Микрорнк - биомаркеры, указывающие на болезнь альцгеймера



Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
Микрорнк - биомаркеры, указывающие на болезнь альцгеймера
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2639509:

ЭЙСАЙ Ар ЭНД Ди МЕНЕДЖМЕНТ КО., ЛТД. (JP)

Изобретения касаются способа диагностики болезни Альцгеймера или умеренного когнитивного нарушения (MCI) у субъекта и набора для осуществления указанной диагностики. Представленный способ включает определение уровня по меньшей мере одной микроРНК, выбранной из группы, состоящей из miR-15b, miR-191, miR-142-3р, Let-7g, Let-7d и их комбинаций, в образце крови, плазмы или сыворотки, взятом у субъекта. Отклонение уровня указанной по меньшей мере одной микроРНК от уровня у здорового субъекта, определенное по отношению к соответствующему контролю, указывает на то, что субъект страдает болезнью Альцгеймера или MCI. Набор для диагностики включает два или более агентов, селективно детектирующих присутствие по меньшей мере двух микроРНК, выбранных из группы, состоящей из miR-191, miR-15b, miR-142-3р, Let-7g, Let-7d, miR-301a и miR-545 в образце. Изобретения могут быть использованы для точной диагностики болезни Альцгеймера и MCI у субъекта. 2 н. и 33 з.п. ф-лы, 3 ил., 11 табл., 3 пр.

 

РОДСТВЕННЫЕ ЗАЯВКИ

Настоящая заявка испрашивает приоритет на основании предварительной заявки США 61/501,720, поданной 27 июня 2011 г., содержание которой полностью включено в настоящий документ посредством ссылки.

УРОВЕНЬ ТЕХНИКИ

Болезнь Альцгеймера - это прогрессирующее заболевание центральной нервной системы у человека. Оно проявляется деменцией, обычно у пожилых людей, а симптомы включают дезориентацию, потерю памяти, затрудненную речь, затруднения с вычислением или утрату зрительно-пространственных навыков, а также психиатрические проявления. Болезнь Альцгеймера связана с дегенерацией нейронов в нескольких областях мозга. Нейропатология болезни Альцгеймера характеризуется присутствием амилоидных бляшек, узлов нейрофибрилл, утратой синапсов и гибелью нейронов. Амилоидные бляшки являются результатом аномального уровня бета-амилоидного пептида, а узлы нейрофибрилл связаны с присутствием гиперфосфорилированного внутриклеточного тау-белка. Клинические симптомы обычно сначала проявляются как ухудшение памяти, а потом в форме нарушения других когнитивных функций и отклонений в поведении. Деменцией страдают приблизительно 24 миллиона человек в мире, причем большинство случаев (~60%) обусловлено болезнью Альцгеймера (Ferri C.P. et al. (2005) Lancet 366(9503):2112-2117). По оценкам более 5 миллионов американцев страдают болезнью Альцгеймера и предполагают, что к середине века это число возрастет до 14,3 миллионов, что соответствует увеличению на 350 процентов по сравнению с 2000 г. Рост числа пациентов с деменцией в развитом мире будет тяжелым бременем для общества и системы здравоохранения.

Ранняя диагностика является важным этапом лечения болезни Альцгеймера, поскольку ранняя постановка диагноза позволяет пациентам принимать лекарства, которые замедляют прогрессирование болезни Альцгеймера. В настоящее время болезнь Альцгеймера диагностируют с использованием комбинации клинических критериев, которые могут включать неврологическое обследование, оценку психического статуса и получение изображений мозга. Диагноз болезнь Альцгеймера часто ставят в результате исключения других видов деменции. По этим критериям может быть затруднительно поставить точный диагноз, особенно у пациентов с умеренной болезнью Альцгеймера или ранней стадией болезни Альцгеймера. Однозначный диагноз может быть поставлен путем исследования ткани головного мозга, однако его можно осуществить только после смерти субъекта. Соответственно, существует потребность в маркерах, указывающих на болезнь Альцгеймера, которые могли бы быть использованы в диагностических целях.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Настоящее изобретение обеспечивает новые микроРНК-биомаркеры, указывающие на болезнь Альцгеймера, которые можно применять для точной диагностики болезни Альцгеймера у субъекта. Эти биомаркеры включают miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d, miR-301a и miR-545. В некоторых вариантах осуществления способы включают обнаружение внеклеточных, циркулирующих микроРНК в пригодном образце, предпочтительно крови, плазмы, мочи или слюны.

Соответственно, в первом аспекте изобретения предложен способ диагностики болезни Альцгеймера у субъекта путем определения уровня по меньшей мере одной микроРНК в образце, содержащем циркулирующие микроРНК, взятом у субъекта, причем эта по меньшей мере одна микроРНК представляет собой miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d или их комбинации, и при этом отклонение уровня указанной по меньшей мере одной микроРНК от уровня у здорового субъекта, определенное по отношению к соответствующему контролю, указывает на то, что субъект страдает болезнью Альцгеймера. Например, в одном варианте осуществления способ включает определение уровня по меньшей мере одной микроРНК в образце, содержащем циркулирующие микроРНК, взятом у субъекта, причем эта по меньшей мере одна микроРНК представляет собой miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d или их комбинации, и при этом снижение уровня указанной по меньшей мере одной микроРНК относительно контроля указывает на то, что субъект страдает болезнью Альцгеймера. Способ может необязательно дополнительно включать диагностирование субъекта как страдающего или не страдающего болезнью Альцгеймера на основании уровня по меньшей мере одной микроРНК в указанном образце. В одном варианте осуществления способ может дополнительно включать определение корреляции отклонения уровня или уровней по меньшей мере одной микроРНК относительно соответствующего контроля с диагнозом болезнь Альцгеймера у субъекта.

В одном варианте осуществления способ включает определение уровня одной микроРНК, например, miR-191, miR-15b, miR-142-3p, Let-7g или Let-7d, в указанном образце, причем отклонение уровня указанной микроРНК от уровня у здорового субъекта представляет собой снижение.

В другом варианте осуществления способ включает определение уровня двух или более микроРНК в указанном образце. В этом варианте способ может дополнительно включать определение уровня miR-301a, miR-545 или miR-301a и miR-545 в указанном образце. Например, по меньшей мере одна микроРНК может быть выбрана из miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d или их комбинаций, и необязательно по меньшей мере одна микроРНК может быть выбрана из miR-301a, miR-545 или miR-301a и miR-545. В одном варианте осуществления способ включает определение уровня одной из следующих комбинаций микроРНК: miR-545, let7g и miR-15b; miR-15b и miR-545; miR-301a, miR-545, let-7g и miR-15b; miR-191 и miR-15b; Let-7g и miR-15b; miR-191, miR-301a и miR-545; miR-301a, let-7g и miR-15b; и miR-191, miR-301a, miR-545 и miR-15b.

В одном конкретном варианте осуществления способ может включать определение уровней двух или более микроРНК в образце, содержащем циркулирующие микроРНК, взятом у субъекта, сравнение уровней указанных двух или более микроРНК в указанном образце с массивом данных, представляющих уровни тех же микроРНК у здоровых субъектов и у субъектов с болезнью Альцгеймера, и постановку диагноза отсутствия болезни Альцгеймера у субъекта на основании сравнения. В некоторых вариантах осуществления две или более микроРНК могут включать следующие комбинации: miR-545, let7g и miR-15b; miR-15b и miR-545; miR-301a, miR-545, let-7g и miR-15b; miR-191 и miR-15b; Let-7g и miR-15b; miR-191, miR-301a и miR-545; miR-301a, let-7g и miR-15b; и miR-191, miR-301a, miR-545 и miR-15b.

Способ может необязательно включать выполнение по меньшей мере одного вспомогательного теста для диагностики болезни Альцгеймера. В некоторых вариантах осуществления дополнительный тест может представлять собой один или более из следующих: краткая шкала оценки психического статуса (MMSE), тест mini-cog, тест по шкале оценки когнитивных функций при болезни Альцгеймера (ADAS-cog test) и тест на рисование часов. В качестве необязательного варианта или дополнения, дополнительное тестирование включает оценку по меньшей мере одного дополнительного биомаркера болезни Альцгеймера.

Способ может необязательно включать введение субъекту терапевтически эффективного количества по меньшей мере одного средства для лечения болезни Альцгеймера. В некоторых вариантах осуществления средство для лечения болезни Альцгеймера может представлять собой Razadyne® (Разадин, галантамин), Exelon® (Экселон, ривастигмин) или Aricept® (Арицепт, донепезил). В одном конкретном варианте осуществления средство для лечения болезни Альцгеймера представляет собой донепезил или его фармацевтически приемлемую соль или эфир (например, донепезил гидрохлорид).

Уровень микроРНК можно определять любым пригодным способом. Например, микроРНК можно детектировать с использованием Гента, который специфично гибридизуется с данной микроРНК. В некоторых вариантах осуществления уровень микроРНК может быть определен с использованием методов амплификации. В одном варианте осуществления уровень микроРНк определяют с использованием количественной ПЦР.

Другой аспект настоящего изобретения относится к способу диагностики болезни Альцгеймера у субъекта, включающему измерение уровня по меньшей мере одной микроРНК в полученном из крови образце, взятом у субъекта, причем эта по меньшей мере одна микроРНК представляет собой miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d или их комбинацию, и определение корреляции разницы между уровнем у субъекта и соответствующим контролем с диагнозом болезни Альцгеймера у субъекта. В одном варианте способ может дополнительно включать измерение уровня miR-301a, miR-545 или miR-301a и miR-545 в указанном образце.

Другой аспект настоящего изобретения относится к способу мониторинга течения болезни Альцгеймера у субъекта путем определения уровня по меньшей мере одной микроРНК в первом образце, содержащем циркулирующую микроРНК, взятом у субъекта, определение уровня указанной по меньшей мере одной микроРНК во втором образце, содержащем циркулирующую микроРНК, взятом у субъекта, причем указанный второй образец берут позже первого образца, и сравнение уровней, определенных в первом образце, с уровнями, определенными во втором образце, причем указанные уровни указывают на прогрессирование болезни Альцгеймера, и при этом эта по меньшей мере одна микроРНК представляет собой miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d или их комбинации. В одном варианте способ может дополнительно включать измерение уровня miR-301a, miR-545, или miR-301a и miR-545 в указанных образцах.

Другой аспект настоящего изобретения относится к способу лечения болезни Альцгеймера у субъекта путем определения уровня по меньшей мере одной микроРНК в образце, содержащем циркулирующие микроРНК, взятом у указанного субъекта, при этом отклонение уровня указанной по меньшей мере одной микроРНК от уровня у здорового субъекта, определенное по отношению к соответствующему контролю, указывает на то, что субъект страдает болезнью Альцгеймера; и в случае обнаружения отклонения уровня по меньшей мере одной микроРНК введение субъекту терапевтически эффективного количества композиции, содержащей средство для лечения болезни Альцгеймера. В одном варианте осуществления указанная по меньшей мере одна микроРНК представляет собой miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d или их комбинации. Способ может необязательно дополнительно включать определение уровня miR-301a, miR-545 или miR-301a и miR-545 в указанном образце.

Другой аспект настоящего изобретения относится к способу лечения субъекта, страдающего болезнью Альцгеймера путем идентификации субъекта, страдающего болезнью Альцгеймера, такого что уровень по меньшей мере одной микроРНК в образце, содержащем циркулирующие микроРНК, взятом у субъекта, отличается (например, понижен) от соответствующего контроля, и введение субъекту терапевтически эффективного количества средства для лечения болезни Альцгеймера. В одном варианте осуществления по меньшей мере одна микроРНК представляет собой miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d или их комбинации. Способ может необязательно включать идентификацию субъекта, у которого уровень miR-301a, miR-545 или miR-301a и miR-545 в указанном образце также отличается (например, понижен) от соответствующего контроля. В этих аспектах средство для лечения болезни Альцгеймера может представлять собой Razadyne® (Разадин, галантамин), Exelon® (Экселон, ривастигмин) или Aricept® (Арицепт, донепезил). В одном примере осуществления средство для лечения болезни Альцгеймера представляет собой донепезил или его фармацевтически приемлемую соль или эфир (например, донепезил гидрохлорид).

В другом аспекте настоящего изобретения предложен набор для диагностики болезни Альцгеймера у субъекта, включающий агент, селективно детектирующий присутствие по меньшей мере одной микроРНК в образце, содержащем циркулирующие микроРНК, взятом у субъекта, причем эта по меньшей мере одна микроРНК представляет собой miR-191, miR-15b, miR-142-3p, Let-7g, Let-7d или их комбинации, и инструкции по определению уровня указанной по меньшей мере одной микроРНК, при этом отклонение уровня указанной по меньшей мере одной микроРНК от уровня у здорового субъекта, определенное по отношению к соответствующему контролю, указывает на то, что субъект страдает болезнью Альцгеймера. Такой набор может дополнительно содержать агент, селективно детектирующий присутствие по меньшей мере одной дополнительной микроРНК в указанном образце, причем указанная дополнительная микроРНК представляет собой miR-301a, miR-545 или miR-301a и miR-545. В некоторых вариантах осуществления агент гибридизуется с микроРНК.

В некоторых вариантах осуществления способов и наборов, описанных в настоящем документе, субъект может представлять собой млекопитающее, например человека.

В описанных здесь способах и наборах отклонение уровня по меньшей мере одной микроРНК относительно соответствующего контроля может быть определено путем исполнения программного алгоритма классификации.

В некоторых вариантах осуществления способов и наборов образец может представлять собой физиологическую жидкость, например кровь, лимфу, мочу или слюну. Образец может представлять собой образец, не содержащий клеток, и/или образец, не содержащий микровезикул. В одном варианте осуществления образец представляет собой плазму. В другом варианте осуществления образец представляет собой сыворотку.

В некоторых вариантах осуществления способов и наборов, в которых выбирают или применяют одну микроРНК, указанная микроРНК представляет собой (a) микроРНК, отличную от miR-191, (b) микроРНК, отличную от miR-15b, (c) микроРНК, отличную от miR-142-3p, (d) микроРНК, отличную от Let-7g, и/или (e) микроРНК, отличную от Let-7d.

В некоторых вариантах осуществления способов и наборов, в которых указанный образец представляет собой спинно-мозговую жидкость, микроРНК представляет собой (a) микроРНК, отличную от miR-15b, и/или (b) микроРНК, отличную от miR-191.

КРАТКОЕ ОПИСАНИЕ ФИГУР И ТАБЛИЦ

Фигуры 1A и 1B: Графики рассеяния нормированной экспрессии микроРНК из Группы 1 (20 пациентов с болезнью Альцгеймера (AD, БА) или умеренными когнитивными нарушениями (MCI, ЛКН) (11 AD; 9 MCI) и 20 пациентов нормального контроля (без заболевания, НК)), определенной с использованием теста микроРНК nCounter.

Фигура 2: Графики рассеяния значений линейных кратных изменений, нормированных по средним значениям НК (нормального контроля), для отдельных кандидатных микроРНК-биомаркеров, полученных в Группе 1 (20 пациентов с БА или ЛКН и 20 пациентов НК) с использованием ОТ-кПЦР TaqMan.

Фигура 3: Графики рассеяния значений линейных кратных изменений, нормированных по средним контрольным значениям для отдельных кандидатных микроРНК-биомаркеров, полученных в Группе 2 (20 пациентов с БА и 17 пациентов НК) с использованием ОТ-кПЦР TaqMan.

Таблица 1: Доступные сведения о пациентах из Группы 1, включая диагноз, возраст, пол, баллы MMSE и число посещений, полученные от PrecisionMed, Inc.

Таблица 2: Последовательности и номер доступа в базе miRBASE микроРНК-биомаркеров и микроРНК, использованных для нормировки.

Таблица 3: Корреляция средних значений кратных изменений для кандидатных микроРНК-биомаркеров между платформами Nanostring и TaqMan для образцов Группы 1 (20 БА или ЛКН (11 БА; 9 ЛКН) и 20 НК).

Таблица 4: Данные об относительном значении Ct, полученные путем кПЦР TaqMan с использованием подмножества образцов Группы 1 (11 БА и 20 НК); данные использовали для получения сигнатурных профилей микроРНК-биомаркеров, позволяющих отличать пациентов с БА от пациентов НК.

Таблица 5: Доступные сведения о пациентах из Группы 2, включая диагноз, возраст, пол, баллы MMSE и число посещений, полученные от PrecisionMed, Inc.

Таблица 6: Корреляция средних значений кратных изменений (нормированных по средним контрольным значениям) для кандидатных микроРНК-биомаркеров между Группой 1 и Группой 2, полученных с использованием исследования микроРНК методом ОТ-кПЦР TaqMan.

Таблица 7: Данные об относительном значении Ct, полученные путем кПЦР TaqMan с использованием образцов Группы 2 (20 БА и 17 НК), которые использовали в качестве входных данных для алгоритма предсказания статуса пациентов с БА и НК с использованием сигнатур, полученных по данным Группы 1 (Таблица 4).

Таблица 8A-8C: Сигнатуры кандидатных микроРНК-биомаркеров, указывающие на болезнь Альцгеймера.

Таблица 9A-9B: Точность, специфичность, чувствительность и AUC (площадь под кривой) для сигнатур микроРНК-биомаркеров с точностью >75%.

Таблица 10: Точность, специфичность, чувствительность и AUC (площадь под кривой) для сигнатурных комбинаций 8 микроРНК с использованием образцов Группы 2 для предсказания.

Таблица 11: Точность, специфичность, чувствительность и AUC (площадь под кривой) для отдельных микроРНК с использованием образцов Группы 2 для предсказания.

ПОДРОБНОЕ ОПИСАНИЕ

1. Введение

Настоящее изобретение обеспечивает новые микроРНК-биомаркеры, указывающие на болезнь Альцгеймера, которые можно применять для точной диагностики болезни Альцгеймера у субъекта. Дополнительно предложены способы мониторинга течения болезни Альцгеймера у субъекта, способы лечения субъекта с болезнью Альцгеймера и наборы для диагностики болезни Альцгеймера. В некоторых вариантах осуществления способы включают детектирование внеклеточных, циркулирующих микроРНК в пригодном образце, предпочтительно крови, плазме, сыворотке, моче или слюне.

2. Определения

Перед подробным описанием настоящего изобретения ниже приведены определения некоторых терминов, используемых в данном тексте. Если не указано иное, все технические и научные термины, используемые здесь, имеют значение, принятое среди специалистов в соответствующей области.

Применение терминов единственного и множественного числа, а также аналогичных обозначений в контексте описания настоящего изобретения (в частности, в контексте приведенной ниже формулы) следует понимать как включающее форму единственного и множественного числа, если не указано иное или если контекст явно не подразумевает обратного. Термины “содержащий», “имеющий”, “включающий” и “заключающий в себе” следует понимать как неограничивающие термины (т.е. означающие “включающий, но не ограниченный перечисленным”), если не указано обратное. Указание диапазонов значений в данном тексте служит исключительно упрощенным способом конкретного перечисления каждого отдельного значения, попадающего в этот диапазон, если в тексте не указано иное, каждое отдельное значение включено в описание так, как если бы оно было конкретно приведено.

Термин “субъект” включает животных, которые могут страдать от деменции или могут быть поражены деменцией, связанной с нарушением ЦНС, включая нейродегенеративные заболевания, такие как болезнь Альцгеймера, или любое нарушение, включающее, прямо или опосредованно, болезнь Альцгеймера. Примеры субъектов включают млекопитающих, например людей, приматов, не являющихся людьми, собак, коров, лошадей, свиней, овец, коз, кошек, мышей, кроликов, крыс и трансгенных животных, не являющихся людьми. В некоторых вариантах осуществления субъект представляет собой человека, например человека, страдающего от деменции, ассоциированной с болезнью Альцгеймера, подверженного риску возникновения деменции, ассоциированной с болезнью Альцгеймера, или который потенциально может страдать от деменции, ассоциированной с болезнью Альцгеймера.

Термин “лечить” в данном тексте означает облегчать, снижать или ослаблять по меньшей мере один симптом заболевания у субъекта. Например, применительно к болезни Альцгеймера термин “лечить” включает облегчение, снижение или ослабление нарушения когнитивных функций (такого, как нарушение памяти и/или ориентации), или нарушения глобальной функциональности (общей функциональности, включая виды активности повседневной жизни) и/или замедление или обращение прогрессирующих общих или когнитивных нарушений. Соответственно, термин “лечить” включает также задержку или предотвращение начала заболевания или симптома заболевания до его клинического проявления и/или снижение риска развития или ухудшения симптома заболевания.

“Терапевтически эффективное количество” терапевтического агента или содержащих его комбинаций представляет собой количество, достаточное для лечения заболевания у субъекта. Например, в случае средства для лечения болезни Альцгеймера терапевтически эффективное количество может представлять собой количество, для которого показано, что оно обеспечивает наблюдаемый полезный терапевтический эффект по сравнению с клиническим фоном наблюдаемых признаков и симптомов болезни Альцгеймера.

Термин “примерно” или “приблизительно” обычно означает отклонение в пределах 5% или, более предпочтительно, в пределах 1% от данного значения или диапазона.

3. МикроРНК-биомаркеры болезни Альцгеймера

Настоящее изобретение относится к микроРНК (“miRNA”), представляющим собой биомаркеры, присутствие которых в образцах, взятых у субъектов с болезнью Альцгеймера, может отличаться от присутствия у субъектов, являющихся «нормальными», т.е. у тех, которые не страдают болезнью Альцгеймера. Присутствие микроРНК-биомаркера или набора микроРНК-биомаркеров может различаться в образцах, если установлено, что различие в уровнях экспрессии микроРНК-биомаркера или набора микроРНК-биомаркеров в указанных образцах статистически значимо. Обычные критерии статистической значимости включают, но не ограничиваясь перечисленными: t-критерий, вариационный анализ ANOVA, критерий Краскела-Уоллиса, критерий Уилкоксона, критерий Манна-Уитни и соотношение неравенства. МикроРНК-биомаркеры отдельно или в комбинации можно применять для обеспечения меры относительного риска того, что субъект страдает или не страдает болезнью Альцгеймера.

МикроРНК представляют собой маленькие некодирующие РНК, которые участвуют в регуляции экспрессии генов посредством различных механизмов, включая подавление трансляции. МикроРНК исходно транскрибируются с ДНК как длинные первичные микроРНК транскрипты (“pri-miRNAs”, первичная микроРНК), размер которых варьирует от сотен до тысяч нуклеотидов. В ядре происходит процессинг первичной микроРНК с участием комплекса ферментов Drosha-DGCR8, в результате чего образуется предшественник микроРНК, имеющий структуру петля-стебель (“pre-miRNA”, пре-микроРНК). Пре-микроРНК транспортируется белком экспортином 5 в цитоплазму, где ее расщепляет фермент Dicer, в результате чего образуется зрелая (функциональная) микроРНК. В геноме человека закодировано более 1300 микроРНК, которые собраны в базе “miRBase: The microRNA Database” (http://www.mirbase.org/). Есть информация об экспрессии микроРНК в большом количестве различных типов клеток и тканей, а также во внеклеточных структурах, например в биологических жидкостях.

МикроРНК-биомаркеры болезни Альцгеймера были обнаружены в результате сравнения уровня экспрессии микроРНК в биологических образцах, взятых у субъектов, страдающих болезнью Альцгеймера, с образцами, взятыми у субъектов, являющихся «нормальными», т.е. субъектов, которые не страдают болезнью Альцгеймера, и идентификации микроРНК, которые представлены по-разному. Таким образом было идентифицировано семь по-разному представленных микроРНК-биомаркеров, которые неожиданно оказались указывающими на болезнь Альцгеймера в случае изменения в плазме: miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a, и miR-545 (см. Таблицу 2). Теперь эти микроРНК-биомаркеры можно применять для определения статуса субъекта в отношении болезни Альцгеймера, например субъекта, статус которого в отношении болезни Альцгеймера исходно не известен или у которого подозревают наличие болезни Альцгеймера. Это может быть выполнено путем определения уровня одной или более из miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a и miR-545 или их комбинаций в биологическом образце, взятом у субъекта. Отличие уровня одного или более из этих микроРНК-биомаркеров по сравнению с уровнем в биологическом образце, взятом у здорового субъекта, указывает на то, что субъект страдает болезнью Альцгеймера.

Субъект, у которого определено отклонение уровня одного или большего числа микроРНК-биомаркеров от здорового субъекта, возможно страдает болезнью Альцгеймера, включая раннюю стадию болезни Альцгеймера, умеренную или переходную стадию болезни Альцгеймера или тяжелую или позднюю стадию болезни Альцгеймера. В одном варианте осуществления уровень одного или большего числа микроРНК-биомаркеров можно применять для диагностики болезни Альцгеймера у субъекта с симптомами, характерными для ранней стадии болезни Альцгеймера, также известной как продромальная болезнь Альцгеймера. У субъектов с ранней стадией болезни Альцгеймера балл MMSE обычно составляет 24-30. Часто встречаются жалобы на умеренную потерю памяти и снижение способности выполнять сложные операции со стороны самих пациентов, их партнеров или ухаживающих за ними лиц.

В другом варианте осуществления уровень одного или большего числа микроРНК-биомаркеров можно применять для диагностики болезни Альцгеймера у субъекта с симптомами, характеризующимися как “снижение когнитивных способностей средней тяжести”, также называемое “умеренной” или “промежуточной” болезнью Альцгеймера. Снижение когнитивных способностей средней тяжести характеризуется большими провалами в памяти и началом нарушения когнитивных функций. На этой стадии показана некоторая помощь в повседневной деятельности.

В другом варианте осуществления уровень одного или большего числа микроРНК-биомаркеров можно применять для диагностики болезни Альцгеймера у субъекта с симптомами, характерными для «тяжелого снижения когнитивных функций», также называемого “умеренной” или “промежуточной” болезнью Альцгеймера. При тяжелых нарушениях когнитивных функций усугубляются проблемы с памятью и могут возникнуть значительные изменения личности. Пораженным лицам обычно требуется серьезная помощь в выполнении обычных повседневных дел.

В другом варианте осуществления уровень одного или большего числа микроРНК-биомаркеров можно применять для диагностики болезни Альцгеймера у субъекта с симптомами, характерными для “очень тяжелого снижения когнитивных функций”, также называемого «тяжелой» болезнью Альцгеймера или «поздней стадией» болезни Альцгеймера. Поздняя стадия болезни Альцгеймера или очень тяжелое снижение когнитивных функций является последней стадией заболевания. Субъекты обычно теряют способность реагировать на окружение, способность говорить и, наконец, способность контролировать движение (см., например, http://www.alz.org).

В другом варианте осуществления уровень одного или большего числа микроРНК-биомаркеров можно применять для диагностики болезни Альцгеймера у субъекта с баллом по шкале MMSE от 0 до 26, например, с баллом MMSE, равным 0-10, с баллом MMSE, равным 0-20, с баллом MMSE, равным 0-26, и т.д. “MMSE” обозначает краткую шкалу оценки психического статуса, используемую среди специалистов по оценке когнитивных способностей. В ходе теста MMSE врач или другой медицинский специалист задает пациенту ряд вопросов, направленных на оценку диапазона обычных психических навыков. Часто задаваемые вопросы включают, например, запоминание или повторение названий обычных объектов, указание года, даты, времени года, дня недели, счет в обратом порядке от ста с шагом 7, произнесение по буквам в обратном порядке слова “world” (мир), именование показываемых исследователем обычных объектов, указание расположения кабинета исследователя, повторение обычных фраз после произнесения их исследователем, копирование рисунка двух сцепленных форм и выполнение серии инструкций из трех частей (например, взять лист бумаги, согнуть пополам и положить на пол). Максимальный балл по шкале теста MMSE составляет 30 очков. Обычно считают, что пациенты с оценкой 27-30 по шкале MMSE не имеют нарушения когнитивных функций, что пациенты с оценкой 21-26 по шкале MMSE имеют легкие когнитивные нарушения, что пациенты с оценкой 11-20 по шкале MMSE имеют умеренные (moderate) когнитивные нарушения, а пациенты с оценкой 0-10 по шкале MMSE имеют тяжелые когнитивные нарушения. В некоторых вариантах осуществления пациентов считают страдающими болезнью Альцгеймера на поздней стадии (средней тяжести или тяжелой).

В одном варианте осуществления уровень одного или большего числа микроРНК-биомаркеров можно применять для мониторинга течения болезни Альцгеймера у субъекта. Статус (состояние) болезни Альцгеймера у субъекта может меняться с течением времени. Например, со временем болезнь может улучшаться или ухудшаться (усугубляться). При таком улучшении или ухудшении уровень одного или большего числа микроРНК-биомаркеров, определяемый во взятых у пациента образцах, может меняться. Например, уровень одной или более из miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a и/или miR-545 снижается при развитии болезни Альцгеймера. Соответственно, течение болезни Альцгеймера можно мониторировать путем определения уровня одного или большего числа микроРНК-биомаркеров в первом образце, взятом у субъекта, и определение уровня одного или большего числа микроРНК-биомаркеров во втором образце, взятом у субъекта, где второй образец взят позже, чем первый образец. Уровни во втором образце по отношению к уровням в первом образце являются показателем прогрессирования заболевания. Например, снижение уровня одной или более из miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a и/или miR-545 от первого образца ко второму образцу указывает на то, что у субъекта развилась болезнь Альцгеймера, или на то, что заболевание ухудшилось. И наоборот, повышение уровня одной или более из miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a и/или miR-545 от первого образца ко второму образцу указывает на улучшение заболевания. В одном варианте осуществления один или большее число микроРНК-биомаркеров представляют собой miR-191, miR-15b, let-7d, let-7g, miR-142-3p и их комбинаций.

Имеет ли место отклонение уровня микроРНК-биомаркера в биологическом образце, взятом у субъекта, от уровня микроРНК-биомаркера у здорового субъекта, можно определить путем сравнения уровня микроРНК-биомаркера в указанном образце, взятом у исследуемого субъекта, с соответствующим контролем. Специалист сможет выбрать подходящий контроль для данного способа анализа (теста). Например, соответствующий контроль может представлять собой биологический образец, взятый у известного субъекта, например субъекта, о котором известно, что он является нормальным (т.е. не страдает болезнью Альцгеймера), или субъекта, о котором известно, что он страдает болезнью Альцгеймера. В случае, когда соответствующий образец берут у здорового субъекта, статистически значимое отклонение уровня микроРНК-биомаркера у исследуемого субъекта относительно соответствующего контроля указывает на то, что субъект страдает болезнью Альцгеймера. В случае, когда соответствующий образец берут у субъекта, о котором известно, что он страдает болезнью Альцгеймера, уровни, сравнимые с или более низкие, чем в таком контроле, являются показателем болезни Альцгеймера с учетом разницы в уровнях для образцов, взятых у здорового субъекта. В одном варианте осуществления отклонение уровня микроРНК-биомаркера представляет собой снижение. Соответствующий контроль может также представлять собой эталонный стандарт. Эталонный стандарт служит эталонным уровнем для сравнения, при котором исследуемые образцы сравнивают с эталонным стандартом с целью установления статуса субъекта по болезни Альцгеймера. Эталонный стандарт может представлять уровень одного или большего числа микроРНК-биомаркеров у известного субъекта, например субъекта, о котором известно, что он является нормальным (т.е. не страдает болезнью Альцгеймера), или субъекта, о котором известно, что он страдает болезнью Альцгеймера. Аналогично, эталонный стандарт может представлять уровень одного или большего числа микроРНК-биомаркеров в популяции известных субъектов, например популяции субъектов, о которых известно, что они являются нормальными (здоровыми), или в популяции субъектов, о которых известно, что они страдают болезнью Альцгеймера.

Эталонный стандарт может быть получен, например, путем объединения образцов от множества индивидов и определения уровня микроРНК-биомаркера в объединенных образцах, что позволяет получить стандарт по усредненной популяции. Такой эталонный стандарт представляет средний уровень микроРНК-биомаркера в популяциях индивидов. Также может быть получен эталонный стандарт, например, путем усреднения уровня микроРНК-биомаркера, присутствие которого было определено в отдельных образцах, взятых у множества лиц. Такой стандарт также представляет средний уровень микроРНК-биомаркера в популяции лиц. Эталонный стандарт также может представлять собой набор значений, каждое из которых представляет собой уровень микроРНК-биомаркера у известного субъекта в популяции лиц. В некоторых вариантах осуществления может быть осуществлено сравнение исследуемых образцов с таким набором значений, чтобы установить статус субъекта по болезни Альцгеймера. В некоторых вариантах осуществления эталонный стандарт представляет собой абсолютное значение. В таких вариантах осуществления возможно сравнение исследуемых образцов с абсолютным значением с целью определения статуса субъекта по болезни Альцгеймера. В одном варианте осуществления сравнение уровня одной или большего числа микроРНК в образце с соответствующем контролем может быть выполнено путем исполнения программного алгоритма классификации. Специалист легко сможет представить дополнительные соответствующие контроли, которые могут быть подходящими в зависимости от рассматриваемого способа анализа. Упомянутые выше соответствующие контроли представляют собой примеры и не являются ограничивающими.

В целом, снижение уровня одной или более из miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a и/или miR-545 в биологическом образце, полученном у субъекта, относительно соответствующего контроля, представляющего уровень одной или более из miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a и/или miR-545 соответственно у здорового субъекта, указывает на то, что субъект страдает болезнью Альцгеймера. В случаях, когда соответствующий контроль представляет уровень микроРНК-биомаркеров у субъекта, страдающего болезнью Альцгеймера, обычно уровни одной или более из miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a и/или miR-545, сравнимые или более низкие, чем уровни такого контроля, указывают на болезнь Альцгеймера.

В некоторых случаях, когда у исследуемого субъекта определяют уровни двух или более микроРНК-биомаркеров, может наблюдаться снижение уровня одного или большего числа микроРНК-биомаркеров, при отсутствии изменения или повышении уровня одного или большего числа микроРНК-биомаркеров относительно соответствующего контроля. В таких примерах различие в уровне одного или большего числа микроРНК-биомаркеров относительно соответствующего контроля, представляющего уровень микроРНК-биомаркеров у здорового субъекта, указывает на то, что исследуемый субъект страдает болезнью Альцгеймера. Определение такого различия можно выполнять с помощью алгоритма классификации, описанного в настоящем тексте.

4. Биологические образцы

Уровень экспрессии одного или большего числа микроРНК-биомаркеров может быть определен во взятом у субъекта биологическом образце. Взятый у субъекта образец представляет собой образец, происходящий от субъекта. Такой образец после взятия у субъекта может быть подвергнут дальнейшей обработке. Например, из образца может быть выделена РНК. В указанном примере выделенная из образца РНК представляет собой также и взятый у субъекта образец . A биологический образец, подходящий для определения уровня одного или большего числа микроРНК-биомаркеров, может быть получен по существу из любого источника, так как было показано, что экспрессия микроРНК происходит в клетках, тканях и жидкостях всего организма. При этом в одном из аспектов настоящего изобретения уровни одного или более биомаркера, указывающего на болезнь Альцгеймера, могут быть определены в образце, взятом у субъекта неинвазивным путем. Существующие биомаркеры болезни Альцгеймера (например, Aβ1-42, тау-белок, т.д.) часто измеряют в образце, полученном из спинномозговой жидкости (СМЖ) или из тканей головного мозга. СМЖ чаще всего получают с помощью люмбальной пункции, которая представляет собой болезненную процедуру, связанную с факторами риска, в том числе кровотечением в спинномозговой канал, постпункционной головной болью и инфекцией. Обнаружение биомаркеров в образце ткани головного мозга в настоящее время нецелесообразно для диагностики болезни Альцгеймера у живого субъекта и используется в основном для посмертного подтверждения диагноза, поставленного с помощью других способов. Соответственно, предпочтительным является получение образца не из ткани головного мозга, а из другого источника. МикроРНК-биомаркеры, описанные в настоящей заявке, указывают на болезнь Альцгеймера и могут быть обнаружены в биологических образцах, полученных неинвазивным путем.

В предпочтительном варианте осуществления биологический образец, используемый для определения уровня одного или большего числа микроРНК-биомаркеров, представляет собой образец, содержащий циркулирующие микроРНК, например внеклеточные микроРНК. Внеклеточные микроРНК свободно циркулируют в разнообразном биологическом материале, в том числе в биологических жидкостях, таких как жидкости системы кровообращения, например образец крови или образец лимфы, или образцах другой биологической жидкости, такой как СМЖ, моча или слюна. Соответственно, в некоторых вариантах осуществления биологический образец, используемый для определения уровня одного или большего числа микроРНК-биомаркеров, представляет собой биологическую жидкость, например кровь, фракции крови, сыворотку, плазму, мочу, слюну, слезы, пот, сперму, влагалищные выделения, лимфу, бронхиальный секрет, СМЖ и т.д. В некоторых вариантах осуществления указанный образец представляет собой образец, полученный неинвазивным путем. В некоторых вариантах осуществления указанный образец получают из биологической жидкости, не являющейся СМЖ.

Циркулирующие микроРНК включают микроРНК клеток (клеточную микроРНК), внеклеточные микроРНК микровезикул (ассоциированная с микровезикулами микроРНК) и внеклеточные микроРНК, не связанные с клетками или микровезикулами (внеклеточная невезикулярная микроРНК). В некоторых вариантах осуществления биологический образец, используемый для определения уровня одного или большего числа микроРНК-биомаркеров (например, образец, содержащий циркулирующие микроРНК), может содержать клетки. В других вариантах осуществления указанный биологический образец может не содержать или по существу не содержать клеток (например, образец сыворотки). Указанный образец также может не содержать или по существу не содержать микровезикул. Например, образец, не содержащий или по существу не содержащий микровезикул, представляет собой такой образец, содержание микровезикул в котором достаточно мало, чтобы не создавать помех для точного определения уровня невезикулярных микроРНК в указанном образце. В некоторых вариантах осуществления образец, содержащий циркулирующие микроРНК, например внеклеточные микроРНК, представляет собой полученный из крови образец. Примеры полученных из крови типов образцов включают, например, образец плазмы, образец сыворотки, образец крови и т.д. В других вариантах осуществления образец, содержащий циркулирующие микроРНК, представляет собой образец лимфы. Циркулирующие микроРНК также обнаруживаются в моче и слюне, и биологические образцы, полученные из указанных источников, также подходят для определения уровня одного или большего числа микроРНК-биомаркеров.

5. Определение уровня микроРНК-биомаркеров в образце

Уровень одного или большего числа микроРНК-биомаркеров в биологическом образце может быть определен с помощью любого подходящего способа. Может применяться любой надежный способ измерения уровня или количества микроРНК в образце. Как правило, микроРНК могут быть обнаружены и количественно определены в таком образце (в том числе в его фракциях), как образцы выделенной РНК, при помощи различных способов, известных для мРНК, включая, например, способы, основанные на амплификации (например, полимеразная цепная реакция (ПЦР), ПЦР в реальном времени (ПЦР-РВ), количественная полимеразная цепная реакция (кПЦР), амплификация по типу катящегося кольца и т.д.), способы, основанные на гибридизации (например, гибридизационные матрицы (в частности, микрочипы), анализ NanoString, Нозерн-блоттинг, усиление сигнала методом разветвленной ДНК (рДНК), гибридизация in situ и т.д.), и способы на основе секвенирования (например, способы секвенирования нового поколения, в частности применение платформ Illumina или IonTorrent). Другие примеры методик включают анализ с помощью защиты от рибонуклеазы (RPA) и масс-спектроскопию.

В некоторых вариантах осуществления РНК преобразуют в ДНК (кДНК) перед анализом. кДНК может быть получена обратной транскрипцией выделенных микроРНК с применением общепринятых методик. Известны и коммерчески доступны наборы для обратной транскрипции микроРНК. Примеры подходящих наборов включают, но не ограничиваясь перечисленными, набор для обратной транскрипции микроРНК mirVanaTM TaqMan® (Ambion, Остин, Техас) и набор для обратной транскрипции микроРНК TaqMan® (Applied Biosystems, Фостер-Сити, Калифорния). Универсальные праймеры или специфические праймеры, включая микроРНК-специфические праймеры типа «петля-на-стебле», известны и коммерчески доступны, например, от Applied Biosystems. В некоторых вариантах осуществления микроРНК амплифицируют перед измерением. В других вариантах осуществления уровень микроРНК измеряют во время процесса амплификации. В дальнейших вариантах осуществления уровень микроРНК не амплифицируют перед измерением. Некоторые примеры способов, подходящих для определения уровня микроРНК в образце, более подробно описаны ниже. Указанные способы приводятся исключительно для наглядности, и для специалиста будет очевидно, что могут быть использованы также другие подходящие способы.

A. Способы, основанные на амплификации

Существует множество основанных на амплификации способов определения уровня последовательностей нуклеиновых кислот микроРНК, включая, но не ограничиваясь перечисленными, ПЦР, РВ-ПЦР, кПЦР и амплификацию по типу катящегося кольца. Другие основанные на амплификации техники включают, например, лигазную цепную реакцию, мультиплексную амплификацию лигированных зондов, транскрипцию in vitro (IVT), амплификацию с замещением цепей, транскрипционно-опосредованную амплификацию, РНК-амплификацию (по Eberwine) и другие способы, известные специалистам в данной области техники.

Стандартная ПЦР-реакция включает несколько стадий, или циклов, избирательного амплифицирования целевых нуклеиновых кислот: стадию денатурации, во время которой целевую нуклеиновую кислоту денатурируют; стадию отжига, во время которой группа ПЦР-праймеров (а именно прямой и обратный праймеры) соединяется с комплементарными цепями ДНК, и стадию удлинения, во время которой термостабильная ДНК-полимераза удлиняет указанные праймеры. Повторяя указанные стадии несколько раз, амплифицируют фрагмент ДНК с получением ампликона, соответствующего целевой последовательности. Стандартные ПЦР-реакции включают 20 или более циклов денатурации, отжига и удлинения. Во многих случаях стадии отжига и удлинения могут проводиться параллельно, в этом случае цикл включает только две стадии. Перед ПЦР-амплификацией может проводиться реакция обратной транскрипции (которая дает последовательность кДНК, комплементарную микроРНК). Реакции обратной транскрипции включают применение, например, РНК-зависимой ДНК-полимеразы (обратной транскриптазы) и праймера.

Известны и коммерчески доступны наборы для количественной ПЦР микроРНК в режиме реального времени. Примеры подходящих наборов включают, но не ограничиваясь перечисленными, набор для анализа микроРНК TaqMan® (Applied Biosystems) и набор для обнаружения микроРНК методом РВ-кПЦР mirVanaTM (Ambion). МикроРНК может быть лигирована в одноцепочечный олигонуклеотид, содержащий последовательности универсальных праймеров, полиаденилированную последовательность или адапторную последовательность, до обработки обратной транскриптазой и амплифицирована с применением праймера, комплементарного последовательности универсального праймера, поли(T)праймера или праймера, содержащего последовательность, комплементарную адапторной последовательности.

В некоторых случаях могут быть разработаны индивидуальные методы РВ-кПЦР анализа для определения уровней микроРНК. Специальные методы РВ-кПЦР анализа для измерения микроРНК в биологическом образце, например биологической жидкости, могут быть разработаны с применением, например, способов, задействующих удлиненный праймер для обратной транскрипции и модифицированную закрытой нуклеиновой кислотой ПЦР. Специальные методы анализа микроРНК могут быть протестированы проведением анализа серии разведений химически синтезированных микроРНК, соответствующих целевой последовательности. Это позволяет определить предел обнаружения и диапазон линейности количественного определения для каждого анализа. Кроме того, при использовании в качестве калибровочной кривой эти данные позволяют оценить абсолютную концентрацию микроРНК, обнаруживаемых в биологических образцах.

Кривые амплификации могут необязательно быть валидированы для подтверждения того, что значения Ct оцениваются в диапазоне линейности каждого графика амплификации. Как правило, диапазон линейности составляет несколько порядков. Для каждой анализируемой целевой микроРНК может быть получена и проанализирована в серии разведений химически синтезированная версия указанной микроРНК для определения предела чувствительности анализа и диапазона линейности количественного определения. Относительные уровни экспрессии могут быть определены, например, в соответствии со способом 2(-ΔΔ C(T)), согласно описанию в Livak et al., Analysis of relative gene expression data using real-time quantitative PCR and the 2(-ΔΔ C(T)) Method. Methods (2001) Dec;25(4):402-8.

В некоторых вариантах осуществления две или более микроРНК амплифицируют в одном реакционном объеме. Например, мультиплексная к-ПЦР, такая как РВ-кПЦР, позволяет проводить одновременное амплифицирование и количественное определение по меньшей мере двух представляющих интерес микроРНК в одном реакционном объеме с помощью применения более чем одной пары праймеров и/или более чем одного зонда. Указанные пары праймеров содержат по меньшей мере один амплифицирующий праймер, который специфически связывает каждую микроРНК, а указанные зонды помечены таким образом, чтобы их возможно было различить, что, соответственно, позволяет проводить одновременное количественное определение нескольких микроРНК.

Амплификация по типу катящегося кольца представляет собой управляемую ДНК-полимеразой реакцию, позволяющую реплицировать замкнутые в кольцо олигонуклеотидные зонды с линейной или нелинейной кинетикой в изотермических условиях (см., например, Lizardi et al., Nat. Gen. (1998) 19(3):225-232; Gusev et al., Am. J. Pathol. (2001) 159(1):63-69; Nallur et al., Nucleic Acids Res. (2001) 29(23):E118). В присутствии двух праймеров, один из которых гибридизуется с (+) нитью ДНК, а второй гибридизуется с (-) нитью, сложный паттерн замещения цепей приводит к синтезу более чем 10^9 копий каждой молекулы ДНК за 90 минут или менее. Тандемно соединенные копии замкнутой кольцевой молекулы ДНК могут быть получены с применением одиночного праймера. Указанный процесс может также осуществляться с применением матрикс-ассоциированной ДНК. Матрица, используемая для амплификации по типу катящегося кольца, может быть обратно транскрибированной. Указанный способ может применяться для высокочувствительной индикации последовательности и уровня экспрессии микроРНК при очень низких концентрациях микроРНК (см., например, Cheng et al., Angew Chem. Int. Ed. Engl. (2009) 48(18):3268-72; Neubacher et al., Chembiochem. (2009) 10(8):1289-91).

B. Способы, основанные на гибридизации

МикроРНК могут быть обнаружены с применением способов, основанных на гибридизации, включая, но не ограничиваясь перечисленными, гибридизационные матрицы (например, микрочипы), анализ NanoString, Нозерн-блоттинг, усиление сигнала методом разветвленной ДНК (рДНК) и гибридизацию in situ.

Микрочипы могут применяться для измерения уровней экспрессии больших количеств микроРНК одновременно. Микрочипы могут быть получены с применением разнообразных технологий, включая печать тонкими иглами на стеклянных пластинах, фотолитографию с применением готовых шаблонов, фотолитографию с применением динамических микрозеркальных устройств, струйную печать или электрохимическую обработку микроэлектродных матриц. Также подходят микрожидкостные матрицы TaqMan (TaqMan Low-Density Arrays) на основе матриц для микрожидкостной РВ-кПЦР-реакции, а также сходные методы на основе микрожидкостной РВ-кПЦР.

В одном из примеров детекции на основе микрочипов различные олигонуклеотиды (например, 200+ 5'-аминомодифицированные-C6 олигонуклеотиды), соответствующие смысловым последовательностям микроРНК человека, точечно наносят на трехмерные пластины CodeLink (GE Health/Amersham Biosciences) в конечной концентрации приблизительно 20 мкМ и обрабатывают в соответствии с рекомендациями производителя. Первую нить кДНК, синтезированную из 20 мкг очищенной с применением TRIzol тотальной РНК, метят биотинилированным ddUTP с помощью набора для концевого мечения Enzo BioArray (Enzo Life Sciences Inc.). Гибридизация, окрашивание и отмывка могут проводиться в соответствии с модифицированным протоколом для антисмысловой геномной матрицы Affymetrix Antisense Genome Array.

Для сканирования изображений могут применяться сканер Axon B-4000 и программное обеспечение Gene-Pix Pro 4.0 или другое подходящее программное обеспечение. Участки, неположительные после вычитания фона, и выпадающие значения, определенные с помощью процедуры ESD, удаляют. Полученные значения интенсивности сигнала нормализуют по медианным значениям для чипа и используют для расчета значений среднего геометрического и стандартной ошибки для каждой микроРНК. Каждый сигнал микроРНК может быть представлен в виде логарифма по основанию 2, затем можно применять одновыборочный t-критерий. Независимая гибридизация для каждого образца может быть проведена на чипах с нанесением каждой микроРНК несколько раз для повышения устойчивости данных.

Микрочипы могут применяться для определения профиля экспрессии микроРНК при заболеваниях. Например, из образца может быть экстрагирована РНК, и необязательно проведена селекция микроРНК по размеру из тотальной РНК. К 5'- и 3'-концам микроРНК могут быть присоединены олигонуклеотидные линкеры, и полученные продукты лигирования применяют в качестве матриц для РВ-ПЦР-реакции. ПЦР-праймер смысловой цепи может содержать присоединенный к 5'-концу флуорофор, таким образом обеспечивая мечение смысловой цепи указанного ПЦР-продукта. Указанный ПЦР-продукт денатурируют и затем гибридизуют с микрочипом. ПЦР-продукт, называемый «целевой нуклеиновой кислотой», комплементарный последовательности соответствующего зонда захвата микроРНК на матрице, гибридизуется, путем спаривания оснований, с участком, к которому присоединены указанные зонды захвата. Указанный участок флуоресцирует при возбуждении с применением лазерного сканера микрочипов.

Затем интенсивность флуоресценции каждого участка оценивают в пересчете на число копий конкретной микроРНК с применением ряда позитивных и негативных контролей и методов нормализации данных матрицы, что позволяет оценить уровень экспрессии конкретной микроРНК.

Тотальная РНК, содержащая микроРНК, выделенная из образца биологической жидкости, может также быть использована непосредственно, без селекции по размеру микроРНК. Например, указанная РНК может быть помечена по 3'-концу с применением T4 РНК-лигазы и меченного флуорофором короткого РНК-линкера. Меченные флуорофором микроРНК, комплементарные соответствующим микроРНК-последовательностям зондов захвата на матрице, гибридизуются, путем спаривания оснований, с участком, к которому прикреплены указанные зонды захвата. Интенсивность флуоресценции каждого участка затем оценивают в пересчете на число копий конкретной микроРНК с применением ряда позитивных и негативных контролей и методов нормализации данных матрицы, что позволяет оценить уровень экспрессии конкретной микроРНК.

Могут применяться разные типы микрочипов, включая, но не ограничиваясь перечисленными, точечные олигонуклеотидные микрочипы, готовые олигонуклеотидные микрочипы или точечные длинные олигонуклеотидные матрицы.

МикроРНК также могут быть обнаружены без амплифицирования с применением аналитической системы nCounter Analysis System (NanoString Technologies, Сиэтл, Вашингтон). Указанная технология задействует два зонда на основе нуклеиновых кислот, которые гибридизуются в растворе (например, репортерный зонд и зонд захвата). После гибридизации избыток зондов удаляют, и комплексы зонд/мишень анализируют в соответствии с протоколом производителя. NanoString Technologies поставляет наборы nCounter для анализа микроРНК, позволяющие с большой специфичностью различать очень сходные микроРНК.

МикроРНК также могут быть обнаружены при помощи метода усиления сигнала с применением разветвленной ДНК (рДНК) (см., например, Urdea, Nature Biotechnology (1994), 12:926-928). МикроРНК-тесты, основанные на усилении сигнала рДНК, коммерчески доступны. Одним из таких тестов является QuantiGene® 2.0 miRNA Assay (Affymetrix, Санта-Клара, Калифорния).

Нозерн-блоттинг и гибридизация in situ также могут применяться для обнаружения микроРНК. Подходящие способы проведения нозерн-блоттинга и гибридизации in situ известны в данной области техники.

C. Способы на основе секвенирования

При возможности могут применяться также современные способы секвенирования. Например, микроРНК могут быть обнаружены с применением Illumina® Next Generation Sequencing (например, метода «секвенирования с помощью синтеза» (Sequencing-By-Synthesis) или TruSeq с применением, например, систем HiSeq, HiScan, GenomeAnalyzer или MiSeq (Illumina, Inc., Сан-Диего, Калифорния)). МикроРНК могут также быть обнаружены с применением метода секвенирования Ion Torrent (Ion Torrent Systems, Inc., Гилфорд, Коннектикут) или других подходящих способов полупроводникового секвенирования.

D. Дополнительные инструменты для обнаружения микроРНК

Масс-спектроскопия может применяться для количественного определения микроРНК с применением РНКазного картирования. Выделенные РНК могут ферментативно расщепляться РНК-эндонуклеазами (РНКазами), обладающими высокой специфичностью (например, РНКаза Tl, расщепляющая все немодифицированные остатки гуанозина со стороны 3'), перед их анализом с помощью методов МС или тандемной МС (МС/МС). Первый разработанный подход задействовал хроматографическое разделение в режиме реального времени продуктов эндонуклеазного расщепления с помощью ВЭЖХ с обращенной фазой непосредственно в сочетании с ЭСИ-МС (ESI-MS). Наличие посттранскрипционных модификаций может быть определено по сдвигам масс относительно ожидаемых на основании последовательности РНК. Ионы с аномальной массой/зарядом затем могут быть выделены для локализации расположения последовательности в посттранскрипционно модифицированном нуклеозиде с применением тандемного МС-секвенирования.

Матрично-активированная лазерная десорбция/ионизация (МАЛДИ-МС) также применялась в качестве аналитического метода получения информации о посттранскрипционно модифицированных нуклеозидах. Методики на основе МАЛДИ отличаются от основанных на ЭСИ методик наличием стадии разделения. При МАЛДИ-МС масс-спектрометр используют для разделения микроРНК.

Для анализа ограниченного количества интактных микроРНК может применяться система капиллярной ЖХ в сочетании с нано-ЭСИ-МС с использованием гибридного масс-спектрометра с линейной/орбитальной ионной ловушкой (LTQ Orbitrap XL, Thermo Fisher Scientific) или тандем-квадрупольного время-пролетного масс-спектрометра (QSTAR® XL, Applied Biosystems), оснащенного специально сконструированным источником ионного наноспрея, клапаном Nanovolume (Valco Instruments) и нано-ВЭЖХ системой без деления потока (DiNa, KYA Technologies). Аналит/ТЭАА загружают в ЖХ наноколонку-ловушку, обессоливают, а затем концентрируют. Интактные микроРНК элюируют из колонки-ловушки, инжектируют непосредственно в капиллярную колонку Cl 8 и хроматографируют с помощью ОФ-ВЭЖХ в градиенте растворителей с возрастающей полярностью. Хроматографический элюент распыляется из наконечника-распылителя, присоединенного к капиллярной колонке, с напряжением ионизации, позволяющим проводить сканирование ионов в режиме отрицательной полярности.

Дополнительные способы обнаружения и измерения микроРНК включают, например, анализ с замещением цепей (Third Wave Technologies, Inc.), поверхностный плазмонный резонанс (SPR) кДНК, MTDNA (металлическая ДНК; Advance Technologies, Саскатун, Саскачеван) и методы на основе единичных молекул, например, разработанные US Genomics. Неединичные микроРНК могут быть обнаружены с применением формата микрочипов с применением нового подхода, сочетающего поверхностную ферментативную реакцию с усиленной наночастицами визуализацией поверхностного плазмонного резонанса (SPRI). В ходе поверхностной реакции поли(A) полимеразы образовывались поли(A)-хвосты на микроРНК, гибридизованных на микрочипах с закрытой нуклеиновой кислотой (ЗНК). ДНК-модифицированные наночастицы затем адсорбируют на поли(A)-хвостах и определяют с помощью SPRI. Указанный сверхчувствительный метод усиленной наночастицами SPRI может применяться для определения профилей микроРНК на аттомольных уровнях.

E. Обнаружение амплифицированных или неамплифицированных микроРНК

В некоторых вариантах осуществления для обнаружения амплифицированных или неамплифицированных микроРНК применяют метки, красители или меченые зонды и/или праймеры. Специалист в данной области техники сможет определить подходящие способы обнаружения на основании чувствительности способа обнаружения и концентрации мишени. В зависимости от чувствительности способа обнаружения и концентрации мишени перед детекцией может требоваться или не требоваться амплифицирование. Специалисту в данной области техники будет понятно, для каких способов обнаружения предпочтительно проведение амплифицирования микроРНК.

Зонд или праймер может включать стандартные (A, T или U, G и C) основания или модифицированные основания. Модифицированные основания включают, но не ограничиваясь перечисленными, AEGIS-основания (от Eragen Biosciences), которые были описаны, например, в патентах США №5432272, 5965364 и 6001983. Согласно определенным аспектам основания соединены природной фосфодиэфирной связью или другой химической связью. Другие химические связи включают, не ограничиваясь перечисленными, пептидную связь или связь на основе закрытой нуклеиновой кислоты (ЗНК-связь), описанные, например, в патенте США №7060809.

Согласно еще одному аспекту олигонуклеотидные зонды или праймеры, присутствующие в реакции амплифицирования, подходят для мониторинга количества продукта амплифицирования, представленного как функция от времени. Согласно определенным аспектам зонды, имеющие разную однонитевую/двунитевую структуру, применяют для обнаружения нуклеиновой кислоты. Зонды включают, но не ограничиваясь перечисленными, зонды для 5′-экзонуклеазного анализа (например, TaqMan™) (см. патент США №5538848), молекулярные маяки типа «петля-на-стебле» (см., например, патенты США №6103476 и 5925517), маяки "без стебля" или линейные маяки (см., например, WO 9921881, патенты США №6485901 и 6649349), молекулярные маяки на основе пептидной нуклеиновой кислоты (ПНК) (см., например, патенты США №6355421 и 6593091), линейные ПНК-маяки (см., например патент США №6329144), зонды без использования FRET (см., например, патент США №6150097), зонды Sunrise™/AmplifluorB™ (см., например, патент США №6548250), зонды типа «петля-на-стебле» и дуплексные зонды Scorpion™ (см., например, патент США №6589743), выпетливающие зонды (см., например, патент США №6590091), псевдоузловые зонды (см., например, патент США №6548250), цикликоны (см., например, патент США №6383752), зонд MGB Eclipse™ (Epoch Biosciences), шпилечные зонды (см., например, патент США №6596490), светящиеся ПНК-зонды, зонды с гасителем-антипраймером (Li et al., Clin. Chem. 53:624-633 (2006)), зонды на основе самоорганизующихся наночастиц и модифицированные ферроценом зонды, описанные, например, в патенте США №6485901.

В некоторых вариантах осуществления один или большее число праймеров в реакции амплификации могут содержать метку. В других вариантах осуществления различные зонды и праймеры содержат детектируемые метки, которые можно отличить друг от друга. В некоторых вариантах осуществления нуклеиновая кислота, такая как зонд или праймер, может быть мечена двумя или более различимыми метками.

В некоторых аспектах метка присоединена к одному или большему числу зондов и обладает одним или большим числом следующих свойств: (i) генерирует детектируемый сигнал; (ii) взаимодействует со второй меткой, модифицируя детектируемый сигнал, генерируемый второй меткой, например FRET (резонансный перенос энергии флуоресценции); (iii) стабилизирует гибридизацию, например образование дуплексов; и (iv) обеспечивает участника связывающего комплекса или аффинного множества, например аффинность, антитело-антиген, ионные комплексы, гаптен-лиганд (например, биотин-авидин). В других аспектах применение меток может быть реализовано с использованием любого из большого числе известных меток, связей, связывающих групп, реагентов, условий реакции и методов анализа и очистки.

Детектирование микроРНК может быть осуществлено прямыми или непрямыми методами. В прямых методах детектирования одну или большее число микроРНК детектируют посредством детектируемой метки, которая связана с молекулой нуклеиновой кислоты. В таких методах микроРНК может быть снабжена меткой перед связыванием с зондом. Соответственно, связывание детектируют путем скрининга на меченую микроРНК, которая связана с зондом. Зонд может быть необязательно присоединен к бусине в реакционном растворе.

В некоторых вариантах осуществления детектирование нуклеиновых кислот определяют по прямому связыванию с меченым зондом с последующим детектированием зонда. В одном варианте осуществления изобретения датектирование нуклеиновых кислот, таких как амплифицированные микроРНК, осуществляют с использованием микросфер FIexMAP Microspheres (Luminex), конъюгированных с зондами, для захвата целевых нуклеиновых кислот. Некоторые способы могут включать детектирование полинуклеотидными зондами, модифицированными флуоресцентными метками или детектирование разветвленных ДНК (рДНК), например.

В других вариантах осуществления детектирование нуклеиновых кислот осуществляют методами непрямого детектирования. Например, можно смешать биотинилированный зонд с конъюгированным со стрептавидином красителем для детектирования связанной нуклеиновой кислоты. Молекула стрептавидина связывается с биотиновой меткой на амплифицированной микроРНК, и связанную микроРНК детектируют путем детектирования молекулы красителя, присоединенной к молекуле стрептавидина. В одном варианте осуществления конъюгированная со стрептавидином молекула красителя включает Phycolink® Streptavidin R-Phycoerythrin (PROzyme). Специалисту в данной области известны также другие молекулы конъюгированных красителей.

Метки включают, но не ограничиваясь следующими: испускающие свет, рассеивающие свет и поглощающие свет соединения, которые генерируют или гасят детектируемый флуоресцентный, хемилюминесцентный или биолюминесцентный сигнал (см., например, Kricka, L., Nonisotopic DNA Probe Techniques, Academic Press, San Diego (1992) и Garman A., Non-Radioactive Labeling, Academic Press (1997).). В некоторых вариантах осуществления используются зонды с двойными метками, которые содержат флюорофор-репортер и флюорофор-гаситель. Понятно, что выбираются пары флюорофоров, которые характеризуются различными спектрами испускания, чтобы обеспечить возможность их различения.

В некоторых вариантах осуществления метки и стабилизирующие гибридизацию зонды, которые служат для усиления, стабилизации или модификации гибридизации дуплексов, например интеркаляторы и интеркалирующие красители (включая, но не ограничиваясь перечисленными: этидия бромид и SYBR-зеленый), вещества, связывающиеся с малой бороздкой ДНК, и поперечно сшивающие функциональные группы (см., например, Blackburn et al., eds. “DNA and RNA Structure” (Nucleic Acids in Chemistry and Biology) (1996)).

В других вариантах осуществления для количественного определения микроРНК могут использоваться способы, основанные на гибридизации и/или лигировании, включая методы олигонуклеотидного лигирования (OLA) и методы, обеспечивающие возможность отделения различимых зондов, которые гибридизуются с целевыми последовательностями ДНК, от несвязанного зонда. В качестве примера, HARP-подобные зонды, описанные в патентной публикации США 2006/0078894, могут применяться для измерения количества микроРНК. В таких методах после гибридизации между зондом и целевой нуклеиновой кислотой зонд модифицируестся, что позволяет отличить гибридизованный зонд от негибридизованного зонда. Затем зонд может быть амплифицирован и/или детектирован. В общем, область инактивации зонда включает подмножество нуклеотидов в пределах области гибридизации зонда. Для уменьшения или предотвращения амплификации или детектирования зонда HARP, не гибридизованного с целевой молекулой нуклеиновой кислоты, и, соответственно, обеспечения возможности детектирования целевой нуклеиновой кислоты осуществляют пост-гибридизационные стадии инактивации с использованием агента, способного отличать зонд HARP, гибридизованный с целевой молекулой нуклеиновой кислоты, и соответствующий негибридизованный зонд. Агент способен инактивировать или модифицировать негибридизованный зонд таким образом, что его амплификация становится невозможной.

Реакцию лигирования с зондом также можно применять для количественного определения микроРНК. В методике мультиплексной амплификации лигированных зондов (MLPA) (Schouten et al., Nucleic Acids Research 30:e57 (2002)) пара зондов, гибридизующихся в непосредственно соседних участках на целевой молекуле нуклеиновой кислоты, лигируется между собой в зависимости от присутствия целевой нуклеиновой кислоты. В некоторых аспектах зонды MLPA содержат сайты, фланкирующие праймеры для ПЦР. Зонды MLPA специфично амплифицируются после лигирования, что обеспечивает возможность детектирования и определения количества микроРНК-биомаркеров.

6. Определение статуса болезни Альцгеймера с использованием микроРНК-биомаркеров

Описанные здесь микроРНК-биомаркеры можно применять отдельно или в комбинации в диагностических тестах для оценки статуса субъекта в отношении болезни Альцгеймера. Статус болезни включает наличие или отсутствие болезни Альцгеймера. Статус болезни может также включать мониторинг течения болезни Альцгеймера, например мониторинг прогрессирования заболевания. На основании статуса субъекта в отношении болезни Альцгеймера могут быть назначены дополнительные процедуры, включая, например, дополнительные диагностические тесты или терапевтические процедуры.

Эффективность диагностического теста в правильном предсказании статуса болезни обычно измеряется в терминах точности анализа, чувствительности анализа, специфичности анализа или “Площади под кривой” (AUC), например площади под кривой характеристической (ROC). В настоящем тексте точность является мерой доли неправильно классифицированных образцов. Точность может быть рассчитана как общее число правильно классифицированных образцов, деленное на общее число образцов, например, в исследуемой популяции. Чувствительность является мерой “истинно положительных” результатов, которые тест определяет как положительные, и может быть рассчитана как число правильно идентифицированных образцов с болезнью Альцгеймера, деленное на общее число образцов с болезнью Альцгеймера. Специфичность является мерой “истинно отрицательных” результатов, которые тест определяет как отрицательные, и может быть рассчитана как число правильно идентифицированных нормальных образцов, деленное на общее число нормальных образцов. AUC является мерой площади под характеристической кривой, которая является графиком чувствительности от уровня ложноположительных результатов (1-специфичность). Чем больше AUC, тем выше прогностическая ценность теста. Другие пригодные меры полезности теста включают “положительное предсказательное значение”, которое представляет собой процентную долю реально положительных образцов, определенных в тесте как положительные, и “отрицательное прогностическое значение”, которое представляет собой процентную долю реально отрицательных образцов, определенных в тесте как отрицательные. В предпочтительном варианте осуществления уровень одного или большего числа микроРНК-биомаркеров в образцах, взятых у субъектов с различными статусами болезни Альцгеймера, демонстрирует статистически значимое отклонение с р-значением по меньшей мере p≤0,05, например p≤ 0,05, p≤0,01, p≤0,005, p≤0,001 и т.д. относительно здоровых субъектов, определенное по отношению к соответствующему контролю. В других предпочтительных вариантах осуществления описанные здесь диагностические тесты с применением микроРНК-биомаркеров, отдельно или в комбинации, демонстрируют точность, равную по меньшей мере приблизительно 75%, например точность, равную по меньшей мере приблизительно 75%, приблизительно 80%, приблизительно 85%, приблизительно 90%, приблизительно 95%, приблизительно 97%, приблизительно 99% или приблизительно 100%. В других вариантах осуществления описанные здесь диагностические тесты с применением микроРНК-биомаркеров, отдельно или в комбинации, демонстрируют специфичность, равную по меньшей мере приблизительно 75%, например специфичность, равную по меньшей мере приблизительно 75%, приблизительно 80%, приблизительно 85%, приблизительно 90%, приблизительно 95%, приблизительно 97%, приблизительно 99% или приблизительно 100%. В других вариантах осуществления описанные здесь диагностические тесты с применением микроРНК-биомаркеров, отдельно или в комбинации, демонстрируют чувствительность, равную по меньшей мере приблизительно 75%, например чувствительность, равную по меньшей мере приблизительно 75%, приблизительно 80%, приблизительно 85%, приблизительно 90%, приблизительно 95%, приблизительно 97%, приблизительно 99% или приблизительно 100%. В других вариантах осуществления описанные здесь диагностические тесты с применением микроРНК-биомаркеров, отдельно или в комбинации, демонстрируют специфичность и чувствительность, равные по меньшей мере приблизительно 75% каждая, например специфичность и чувствительность, равные по меньшей мере приблизительно 75%, приблизительно 80%, приблизительно 85%, приблизительно 90%, приблизительно 95%, приблизительно 97%, приблизительно 99% или приблизительно 100% (например, специфичность, равную по меньшей мере приблизительно 80%, и чувствительность, равную по меньшей мере приблизительно 80%, или например, специфичность, равную по меньшей мере приблизительно 80%, и чувствительность, равную по меньшей мере приблизительно 95%).

Присутствие каждого из биомаркеров, перечисленных в Таблице 2, в биологических образцах, взятых у субъектов с болезнью Альцгеймера, отличается от здоровых субъектов, и, соответственно, каждый из них отдельно можно применять для определения болезни Альцгеймера у исследуемого субъекта. Такой способ включает определение уровня биомаркера в образце, взятом у субъекта. Определение уровня биомаркера в образце может включать измерение, детектирование или оценку уровня биомаркера в указанном образце с использованием любого подходящего метода, например методов, приведенных в настоящем тексте. Определение уровня биомаркера в образце может также включать исследование результатов анализа, в котором измеряют, детектируют или оценивают уровень биомаркера в указанном образце. Способ может также включать сравнение уровня биомаркера в образце с соответствующим контролем. Изменение уровня биомаркера относительно уровня у здорового субъекта, определенное с использованием соответствующего контроля, является показателем статуса пациента в отношении болезни Альцгеймера. Может применяться диагностическое количество биомаркера, представляющее количество биомаркера, значение выше или ниже которого определяет субъекта как имеющего определенный статус в отношении болезни Альцгеймера. Например, если уровень маркера понижен в образцах, полученных у лиц, страдающих болезнью Альцгеймера, по сравнению со здоровым индивидом, измеренное значение ниже диагностического отсекающего значения дает диагноз болезни Альцгеймера. В целом, уровень отдельных микроРНК-биомаркеров из Таблицы 2 понижен в образцах с болезнью Альцгеймера относительно здоровых индивидов. Как широко известно в данной области, варьирование определенного диагностического отсекающего значения для теста позволяет произвольно регулировать чувствительность и/или специфичность диагностического теста. Конкретное диагностическое отсекающее значение может быть определено, например, путем измерения количества биомаркера в статистически значимом числе образцов от субъектов с различными статусами в отношении болезни Альцгеймера и назначения отсекающего значения, дающего желаемый уровень точности, чувствительности и/или специфичности. В некоторых вариантах осуществления диагностическое отсекающее значение может быть определено с помощью алгоритма классификации, описанного в настоящей заявке.

Соответственно, предложены способы диагностики болезни Альцгеймера у пациента путем определения уровня по меньшей мере одной микроРНК в образце, содержащем циркулирующие микроРНК, взятом у субъекта, при этом отклонение уровня указанной по меньшей мере одной микроРНК от уровня у здорового субъекта (определенное относительно соответствующего контроля) указывает на то, что субъект страдает болезнью Альцгеймера. Указанная по меньшей мере одна микроРНК предпочтительно включает одну или более из miR-191, miR-15b, miR-142-3p, Let-7g и Let-7d, и может необязательно включать miR-301a, miR-545 или miR-301a и miR-545. Например согласно настоящему изобретению предложен способ определения уровня по меньшей мере одной микроРНК в образце, содержащем циркулирующие микроРНК, взятом у субъекта, где снижение уровня указанной по меньшей мере одной микроРНК относительно контроля указывает на то, что субъект страдает болезнью Альцгеймера.

Способ может необязательно дополнительно включать диагностирование субъекта как страдающего или не страдающего болезнью Альцгеймера на основании уровня по меньшей мере одной микроРНК в указанном образце. В качестве дополнения или альтернативы, способ может включать определение корреляции отклонения уровня или уровней по меньшей мере одной микроРНК от соответствующего контроля с диагнозом болезни Альцгеймера у субъекта. В некоторых вариантах осуществления такой диагноз может быть сообщен непосредственно субъекту или может быть сообщен другим лицам, участвующим в уходе за пациентом.

Хотя отдельные микроРНК-биомаркеры пригодны для применения в диагностике болезни Альцгеймера, в настоящей заявке показано, что комбинация микроРНК-биомаркеров может обеспечить большую прогностическую ценность для статуса болезни Альцгеймера, чем используемые по отдельности микроРНК-биомаркеры. В частности, детектирование нескольких микроРНК-биомаркеров может повысить точность, чувствительность и/или специфичность диагностического теста. Примеры микроРНК-биомаркеров и комбинаций биомаркеров показаны в Таблице 8A-8C. МикроРНК-биомаркеры и комбинации биомаркеров, демонстрирующие общую точность 75%, показаны в Таблице 9A-9B. Настоящее изобретение включает отдельные биомаркеры и комбинации биомаркеров, приведенные в этих таблицах, и их применение в описанных здесь тестах и наборах.

Соответственно, предложены способы диагностики болезни Альцгеймера у пациента путем определения уровня двух или более микроРНК в образце, содержащем циркулирующие микроРНК, взятом у субъекта, причем отклонение уровня микроРНК от уровня у здорового субъекта (определенное относительно соответствующего контроля) указывает на то, что субъект страдает болезнью Альцгеймера. МикроРНК предпочтительно включают одну или более из miR-191, miR-15b, miR-142-3p, Let-7g и Let-7d и могут необязательно включать miR-301a, miR-545 или miR-301a и miR-545. Примеры комбинаций двух или более микроРНК-биомаркеров включают, например, miR-545, let7g и miR-15b; miR-15b и miR-545; miR-301a, miR-545, let-7g и miR-15b; miR-191 и miR-15b; Let-7g и miR-15b; miR-191, miR-301a и miR-545; miR-301a, let-7g и miR-15b; и miR-191, miR-301a, miR-545 и miR-15b.

Также предложен способ диагностики болезни Альцгеймера у субъекта путем определения уровней двух или более микроРНК в образце, содержащем циркулирующие микроРНК, взятом у субъекта, сравнение уровней указанных двух или более микроРНК в указанном образце с массивом данных, представляющих уровни тех же микроРНК у здоровых субъектов и у субъектов с болезнью Альцгеймера, и диагностирование субъекта как страдающего или не страдающего болезнью Альцгеймера на основании этого сравнения. В таких способах массив данных служит соответствующим контролем или эталонным стандартом для сравнения с образцом от того же субъекта. Сравнение образца от субъекта с массивом данных может быть выполнено при помощи алгоритма классификации, который рассчитывает наличие или отсутствие статистически значимой разницы между объединенными уровнями двух или большего числа микроРНК в указанном образце и уровнями тех же микроРНК у здорового субъекта или субъекта, страдающего болезнью Альцгеймера.

7. Создание алгоритма классификации для определения статуса болезни Альцгеймера

В некоторых вариантах осуществления данные, полученные с использованием образцов, таких как «известные образцы», можно затем применять для «тренировки» модели классификации. «Известный образец» - это предварительно классифицированный образец, например классифицированный как образец, полученный от здорового субъекта или от субъекта, страдающего болезнью Альцгеймера. Получают данные по спектру и применяют их для формирования модели классификации, эти данные называют "тренировочным массивом данных". После тренировки модель классификации может распознавать структуры в данных, полученных из спектров, сгенерированных по неизвестным образцам. Затем модель классификации можно применять для классификации неизвестных образцов по классам. Это может быть полезным например, для предсказания, связан или нет конкретный биологический образец с некоторым биологическим состоянием (например, болезнь - отсутствие болезни).

В некоторых вариантах осуществления данные для тренировочного массива, который используется для построения модели классификации, могут быть получены непосредственно путем количественной ПЦР (например, значения Ct, полученные с использованием метода ∆∆Ct) или путем высокопроизводительного определения профиля экспрессии, такого как микроматричный анализ (например, общие значения или нормированные значения результатов анализа экспрессии микроРНК, например анализа экспрессии микроРНК nCounter). Модели классификации могут быть созданы с использованием любого пригодного статистического метода классификации (или «обучения»), который предназначен для разделения массива данных на классы на основании объективных параметров, содержащихся в данных. Методы классификации могут быть с контролем или без. Примеры процедур классификации с контролем и без него описаны в Jain, "Statistical Pattern Recognition: A Review", IEEE Transactions on Pattern Analysis and Machine Intelligence, Vol. 22, No. 1, January 2000, содержание которой включено в настоящий текст путем ссылки. В контролируемой классификации тренировочные данные, включающие примеры известных категорий, представляются обучающему механизму, который выявляет один или более наборов связей, которые определяют каждый известный класс. Затем обучающему механизму предъявляют новые данные, и он классифицирует их с использованием установленных связей. Примеры процедуры классификации с контролем включают методы линейной регрессии (например, множественная линейная регрессия (MLR), регрессия методом частных наименьших квадратов (PLS) или регрессия основных компонентов (PCR)), двоичные деревья решений (например, процедуры рекуррентного разбиения, такие как CART-деревья классификации и регрессии), искусственные нейронные сети, такие как сеть с обучением по алгоритму обратного распространения, дискриминантный анализ (например, байесовы классификаторы и анализ), логистические классификаторы и классификаторы опорных векторов (машины опорных векторов).

В других вариантах осуществления создаваемые модели классификации могут формироваться с использованием моделей обучения без контроля. Подход классификации без контроля для обучения классификаций основан на сходствах в тренировочном массиве данных без предварительной классификации спектров, из которых получен тренировочный массив данных. Методы обучения без учителя включают методы кластерного анализа. Кластерный анализ направлен на разделение данных на «кластеры» или группы, которые в идеале должны содержать элементы, очень сходные друг с другом и сильно отличающиеся от элементов других кластеров. Затем измеряют сходство с использованием некоторой меры удаленности, которая количественно характеризует расстояние между элементами данных, и объединяют данные, которые оказываются ближе друг к другу. Методики кластеризации включают алгоритм К-значений МакКуина и алгоритм самоорганизующейся карты Кохонена. Алгоритмы обучения, предназначенные для применения в классификации биологической информации, описаны, например, в международной публикации РСТ WO 01/31580 (Barnhill et al., "Methods and devices for identifying patterns in biological systems and methods of use thereof"), патентной заявке США № 2002 0193950 A1 (Gavin et al, "Method or analyzing mass spectra"), патентной заявке США № 2003 0004402 A1 (Hitt et al., "Process for discriminating between biological states based on hidden patterns from biological data") и патентной заявке США № 2003 0055615 A1 (Zhang and Zhang, "Systems and methods for processing biological expression data"). Содержание приведенных выше патентных заявок полностью включено в настоящее описание посредством ссылки.

Модули классификации могут создаваться и использоваться на любом пригодном цифровом вычислительном устройстве. Пригодные цифровые вычислительные устройства включают микро-, мини- или большие компьютеры с любой стандартной или специализированной операционной системой, такой как операционная система на основе Unix, WindowsTM или LinuxTM.

Тренировочные массив(-ы) данных и модели классификации могут быть реализованы в компьютерном коде, который исполняется или используется цифровым вычислительным устройством. Компьютерный код может храниться на любом пригодном машиночитаемом носителе, включая оптические или магнитные диски, карты памяти, пленки и т.д., и может быть записан на любом пригодном компьютерном языке, включая C, C++, visual basic и т.д. Алгоритмы тренировки, описанные выше, могут применяться для разработки алгоритмов классификации для микроРНК-биомаркеров болезни Альцгеймера. Алгоритмы классификации можно, в свою очередь, использовать в диагностических тестах путем определения диагностических значений (например, отсекающих (пороговых) значений) для биомаркеров, применяемых по отдельности или в комбинации.

8. Дополнительные диагностические тесты

Уровень микроРНК-биомаркеров, указывающих на болезнь Альцгеймера, можно применять в качестве самостоятельного показателя диагноза болезни Альцгеймера у субъекта. Необязательно, способы могут включать проведение по меньшей мере одного дополнительного теста для диагностики болезни Альцгеймера. Например, могут быть проведены другие тесты в дополнение к определению уровня одного или большего числа микроРНК-биомаркеров для диагностики болезни Альцгеймера.

Например, врач может провести тесты на оценку психического состояния субъекта в дополнение к определению уровня одного или большего числа микроРНК-биомаркеров в образце, взятом у субъекта. Такие тесты могут включать, но не ограничиваясь следующими: краткую шкалу оценки психического статуса, тест по краткой шкале оценки когнитивных функций (mini-cog test), тест по шкале оценки когнитивных функций при болезни Альцгеймера (ADAS-cog test) и тест на рисование часов. Эти тесты рутинно используются в клинической практике для диагностирования болезни Альцгеймера.

Также могут быть выполнены анализы изображений мозга субъекта, например ЯМР или компьютерная томография. Эти тесты обычно проводят для исключения других состояний, которые могут вызывать симптомы, сходные с болезнью Альцгеймера, такие как опухоли, инсульты или водянка мозга.

Может быть проведено неврологическое обследование субъекта, в котором исследуют такие параметры, как рефлексы, координацию, силу мышц, движения глаз, речь и/или чувствительность субъекта.

Также может быть осуществлен скрининг субъекта на генетические факторы, указывающие на то, что у субъекта может быть повышен риск развития болезни Альцгеймера. Субъект также может быть подвергнут скринингу на присутствие, отсутствие или уровень по меньшей мере одного другого биомаркера, указывающего на болезнь Альцгеймера.

9. Способы лечения

В некоторых вариантах осуществления в случае диагностирования у субъекта болезни Альцгеймера описанными здесь способами, настоящее изобретение дополнительно включает способы лечения таких субъектов, идентифицированных как страдающие от болезни Альцгеймера. Соответственно, в одном варианте осуществления изобретение относится к способу лечения болезни Альцгеймера у субъекта, включающему определение уровня по меньшей мере одного микроРНК-биомаркера в образце, взятом у субъекта, причем отклонение уровня по меньшей мере одного микроРНК-биомаркера от уровня у здорового субъекта, определенное по отношению к соответствующему контролю, указывает на то, что субъект страдает болезнью Альцгеймера, и введение субъекту терапевтически эффективного количества средства для лечения болезни Альцгеймера. В другом варианте осуществления изобретение относится к способу лечения субъекта с болезнью Альцгеймера, включающему идентификацию субъекта, страдающего болезнью Альцгеймера, такого что уровень по меньшей мере одного микроРНК-биомаркера в образце, взятом у субъекта, отличается (например, понижен) от уровня у здорового субъекта, определенного относительно соответствующего контроля, и введение субъекту терапевтически эффективного количества средства для лечения болезни Альцгеймера.

Термин “средство для лечения болезни Альцгеймера” включает, например, вещества, одобренные управлением по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA) США для лечения болезни Альцгеймера. Такие вещества включают, например, Разадин® (галантамин), Экселон® (ривастигмин) и Арицепт® (донепезил). В одном из примеров вариантов осуществления средством для лечения болезни Альцгеймера является донепезил или его фармацевтически приемлемая соль или эфир (например, гидрохлорид донепезила).

Средства для лечения болезни Альцгеймера можно вводить субъекту в виде фармацевтической композиции. Подходящие фармацевтические композиции содержат средство для лечения болезни Альцгеймера (или его фармацевтически приемлемую соль или эфир) и необязательно содержат фармацевтически приемлемый носитель, например фармацевтическую композицию, содержащую галантамин, ривастигмин, донепезил или фармацевтически приемлемую соль или эфир любого из нижеследующих веществ (например, галантамин гидробромид, ривастигмин тартрат, донепезил гидрохлорид). В некоторых вариантах осуществления эти композиции также необязательно содержат одно или несколько дополнительных лекарственных средств.

В данной заявке термин “фармацевтически приемлемая соль” относится к солям, которые, в рамках обоснованного медицинского суждения, подходят для использования в контакте с тканями человеческого или животного организма без проявления неспецифической токсичности, раздражения, аллергической реакции и тому подобного и имеют целесообразное соотношение польза/риск. Фармацевтически приемлемые соли аминов, органических кислот и других типов соединений хорошо известны в данной области. Например, С.М. Берге (S.M. Berge) и др. подробно описывают фармацевтически приемлемые соли в публикации J. Pharmaceutical Sciences, 66: 1-19 (1977), включенной в данную заявку посредством ссылки. Соли можно получать in situ, во время окончательного отделения и очистки соединений согласно данному изобретению, или отдельно, осуществляя реакцию производного свободного основания или свободной кислоты с подходящим реагентом. Например, можно осуществить реакцию производного свободного основания и подходящей кислоты. Более того, в случае, если соединения имеют кислотную функциональную группу, их подходящие фармацевтически приемлемые соли могут включать соли металлов, такие как соли щелочных металлов, например соли натрия или калия; и соли щелочно-земельных металлов, такие как соли кальция и магния.

Термин “фармацевтически приемлемый эфир” в настоящем тексте относится к эфирам, которые гидролизуются in vivo (в организме), и включает эфиры, которые легко распадаются в организме человека с получением исходного вещества или его соли. Подходящие группы эфира включают, например, производные от фармацевтически приемлемых алифатических органических кислот, в частности алкановой кислоты, алкеновой кислоты, циклоалкановой кислоты и алкандикислоты, в которых каждая алкильная или алкенильная функциональная группа преимущественно имеет не более 6 атомов углерода.

Как описано выше, фармацевтические композиции могут дополнительно содержать фармацевтически приемлемый носитель. Термин «носитель» включает любые и все растворители, разбавители и другие жидкие носители, диспергирующие или суспендирующие вспомогательные вещества, поверхностно-активные вещества, изотонические вещества, загустители и эмульгаторы, консерванты, твердые связующие вещества, лубриканты и тому подобные вещества, подходящие для приготовления определенной необходимой лекарственной формы. В издании Remington’s Pharmaceutical Sciences, Sixteenth Edition, Е. В. Мартин (Mack Publishing Co., Easton, Pa., 1980) приводит многочисленные носители, используемые при составлении фармацевтических композиций, и известные профессионалам методики их приготовления. Некоторые примеры материалов, могущих служить фармацевтически приемлемыми носителями, включают, но не ограничиваясь ими, сахара, такие как лактоза, глюкоза и сахароза; крахмалы, такие как кукурузный и картофельный крахмал; целлюлозу и ее производные, такие как натрий карбоксиметилцеллюлоза, этилцеллюлоза и ацетат целлюлозы; порошкообразные трагаканты; солод; желатин; тальк; вспомогательные вещества, такие как масло какао и воск для приготовления суппозиториев; масла, такие как арахисовое масло, хлопковое масло, шафрановое масло, кунжутное масло; оливковое масло; кукурузное масло и соевое масло; гликоли; такие как пропиленгликоль; эфиры, такие как этилолеат и этиллаурат; агар; буферные вещества, такие как гидроксид магния и гидроксид алюминия; альгиновую кислоту; апирогенную воду; изотонический раствор соли; раствор Рингера; этиловый спирт, и фосфатные буферные соединения, а также другие нетоксичные совместимые лубриканты, такие как лаурилсульфат натрия и стеарат магния, а также красители, высвобождающие вещества, вещества для покрытия, подсластители, вкусовые и ароматические добавки, консерванты и антиоксиданты также могут присутствовать в композиции, если специалист, составляющий соединение, сочтет нужным.

Композиции для использования согласно данному изобретению могут иметь произвольную концентрацию нужного средства для лечения болезни Альцгеймера. В предпочтительных вариантах осуществления композиция составляется так, чтобы содержать терапевтически эффективное количество средства для лечения болезни Альцгеймера.

10. Наборы для детектирования микроРНК-биомаркеров

В другом аспекте настоящего изобретения предложены наборы для диагностики болезни Альцгеймера у субъекта, которые можно применять для определения уровня одной или более из miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a и miR-545 и их комбинаций. В одном варианте осуществления указанные одна или более микроРНК выбраны из группы, состоящей из miR-191, miR-15b, let-7d, let-7g, miR-142-3p. Наборы могут включать материалы и реагенты, приспособленные для селективного детектирования присутствия микроРНК или группы микроРНК, являющихся диагностическими признаками болезни Альцгеймера, в образце, взятом у субъекта. Например, в одном варианте осуществления набор может включать реагент, который специфично гибридизуется с микроРНК. Такой реагент может представлять собой молекулу нуклеиновой кислоты в форме, пригодной для детектирования микроРНК, например в форме зонда или праймера. Набор может включать реагенты, пригодные для осуществления теста (анализа) для детектирования одной или большего числа микроРНК, например реагентов, которые могут применяться для детектирования одной или большего числа микроРНК в реакции кПЦР. Набор может также включать микроматрицу, пригодную для детектирования одной или большего числа микроРНК.

В другом варианте осуществления набор может содержать инструкции относительно соответствующих рабочих параметров в форме этикетки или вкладыша. Например, инструкции могут включать информацию или указания относительно того, как следует брать образец, как определять уровень одного или большего числа микроРНК-биомаркеров в образце или как определять корреляцию уровня одного или большего числа микроРНК-биомаркеров в образце со статусом субъекта по болезни Альцгеймера.

В другом варианте осуществления набор может содержать один или большее число контейнеров с образцами микроРНК-биомаркеров для применения в качестве эталонных стандартов, соответствующих контролей или для калибровки теста для детектирования микроРНК-биомаркеров в исследуемом образце.

Ниже настоящее изобретение проиллюстрировано посредством примеров, которые не следует воспринимать как ограничивающие. Полное содержание всех источников, патентов и опубликованных заявок на патент, цитируемых в тексте настоящей заявки, полностью включено в настоящую заявку посредством ссылки

ПРИМЕРЫ

Пример 1: Идентификация и проверка кандидатных микроРНК-биомаркеров

Цель данного исследования заключалась в создании профилей микроРНК из фракции плазмы крови человека и определении, имеются ли существенные различия (отклонения) в содержании микроРНК и уровне экспрессии между пациентами с диагнозом болезни Альцгеймера (AD, БА) и с здоровыми контролями (ЗК, НК).

Образцы плазмы крови человека были приобретены в компании PrecisionMed, Inc (Солано Бич, Калифорния-США). Группа 1 включала образцы, полученные от 11 пациентов с болезнью Альцгеймера, 9 пациентов с мягкими когнитивными нарушениями (MCI, ЛКН) и 20 пациентов ЗК. Возраст, пол, диагноз и значение результата краткой шкалы оценки психического статуса (MMSE) пациентов в Группе 1 представлены в Таблице 1. Тотальную РНК экстрагировали из образцов плазмы (1 мл), добавляли синтетические микроРНК (Ath-159A и Neg-A) в качестве внутреннего контроля для контроля эффективности экстракции и нормировки, как описано ниже.

Затем каждый образец использовали для высокопроизводительного определения профиля экспрессии с использованием метода анализа экспрессии микроРНК NCounter (NanoString Technology, Сиэтл, Вашингтон, США) в трех повторах, как описано ниже. После нормировки и поправки на фон окончательные линейные значения усредняли как для образцов БА/ЛКН, так и для ЗК, и определяли значения кратных изменений. Отбирали кандидатные микроРНК, которые характеризовались по меньшей мере 1,5-кратным различием между средними значениями экспрессии в образцах БА/ЛКН и ЗК и средними нормированными значениями >200. МикроРНК 106a (HSA-miR-106а), которая показала минимальные отклонения во всех образцах БА/ЛКН и ЗК, идентифицировали как потенциальный эндогенный контроль.

Были выявлены 227 микроРНК, для которых средние значения экспрессии составляли по меньшей мере >100 (экспрессия которых считалась существенной по сравнению с фоном). Среди этих 227 микроРНК были выявлены 13 микроРНК, которые продемонстрировали по меньшей мере 1,5-кратное изменение и средние нормированные значения экспрессии >200 (Фиг.1А и 1В). К ним относятся hsa-let-7d, hsa-let-7g, hsa-miR-15b, hsa-miR-126, hsa-miR-142-3p, hsa-miR-191, hsa-miR-301а, hsa-miR-453, hsa-miR-545, hsa-miR-563, hsa-miR-600, hsa-miR-1274a и hsa-miR-1975.

Затем кандидатные микроРНК-биомаркеры, выявленные с помощью высокопроизводительной платформы NanoString, валидировали методом Stem-loop TaqMan ОТ-кПЦР (количественной ПЦР с обратной транскрипцией) микроРНК (Life Technologies). Разводили 1:10 тотальной РНК для всех 40 образцов Группы 1 и проводили анализ TaqMan для каждого образца, как описано ниже. Значения Ath-159a (внутренний контроль) и miR-106а (эндогенная микроРНК) использовали для нормировки значений во всех образцах путем анализа методом ΔΔCt (Life Technologies). Из 13 исследованных микроРНК присутствие 6 микроРНК не подтвердилось. К ним относятся hsa-miR-126, hsa-miR-453, hsa-miR-563, hsa-miR-600, hsa-miR-1274a и hsa-miR-1975.

Оставшиеся 7 микроРНК (miR-191, miR-15b, let-7d, let-7g, miR-142-3p, miR-301a и miR-545) продемонстрировали очень сильную корреляцию между средними значениями кратных изменений, определенных методами NanoString и TaqMan (Фиг.2, Таблица 3). Последовательности микроРНК и номера доступа в базе микроРНК (miRBase) приведены в Таблице 2. Например, экспрессия miR-191 в образцах БА была снижена в ~3,1 раза согласно методу NanoString, в то время как с помощью метода TaqMan было установлено, что она снижена в ~3,7 раза (см. Таблицу 3). Эта четкая тенденция наблюдалась во всех остальных микроРНК (miR-15b, let-7d, let-7g, miR-142-3p, miR-301а и miR-545). Все значения кратных изменений имели р-значение <0,005.

Следует отметить, что все кандидаты микроРНК (кроме miR-126), которые не были подтверждены методом TaqMan, имели нормированные линейные значения (определенные методом NanoString) менее 500. С другой стороны, средние значения каждой из подтвержденных микроРНК были выше 3000. Это говорит о том, что установка более высокого порога для экспериментов в методе NanoString может быть полезна для уменьшения количества ложноположительных кандидатов.

Материалы и методы

Выделение тотальной РНК

Тотальную РНК экстрагировали с использованием модифицированного протокола miRvana PARIS (Life Technologies; AM 1556), как описано в статье Mitchell, PS и др. PNAS 29 июля 2008; 105 (30) :10513-8). 1 мл плазмы крови человека добавляли к равному количеству 2-кратного денатурирующего буфера, а затем вносили 10 мкл 0,05 мкМ Ath-159A и 40 пМ Neg-A (UUGUGGCGAGCGGAAUGGAAU) (синтетические микроРНК, используемые для нормировки и контроля эффективности экстракции). Экстракцию фенолом проводили дважды, и суммарную РНК элюировали в 70 мкл воды в соответствии с рекомендациями протокола (AM1556).

Высокопроизводительное определение профиля экспрессии микроРНК

45 мкл тотальной РНК концентрировали до 9 мкл и использовали в качестве матрицы в методе определения экспрессии микроРНК NCounter (NanoString Technology, Сиэтл, Вашингтон, США). Подготовку образца осуществляли в соответствии с рекомендациями (NanoString; C-0009-02) с использованием 3 мкл концентрированной тотальной РНК в качестве исходного количества для всех образцов в трех повторах. Поскольку количество выделенной тотальной РНК было недостаточным для надежного обнаружения с использованием стандартных спектральных инструментов, в частности NanoDrop, был использован подход равного объема, в котором 3 мкл концентрированной тотальной РНК использовали в качестве исходного материала для всех анализов с использованием метода NanoString (он также использовался в статье Mitchell, PS и др. PNAS 29 июля 2008; 105(30):10513-8). Реакционные смеси были поставлены на ночную гибридизацию в течение 16 часов при температуре 65°С. На следующий день образцы обрабатывали на NCounter Prep Station (NanoString технологии, Сиэтл, WA-США, v.20081003) в соответствии с рекомендациями протокола производителя, а затем обрабатывали на цифровом анализаторе NCounter (NanoString технологии, Сиэтл-США, v.20081009). Разрешение анализатора было установлено на уровне 600 FOV. Данные были загружены и проанализированы в Excel в соответствии с рекомендациями (Руководство по анализу данных NCounter). Вкратце, сначала данные нормировали по изменению от полосы к полосе с использованием имеющихся в методе положительных контролей. Затем проводили общую нормировку среднего значения с использованием значений экспрессий 100 микроРНК с самым высоким уровнем экспрессии. Затем каждое нормированное значение проверяли, чтобы убедиться, что оно превышает средний фоновый сигнал, зарегистрированный для этой полосы, по меньшей мере на 2 стандартных отклонения. Любое более низкое значение преобразовывали в ноль. Значения кратных изменений рассчитывали на основе среднего значения всех значений экспрессии образцов БА/ЛКН и ЗК для отдельных микроРНК.

Проверка кандидатов биомаркерных микроРНК с использованием TaqMan количественной ПЦР

Кандидаты микроРНК биомаркеров, выявленные с помощью высокопроизводительной платформы NanoString, затем проверяли с помощью метода Stem-loop TaqMan ОТ-кПЦР (обратной транскрипции - количественной ПЦР) микроРНК (Life Technologies). Вкратце, набор праймеров для обратной транскрипции был получен с использованием микроРНК-специфичных праймеров для обратной транскрипции (miR-301a, miR-1975, miR-191, miR-15b, miR-126, let-7g, let-7d, miR-545, miR-1274, miR-142-3p, miR-600, miR-453, miR-563, miR-106a и ath-159a) с конечной концентрацией 0,05× в 1× буфере TE. МикроРНК-специфичные праймеры и зонды были приобретены у Life Technologies. Реакционная смесь для обратной транскрипции объемом 15 мкл содержала 6 мкл набора праймеров для обратной транскрипции, 0,3 мкл нуклеотидтрифосфатов (100 мМ), 3 мкл Multiscribe RT (50 ед/мкл), 1,5 мкл 10× буфера для обратной транскрипции и 0,2 мкл RNAseIN (20 ед/мкл) и воду. Все компоненты для обратной транскрипции содержались в наборе miRNA RT kit (Life Technologies; # 4366596). Три мкл тотальной РНК (1:10 разбавление) добавляли в качестве матрицы к каждому образцу, и реакционную смесь инкубировали на льду в течение 5 мин, а затем 30 мин при 16°С, 30 мин при 42°С и 5 минут при 85°С для инактивации фермента. Затем реакционную смесь хранили при 4°С. Затем был получен второй набор праймеров для предварительной амплификации для каждого зонда-праймера ПЦР (20×) для тех же методов, смешанных в конечной концентрации 0,2× в 1× буфере ТЕ. Реакционная смесь для предварительной амплификации содержала 2× мастер-микс для предварительной амплификации (Life Technologies; # 4391128), 3,75 мкл собственного набора праймеров для амплификации и воды (для доведения объема реакции до 22,5 мкл). Затем добавляли 2,5 мкл продукта обратной транскрипции и запускали циклы в соответствии с программой предварительной амплификации [95°С в течение 10 мин, 55°С в течение 2 мин и 72°С в течение 2 мин с последующими 12 циклами при 95°С в течение 15 сек и 60°С в течение 4 мин]. Затем проводили инкубацию при 99,9°C в течение 10 мин, реакционную смесь разбавляли добавлением 175 мкл 0,1× буфера ТЕ (рН 8,0) и перемешивали путем переворачивания. Затем два мкл продукта предварительной амплификации использовали для отдельных стандартных реакций TaqMan количественной ПЦР (в двух повторах) в соответствии со стандартным протоколом (Life Technologies, P/N 4364031-Rev D) на инструменте ABI7500. Значения Ct были рассчитаны путем ручной установки порога 0,2 и автоматической базовой линии для всех реакций в одном исследовании (SDS 2.4, Life Technologies) для стандартного анализа.

Метод ΔΔCt (Life Technologies, см. также Livak KJ, Schmittgen ТД, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-ΔΔ C(T)) Method. Methods. (2001) Декабрь; 25(4):402-8) был использован для среднего геометрического как HSA-miR-106а, так и Ath-159A, использовавшихся в качестве внутреннего контроля, и средние относительные значения Ct для пациентов ЗК использовали для калибровки всех индивидуальных значений. Затем рассчитывали линейные кратные изменения и наносили на график рассеяния с использованием Prism (GraphPad Prism Software, Сан-Диего, Калифорния, США). (Примечание: проверка характеристик сигналов для Группы 2 (см. Пример 2) была проведена в точности так, как описано выше, а наборы праймеров для обратной транскрипции и предварительной амплификации были получены только с использованием указанных характеристик сигналов и специфических контрольных праймеров для нормализации (miR-301a, miR-191, miR-15b, let-7g, let-7d, miR-545, miR-142-3p, miR-106a и ath-159a). МикроРНК-специфичные праймеры и зонды были приобретены у Applied Biosystems под каталожными номерами 000464 (miR-142-3p), 001289 (miR-545), 000380 (let-7d), 000490 (miR-191), 000528 (miR-301a), 000383 (let-7g), 000390 (miR-15b), 000578 (miR-106a) и 000338 (ath-159a)).

Пример 2: Получение характеристических сигналов и построение предсказательной модели

МикроРНК, идентифицированные и валидированные как имеющие существенно отличающиеся экспрессии в образцах БА и ЗК в Группе 1 (кратное изменение >1,5, р-значение <0,005), были отобраны для построения предсказательной модели. Значения экспрессии 7 микроРНК (let-7D, miR-191, miR-301а, miR-545, let-7G, miR-15b, miR-142-3p) для каждого образца из БА (n=11) и НК (n=20) в Группе 1 были использованы в качестве входящих данных для модели построения характеристических сигналов. В частности, относительные величины Ct (наблюдаемые значения Ct отдельных микроРНК минус среднее геометрическое значений Ct Ath-159A и miR-106а) для каждой из 7 микроРНК, полученные посредством количественной ПЦР Taqman образцов Группы 1. были использованы для создания линейного классификатора для отделения образцов БА от ЗК (относительные значения Ct показаны в Таблице 4). Все возможные ненулевые подмножества 7 микроРНК (127 характеристических сигналов) были использованы для линейного дискриминантного анализа (LDA). Для LDA использовали пакет программного обеспечения MASS версии R 2.12.2 в осуществлении для Windows (Venables, W. N. & Ripley, B. D. (2002) Modern Applied Statistics with S. Fourth Edition. Springer, New York. ISBN 0-387-95457-0). Исходный код пакета доступен по адресу http://cran.r-project.org/web/packages/MASS/index.html. Другие подходящие программные пакеты могут быть использованы или разработаны. Значение площади под кривой (AUC) были также рассчитаны с помощью R (версия 2.12.2) с помощью программного пакета "verification" (исходный код доступен по адресу http://cran.r-project.org/web/packages/verification/index.html; см. также Mason, S.J. и N.E. Graham. “Areas beneath the relative operating characteristics (ROC) and relative operating levels (ROL) curves: Statistical significance and interpretation,” Q. J. R. Meteorol. Soc. 30 (1982) 291-303). Могут быть использованы или разработаны другие подходящие программные пакеты.

Образец кода и описание входных файлов, используемых для расчета точности прогнозирования, чувствительности, специфичности и значения AUC, приведены ниже. Этот код показывает, как классифицировать неизвестные образцы как БА или норма с использованием репрезентативных характеристических сигналов трех микроРНК ("miR-545", "let-7G", "miR-15b"). Код для выполнения классификации, основанной на любой комбинации 7 проверенных микроРНК, будет аналогичным, и следует понимать, что могут быть использованы характеристические сигналы на основе любой комбинации этих 7 микроРНК. Для любой комбинации или для отдельной микроРНК, выбранной из 7 проверенных микроРНК, можно построить линейную дискриминантную модель путем определения коэффициентов модели LDA на основе данных режима обучения, полученных на Группе 1. После того как получили модель, основанную на данных, полученных от Группы 1, можно предсказать для любого нового образца, является ли физическое лицо, у которого был получен образец, БА или нормальным индивидуумом. Для того чтобы сделать предсказание для нового образца, необходимо определить уровни экспрессии микроРНК для каждой отдельной микроРНК в характеристическом сигнале. Исходя из этих значений, модель выдаст ("апостериори") вероятность того, что новый образец получен от индивида БА. Значение отсечения этой вероятности определяет чувствительность и специфичность модели. Для предсказаний авторы изобретения определяли точность, чувствительность и специфичность при пороге 0,5 (то есть, если вероятность образца, являющегося образцом БА, больше чем 0,5, модель классифицирует его как БА).

Примеры входящих файлов могут быть в виде train.txt, validation.txt, train_an.txt и validation_an.txt. "Train.txt" - это файл, который содержит профиль экспрессии для когорты 1 в виде матрицы, где строки являются образцами, а столбцы являются микроРНК. Первая строка содержит имена микроРНК, а первый столбец - имена образцов. Файл "train_an.txt" содержит аннотацию образцов. Есть два столбца, где первый столбец содержит имя образца, а второй столбец - аннотации образцов ("здоров" и "БА" в данном случае). Файлы "validation.txt" и "validation_an.txt" содержат данные и аннотацию для Группы 2 в точно таком же формате. Переменные prediction$class и prediction$posteri содержат предсказанную аннотацию и соответствующую вероятность образцов из Группы 2.

Пример кода, который может быть использован для расчета точности прогнозирования, чувствительности, специфичности и значения AUC, выглядит следующим образом:

Для выполнения классификации на основе любой комбинации 7 проверенных микроРНК может использоваться примерный код, сходный с показанным выше. Кроме того, другой программный код, пригодный для прогнозирования или расчета точности прогнозирования, чувствительности, специфичности и AUC из набора данных, может быть использован вместо примера кода, описанного выше.

Пример 3. МикроРНК-биомаркеры позволяют предсказать статус субъекта: здоровый или страдающий болезнью Альцгеймера.

Эффективность предсказательной модели, использующей все ненулевые подмножества 7 проверенных микроРНК (let-7d, let-7g, miR-15b, miR-142-3p, miR-191, miR-301а и miR-545), как описано в Примере 2, оценивали на основании результатов классификации образцов плазмы человека из второй группы, содержащей 20 пациентов БА и 17 пациентов ЗК ("Группа 2"), полученных из PrecisionMed, Inc. Возраст, пол, диагноз, и значения MMSE для пациентов в группе 2 приведены в таблице 5. Эффективность предсказательной модели оценивали по точности, специфичности, чувствительности и значениям площади под кривой (AUC).

Извлечение тотальной РНК проводили с использованием только 500 мкл плазмы из каждого образца Группы 2, как описано в Примере 1, с последующим анализом TaqMan ОТ-кПЦР. Авторы изобретения достигали значимой корреляции со средними кратными изменениями между двумя группами для характеристических микроРНК, очень хорошо воспроизводящейся и с превосходными значениями р (Фиг.3, Таблица 6).

Относительные значения Ct (наблюдаемые значения Ct отдельных микроРНК минус среднее геометрическое значений Ct ATH-159A и miR-106а) для каждого кандидата микроРНК (let-7d, let-7g, miR-15b, miR-142-3p, miR-191, miR-301а и miR-545) из каждого из образцов Группы 2 были затем использованы в качестве входящих данных (Таблица 7) для характеристических сигналов микроРНК алгоритма прогнозирования, который был разработан на основе данные Группы 1, как описано выше. Все потенциальные характеристические сигналы приведены в Таблице 8. Характеристические сигналы, имеющие точность >75%, показаны в Таблице 9, в то время как характеристические сигналы, имеющие точность >89%, показаны в Таблице 10. Точность совокупности всех характеристических сигналов была рассчитана как доля неправильно классифицированных образцов (БА или ЗК). Чувствительность характеризует способность предсказательной модели выявлять истинно положительные сигналы, которая в этом исследовании была рассчитана как количество правильно определенных образцов БА, деленное на общее количество образцов БА. С другой стороны, специфичность определяется как количество правильно классифицированных образцов ЗК (истинно отрицательных), деленное на общее количество образцов ЗК. Значение AUC рассчитывали как площадь под операционной характеристической кривой (ROC) приемного устройства, которая представляет собой график чувствительности по отношению к частоте ложных определений (1 - специфичность). Характеристическая кривая (ROC) была получения путем варьирования порога вероятности прогнозирования.

Сочетание miR-545, let-7G и miR-15b привело к самой высокой специфичности (94,1%), чувствительности (95%) и AUC (0,953). Комбинации характеристических сигналов варьировались от всего двух микроРНК (например, miR-15b и miR-545) до 7 miR (например, miR-191, miR-301а, miR-545, let-7g, let-7d, miR-15b и miR-142-3P) (см. Таблицу 8А-8В). Каждый характеристический сигнал имел различные комбинации биомаркеров кандидатов микроРНК, что приводило к различной специфичности и чувствительности (см. Таблицу 9A-9B). Кроме того, авторы изобретения также проверили достоверность характеристических сигналов для отдельных микроРНК (Таблица 11). Точность характеристического сигнала была ниже для отдельных микроРНК в сравнении с комбинацией характеристических сигналов. Лучшими отдельными микроРНК с точки зрения специфичности были miR-142-3p и miR-301а, обе имеющие 100% специфичность. Но miR-142-3p имела лучшую чувствительность (65%) по сравнению с 25% чувствительностью для miR-301а. Led-7g и miR-191 имели лучшую чувствительность 95%, но только miR-191 имела повышенную специфичность 76%. miR-191, miR-15b и let-7d имели лучшую общую точность среди отдельно используемых микроРНК.

1. Способ диагностики болезни Альцгеймера или умеренного когнитивного нарушения (MCI) у субъекта, включающий:

определение уровня по меньшей мере одной микроРНК в образце крови, плазмы или сыворотки, взятом у субъекта, причем указанная по меньшей мере одна микроРНК выбрана из группы, состоящей из miR-15b, miR-191, miR-142-3р, Let-7g, Let-7d и их комбинаций,

при этом отклонение уровня указанной по меньшей мере одной микроРНК от уровня у здорового субъекта, определенное по отношению к соответствующему контролю, указывает на то, что субъект страдает болезнью Альцгеймера или MCI.

2. Способ по п. 1, где субъект имеет балл MMSE 0-20.

3. Способ по п. 1, где субъект имеет балл MMSE 21-26.

4. Способ по любому из пп. 1-3, включающий определение уровня одной микроРНК, выбранной из группы, состоящей из miR-191, miR-15b, miR-142-3р, Let-7g, Let-7d, в образце, причем отклонение уровня указанной микроРНК относительно уровня у здорового субъекта представляет собой снижение.

5. Способ по любому из пп. 1-3, дополнительно включающий определение уровня по меньшей мере одной дополнительной микроРНК в указанном образце, выбранной из группы, состоящей из miR-301a; miR-545; и miR-301a и miR-545.

6. Способ по любому из пп. 1-3, включающий определение уровня по меньшей мере двух микроРНК в указанном образце.

7. Способ по любому из пп. 1-3, включающий определение уровня по меньшей мере трех микроРНК в указанном образце.

8. Способ по п. 5, в котором указанная микроРНК представляет собой miR-545, let7g и miR-15b.

9. Способ по п. 5, в котором указанная микроРНК представляет собой miR-15b и miR-545.

10. Способ по п. 5, в котором указанная микроРНК представляет собой miR-301a, miR-545, let-7g и miR-15b.

11. Способ по любому из пп. 1-3, в котором указанная микроРНК представляет собой miR-191 и miR-15b.

12. Способ по любому из пп. 1-3, в котором указанная микроРНК представляет собой Let-7g и miR-15b.

13. Способ по п. 5, в котором указанная микроРНК представляет собой miR-191, miR-301a и miR-545.

14. Способ по п. 5, в котором указанная микроРНК представляет собой miR-301a, let-7g и miR-15b.

15. Способ по п. 5, в котором указанная микроРНК представляет собой miR-191, miR-301a, miR-545 и miR-15b.

16. Способ по любому из пп. 1-3, включающий определение уровней двух или более микроРНК в образце крови, плазме или сыворотке, взятом у субъекта, причем указанные микроРНК выбраны из группы, состоящей из

(a) miR-545, let7g и miR-15b,

(b) miR-15b и miR-545,

(c) miR-301a, miR-545, let-7g и miR-15b,

(d) miR-191 и miR-15b,

(e) Let-7g и miR-15b,

(f) miR-191, miR-301a и miR-545,

(g) miR-301a, let-7g и miR-15b, и

(h) miR-191, miR-301a, miR-545 и miR-15b;

и где соответствующим контролем является массив данных, представляющих уровни тех же микроРНК у здоровых субъектов и у субъектов с болезнью Альцгеймера или MCI.

17. Способ по любому из пп. 1-3, 8-10 или 13-15, в котором отклонение уровня по меньшей мере одной микроРНК от соответствующего контроля определяют путем исполнения программного алгоритма классификации.

18. Способ по любому из пп. 1-3, 8-10, 13-15, в котором указанный образец представляет собой образец, не содержащий микровезикул.

19. Способ по любому из пп. 1-3, 8-10, 13-15, в котором указанный образец представляет собой плазму.

20. Способ по любому из пп. 1-3, 8-10, 13-15, в котором указанный образец представляет собой сыворотку.

21. Способ по любому из пп. 1-3, 8-10, 13-15, дополнительно включающий выполнение по меньшей мере одного вспомогательного теста для диагностики болезни Альцгеймера.

22. Способ по п. 21, отличающийся тем, что дополнительный тест выбран из группы, состоящей из краткой шкалы оценки психического статуса (MMSE), теста mini-cog, теста по шкале оценки когнитивных функций при болезни Альцгеймера (ADAS-cog test) и теста на рисование часов.

23. Способ по п. 21, отличающийся тем, что дополнительный тест включает детектирование по меньшей мере одного дополнительного биомаркера болезни Альцгеймера.

24. Способ по любому из пп. 1-3, 8-10, 13-15, 22 или 23, дополнительно включающий введение субъекту терапевтически эффективного количества фармацевтической композиции, содержащей средство для лечения болезни Альцгеймера или его фармацевтически приемлемую соль или эфир, если определено, что субъект имеет отклонение в уровне по меньшей мере одной микроРНК по сравнению со здоровым субъектом.

25. Способ по п. 24, отличающийся тем, что средство для лечения болезни Альцгеймера выбрано из группы, состоящей из галантамина, ривастигмина и донепезила.

26. Способ по любому из пп. 1-3, 8-10, 13-15, 22, 23 или 25, отличающийся тем, что уровень микроРНК определяют с использованием агента, который специфично гибридизуется с указанной микроРНК.

27. Способ по любому из пп. 1-3, 8-10, 13-15, 22, 23 или 25, отличающийся тем, что уровень микроРНК определяют с использованием методов амплификации, гибридизации и/или секвенирования (например, количественной ПЦР).

28. Набор для диагностики болезни Альцгеймера или умеренного когнитивного нарушения (MCI) у субъекта, включающий:

(i) два или более агентов, селективно детектирующих присутствие по меньшей мере двух микроРНК, выбранных из группы, состоящей из miR-191, miR-15b, miR-142-3р, Let-7g, Let-7d, miR-301a и miR-545 в образце крови, плазмы или сыворотки, взятом у субъекта, причем каждый из указанных агентов содержит молекулу нуклеиновой кислоты, которая специфично гибридизуется с miR-191, miR-15b, miR-142-3р, Let-7g, Let-7d, miR-301a или miR-545; и

(ii) инструкции по определению уровня указанных по меньшей мере двух микроРНК в образце крови, плазмы или сыворотки, при этом отклонение уровня одной или более из указанных микроРНК от уровня у здорового субъекта, определенное по отношению к соответствующему контролю, указывает на то, что субъект страдает болезнью Альцгеймера или MCI.

29. Набор по п. 28, отличающийся тем, что указанный образец является плазмой.

30. Набор по п. 28, в котором указанный образец представляет собой сыворотку.

31. Набор по п. 28, отличающийся тем, что указанный образец представляет собой образец, не содержащий микровезикул.

32. Набор по п. 28, отличающийся тем, что отклонение уровня по меньшей мере одной микроРНК от соответствующего контроля определяют путем исполнения программного алгоритма классификации.

33. Способ или набор по любому из пп. 1-3, 8-10, 13-15 или 28, причем отклонение уровня указанной микроРНК от уровня у здорового субъекта представляет собой снижение.

34. Способ или набор по любому из пп.1-3, 8-10, 13-15 или 28, отличающийся тем, что субъект представляет собой млекопитающее.

35. Способ или набор по п. 34, отличающийся тем, что субъект является человеком.



 

Похожие патенты:

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для оценки прогноза кариеса. Из венозной крови выделяют ДНК.

Изобретение относится к области биохимии, в частности к способу определения зиготности гена fad-2 растения канолы. Также раскрыт набор для осуществления указанного способа.

Изобретение относится к области биотехнологии. Предложена тест-система, содержащая синтетические олигонуклеотидные праймеры, представляющие собой нуклеотидные последовательности SEQ ID NO:1-192 и определяющие 64 однонуклеотидных полиморфных маркера Х-хромосомы.

Изобретение относится к области биохимии и молекулярной биологии, в частности к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда. Указанный набор предназначен для идентификации ДНК возбудителя бластомикоза Blastomyces dermatitidis методом полимеразной цепной реакции с гибридизационно-флуоресцентным учетом результатов.

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для оценки прогноза кариеса. Из венозной крови выделяют ДНК.

Изобретение относится к области медицины, а именно к акушерству, гинекологии, неонатологии, микробиологии, молекулярной генетике, клинической лабораторной диагностике.

Изобретение относится к области биотехнологии. Заявлен способ определения бактериальной контаминации культур клеток человека, а также лекарственных средств и биоматериалов на их основе при помощи ПЦР-амплификации последовательности ДНК гена бактериальной 16s РНК, универсальной для всех видов бактерий, который отличается наличием внутреннего контроля, отсутствием ложноположительных результатов и регулируемой чувствительностью, что достигается введением в реакционную смесь праймеров для амплификации последовательности гена человеческого бета-актина.

Изобретение относится к области биотехнологии, в частности к клинической лабораторной диагностики вирусных инфекций, и может быть использовано для генотипирования вируса герпеса 6-го типа (ВГЧ-6).

Изобретение относится к биотехнологии. Предложен способ идентификации микроводорослей.

Изобретение относится к молекулярной генетике. Описан способ определения полиморфизма генов, ассоциированных с фертильностью крупного рогатого скота, а именно гена апоптотического протеаза-активирующего фактора 1 (APAF1), связанного с гаплотипом фертильности голштинского скота НН1.

Изобретение относится к области биотехнологии и вирусологии. Описан бактериофаг F510/08, имеющий геном, который содержит последовательность нуклеиновой кислоты SEQ ID NO:4.

Изобретение относится к области биохимии, в частности к способу определения зиготности гена fad-2 растения канолы. Также раскрыт набор для осуществления указанного способа.

Изобретение относится к области биохимии, в частности к способу определения зиготности гена fad-2 растения канолы. Также раскрыт набор для осуществления указанного способа.

Изобретение относится к области биотехнологии. Предложена тест-система, содержащая синтетические олигонуклеотидные праймеры, представляющие собой нуклеотидные последовательности SEQ ID NO:1-192 и определяющие 64 однонуклеотидных полиморфных маркера Х-хромосомы.

Изобретение относится к области биотехнологии. Предложена тест-система, содержащая синтетические олигонуклеотидные праймеры, представляющие собой нуклеотидные последовательности SEQ ID NO:1-192 и определяющие 64 однонуклеотидных полиморфных маркера Х-хромосомы.

Изобретение относится к области биохимии и молекулярной биологии, в частности к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда. Указанный набор предназначен для идентификации ДНК возбудителя бластомикоза Blastomyces dermatitidis методом полимеразной цепной реакции с гибридизационно-флуоресцентным учетом результатов.

Изобретение относится к области биохимии и молекулярной биологии, в частности к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда. Указанный набор предназначен для идентификации ДНК возбудителя бластомикоза Blastomyces dermatitidis методом полимеразной цепной реакции с гибридизационно-флуоресцентным учетом результатов.

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для оценки прогноза кариеса. Из венозной крови выделяют ДНК.

Изобретение относится к области медицины, в частности к стоматологии, и предназначено для оценки прогноза кариеса. Из венозной крови выделяют ДНК.

Изобретение относится к области биотехнологии, конкретно к белку «цинковые пальцы» неприродного происхождения, который связывается с геном Htt, что может быть использовано в медицине.

Изобретение относится к области медицины, в частности к пульмонологии и аллергологии, и предназначено для прогнозирования дыхательной недостаточности у больных бронхиальной астмой.

Изобретения касаются способа диагностики болезни Альцгеймера или умеренного когнитивного нарушения у субъекта и набора для осуществления указанной диагностики. Представленный способ включает определение уровня по меньшей мере одной микроРНК, выбранной из группы, состоящей из miR-15b, miR-191, miR-142-3р, Let-7g, Let-7d и их комбинаций, в образце крови, плазмы или сыворотки, взятом у субъекта. Отклонение уровня указанной по меньшей мере одной микроРНК от уровня у здорового субъекта, определенное по отношению к соответствующему контролю, указывает на то, что субъект страдает болезнью Альцгеймера или MCI. Набор для диагностики включает два или более агентов, селективно детектирующих присутствие по меньшей мере двух микроРНК, выбранных из группы, состоящей из miR-191, miR-15b, miR-142-3р, Let-7g, Let-7d, miR-301a и miR-545 в образце. Изобретения могут быть использованы для точной диагностики болезни Альцгеймера и MCI у субъекта. 2 н. и 33 з.п. ф-лы, 3 ил., 11 табл., 3 пр.

Наверх