Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения



Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения
Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, которая кодирует укороченный белок олеат-десатуразы, белки, способы и применения

 


Владельцы патента RU 2630641:

ЭДВАНТА ИНТЕРНЭШНЛ БВ (NL)

Изобретение относится к области биохимии, в частности к выделенной нуклеотидной последовательности, включающей преждевременный стоп-кодон и кодирующей укороченный белок олеат-десатуразы подсолнечника, а также к растению и семени подсолнечника, ее содержащим. Также раскрыт укороченный белок олеат-десатуразы подсолнечника, который имеет сниженную ферментную активность по сравнению с ферментной активностью белка олеат-десатуразы подсолнечника дикого типа. Изобретение также относится к способу получения растения подсолнечника, способного производить семя с содержанием олеиновой кислоты от 87,5 до 93,3% по отношению к суммарному процентному содержанию жирных кислот в семени, а также к способу получения масла, имеющего содержание олеиновой кислоты от 87,5 до 93,3% по отношению к суммарному процентному содержанию жирных кислот в масле. Изобретение позволяет эффективно получать семя с содержанием олеиновой кислоты от 87,5 до 93,3% по отношению к суммарному процентному содержанию жирных кислот в семени. 7 н. и 10 з.п. ф-лы, 1 ил., 3 табл., 3 пр.

 

Настоящее изобретение относится к выделенным нуклеотидным последовательностям, которые кодируют мутантный белок олеат-десатуразы подсолнечника, к мутантному белку, к растениям, вырабатывающим белок, к семенам и маслам, вырабатываемым растением, к способам получения мутантных последовательностей и к применениям белка и растения.

УРОВЕНЬ ТЕХНИКИ

Кислый фермент олеат-десатуразы (OLD) вовлечен в ферментативное превращение олеиновой кислоты в линолевую кислоту. Микросомный OLD клонировали и охарактеризовывали с использованием маркерной технологии с помощью T-ДНК (T-DNA tagging, Okuley, et al. (1994) Plant Cell 6:147-158). Нуклеотидные последовательности высших растений, кодирующие микросомный OLD, были описаны в документе WO94/11516 PCT Lightner et al.

Подсолнечник, как правило, культивируется для получения насыщенных жирных кислот (пальмитиновой и стеариновой) и ненасыщенных жирных кислот (олеиновой и линолевой). Содержание стеариновой кислоты всегда ниже чем 10% (Guston et al. (1986) The lipid handbook, Chapman and Hall Great Britain), обычно от 3 до 7%. Что касается содержания ненасыщенных жирных кислот, то существует два типа семян подсолнечника: обыкновенный подсолнечник, который имеет содержание линолевой кислоты от 50% до 70% (Knowles (1988) Recent advances in oil crops breeding, AOCS Proceedings), и подсолнечник с высоким содержанием олеиновой кислоты, который имеет содержание линолевой кислоты 2-10% и олеиновой кислоты от 75% до 90% (Soldatov (1976) Chemical mutagenesis in sunflower breeding, Proceedings of the 7th International Sunflower Conference, 352-357). Также существует линия подсолнечника, которая имеет высокое содержание пальмитиновой кислоты от 22 до 40% (Ivanov et al. (1988) Sunflower Breeding for High Palmitic Acid Content in the Oil, Proceedings of the 12th Interntional Sunflower Conference, Vol II, 453-465), и другая линия подсолнечника с низким содержанием насыщенных жирных кислот (менее чем 6%) (EP-A-0496504).

С целью реагирования на потребности в интересующих растительных маслах как для промышленности, так и для пищевого потребления человеком, были предприняты усилия по улучшению сортов семян масличных культур, сфокусированные на модификации жирнокислотного состава семян, например, посредством стандартных программ скрещивания, мутагенеза или трансгеноза.

Мутации, как правило, индуцируются с помощью очень высоких доз радиации или химического мутагенеза (Gaul (1964) Radiation Botany 4:155-232). Высокие дозы, превышающие летальную дозу 50% (LD50), и, как правило, летальные дозы 90% (LD90) максимизируют процентное содержание возможных мутаций.

Мутагенез, проведенный Солдатовым в 1976 в популяции подсолнечника, позволил получить популяцию так называемых мутантов "Первенец". Среднее содержание олеиновой жирной кислоты (18:1) семян данного сорта составляет выше, чем 65%, индивидуальное содержание составляет от 60 до 80%, в то время как в обыкновенных сортах (низкое содержание олеиновой кислоты, LO) это содержание составляет приблизительно 20%. Популяция "Первенец" распространена по всему миру и используется во многих программах скрещивания с целью превращения определенных генотипов с низким содержанием 18:1 в генотипы с высоким содержанием 18:1 в их семенах.

Аккумуляция 18:1 в семенах зависит от двух ферментных реакций: десатурация 18:0 (стеариновая кислота) до 18:1 и последующая десатурация 18:1 до 18:2 (линолевая кислота). Фермент олеат-десатураза (OLD) катализирует десатурацию 18:1 до 18:2 (Ohlrogge and Browse (1995) The Plant Cell, 7:957-970, Somerville and Browse (1996) Trends Cell Biol 6:148-153; Schwartzbeck (2001) Phytochemistry, 57:643-652).

Подсолнечное масло по своей природе богато 18:2 (55-70%) и соответственно бедно 18:1 (20-25%). Традиционные сорта классифицируются как имеющие низкое содержание олеиновой кислоты (низкомасличные, LO). Поскольку существует высокий запрос среди потребителей на получение более здоровой пищи в виде масел с высоким содержанием олеиновой кислоты, то также существует запрос на разработку растений подсолнечника с высоким содержанием олеиновой кислоты, которые предпочтительно приводят к получению культур с таким же высоким выходом, как и у обыкновенных сортов подсолнечника.

Исследования, проводимые Garces et al. в 1989 и 1991 (Garces et al. (1989) Phytochemistry 28:2597-2600; Garces and Mancha (1991) Phytochemistry 30:2127-2130), продемонстрировали, что фенотип с высоким содержанием олеиновой кислоты (высокомасличные, HO) ассоциирован с заметным снижением активности фермента OLD, который катализирует десатурацию 18:1 до 18:2 в HO-семенах во время критических стадий синтеза липидного запаса, что объясняет аккумуляцию 18:1.

Было продемонстрировано, что мутация "Первенец" ассоциирована с генными дупликациями внутри гена OLD, приводящими к сайленсингу гена. Это уменьшение в транскрипции OLD объясняет уменьшение количества фермента и, таким образом, низкую продемонстрированную активность OLD (Hongtrakul et al. (1998) Crop Sci 38:1245-1249), что согласуется с аккумуляцией 18:1 в семенах подсолнечника. Это открытие привело к разработке молекулярных маркерных характеристик мутации, которые могут использоваться в программах скрещивания для облегчения селекции HO-генотипов (WO2005/106022; Lacombe et al. (2001) Life Sci 324:839-845).

Традиционное подсолнечное масло с высоким содержанием 18:2 рассматривается как здоровое растительное масло, которое имеет правильный вкус, и рассматривается как масло, имеющее первый класс качества на мировом рынке благодаря его высокому процентному содержанию полиненасыщенных жирных кислот. Оно используется в качестве салатного масла, кулинарного масла или для получения маргарина.

Путем модификации профиля жирных кислот в подсолнечном масле может быть разработано новое подсолнечное масло, имеющее более высокую устойчивость к окислению по сравнению с обыкновенным маслом. Это масло должно содержать уровень, по меньшей мере, 18:1 55-65% в отношении суммарного содержания жирных кислот. Польза данного масла в его высокой устойчивости к окислению после процесса экстракции и стабильность вкуса жареных продуктов. Подсолнечное масло с высокой концентрацией 18:1 не нуждается в гидрогенизации для повышения стабильности и не образует транс-жирных кислот.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Целью данного изобретения является предложение выделенной нуклеотидной последовательности, кодирующей мутантный белок олеат-десатуразы (OLD), обладающий низкой ферментной активностью. Эта более низкая ферментная активность при экспрессии в растении, конкретно в растении подсолнечника, вызывает повышение количества олеиновой кислоты в растительном масле или в растительном масле из семян по сравнению с существующими растениями.

Таким образом, изобретение дополнительно относится к выделенной нуклеотидной последовательности, включающей вставку, которая изменяет рамку считывания, чья нуклеотидная последовательность кодирует укороченный белок OLD подсолнечника. В предпочтительном воплощении вставленная нуклеотидная последовательность включает преждевременный стоп-кодон и кодирует укороченный белок олеат-десатуразы подсолнечника, который включает аминокислотную последовательность SEQ ID NO:1 или SEQ ID NO:2. Кодирующая последовательность укороченного белка олеат-десатуразы может представлять собой нуклеотидную последовательность, представленную в SEQ ID NO:3 или SEQ ID NO:4.

Согласно следующему аспекту в данном изобретении предлагается укороченный белок олеат-десатуразы, включающий не более чем 110 аминокислот из N-концевой области. В предпочтительном воплощении аминокислотная последовательность состоит из SEQ ID NO:1 или SEQ ID NO:2.

Согласно другому аспекту данное изобретение относится к растению подсолнечника, включающему два аллеля OLD со вставкой, кодирующей укороченный белок OLD. Каждый аллель включает нуклеотидную последовательность, которая имеет вставку, включающую преждевременный стоп-кодон, и где указанная последовательность кодирует укороченный белок OLD. В предпочтительном воплощении нуклеотидная последовательность представляет собой SEQ ID NO:3 или SEQ ID NO:4. Мутантное растение производит семена с содержанием олеиновой кислоты от 80% до 95% по отношению к суммарному процентному содержанию жирных кислот в семенах.

В следующем воплощении изобретение относится к растению подсолнечника, способному производить семена, с содержанием олеиновой кислоты от 80 до 95% по отношению к суммарному процентному содержанию жирных кислот в семенах, причем растение получают путем скрещивания растения линии 29065, которая имеет регистрационный номер NCIMB 41733, или линии 29066, которая имеет регистрационный номер NCIMB 41734, с другим растением, и путем селекции в F2 с получением растений, которые производят семена, имеющие содержание олеиновой кислоты от 80 до 95% по отношению к суммарному процентному содержанию жирных кислот в семенах.

В изобретении также предлагаются семена подсолнечника, которые включают два аллеля OLD со вставкой, кодирующей укороченный белок олеат-десатуразы. Каждый аллель включает нуклеотидную последовательность, которая имеет вставку, включающую преждевременный стоп-кодон, и где указанная последовательность кодирует укороченный белок олеат-десатуразы. Нуклеотидная последовательность может представлять собой последовательность, представленную в SEQ ID NO:3 или SEQ ID NO:4. Аминокислотная последовательность белка олеат-десатуразы может представлять собой последовательность, представленную в SEQ ID NO:1 или SEQ ID NO:2. В предпочтительном воплощении семена представляют собой семена линии 29065, репрезентативный образец семян которой был депонирован под регистрационным номером NCIMB 41733, или семена линии 29066, репрезентативный образец семян которой был депонирован под регистрационным номером NCIMB 41734.

Согласно другому аспекту данного изобретения предлагается подсолнечное масло, которое имеет содержание олеиновой кислоты от 80% до 95% по отношению к суммарному содержанию жирных кислот в масле, которое можно получить или получают из семян подсолнечника, которые включают два аллеля OLD, которые содержат вставку и кодируют укороченный белок олеат-десатуразы. В предпочтительном воплощении масло получают из семян линии 29065, репрезентативный образец семян которой был депонирован под регистрационным номером NCIMB 41733, или из семян линии 29066, репрезентативный образец семян которой был депонирован под регистрационным номером NCIMB 41734.

В настоящем изобретении дополнительно предлагается применение семян подсолнечника для экстракции масла. В предпочтительном воплощении семена представляют собой семена линии 29065, репрезентативный образец семян которой был депонирован под регистрационным номером NCIMB 41733, или семена линии 29066, репрезентативный образец семян которой был депонирован под регистрационным номером NCIMB 41734.

Изобретение дополнительно относится к потомству заявленных семян, где указанное потомство включает вставку в гене, который кодирует белок олеат-десатуразы, в котором такая вставка приводит к синтезу укороченного белка олеат-десатуразы.

Изобретение дополнительно относится к способу получения растения подсолнечника с высоким содержанием олеиновой кислоты, который включает следующие стадии:

a) мутагенез части растения подсолнечника;

b) получение, по меньшей мере, одного потомства мутантного растения, и

c) идентификация и селекция, по меньшей мере, одного растения, полученного в стадии b), включающего нуклеотидную последовательность, которая имеет вставку, включающую преждевременный стоп-кодон, и где указанная нуклеотидная последовательность кодирует укороченный белок олеат-десатуразы. В одном воплощении укороченный белок олеат-десатуразы включает последовательность, составляющую не более чем 110 аминокислот из N-концевой области олеат-десатуразы подсолнечника, например, белок, представленный в SEQ ID NO:1 или SEQ ID NO:2.

Согласно другому аспекту в изобретении предлагается способ получения высокомасличного подсолнечного масла, включающий экстракцию масла из семян, причем репрезентативный образец семян был депонирован под регистрационным номером NCIMB 41733 или NCIMB 41734.

ОПИСАНИЕ ФИГУР

На Фиг. 1 представлен график процентного содержания олеиновой кислоты по отношению ко всем основным жирным кислотам для гомозиготных растений для высокомасличной мутации "Первенец", для линий 29065 и 29066, полученных в скрещиваниях 20342×29065; 20342×29066; 20340×29065 и 20340×29066. Во всех случаях процентные содержания олеиновой кислоты в растениях F2, несущих мутации по настоящему изобретению в гомозиготном статусе (mut 29065 Hm и mut 29066 Hm, соответственно) сравниваются с растениями F2, несущими мутацию "Первенец" в гомозиготном статусе (mut "Первенец" Hm). Точки характеризуют значение и сегменты внутри боксов характеризуют средние значения.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к мутантной нуклеотидной последовательности, кодирующей олеат-десатуразу, которая имеет вставку, где вставленная последовательность включает преждевременный стоп-кодон и, таким образом, белок олеат-десатуразы подсолнечника является укороченным. Кодируемый укороченный белок олеат-десатуразы имеет более низкую ферментную активность, приводящую к получению растения или частей растения, таких как семена, которые аккумулируют большое количество олеиновой кислоты.

Укороченная аминокислотная последовательность может представлять собой любую последовательность, которая включает не более чем первые 110 аминокислот из N-концевой области белка олеат-десатуразы подсолнечника. В предпочтительном воплощении укороченная аминокислотная последовательность может представлять собой последовательность, представленную в SEQ ID NO:1, или последовательность, представленную в SEQ ID NO:2.

Нуклеотидные последовательности, подвергнутые мутации с помощью вставки, включают преждевременный стоп-кодон, который приводит к синтезу укороченного белка OLD подсолнечника. Следует понимать, что любая нуклеотидная последовательность, которая кодирует белок олеат-десатуразы, который включает не более чем первые 110 аминокислот N-концевой области OLD подсолнечника дикого типа, например, один из линии HA89, находится в рамках данного изобретения.

Нуклеотидные последовательности, которые включают вставку, которая содержит преждевременный стоп-кодон, например, последовательности, представленные в SEQ ID NO:3 и SEQ ID NO:4, находятся в рамках настоящего изобретения.

Различные линии подсолнечника были подвергнуты мутации, например, линии HA89 и 29010, для получения семян с высоким содержанием олеиновой кислоты. Отобранные мутации в кодирующей последовательности гена олеат-десатуразы подсолнечника, представляют собой мутации, путем вставки последовательностей, которые включают преждевременный стоп-кодон, причем указанные нуклеотидные последовательности кодируют укороченные белки олеат-десатуразы.

Мутантные семена по изобретению депонировали согласно Будапештскому соглашению в коллекцию Национальной Библиотеки Промышленных, Пищевых и Морских Бактерий (NCIMB) 20.07.2010 под следующими регистрационными номерами: линия 29065 соответствует регистрационному номеру NCIMB 41733, и линия 29066 соответствует регистрационному номеру NCIMB 41734.

Настоящее изобретение относится ко всем семенам и растениям, конкретно, к семенам подсолнечника и к растениям, которые несут в своем геноме мутацию, которая приводит к получению укороченного белка олеат-десатуразы, имеющего ферментную активность, которая является пониженной по сравнению с существующими ферментами олеат-десатуразы, что приводит к более высокому содержанию олеиновой кислоты в масле из семян. В одном воплощении мутация представляет собой вставку, которая несет стоп-кодон. Другие мутации, которые приводят к получению укорочению олеат-десатуразы максимум до 110 аминокислот, также находятся в рамках данного изобретения. Такие растения и семена, которые имеют более высокое содержание олеиновой кислоты в масле, могут быть получены путем скрещивания с растениями депонированных линий 29065 (NCIMB 41733) или 29066 (NCIMB 41734) и селекции потомства растений, которые имеют более высокое содержание олеиновой кислоты. Селекция осуществляется подходящим образом в F2, так как мутация, приводящая к укорочению, должна предпочтительно присутствовать гомозиготно для более низкой ферментной активности, чтобы приводить к более высокому содержанию олеиновой кислоты. Альтернативно, мутантный ген может быть привнесен в растение подсолнечника посредством генетической инженерии, конкретно, с использованием мутантного гена олеат-десатуразы, описанного в данном документе, или с использованием любого другого гена, приводящего к получению такого же укороченного продукта экспрессии длиной не более чем 110 аминокислот.

Мутантные растения и семена по изобретению могут быть получены с использованием различных схем мутагенеза. В предпочтительном воплощении мутагенный агент, такой как EMS, в концентрации от 5 до 15% инъецируется в цветочные головки растений, семена собирают и затем применяют рентгеновское излучение.

После мутагенеза анализировали жирнокислотный профиль мутантных семян M2 и родительских семян, и отбирали те, которые демонстрировали высокое содержание олеиновой кислоты, например, выше 80% по сравнению с содержанием жирных кислот семян, предпочтительно примерно 90% по сравнению с суммарным содержанием жирных кислот семян.

В другом предпочтительном воплощении мутантные растения и семена получали с помощью применения рентгеновского излучения. Затем жирнокислотный профиль семян M2 сравнивали с жирнокислотным профилем родительских семян, и отбирали те, которые демонстрировали высокое содержание олеиновой кислоты, например, имеющие выше 80% по отношению к суммарному содержанию жирных кислот в семенах, предпочтительно, примерно 90% по сравнению с суммарным содержанием жирных кислот в семенах.

Масло, полученное из любых семян подсолнечника по изобретению, имеет содержание олеиновой кислоты выше, чем 80% по отношению к суммарному содержанию жирных кислот в семенах, предпочтительно, выше чем 85% и более предпочтительно, выше чем 90%.

Осуществляли направленные скрещивания между линиями, которые принадлежат Advanta Semillas, с высокомасличным фенотипом, которые являются носителями мутации "Первенец" (20342 и 20340), и высокомасличными мутантами 29065 и 29066 по изобретению: 20342x29065; 2042x29066; 20340x29065 и 20340x29066. Растения F1, полученные в каждом скрещивании, были самоопыляющимися, и их семена (F2) собирали. Семена F2 из каждого скрещивания высаживали в поле в Балкарке в сезон 2008/2009.

Посредством применения специфических молекулярных маркеров, гомозиготные растения идентифицировали на предмет мутации "Первенец" и мутаций 29065 и 29066, полученных в каждом скрещивании. Указанные растения были самоопыляющимися, и семена собирали индивидуально. Группу из 30 семян отбирали из каждого растения, высевали в блок и определяли жирнокислотный состав масла с помощью газовой хроматографии.

Во всех случаях гомозиготные растения с мутациями 29065 и 29066 демонстрировали средние процентные содержания олеиновой кислоты, превышающие их соответствующие значения у растений с мутацией "Первенец" (см. Таблицу 3 и Фиг.1).

Нуклеотидные и аминокислотные последовательности сравнивали с соответствующими последовательностями линии HA89 подсолнечника дикого типа (SEQ ID NO:5 и SEQ ID NO:6). Эти последовательности были идентичны соответствующим последовательностям линии 29010 подсолнечника дикого типа.

Изобретение иллюстрируется следующими примерами, которые не следует рассматривать как ограничение рамок изобретения. Напротив, следует со всей ясностью понимать, что для специалиста в данной области возможно после прочтения настоящего описания применить другие воплощения, модификации и эквиваленты изобретения, не выходя при этом за рамки настоящего изобретения и/или приложенной формулы изобретения.

ПРИМЕРЫ

Пример 1

1.1 Мутагенез с помощью рентгеновского излучения (получение линии 29065)

Семена M0 линии 29010, собственность Advanta Semillas SAIC, подвергали мутагенезу с помощью применения рентгеновского излучения. Излучение проводили в Институте Генетики "Edward A. Favret”, CICVyA-CNIA, INTA-Castelar, Аргентина. Устройство для рентгеновского излучения Philips MG 160, 4KW с максимальной мощностью 160 кВ, 19 мА и с потреблением энергии 120 кВ, 15 мА. Используемые время экспонирования и дозы составили 7 мин 55 сек и 144 Гр, соответственно, с расстоянием между фокусом источника и объектом (семена) 40 сантиметров.

Облученные семена высевали 12 декабря 2005 в 12 рядов по 100 метров длиной в Балкарке с номером партии CA05-6347. Цветочные головки полученных 1606 растений упаковывали в мешочки перед цветением с целью получения семян с помощью самоопыления, M2. Цветочные головки в каждом ряду собирали и обмолачивали индивидуально. Семена M2 из 1606 растений анализировали с помощью газовой хроматографии (GC) для определения жирнокислотного состава в 30 индивидуальных семенах M2 на растение. Мутантное растение CA05-6347-725 демонстрировало фенотип с высоким содержанием олеиновой кислоты, и было названо 29065.

1.2 Мутагенез с помощью инъекции EMS и последующего облучения с помощью рентгеновского излучения (получение линии 29066)

Семьдесят пять рядов семян линии HA89 высевали в Биотехнологическом Исследовательском Центре Advanta Semillas SAIC в Балкарке (Буэнос-Айрес, Аргентина) в сезон 2004/5 и идентифицировали под номером партии CA04-3, и 40 рядов под номером партии CA04-1501. Каждый ряд составлял 6 метров в длину.

Цветочные головки подвергали мутагенезу с помощью инъекции EMS (этиловый эфир метансульфокислоты) в дозах 5, 10 и 15% с использованием подходящего протокола мутагенеза. Каждое растение M0 упаковывали в мешочки перед цветением с целью получения самоопыляющихся семян M1. Цветочные головки растений каждой обработки EMS собирали, обмолачивали и сохраняли. Цветочные головки растений подвергали мутагенезу с помощью инъекции с использованием EMS (этиловый эфир метансульфокислоты) в дозах 5, 10 и 15% с использованием протокола, описанного в WO2006/024351 и WO2008/071715. EMS представляет собой мутагенный агент, который индуцирует транзиции G/C в A/T (Jander et al. (2003) Plant Physiol. 131:139-146). С целью получения самоопыляющихся семян M1 каждое растение M0 покрывали нейлоновой сеткой перед цветением. Цветочные головки растений каждой 5% обработки EMS собирали, обмолачивали и идентифицировали (партия CA04-3).

Указанные семена M1 затем подвергали мутагенезу с помощью применения рентгеновского излучения. Облучение проводили в Институте Генетики "Edward A. Favret”, CICVyA-CNIA, INTA-Castelar, Аргентина. Устройство для рентгеновского излучения Philips MG 160, 4KW с максимальной мощностью 160 кВ, 19 мА и с потреблением энергии 120 кВ, 15 мА. Используемые время экспонирования и дозы составили 7 мин 55 сек и 144 Гр, соответственно, с расстоянием между фокусом источника и объектом (семена) 40 сантиметров.

Облученные семена высевали 12 декабря 16 в 2005 в 16 рядов по 100 метров длиной в Балкарке с номером партии CA05-6362. Цветочные головки полученных 555 растений упаковывали в мешочки перед цветением с целью получения семян с помощью самоопыления, M2. Цветочные головки в каждом ряду собирали и обмолачивали индивидуально. Семена M2 из 555 растений анализировали с помощью газовой хроматографии (GC) для определения жирнокислотного состава в 30 индивидуальных семенах M2 на растение. Мутантное растение CA05-6362-263 демонстрировало фенотип с высоким содержанием олеиновой кислоты, и было названо 29066.

Таблица 1 демонстрирует метод мутагенеза, используемый для каждой мутантной линии по изобретению, нуклеотидная последовательность и аминокислотная последовательность укороченного белка олеат-десатуразы.

Таблица 1
Линия Метод Мутагенеза Размер вставки в парах оснований Нуклеотидное положение вставки в OLD-кодирующем участке Мутантная нуклеотидная последовательность по изобретению Последовательность предсказанного укороченного белка OLD
29065 Рентгеновское облучение для семян 785 310 SEQ ID NO:3 SEQ ID NO:1
29066 5% EMS-инъекция в цветочные головки с последующим рентгеновским облучением собранных семян 4872 201 SEQ ID NO:4 SEQ ID NO:2

Пример 2

Анализ жирнокислотного состава жирных кислот масла из семян с помощью газовой хроматографии

Семена подсолнечника разрезали по саггитальной оси и помещали в 2-мл стеклянные пробирки, содержащие метанол, толуол, диметоксипропан и серную кислоту в соотношении 66:28:4:2. Пробирки закрывали и инкубировали в течение одного часа при 80°C. Им давали возможность охладиться при комнатной температуре и затем добавляли 1 мл гептана (Garcés and Mancha (2003) Analytical Biochemistry 317:247-254). Метиловые эфиры жирных кислот, присутствующие в верхней фазе (гептан) отделяли на газовом хроматографе Agilent 6890 с помощью автоматического устройства для забора образцов Model 7683B. Температура инъекции составила 240°C, а также использовали хроматографическую колонку Durabond 15 метров длиной с внутренним диаметром 250 мкМ и 250 мкМ пленку (J & W Scientific) при 200°C. Газ H2 использовали в качестве рабочего газа под давлением 9,56 фунтов/кв. дюйм, со скоростью потока 1,7 мл/мин, и со средней скоростью 69 см/сек. Метиловые эфиры детектировали с помощью детектора ионизации пламени (FID) при 300°C. Результаты интегрировали и анализировали с использованием программного обеспечения Chem32 Agilent Technologies. Относительные количества каждой жирной кислоты измеряли по отношению к стандартному раствору метилированных жирных кислот (Alltech).

В Таблице 2 представлены анализы жирнокислотного состава, проводимые с помощью газовой хроматографии на образцах семян из мутантных растений по изобретению.

Таблица 2
Линия % жирных кислот
P S O L
29065 2,9 2,7 93,3 1,1
29066 4,4 3,7 90,6 1,3
P: пальмитиновая кислота; S: стеариновая кислота; O: олеиновая кислота; L: линолевая кислота

Таблица 3

Сравнение уровня олеиновой кислоты (%) семян подсолнечника из гомозиготных растений F2 (Hm) для мутаций 29065 и 29066 по сравнению с гомозиготными растениями F2 (Hm) для мутации "Первенец". Процентное содержание для обоих, Hm 29065 и 29066, было значительно выше, чем соответствующие значения для Hm "Первенец".

Таблица 3
Популяция Гомозиготная мутация высокого содержания олеиновой кислоты Среднее процентное содержание олеиновой кислоты Стандартное отклонение n
20340x29065 29065 87,50 1,08 12
"Первенец" 82,86 5,38 18
20340x29066 29066 87,91 2,56 114
"Первенец" 86,26 2,64 90
20342x29065 29065 89,08 3,56 56
"Первенец" 75,81 11,15 57
20342x29066 29066 88,90 2,17 37
"Первенец" 87,17 2,08 41
n: количество растений F2, чей жирнокислотный состав анализировали с помощью газовой хроматографии

Пример 3

Секвенирование генов подсолнечника, которые кодируют полипептид, который имеет активность олеат-десатуразы

Для анализа секвенирования образцы ткани брали из каждого мутанта с высоким содержанием олеиновой кислоты, выделяли геномную ДНК и разводили до базовой концентрации 100 нг/мкл. С целью получения кодирующей последовательности полноразмерной олеат-десатуразы мутантов с высоким содержанием олеиновой кислоты 29065 и 29066 и исходных линий 29010 и HA89 (дикий тип), использовали специфичные праймеры, сконструированные для гена. Их использовали для амплификации с помощью ПЦР (полимеразная цепная реакция) и получения двух перекрывающихся ДНК сегментов (ампликоны), которые перекрывали весь ген OLD. Последовательность сконструированных праймеров показана ниже:

1-й ампликон (705 п.о.) OLD1-F2 GAAAAGTCTGGTCAAACAGTCAACAT (SEQ ID NO:7)
OLD1-R2 CCGATGTCGGACATGACTATC (SEQ ID NO:8)
2-й ампликон (733 п.о.) OLD1adv-F2 AAATACTTTAACAACACAGTGGGC (SEQ ID NO:9)
OLD1-R3 CCAGAACCAGGACAACAGCCATTGTC (SEQ ID NO:10)

Все праймеры являются специфичными для гена олеат-десатуразы. Следующие концентрации использовали для полимеразной цепной реакции (ПЦР) в конечном объеме 25 мкл: 1X буфер (Invitrogen), 0,2 мм dNTP (GE Healthcare), 2,5 мМ MgCl2 (Invitrogen), 0,2 мкМ каждого праймера, 0,5 мкл Platinum Taq (5 Ед/мкл) (Invitrogen) и 100 нг геномной ДНК. KLA-реакцию с помощью ПЦР осуществляли на компьютерной системе GeneAmp PCR System 9700 (Perkin-Elmer). Условия цикла: исходная стадия денатурации при 94°C в течение 1 минуты с последующими 35 циклами, состоящими из 94°C в течение 45 секунд, 57°C в течение 45 секунд и 72°C в течение 70 секунд, и конечная стадия элонгации 72°C в течение 10 минут.

В случае двух мутантов, обнаруживших высокое содержание олеиновой кислоты (29065 и 29066), продукт амплификации нельзя было получить с использованием праймеров OLD1-F2 и OLD1-R2. Это приводило к утверждению, что мутанты обладают крупными сегментами ДНК, вставленной в участок, заключенный между этими праймерами, в результате мутагенной обработки с помощью рентгеновского излучения. Это будет означать, что благодаря крупному сегменту, фланкированному праймерами OLD1-F2 и OLD1-R2, продукта амплификации не получат.

С целью установления нуклеотидной последовательности вставленных сегментов, генерировали геномные библиотеки для каждого из мутантов (29065 и 29066) с целью осуществления "хромосомной прогулки" с помощью ПЦР с использованием системы GenomeWalkerTM Universal Kit Protocol-at-a-Glance (Clontech), следуя инструкциям производителя.

Используя нуклеотидную последовательность гена олеат-десатуразы линий HA89 и 29010 в качестве эталона, "хромосомную прогулку" осуществляли как в 5'-направлении, так и в 3'направлении смысловой цепи каждого мутанта. Следующие специфичные праймеры использовались для каждого из мутантов:

Мутант 29065

Первый раз OLD1-Walk3´-F1 AACCACCCTTCACCATCGGCG
(SEQ ID NO:11)
OLD1-Walk3´-F2 ACCCGTTCGTTCTCCTACGT
(SEQ ID NO:12)
OLD1-Walk5´-R1 AGTGGCAGGCGAAACGGTCA
(SEQ ID NO:13)
OLD1-Walk5´-R2 AGCCGAGAGTGAGAGTGACG
(SEQ ID NO:14)
Второй раз MUT29010HO-W2-5'-1 ATGATCGCAGTCCCCAAAAG
(SEQ ID NO:15)
MUT29010HO-W2-5'-2 CCAATCAGCCTACAATAACAA
(SEQ ID NO:16)
MUT29010HO-W2-3'-1 AAGGGACGAGTAAAGACGAG
(SEQ ID NO:17)
MUT29010HO-W2-3'-2 TCGTCGACCCATTGATAATC
(SEQ ID NO:18)

Мутант 29066

Первый раз OLD1-Walk3´-F1 AACCACCCTTCACCATCGGCG
(SEQ ID NO:11)

OLD1-Walk3´-F2 ACCCGTTCGTTCTCCTACGT
(SEQ ID NO:12)
OLD1-Walk5´-R1 AGTGGCAGGCGAAACGGTCA
(SEQ ID NO:13)
OLD1-Walk5´-R2 AGCCGAGAGTGAGAGTGACG
(SEQ ID NO:14)
Второй раз MUTHA89HO-W2-5'-1 GGAAAACAGGGTTATTGGCA
(SEQ ID NO:19)
MUTHA89HO-W2-5'-2 CAACAAAGCACGCACCCACA
(SEQ ID NO:20)
Третий раз MUTHA89HO-W52-1 TCATGGTAGTCAACTCCCTC
(SEQ ID NO:21)
MUTHA89HO-W52-2 CGCTTTCTTTCCTTCGGGCAA (SEQ ID NO:22)
MUTHA89HO-W32-1 GCTAATCGTGATCCACAGGC
(SEQ ID NO:23)
MUTHA89HO-W32-2 GCCCACGACACTTACCAGA
(SEQ ID NO:24)
Четвертый раз MUTHA89HO-W53-1 CCCAACTCTATATTTTCAAG
(SEQ ID NO:25)
MUTHA89HO-W53-2 ACTTGAAAGTTTGGTTTCGG
(SEQ ID NO:26)
MUTHA89HO-W33-1 AGGGAACGGGGCAACATTTG
(SEQ ID NO:27)
MUTHA89HO-W33-2 GCCGCCTAACGAGAGACTT
(SEQ ID NO:28)

Два микролитра каждого продукта, которые получали в результате каждой ПЦР, анализировали с помощью электрофореза на агарозном геле, и концентрацию ДНК оценивали путем сравнения с маркером молекулярной массы Low DNA Mass Ladder (Invitrogen). Оставшийся продукт ПЦР очищали с использованием Gel Wizard® SV (Promega) и Системы PCR Clean-Up System (Promega). Очищенные ПЦР-продукты секвенировали с использованием системы циклического секвенирования BigDye® Terminator v3.1 (Applied Biosystems), следуя инструкциям производителя.

Файлы секвенирования олеат-десатуразы, полученные для каждого ампликона, собирали с использованием Программы сборки последовательности CAP3 (http://pbil.univ-lyon1.fr/cap3.php). Полученные в результате ДНК-последовательности олеат-десатуразы сравнивали с последовательностями олеат-десатуразы линии HA89, депонированными в GenBank (регистрационный номер AY802989) с использованием программы Clustal W версии 2.1 (http://www.clustal.org), идентифицирующей нуклеотидные вставки, присутствующие в мутантах 29065 и 29066, которые, как было продемонстрировано, имеют размер 785 пар оснований (п.о.) и 4872 п.о., соответственно. Кроме того, анализ мутантных последовательностей OLD и соответствующей последовательности дикого типа продемонстрировал, что в случае мутанта линии 29065 вставка 785-п.о. была локализована в нуклеотидном положении 310 кодирующего участка гена OLD, в то врем как вставка мутантной линии 29066 размером 4872 п.о. была локализована в нуклеотидном положении 201.

1. Выделенная нуклеотидная последовательность SEQ ID NO:5, включающая преждевременный стоп-кодон и кодирующая укороченный белок олеат-десатуразы подсолнечника, содержащий не более чем 110 первых аминокислот N-концевого участка, где последовательность кодирует укороченный белок олеат-десатуразы подсолнечника, характеризующийся аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO:1 и SEQ ID NO:2.

2. Последовательность по п. 1, где указанная нуклеотидная последовательность выбрана из группы, состоящей из SEQ ID NO:3 и SEQ ID NO:4.

3. Укороченный белок олеат-десатуразы подсолнечника SEQ ID NO: 6, включающий не более чем 110 первых аминокислот N-концевого участка олеат-десатуразы дикого типа, где укороченный белок олеат-десатуразы подсолнечника имеет сниженную ферментную активность по сравнению с ферментной активностью белка олеат-десатуразы подсолнечника дикого типа и где белок характеризуется аминокислотной последовательностью, выбранной из группы, состоящей из SEQ ID NO:1 и SEQ ID NO:2.

4. Растение подсолнечника для получения семени с содержанием олеиновой кислоты от 87,5 до 93,3% по отношению к суммарному процентному содержанию жирных кислот в семени, где указанное растение включает ген олеат-десатуразы, который имеет нуклеотидную последовательность по п. 1.

5. Растение по п. 4, где нуклеотидная последовательность выбрана из группы, состоящей из SEQ ID NO:3 и SEQ ID NO:4.

6. Семя подсолнечника, имеющее содержание олеиновой кислоты от 87,5 до 93,3% по отношению к суммарному процентному содержанию жирных кислот в семени, включающее ген олеат-десатуразы, охарактеризованный нуклеотидной последовательностью по п. 1.

7. Семя по п. 6, где нуклеотидная последовательность выбрана из группы, состоящей из SEQ ID NO:3 и SEQ ID NO:4.

8. Семя по п. 7, где указанное семя выбрано из группы, состоящей из:

a) линии 29065, которая имеет регистрационный номер NCIMB 41733, и

b) линии 29066, которая имеет регистрационный номер NCIMB 41734.

9. Применение семени подсолнечника по любому из пп. 6-8 для получения масла.

10. Применение по п. 9, где указанное семя выбрано из группы, состоящей из:

a) линии 29065, которая имеет регистрационный номер NCIMB 41733, и

b) линии 29066, которая имеет регистрационный номер NCIMB 41734.

11. Способ получения растения подсолнечника, способного производить семя с содержанием олеиновой кислоты от 87,5 до 93,3% по отношению к суммарному процентному содержанию жирных кислот в семени, который включает следующие стадии:

a) мутагенез части растения подсолнечника, получая таким образом мутантное растение;

b) получение по меньшей мере одного потомства указанного мутантного растения, и

с) идентификация и селекция по меньшей мере одного растения, полученного в стадии b), включающего нуклеотидную последовательность по п. 1.

12. Способ по п. 11, где стадию мутагенеза осуществляют путем инъекции мутагенного агента в цветочную головку растения.

13. Способ по п. 12, отличающийся тем, что он дополнительно включает стадию облучения семян рентгеновскими лучами.

14. Способ по п. 11, где мутагенный агент представляет собой этиловый эфир метансульфокислоты в концентрации от 5% до 15%.

15. Способ по п. 11, где стадию мутагенеза проводят путем облучения семян рентгеновскими лучами.

16. Способ по п. 11, где укороченный белок олеат-десатуразы включает последовательность, составляющую не более чем 110 аминокислот N-концевого участка.

17. Способ получения подсолнечного масла, имеющего содержание олеиновой кислоты от 87,5 до 93,3% по отношению к суммарному процентному содержанию жирных кислот в масле, включающий экстракцию масла из семян подсолнечника, выбранного из группы, состоящей из линии 29065, репрезентативный образец которой депонирован под регистрационным номером NCIMB 41733, и линии 29066, репрезентативный образец которой депонирован под регистрационным номером NCIMB 41734, где семя линии 29065, которая имеет регистрационный номер NCIMB 41733, и семя линии 29066, которая имеет регистрационный номер NCIMB 41734, содержат выделенную нуклеотидную последовательность по п. 1.



 

Похожие патенты:

Изобретение относится к сельскому хозяйству. Для повышения урожайности резистентного к 2,4-D растения сои его обрабатывают 2,4-D на стадии роста V3 и R2 при норме внесения от 1000 до 2000 г кэ/га.

Изобретение относится к области биохимии, в частности к синтетическому конструкту двухцепочечной нуклеиновой кислоты для экспрессии множества гетерологичных генов в растительной клетке, характеризующемуся двунаправленным промотором, состоящему из первой цепи, содержащей элемент минимального корового промотора, и второй цепи, содержащей промотор бациллярного вируса сахарного тростника, а также к способу получения трансгенной растительной клетки или ткани, которые экспрессируют множество гетерологичных генов с его использованием.

Изобретение относится к области биохимии, в частности к трансгенному растению осины, обладающему устойчивостью к фосфинотрицину по сравнению с нетрансформированным растением и не имеющему сомаклональных изменений.

Изобретение относится к области биохимии, в частности к выделенной молекуле нуклеиновой кислоты для обеспечения в растении устойчивости к глифосату, а также к экспрессирующему вектору, клетке-хозяину, растения, части растения, семени растения, культуре ткани растения, ее содержащего.

Изобретение относится к области биохимии, в частности к конструкции нуклеиновой кислоты и химерному белку для локализации полипептида в хлоропласт, а также к конструкции для экспрессии нацеливающего хлоропласты полипептида в клетке растения.

Изобретение относится к области биохимии, в частности к способу получения безмаркерных трансгенных растений каланхоэ, экспрессирующих ген цекропина P1. Изобретение позволяет создавать биобезопасные лекарственные растения каланхоэ с высоким уровнем накопления целевого продукта и в сокращенные по времени сроки.

Изобретение относится к области биохимии, в частности к трансгенному растению для замедления или предотвращения развития устойчивости к белкам Cry1Ab и DIG-3 у кукурузного мотылька (ЕСВ), его семени, а также к способу предотвращения развития устойчивости к белку Cry1Ab и DIG-3 у ECB с его использованием.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК, указывающей на присутствие трансгенного события, где репрезентативный образец семени, содержащий указанное трансгенное событие, депонирован как АТСС РТА-9670.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК, указывающей на присутствие трансгенного события, где репрезентативный образец семени, содержащий указанное трансгенное событие, депонирован как АТСС РТА-7899.

Изобретение относится к области биохимии, в частности к способу трансформации растительной клетки, где способ включает контакт растительных клеток незрелых зародышей кукурузы с клетками Agrobacterium в жидкой среде, содержащей неионное трисилоксановое поверхностно-активное вещество.

Изобретение относится к области биохимии, в частности к способу борьбы с чешуекрылыми насекомыми. Также раскрыта выделенная нуклеиновая последовательность, которая является праймером.

Изобретение относится к биотехнологии. Изобретение представляет собой способ стимуляции морфогенеза в культуре ткани ячменя, включающий получение каллуса на плотной среде Мурасиге-Скуга, содержащей 2 мг/л дихлорфеноксиуксусной кислоты; его пассирование для пролиферации на среду с 1 мг/л дихлорфеноксиуксусной кислоты, а через три недели - для индукции морфогенеза - пассирование на среду с 1 мг/л кинетина, 0,5 мг/л индолилуксусной кислоты, 0,1 мг/л гибберелловой кислоты, при этом одну из сред (для пролиферации каллуса или индукции морфогенеза) готовят не плотной, а полужидкой (4 г/л агара) с добавлением 5 об.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ клонального микроразмножения растений сем.

Изобретение относится к области биохимии, в частности к трансгенному растению осины, обладающему устойчивостью к фосфинотрицину по сравнению с нетрансформированным растением и не имеющему сомаклональных изменений.

Изобретение относится к области биохимии, в частности к выделенной молекуле нуклеиновой кислоты для обеспечения в растении устойчивости к глифосату, а также к экспрессирующему вектору, клетке-хозяину, растения, части растения, семени растения, культуре ткани растения, ее содержащего.

Изобретение относится к области биохимии, в частности к способу борьбы с насекомыми-вредителями, такими как Pseudoplusia includens (соевая совка), Anticarsia gemmatalis (гусеница бархатных бобов), Spodoptera frugiperda (травяная совка).

Изобретение относится к сельскому хозяйству, в частности к области растениеводства и селекции. Изобретение представляет собой способ оценки селекционного материала гороха посевного на интенсивность фотосинтеза листьев, включающий измерение интенсивности поглощения молекул углекислого газа на единицу поверхности листьев первого плодоносящего узла в фазу плодообразования, при этом измерения проводят с 9:00 до 11:00 часов дня с помощью переносного газоанализатора марки LI-6400 XT, который фиксирует и показывает значение интенсивности фотосинтеза на цифровом экране, при этом измерительную камеру прикрепляют к листу растения и в течение 1,5-2 минут ожидают стабилизации газообмена в измерительной камере.

Изобретение относится к области биохимии, в частности к способу получения безмаркерных трансгенных растений каланхоэ, экспрессирующих ген цекропина P1. Изобретение позволяет создавать биобезопасные лекарственные растения каланхоэ с высоким уровнем накопления целевого продукта и в сокращенные по времени сроки.

Изобретение относится к области биохимии, в частности к трансгенному растению для замедления или предотвращения развития устойчивости к белкам Cry1Ab и DIG-3 у кукурузного мотылька (ЕСВ), его семени, а также к способу предотвращения развития устойчивости к белку Cry1Ab и DIG-3 у ECB с его использованием.

Изобретение относится к области биохимии, в частности к рекомбинантной молекуле ДНК, указывающей на присутствие трансгенного события, где репрезентативный образец семени, содержащий указанное трансгенное событие, депонирован как АТСС РТА-9670.

Группа изобретений относится к области биотехнологии. Предложен полинуклеотид, кодирующий трегалоза-6-фосфатфосфатазный полипептид. Предложены растение кукурузы, обладающее повышенной урожайностью, кукурузная клетка-хозяин, ткань растения кукурузы, бинарный вектор экспрессии, включающие указанный полинуклеотид. Предложена кассета экспрессии для трансформации кукурузных клеток, включающая указанный полинуклеотид, функционально связанный с промотором, контролирующим его транскрипцию. Предложен способ повышения урожайности у растений кукурузы с использованием вышеуказанной кассеты экспрессии. Группа изобретений позволяет повысить урожайность растения кукурузы и смягчить влияние стресса, вызванного засухой при цветении, путем снижения бесплодия, увеличения числа початков на растение и увеличения числа зерен на растение. 7 н. и 4 з.п. ф-лы, 15 ил., 15 табл., 13 пр.
Наверх