сорбцию белков-антигенов (0,5 мкг) в ячейках полистеренового 96-луночного планшета производят в буфере TBS в течение 1 ч при температуре 37°С. После трехкратной промывки лунок планшета буфером TBS, содержащим 0,05% твин 20 (TBS-Т), свободные сайты связывания в лунках планшета блокируют путем инкубации в термостатируемом шейкере ST-3 (ELMI) в течение 1 ч при температуре 37°С с 1% раствором BSA в буфере TBS. Далее в лунки планшета вносят раствор кроличьих анти-Len с 3 антител в TBS (разведение 1:8000) и проводят инкубацию в течение 1 ч при температуре 37°С. После пятикратной промывки буфером TBS-T в лунки вносят раствор конъюгированных с пероксидазой хрена козьих антивидовых антител к IgG кролика и инкубируют планшет при температуре 37°С в течение 1 ч. После пятикратной промывки буфером TBS-T в лунки вносят раствор ТМВ для ИФА. Ферментативную реакцию останавливают через 30 мин добавлением 4 н. H2SO4 и проводят анализ полученных данных, измеряя оптическую плотность в лунках при 450 нм при помощи планшетного фотометра Multiscan EX (Thermo). На основании результатов твердофазного иммуноферментного анализа можно сделать вывод, что анти-Len с 3 антитела взаимодействуют со всеми исследуемыми антигенами (фиг. 5А).

Ингибирование связывания анти-Len с 3 антител с Len с 3 проводят по вышеописанной методике с небольшими модификациями. В лунки планшета вносят раствор Len с 3, а анти-Len с 3 антитела в разведении 1:16000 предварительно инкубируют с аллергенами Pis s 3, Pru р 3 и Len с 3 в концентрациях 0,02-200 мкг/мл в течение 3 ч при температуре 37°С. Остальные этапы осуществляют по описанной выше методике (фиг. 5Б).

SEQUENCE LISTING

<110> ИБХ РАН

Богданов, Иван

Баландин, Сергей

Овчинникова, Татьяна

<120> ПЛАЗМИДНЫЙ ВЕКТОР pET-pPsLTP, ШТАММ БАКТЕРИИ Escherichia coli

BL21(DE3)Star/pET-pPsLTP - ПРОДУЦЕНТ ПИЩЕВОГО АЛЛЕРГЕНА ГОРОХА

Pis s 3 И СПОСОБ ПОЛУЧЕНИЯ УКАЗАННОГО АЛЛЕРГЕНА

<130> (Reference Number)

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 95

<212> PRT

<213> Pisum sativum

<400> 1

<210> 2

<211> 6033

<212> DNA

<213> Artificial Sequence

<220>

<223> plasmid vector

<400> 2

gtagaggatc gagatctgcg ggatctcgat cccgcgaaat taatacgact cactataggg 60

gaattgtgag cggataacaa ttcccctcta gagtcgacgg atcttacttt aagaaggaga 120

tatacatatg agccatcacc accaccatca ccatcacgga tctagcgata aaattattca 180

cctgactgac gacagttttg acacggatgt actcaaagcg gacggggcga tcctcgtcga 240

tttctgggca gagtggtgcg gtccgtgcaa actgatcgcc ccgattctgg atgaaatcgc 300

tgacgaatat cagggcaaac tgaccgttgc aaaactgaac atcgatcaaa accctggcac 360

tgcgccgaaa tatggcatcc gtggtatccc gactctgctg ctgttcaaaa acggtgaagt 420

ggcggcaacc aaagtgggtg cactgtctaa aggtcagttg aaagagttcc tcgacgctaa 480

cctggccgga tccatggctt tgtcttgtgg aactgtatcc gctgatttgg ctccatgcgt 540

tacttatctt caagctccta ataatgccag tcctccaccg ccatgctgtg caggagtgaa 600

gaagcttctt gctgccgcca ccaccacgcc ggatcgtcag gctgcctgta actgcttgaa 660

atcagctgcc ggttctattc ctaaattgaa tactaacaat gctgctgctc tccctggcaa 720

atgcggtgtt agcatccctt acaagatcag tacctccacc aactgtaaca ctgttaggtt 780

ttgagaattc tctcgagcac caccaccacc accactgaga tccggctgct aacaaagccc 840

gaaaggaagc tgagttggct gctgccaccg ctgagcaata actagcataa ccccttgggg 900

cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg aactatatcc ggattggcga 960

atgggacgcg ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt 1020

gaccgctaca cttgccagcg ccctagcgcc cgctcctttc gctttcttcc cttcctttct 1080

cgccacgttc gccggctttc cccgtcaagc tctaaatcgg gggctccctt tagggttccg 1140

atttagtgct ttacggcacc tcgaccccaa aaaacttgat tagggtgatg gttcacgtag 1200

tgggccatcg ccctgataga cggtttttcg ccctttgacg ttggagtcca cgttctttaa 1260

tagtggactc ttgttccaaa ctggaacaac actcaaccct atctcggtct attcttttga 1320

tttataaggg attttgccga tttcggccta ttggttaaaa aatgagctga tttaacaaaa 1380

atttaacgcg aattttaaca aaatattaac gtttacaatt tcaggtggca cttttcgggg 1440

aaatgtgcgc ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct 1500

catgagacaa taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat 1560

tcaacatttc cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc 1620

tcacccagaa acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg 1680

ttacatcgaa ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg 1740

ttttccaatg atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga 1800

cgccgggcaa gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta 1860

ctcaccagtc acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc 1920

tgccataacc atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc 1980

gaaggagcta accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg 2040

ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgcagc 2100

aatggcaaca acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca 2160

acaattaata gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct 2220

tccggctggc tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat 2280

cattgcagca ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg 2340

gagtcaggca actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat 2400

taagcattgg taactgtcag accaagttta ctcatatata ctttagattg atttaaaact 2460

tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat 2520

cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc 2580

ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct 2640

accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg 2700

cttcagcaga gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca 2760

cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagctgc 2820

cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac cggataaggc 2880

gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc gaacgaccta 2940

caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc ccgaagggag 3000

aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca cgagggagct 3060

tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc tctgacttga 3120

gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc 3180

ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct ttcctgcgtt 3240

atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata ccgctcgccg 3300

cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc gcctgatgcg 3360

gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atatatggtg cactctcagt 3420

acaatctgct ctgatgccgc atagttaagc cagtatacac tccgctatcg ctacgtgact 3480

gggtcatggc tgcgccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc 3540

tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga 3600

ggttttcacc gtcatcaccg aaacgcgcga ggcagctgcg gtaaagctca tcagcgtggt 3660

cgtgaagcga ttcacagatg tctgcctgtt catccgcgtc cagctcgttg agtttctcca 3720

gaagcgttaa tgtctggctt ctgataaagc gggccatgtt aagggcggtt ttttcctgtt 3780

tggtcactga tgcctccgtg taagggggat ttctgttcat gggggtaatg ataccgatga 3840

aacgagagag gatgctcacg atacgggtta ctgatgatga acatgcccgg ttactggaac 3900

gttgtgaggg taaacaactg gcggtatgga tgcggcggga ccagagaaaa atcactcagg 3960

gtcaatgcca gcgcttcgtt aatacagatg taggtgttcc acagggtagc cagcagcatc 4020

ctgcgatgca gatccggaac ataatggtgc agggcgctga cttccgcgtt tccagacttt 4080

acgaaacacg gaaaccgaag accattcatg ttgttgctca ggtcgcagac gttttgcagc 4140

agcagtcgct tcacgttcgc tcgcgtatcg gtgattcatt ctgctaacca gtaaggcaac 4200

cccgccagcc tagccgggtc ctcaacgaca ggagcacgat catgcgcacc cgtggggccg 4260

ccatgccggc gataatggcc tgcttctcgc cgaaacgttt ggtggcggga ccagtgacga 4320

aggcttgagc gagggcgtgc aagattccga ataccgcaag cgacaggccg atcatcgtcg 4380

cgctccagcg aaagcggtcc tcgccgaaaa tgacccagag cgctgccggc acctgtccta 4440

cgagttgcat gataaagaag acagtcataa gtgcggcgac gatagtcatg ccccgcgccc 4500

accggaagga gctgactggg ttgaaggctc tcaagggcat cggtcgagat cccggtgcct 4560

aatgagtgag ctaacttaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa 4620

acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta 4680

ttgggcgcca gggtggtttt tcttttcacc agtgagacgg gcaacagctg attgcccttc 4740

accgcctggc cctgagagag ttgcagcaag cggtccacgc tggtttgccc cagcaggcga 4800

aaatcctgtt tgatggtggt taacggcggg atataacatg agctgtcttc ggtatcgtcg 4860

tatcccacta ccgagatatc cgcaccaacg cgcagcccgg actcggtaat ggcgcgcatt 4920

gcgcccagcg ccatctgatc gttggcaacc agcatcgcag tgggaacgat gccctcattc 4980

agcatttgca tggtttgttg aaaaccggac atggcactcc agtcgccttc ccgttccgct 5040

atcggctgaa tttgattgcg agtgagatat ttatgccagc cagccagacg cagacgcgcc 5100

gagacagaac ttaatgggcc cgctaacagc gcgatttgct ggtgacccaa tgcgaccaga 5160

tgctccacgc ccagtcgcgt accgtcttca tgggagaaaa taatactgtt gatgggtgtc 5220

tggtcagaga catcaagaaa taacgccgga acattagtgc aggcagcttc cacagcaatg 5280

gcatcctggt catccagcgg atagttaatg atcagcccac tgacgcgttg cgcgagaaga 5340

ttgtgcaccg ccgctttaca ggcttcgacg ccgcttcgtt ctaccatcga caccaccacg 5400

ctggcaccca gttgatcggc gcgagattta atcgccgcga caatttgcga cggcgcgtgc 5460

agggccagac tggaggtggc aacgccaatc agcaacgact gtttgcccgc cagttgttgt 5520

gccacgcggt tgggaatgta attcagctcc gccatcgccg cttccacttt ttcccgcgtt 5580

ttcgcagaaa cgtggctggc ctggttcacc acgcgggaaa cggtctgata agagacaccg 5640

gcatactctg cgacatcgta taacgttact ggtttcacat tcaccaccct gaattgactc 5700

tcttccgggc gctatcatgc cataccgcga aaggttttgc gccattcgat ggtgtccggg 5760

atctcgacgc tctcccttat gcgactcctg cattaggaag cagcccagta gtaggttgag 5820

gccgttgagc accgccgccg caaggaatgg tgcatgcaag gagatggcgc ccaacagtcc 5880

cccggccacg gggcctgcca ccatacccac gccgaaacaa gcgctcatga gcccgaagtg 5940

gcgagcccga tcttccccat cggtgatgtc ggcgatatag gcgccagcaa ccgcacctgt 6000

ggcgccggtg atgccggcca cgatgcgtcc ggc 6033

1. Плазмидный вектор pET-pPsLTP, несущий нуклеотидную последовательность SEQ ID No. 2 для экспрессии в клетках Escherichia coli пищевого аллергена гороха посевного Pis s 3, имеющего аминокислотную последовательность SEQ ID NO: 1, в составе гибридного белка His8-TrxL-Pis s 3, и состоящий из двух фрагментов ДНК:

- BglII/XhoI-фрагмента, содержащего промотор транскрипции Т7 РНК-полимеразы, lac-оператор, участок связывания рибосомы и участок, кодирующий аффинную метку, белок тиоредоксин и аллерген Pis s 3;

- BglII/XhoI-фрагмента плазмиды pET31b(+), содержащего терминатор транскрипции Т7 РНК-полимеразы, сайт инициации репликации, ген β-лактамазы и ген lac-репрессора (lacI).

2. Штамм бактерии Escherichia coli BL21(DE3)Star/pET-pPsLTP - продуцент гибридного белка His8-TrxL-Pis s 3, получаемый путем трансформации клеток родительского штамма BL21(DE3)Star плазмидным вектором pET-pPsLTP по п.1.

3. Способ получения пищевого аллергена Pis s 3, включающий экспрессию гена гибридного белка His8-TrxL-Pis s 3 в штамме-продуценте Escherichia coli BL21(DE3)Star/pET-pPsLTP по п.2, лизис клеток, аффинную очистку гибридного белка His8-TrxL-Pis s 3 на металлохелатном носителе, расщепление гибридного белка His8-TrxL-Pis s 3 бромцианом по остатку метионина, введенному между последовательностями аллергена Pis s 3 и тиоредоксина А, повторную металлохелатную очистку и очистку целевого пептида с помощью обращенно-фазовой ВЭЖХ.



 

Похожие патенты:

Изобретение относится к микробиологии. Штамм бактерий Rhodococcus jialingiae Б-М-1 обладает способностью утилизировать газовый конденсат, бензин, нефть, мазут в течение короткого промежутка времени.

Группа изобретений относится к биотехнологии. Предложены способ получения препарата внеклеточного метаболита пробиотического бактериального штамма Bacillus coagulans MTCC 5856, способы контроля роста и жизнеспособности микробных патогенов, способ ингибирования образования микробной биопленки, а также способ предупреждения дальнейшего накопления биопленки Streptococcus mutans и обусловленного этим снижения рН.

Изобретение относится к области биотехнологии. Предложен способ выделения липидов для биодизеля из биомассы микроводоросли рода Chlorella.
Изобретение относится к биотехнологии. Препарат для очистки почв и воды от нефти и нефтепродуктов содержит нефть, биомассу штамма углеводородокисляющих бактерий Bacillus subtilis СНБС- 1, депонированного во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-12239, связующий компонент, в качестве которого используют натрийкарбоксиметилцеллюлозу и органоминеральный субстрат-носитель - композиционную смесь на основе клиноптилолита, подготовленных древесных опилок и перегноя в заданном соотношении компонентов.

Изобретение относится к области микробиологии. Штамм бактерий Bacillus subtilis СНБС-1 обладает высокой утилизирующей способностью по отношению как к нефти, так и к нефтепродуктам в относительно короткие сроки (от 3 до 45 суток), в широком диапазоне температур от +5 до +40°С.

Изобретение относится к микробиологии. Штамм бактерий Stenotrophomonas maltophilia СНБС-3 обладает способностью быстро утилизировать нефть и нефтепродукты (дизельное топливо, масло моторное, масло гидравлическое, газовый конденсат) в широком диапазоне температур от +5 до +37°С.

Изобретение относится к биотехнологии. Способ очистки почв и водной среды от нефти и нефтепродуктов предусматривает внесение бактериального препарата, состоящего из клеток штамма Stenotrophomonas maltophilia СНБС-3, депонированного во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-12247 в концентрации 1·109 клеток/см3 суспензии в загрязненную почву или водную среду.

Группа изобретений относится к биотехнологии и фармакологии и касается штаммов Lactobacillus brevis 47f, Lactobacillus rhamnosus 313, Lactobacillus rhamnosus 40f и Lactobacillus brevis 15f, способных синтезировать антиоксидант глутатион.

Изобретение относится к области биотехнологии, может быть использовано для получения альфа-фетопротеина (АФП) человека с использованием штаммов дрожжей Saccharomyces cerevisiae, содержащих рекомбинантный ген АФП.

Изобретение относится к биотехнологии и может быть использовано как основа биопрепарата для ремедиации грунтов и вод, в том числе засоленных, в регионах с жарким климатом.

Группа изобретений относится к биотехнологии и фармакологии и касается штаммов Lactobacillus brevis 47f, Lactobacillus rhamnosus 313, Lactobacillus rhamnosus 40f и Lactobacillus brevis 15f, способных синтезировать антиоксидант глутатион.

Изобретение относится к области биотехнологии, может быть использовано для получения альфа-фетопротеина (АФП) человека с использованием штаммов дрожжей Saccharomyces cerevisiae, содержащих рекомбинантный ген АФП.

Изобретения касаются способа снижения гетерогенности заряда целевого антитела, способа выработки целевого антитела со сниженной гетерогенностью заряда и способов приготовления лекарственного препарата для лечения злокачественных новообразований, содержащего антитело против глипикана 3 или антитело против IL-31RA.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению белков в клетках млекопитающих, и может быть использовано для получения интерлейкина-7 человека в клетках яичников китайского хомячка CHO.

Изобретение относится к генной инженерии и может быть использовано для получения зрелого аполипопротеина A-I человека. Для увеличения выхода зрелого аполипопротеина A-I человека его получают путем ферментативного гидролиза SUMO-специфичной протеазой SP2 рекомбинантного химерного белка SUMO3-апоА-I, синтезированного штаммом дрожжей Pichia pastoris.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных молекул МНС II класса, и может быть использовано в медицине. Рекомбинантная молекула МНС II класса включает: (i) весь или часть внеклеточного участка α-цепи МНС II класса; (ii) весь или часть внеклеточного участка β-цепи МНС II класса; при этом (i) и (ii) обеспечивают функциональный пептид-связующий домен и при этом (i) и (ii) соединены дисульфидной связью между остатками цистеина, расположенными на α2 домене указанной α-цепи и β2 домене указанной β-цепи, при этом указанные остатки цистеина не присутствуют в нативных доменах α2 и β2 МНС II класса и полученная рекомбинантная молекула не включает мотив лейциновой молнии.

Изобретение относится к области биотехнологии, конкретно к способам активации NKT-клеток млекопитающих, и может быть использовано в медицине. Способ включает введение в пептид или полипептид, которые не активируют NKT-клетки, по меньшей мере, одного CD1d-связывающего мотива путем введения, замены и/или делеции аминокислоты, где CD1d-связывающий мотив представляет собой [FWTHY]-X2X3-[ILMV]-X5X6-[FWTHY], где Х2, Х3, Х5 и Х6 обозначают любую аминокислоту.

Изобретение относится к биохимии. Описан способ получения интересующего белка, включающий введение по меньшей мере одного экспрессионного вектора, который содержит генный фрагмент, содержащий ДНК, кодирующую интересующий белок, и также пару транспозонных последовательностей Tol1 или Tol2 на обоих концах генного фрагмента, в суспензионную клетку млекопитающего СНО и суспензионное культивирование клетки млекопитающего, где суспензионная клетка млекопитающего представляет собой суспензионную клетку СНО, которая способна выживать и пролиферировать в бессывороточной среде.

Изобретение относится к области биотехнологии, конкретно к подавлению нежелательных иммунных ответов млекопитающих, и может быть использовано в медицине. Способ заключается в (a) установлении, по меньшей мере, одного CD1d-связывающего мотива NKT-клеточного эпитопа в пептиде или полипептиде, при этом указанный эпитоп содержит мотив [FWTHY]-X2X3-[ILMV]-X5X6-[FWTHY], где Х2, Х3, Х5, Х6 означает любую аминокислоту, (b) устранении указанного эпитопа путем замены аминокислотных остатков в положении Р1 и/или Р7 на негидрофобные остатки; и (c) получении изолированного пептида или полипептида с пониженной способностью активировать NKT-клетки в млекопитающем.

Представленная группа изобретений касается способа получения антигенной композиции, содержащей цирковирус свиней типа 2 (PCV-2), антигенной композиции, иммуногенной композиции, способа уменьшения симптомов вызываемой PCV-2 инфекции у животного и способа повышения иммуногенности иммуногенной композиции.

Изобретение относится к области биотехнологии, в частности к рекомбинантной продукции белков человека, и может быть использовано для получения белка SLURP-2 человека.
Наверх