Новые связывающие c5a нуклеиновые кислоты



Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
Новые связывающие c5a нуклеиновые кислоты
C12N2310/344 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)
C12N15/115 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2645261:

НОКСОН ФАРМА АГ (DE)

Настоящее изобретение относится к биохимии. Описана молекула L-нуклеиновой кислоты, способная связываться с C5a человека, где молекула L-нуклеиновой кислоты содержит центральный участок нуклеотидов, где центральный участок нуклеотидов содержит нуклеотидную последовательность 5' AUGn1GGUGKUn2n3RGGGHUGUKGGGn4Gn5CGACGCA 3' [SEQ ID NO: 61], где n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и G, A, U, C, H, K и R являются рибонуклеотидами, и dU, dG и dA являются 2'-дезоксирибонуклеотидами. Также описано использование данной молекулы для лечения или предотвращения заболевания, ассоциированного с активацией комплемента и опосредуемыми С5а патогенными механизмами. Также описано использование данной молекулы в диагностике такого заболевания. Также описан способ обнаружения указанной молекулы в образце. 8 н. и 18 з.п. ф-лы, 23 ил., 1 табл., 10 пр.

 

Настоящее изобретение относится к молекуле нуклеиновой кислоты, способной связываться с C5a и/C5, к ее применению для изготовления лекарственного средства, диагностического средства и средства для обнаружения, соответственно, к композиции, содержащей указанную молекулу нуклеиновой кислоты, комплексу, содержащему указанную молекулу нуклеиновой кислоты, способу скрининга антагониста активности, опосредуемой C5a и/C5, с использованием указанной молекулы нуклеиновой кислоты, и способу обнаружения указанной молекулы нуклеиновой кислоты.

Первичная структура анафилатоксина C5a человека (фактор комплемента 5a; SwissProt entry P01031) была определена в 1978 году (Fernandez & Hugh 1978). Он состоит из 74 аминокислот, которые имеют молекулярную массу 8200 Да, в то время как углеводная часть имеет массу приблизительно 3000 Да. Углеводная часть C5a существует в качестве одного комплексного олигосахаридного элемента, присоединенного к аспарагину в положении 64. Три дисульфидных связи обеспечивают стабильную жесткую структуру молекулы.

Хотя трехмерная структура форм C5a из различных видов млекопитающих в основном сохранена, аминокислотная последовательность не очень хорошо сохранилась в процессе эволюции. Выравнивание последовательностей демонстрируют общую идентичность последовательностей C5a человека и мыши, составляющую 64%. C5a человека имеет следующий процент идентичных аминокислот с C5a из:

- Macaca mulatta (макак-резус) 85%

- Macaca fascicularis (яванский макак) 85%

- Bos taurus (дикий бык) 69%

- Sus scrofa (свинья) 68%

- Mus musculus (мышь) 64%

- Rattus norvegicus (крыса) 61%

Помимо ограниченной гомологии последовательностей, гликозилирование также является гетерогенным. В то время как C5a человека гликозилирован по аспарагину 64, гомолог мыши вообще не гликозилирован. Более отдаленно родственные белки человека C3a и C4a обладают только 35 и 40%, соответственно, идентичностью с C5a.

Система комплемента была открыта в начале последнего столетия в качестве чувствительной к нагреванию фракции сыворотки, которая "комплементировала" опосредуемый антисывороткой лизис клеток и бактерий. Являясь гуморальным компонентом природного неспецифического (врожденного) иммунного ответа, она играет важную роль в защите хозяина против инфекционных агентов и в воспалительном процессе. Комплемент может активироваться тремя различными путями: (i) после того, как антитело связывается с поверхностью клетки или бактерией (называемый классическим каскадом), (ii) прямо посредством бактериальных или вирусных гликолипидов (называемый альтернативным каскадом), или (iii) посредством углеводов на бактериях (называемый лектиновым каскадом). Все эти каскады активации сходятся в точке активации компонентов комплемента C3 и C5, где начинается общий конечный каскад, завершающийся сборкой мембраноатакующего комплекса (сокращенно MAC). Система комплемента состоит более чем из 20 растворимых белков, которые функционируют либо в качестве протеолитических ферментов, либо в качестве связывающих белков, составляющих вплоть до приблизительно 10% от всех глобулинов в сыворотке позвоночных. Кроме того, система комплемента включает множество различных рецепторов клеточной поверхности, которые проявляют специфичность в отношении протеолитических фрагментов белков комплемента и которые экспрессируются воспалительными клетками и клетками, регулирующими адаптивный иммунный ответ. Существует несколько регуляторных белков, которые ингибируют активацию комплемента и, таким образом, защищают клетки-хозяева от случайной атаки комплемента. Система комплемента может активироваться независимо или вместе с адаптивным иммунным ответом.

Функции комплемента включают процесс опсонизации (т.е. обеспечение большей чувствительности бактерий к фагоцитозу), лизис бактерий и чужеродных клеток путем встраивания поры (называемой мембраноатакующим комплексом) в их мембрану, образование хемотактически активных веществ, повышение сосудистой проницаемости, обеспечение сокращения гладких мышц и стимуляцию дегрануляции тучных клеток. Аналогично каскаду свертывания, процесс активации комплемента организован в виде последовательных ферментативных стадий, также известных как ферментативный каскад (Sim and Laich, 2000). Подробная последовательность этих взаимодействий приведена ниже.

Классический каскад. Этот каскад антителозависимой активации дополняет специфический антительный ответ. Он настолько же тщательно контролируется, как и альтернативный каскад, но лишен способности к спонтанной инициации, т.е. антителонезависимой функции распознавания, и механизма усиления по принципу отрицательной обратной связи. Активаторами классического каскада являются комплексы антиген-антитело, β-амилоид, ДНК, полиинозиновая кислота, комплексы полианион-поликатион, такие как гепарин/протамин, некоторые оболочечные вирусы, кристаллы мононатрийурата, липид A клеточной стенки бактерий, пликатовая кислота, полисахарид яда муравьев, субклеточные мембраны (такие как митохондрии), а также происходящие из клеток и плазмы ферменты, такие как плазмин, калликреин, активированный фактор Хагемана, эластаза и катепсины. Индуцируемый антителом классический каскад начинается с C1, который связывается с Fc-фрагментом антитела (IgM > IgG3 > IgG1 >> IgG2), лигированным с антигеном клеточной поверхности. C1 представляет собой комплекс распознавания, состоящий из 22 полипептидных цепей в 3 субъединицах: C1q, C1r, C1s. Фактической областью распознавания является C1q - гликопротеин, содержащий коллаген-подобный домен (обладающий остатками гидроксипролина и гидроксилизина), который выглядит как букет тюльпанов. При связывании через C1q, C1r активируется, становясь протеазой, которая расщепляет C1s до формы, которая активирует (путем расщепления) как C2, так и C4, на C2a/b и C4a/b. C2a и C4b в комбинации образуют C4b2a - C3-конвертазу (C3-активирующий фермент). C4a обладает только слабой активностью анафилатоксина, однако не является хемотактическим. C3 является центральным для всех трех каскадов активации. В классическом каскаде конвертаза C4b2a расщепляет C3 на C3a/b. C3a представляет собой анафилатоксин. C3b в комбинации с C4b2a образует комплекс C4b2a3b (C5-конвертаза). C3b также может связываться прямо с клетками, что делает их чувствительными к фагоцитозу (опсонизация).

Альтернативный каскад. Этот каскад не требует антител для активации и имеет большое значение для защиты хозяина против бактериальной и вирусной инфекции, поскольку, в отличие от классического каскада, он прямо активируется поверхностными структурами вторгающихся микроорганизмов, такими как бактериальные/вирусные гликолипиды или эндотоксины. Другими активаторами являются инулины, эритроциты кролика, десиалированные эритроциты человека, фактор яда кобры или фосфоротиоатные олигонуклеотиды. Шесть белков: C3, факторы B, D, H, I и пропердин, вместе выполняют функции инициации, распознавания и активации каскада, которые приводят к образованию связанной с активатором конвертазы C3/C5. Каскад начинается с C3. Небольшое количество C3b всегда встречается в циркуляции в результате спонтанного расщепления C3 ("работа C3 на холостом ходу"), однако концентрации, как правило, держатся на очень низком уровне вследствие последующей деградации. Однако когда C3b связывается с сахарами на клеточной поверхности, он может служить в качестве ядра для активации альтернативного каскада. Затем фактор B связывается с C3b. В присутствии фактора D связавшийся фактор B расщепляется на Ba и Bb; Bb содержит активный центр для C3-конвертазы. Далее, пропердин связывается с C3bBb, стабилизируя C3bBb-конвертазу на клеточной поверхности, что приводит к расщеплению других молекул C3. Наконец, образуется альтернативная C5-конвертаза C3bBb3b, которая расщепляет C5 на C5a/b. После появления C5b инициирует сборку мембраноатакующего комплекса, как описано выше. Как правило, только грамотрицательные клетки могут прямо лизироваться антителом вместе с комплементом; грамположительные клетки в основном устойчивы. Однако фагоцитоз значительно усиливается путем опсонизации C3b (фагоциты имеют рецепторы C3b на их поверхности) и антитело не всегда требуется. Кроме того, комплемент может нейтрализовать вирусные частицы либо путем прямого лизиса, либо путем предотвращения проникновения вируса в клетки-хозяева.

Лектиновый каскад. Открытый самым поздним каскад лектинов или маннан-связывающих лектинов (сокращенно MBL) зависит от врожденного распознавания чужеродных веществ (т.е. бактериальных поверхностей). Этот каскад обладает структурным и функциональным сходством с классическим каскадом. Активация лектинового каскада начинается с помощью белка острой фазы MBL, который распознает маннозу на бактериях, IgA и, возможно, структур, обнажаемых поврежденным эпителием. MBL гомологичен C1q и запускает ассоциированные с MBL сериновые протеазы (сокращенно MASP), для которых было описано три формы: MASP1, MASP2 и MASP3. Последующий лектиновый каскад активации практически идентичен активации классического каскада с образованием тех же C3- и C5-конвертаз. Кроме того, существуют некоторые данные о том, что MASP в некоторых условиях могут прямо активировать C3.

Терминальный каскад. Все три каскада активации сходятся в точке образования C5-конвертазы (C4b2a3b в классическом и лектиновом каскаде, C3bBb3b в альтернативном каскаде), которая расщепляет C5 на C5a/b. C5a обладает активностью анафилатоксина и является хемотактическим. Другой фрагмент C5 C5b функционирует посредством его гидрофобного участка связывания в качестве якоря на поверхности клеток-мишеней, на которой образуется литический мембраноатакующий комплекс (MAC или терминальный комплекс комплемента, сокращенно TCC). MAC собирается из пяти белков-предшественников: C5b, C6, C7, C8 и C9. Конечным событием является образование олигомеров C9, которые встраиваются в качестве трансмембранных каналов в плазматическую мембрану, что приводит к осмотическому лизису клетки. Сборка MAC контролируется растворимым белком фактором S плазмы (также называемый витронектином) и SP-40,40 (также известный как кластерин) и CD59 и HRF (гомологичный фактор рестрикции) на мембранах клеток-хозяев. Многие типы клеток являются чувствительными к опосредуемому комплементом лизису: эритроциты, тромбоциты, бактерии, вирусы, обладающие липопротеиновой оболочкой, и лимфоциты.

Система комплемента является мощным механизмом инициации и усиления воспаления. Оно опосредуется фрагментами компонентов комплемента. Анафилатоксины являются наиболее четко определенными фрагментами, и они являются протеолитическими фрагментами сериновых протеаз системы комплемента: C3a, C4a и C5a. Анафилатоксины продуцируются не только в ходе активации комплемента, но также при активации других ферментных систем, которые могут прямо расщеплять C3, C4 и C5. Такие ферменты включают тромбин, плазмин, калликреин, тканевые и лейкоцитарные лизосомальные ферменты и бактериальные протеазы. Анафилатоксины обладают мощными эффектами на стенки кровеносных сосудов, что вызывает сокращение гладких мышц (например, мышц подвздошной кишки, бронхов, матки и сосудов) и повышение проницаемости сосудов. Эти эффекты демонстрируют специфическую тахифилаксию (т.е. многократная стимуляция индуцирует снижение ответов), и они могут блокироваться антигистаминами; они, возможно, непрямо опосредуются высвобождением гистамина из тучных клеток и базофилов. C5a представляет собой N-концевой продукт расщепления α-цепи белка плазмы C5 из 74 аминокислот. Он связывается с высокой аффинностью рецептором C5aR (также известным как C5R1 или CD88) - молекулой, присутствующей на многих различных типах клеток: в наибольшей степени на нейтрофилах, макрофагах, гладкомышечных клетках и эндотелиальных клетках. C5a до настоящего времени является наиболее мощным анафилатоксином, приблизительно в 100 раз более эффективным, чем C3a, и в 1000 раз более эффективным, чем C4a. Эта активность снижается в порядке C5a > гистамин > ацетилхолин > C3a >> C4a.

C5a является чрезвычайно мощным в отношении стимуляции хемотаксиса, прикрепления нейтрофилов, формировании их дыхательного взрыва и дегрануляции. C5a также стимулирует нейтрофилы и эндотелиальные клетки к представлению большего количество молекул адгезии; внутривенная инъекция C5a, например, быстро приводит к нейтропении в экспериментах на животных путем запуска прикрепления нейтрофилов к стенкам кровеносных сосудов. После лигирования рецептора C5a нейтрофилов следует мобилизация мембранной арахидоновой кислоты, которая метаболизируется до простагландинов и лейкотриенов, включая LTB4, другой мощный хемоаттрактант для нейтрофилов и моноцитов. После лигирования C5a-рецепторов моноцитов высвобождается IL-1. Таким образом, локальное высвобождение C5a в участках воспаления приводит к мощным провоспалительным стимулам. В действительности, высвобождение C5a прямо или непрямо связано с множеством острых и хронических состояний, таких как ассоциированные с иммунным комплексом заболевания в общем (Heller et al., 1999); астма (Kohl, 2001); септический шок (Huber-Lang et al., 2001); синдром системного воспалительного ответа (сокращенно SIRS); полиорганная недостаточность (сокращенно MOF); острый респираторный дистресс-синдром (сокращенно ARDS); синдром воспаленной кишки (сокращенно IBD) (Woodruff et al., 2003); инфекции; тяжелые ожоги (Piccolo et al., 1999); реперфузионное повреждение органов, таких как сердце (van der Pals et al., 2010), селезенка, мочевой пузырь, поджелудочная железа, желудок, легкое, печень, почка, конечности, скелетные мышцы или кишечник (Riley et al., 2000); псориаз (Bergh et al., 1993); миокардит; рассеянный склероз (Muller-Ladner et al., 1996) и ревматоидный артрит (сокращенно RA) (Woodruff et al., 2002).

Опубликованы многочисленные обзоры, касающиеся взаимосвязи между системой комплемента и заболевания (Kirschfink, 1997; Kohl, 2001; Makrides, 1998; Walport, 2001a; Walport, 2001b). Повреждение клеток комплементом происходит вследствие активации либо классического, либо альтернативного каскада на поверхности клетки. MAC представляет собой надмолекулярную организованную структуру, которая состоит приблизительно из двадцати белковых молекул и имеет молекулярную массу приблизительно 1,7 миллиона Да. Полностью собранный MAC содержит одну молекулу каждого из C5b, C6, C7 и C8 и несколько молекул C9. Все эти компоненты MAC являются гликопротеинами. Когда C5 расщепляется C5-конвертазой и образуется C5b, начинается самосборка MAC. C5b и C6 образуют стабильный и растворимый бимолекулярный комплекс, который связывается с C7 и индуцирует представление им метастабильного участка, через который образующийся тримолекулярный комплекс (C5b-7) может встраиваться в мембраны, когда это происходит на липидном бислое-мишени или вблизи него. Встраивание опосредуется гидрофобными областями на комплексе C5b-7, который появляется после связывания C7 с C5b-6. Мембраносвязанный C5b-7 обеспечивает сборку MAC на участке мембраны и формирует рецептор для C8. Связывание одной молекулы C8 с каждым комплексом C5b-7 дает начало небольшим трансмембранным каналам с функциональным диаметром менее 1 нм, которые могут нарушать мембраны бактерий и эритроцитов, являющихся мишенями. Каждый мембраносвязанный комплекс C5b-8 действует в качестве рецептора для множества молекул C9 и, по-видимому, способствует встраиванию C9 в углеводородный центр клеточной мембраны. Связывание одной молекулы C9 инициирует процесс олигомеризации C9 в области атаки на мембрану. После включения в комплекс по меньшей мере 12 молекул образуется отдельная структура канала. Таким образом, конечный продукт состоит из тетрамолекулярного комплекса C5b-8 (c молекулярной массой приблизительно 550 кДа) и трубкообразного поли-C9 (с молекулярной массой приблизительно 1100 кДа). Эта форма MAC после встраивания в клеточные мембраны образует завершенные трансмембранные каналы, обеспечивающие осмотический лизис клетки. Образованные трансмембранные каналы варьируют по размеру в зависимости от количества молекул C9, включенных в структуру канала. В то время как присутствие поли-C9 не является абсолютно необходимым для лизиса эритроцитов или ядросодержащих клеток, оно может быть необходимым для уничтожения бактерий.

Система комплемента в основном полезна для защиты организма против вторгающихся микроорганизмов. Ранние компоненты каскада комплемента важны для опсонизации инфекционных агентов после их элиминации из организма. Кроме того, они выполняют несколько нормальных функций иммунной системы, таких как контроль образования и выведения иммунных комплексов или удаления дебриса, погибших тканей и чужеродных веществ. Все три каскада активации, которые распознают различные молекулярные структуры, которые (в здоровом организме) определяют широкий набор не являющихся своими структур, помогают контролировать вторгающиеся микроорганизмы. Терминальный каскад комплемента - который завершается сборкой MAC - представляет собой следующую линию защиты путем лизиса бактерий и чужеродных клеток.

Важность функциональной системы комплемента становится очевидной при рассмотрении защитных эффектов комплемента. Например, индивидуумы с отсутствием одного из белков альтернативного каскада или более поздних компонентов (C3-C9) имеют тенденцию к приобретению тяжелых инфекций пиогенными организмами, в частности, видами Neisseria. Дефицит компонентов классического каскада (таких как C1, C2, C4) также ассоциирован с увеличенным, хотя и не сильно повышенным, риском инфекции. Компоненты комплемента, такие как C1 и MBL, также не обладают способностью нейтрализовывать вирусы путем препятствования взаимодействию вируса с клеточной мембраной хозяина, таким образом, препятствуя вхождению в клетку.

Следует отметить, что, хотя расщепление C5 приводит к C5a, а также к MAC, клинические признаки дефицита C5 не отличаются значительно от клинических признаков дефицитов других терминальных компонентов (например, C6, C7, C8, C9), что указывает на то, что отсутствие C5a не вносит значительного вклада в клиническую картину у пациентов с дефицитом C5. Таким образом, селективный антагонизм C5a является перспективным в качестве оптимального инструмента воздействия так, чтобы нормальные вышележащие и нижележащие функции комплемента в отношении предотвращения заболевания оставались неизмененными. Таким образом, блокируется только вредоносная сверхпродукция провоспалительного анафилатоксина.

Тот факт, что мыши с дефицитом C5aR - хотя они более чувствительны к инфекциям Pseudomonas aeruginosa - в остальном выглядят нормальными, указывает на то, что блокада функции C5a не имеет вредоносных эффектов.

Известно несколько соединений, нацеленных на C5a или C5 или соответствующий рецептор, и их успешно исследовали в моделях in vivo. Некоторые из них далее исследовали в клинических испытаниях. Специфичное к C5 гуманизированное антитело экулизумаб одобрено для лечения пароксизмальной ночной гемоглобинурии, и была продемонстрирована его эффективность для лечения атипичного гемофильного уремического синдрома (aHUS), острого опосредуемого антителом отторжения аллотрансплантата и синдрома холодовой агглютинации. Оно препятствует расщеплению C5 и ингибирует действие как C5a, так и C5b. Помимо сходных находящихся на стадии испытания антител против C5 и фрагментов антител, особый интерес представляют антитела, которые селективно нарушают взаимодействие C5a:C5aR (CD88) и оставляют расщепление C5 и зависимое от C5b образование MAC неизмененными. Примерами являются гуманизированное mAb против C5a MEDI-7814, которое находится на фазе I клинической разработки для потенциального в/в лечения воспалительных нарушений и повреждения тканей, и антитело против C5a TNX-558, для которого, однако, не описано разработок с 2007 года. Антитело к рецептору C5a нейтразумаб находится на стадии разработки для лечения ревматоидного артрита и инсульта (Ricklin & Lambris, 2007; Wagner & Frank, 2010).

Пегилированный аптамер против C5 (ARC-1905) находится на стадии доклинической разработки для лечения AMD. CCX168 представляет собой низкомолекулярный ингибитор C5aR, в настоящее время находящийся на фазе II клинической разработки для лечения ассоциированного с цитоплазматическими антителами против нейтрофилов васкулитом (ChemoCentryx Press Release Oct 17, 2011). Другим антагонистом C5aR, находящимся в клинической разработке, является MP-435 для лечения ревматоидного артрита.

В последнее время не было описано разработок для низкомолекулярных антагонистов/пептидомиметиков рецепторов C5a JPE-1375, JSM-7717 (Ricklin & Lambris 2007). Другой ингибитор рецептора C5a CD88, циклический гексапептид PMX53, является эффективным в моделях воспаления на животных, однако он не достигает конечных результатов в плацебо-контролируемых двойных слепых испытаниях у пациентов с ревматоидным артритом. Клиническая разработка для AMD также прекратилась (Wagner & Frank 2010). Опубликовано, что находящийся на стадии испытаний вариант PMX53, PMX205 является активным в моделях деменции при болезни Альцгеймера на мышах (Fonseca et al., 2009). Следующим находящимся на стадии клинических испытаний соединением является антагонист рецептора C5a (C5aR) CCX-168. Было начато испытание фазы I для лечения воспалительных и аутоиммунных заболеваний в январе 2010 года.

Помимо эффектов C5a, как описано выше, новые данные позволили предположить, что образование C5a в микроокружении опухоли усиливает рост опухоли путем подавления противоопухолевого опосредуемого CD8+ T-клетками ответа, при этом указанное подавление, по-видимому, ассоциировано с привлечением супрессорных клеток миелоидного происхождения в опухоли и усилением их направленных на T-клетки супрессивных способностей. Markiewski et al. продемонстрировали, что блокада рецепторов C5a пептидным антагонистом рецептора C5a приводила к замедлению роста опухоли в модели на мышах (Markiewski et al., 2008).

Большинство пептидных соединений подвержено деградации, и, кроме того, модификация пептидазами демонстрирует высокую скорость выведения из организма, предпочтительно организма человека. Таким образом, эти пептидные соединения нельзя считать подобными лекарственному средству молекулами, являющимися предпосылкой для разработки лекарственных средств, обычно подлежащими выпуску в продажу.

В прошлом было разработано несколько шпигельмеров, специфично связывающихся с C5a человека, но не с C5a других видов (см. WO 2009/040113 и WO 2010/108657).

Поскольку для доклинической и клинической разработки необходимы модели на животных, проблемой, лежащей в основе настоящего изобретения, является предоставление соединения, которое взаимодействует с C5a мыши. Более конкретно, проблемой, лежащей в основе настоящего изобретения, является предоставление соединения, которое взаимодействует как с C5a мыши, так и с C5a человека.

Следующей проблемой, лежащей в основе настоящего изобретения, является предоставление соединения для изготовления лекарственного средства для лечения заболеваний человека и/или не человека, где заболевание характеризуется тем, что C5a либо прямо, либо непрямо вовлечен в патогенетический механизм такого заболевания.

Следующей проблемой, лежащей в основе настоящего изобретения, является предоставление соединения для изготовления диагностического средства для лечения заболевания, где заболевание характеризуется тем, что C5a либо прямо, либо непрямо вовлечен в патогенетический механизм такого заболевания.

Эти и другие проблемы, лежащие в основе настоящего изобретения, решаются содержанием прилагаемой формулы изобретения. Предпочтительные варианты осуществления могут быть взяты из зависимых пунктов формулы изобретения.

Проблема, лежащая в основе настоящего изобретения, решается в первом аспекте, который также является первым вариантом осуществления первого аспекта, с помощью молекулы нуклеиновой кислоты, способной связываться с C5a человека, где молекула нуклеиновой кислоты содержит центральный участок нуклеотидов, где центральный участок нуклеотидов содержит нуклеотидную последовательность

5' AUGn1GGUGKUn2n3RGGGHUGUKGGGn4Gn5CGACGCA 3' [SEQ ID NO: 61], где

n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и

G, A, U, C, H, K и R являются рибонуклеотидами, и

dU, dG и dA являются 2'-дезоксирибонуклеотидами.

Во втором варианте осуществления первого аспекта, который также является вариантом осуществления первого варианта осуществления первого аспекта, центральный участок нуклеотидов содержит нуклеотидную последовательность, выбранную из группы:

a) 5' AUGn1GGUGUUn2n3AGGGUUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 62],

b) 5' AUGn1GGUGUUn2n3GGGGUUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 63],

c) 5' AUGn1GGUGUUn2n3AGGGUUGUUGGGn4Gn5CGACGCA 3' [SEQ ID NO: 64],

d) 5' AUGn1GGUGGUn2n3AGGGUUGUUGGGn4Gn5CGACGCA 3' [SEQ ID NO: 65],

e) 5' AUGn1GGUGGUn2n3GGGGUUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 66],

f) 5' AUGn1GGUGGUn2n3GGGGAUGUGGGGn4Gn5CGACGCA 3'[SEQ ID NO: 67], и

g) 5' AUGn1GGUGUUn2n3GGGGCUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 68],

где

n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и

G, A, U и C являются рибонуклеотидами, и

dU, dG и dA являются 2'-дезоксирибонуклеотидами.

В третьем варианте осуществления первого аспекта, который также является вариантом осуществления второго варианта осуществления первого аспекта, центральный участок нуклеотидов содержит нуклеотидную последовательность

5' AUGn1GGUGGUn2n3AGGGUUGUUGGGn4Gn5CGACGCA 3' [SEQ ID NO: 65], где

n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и

G, A, U и C являются рибонуклеотидами, и

dU, dG и dA являются 2'-дезоксирибонуклеотидами.

В четвертом варианте осуществления первого аспекта, который также является вариантом осуществления третьего варианта осуществления первого аспекта, центральный участок нуклеотидов содержит нуклеотидную последовательность, выбранную из группы:

a) 5' AUGdUGGUGGUGAAGGGUUGUUGGGUGUCGACGCA 3' [SEQ ID NO: 73],

b) 5' AUGUGGUGGUdGAAGGGUUGUUGGGUGUCGACGCA 3' [SEQ ID NO: 74],

c) 5' AUGUGGUGGUGdAAGGGUUGUUGGGUGUCGACGCA 3' [SEQ ID NO: 75],

d) 5' AUGUGGUGGUGAAGGGUUGUUGGGdUGUCGACGCA 3' [SEQ ID NO: 76],

e) 5' AUGUGGUGGUGAAGGGUUGUUGGGUGdUCGACGCA 3' [SEQ ID NO: 77],

f) 5' AUGdUGGUGGUGAAGGGUUGUUGGGdUGUCGACGCA 3' [SEQ ID NO: 78],

g) 5' AUGdUGGUGGUGAAGGGUUGUUGGGUGdUCGACGCA 3' [SEQ ID NO: 79],

h) 5' AUGUGGUGGUGAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 80],

i) 5' AUGdUGGUGGUGAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 81],

j) 5' AUGdUGGUGGUdGAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 82],

k) 5' AUGdUGGUGGUGdAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 83],

l) 5' AUGdUGGUGGUdGdAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 84],

предпочтительно центральный участок нуклеотидов представляет собой

5' AUGdUGGUGGUGAAGGGUUGUUGGGdUGUCGACGCA 3' [SEQ ID NO: 78] или

5' AUGdUGGUGGUdGdAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 84].

В пятом варианте осуществления первого аспекта, который также является вариантом осуществления второго варианта осуществления первого аспекта, центральный участок нуклеотидов содержит нуклеотидную последовательность

5' AUGn1GGUGGUn2n3GGGGUUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 66], где

n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и

G, A, U и C являются рибонуклеотидами, и

dU, dG и dA являются 2'-дезоксирибонуклеотидами.

В шестом варианте осуществления первого аспекта, который также является вариантом осуществления второго варианта осуществления первого аспекта, центральный участок нуклеотидов содержит нуклеотидную последовательность

5' AUGn1GGUGGUn2n3GGGGAUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 67], где

n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и

G, A, U и C являются рибонуклеотидами, и

dU, dG и dA являются 2'-дезоксирибонуклеотидами.

В седьмом варианте осуществления первого аспекта, который также является вариантом осуществления второго варианта осуществления первого аспекта, центральный участок нуклеотидов содержит нуклеотидную последовательность

5' AUGn1GGUGUUn2n3AGGGUUGUUGGGn4Gn5CGACGCA 3' [SEQ ID NO: 64], где

n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и

G, A, U и C являются рибонуклеотидами, и

dU, dG и dA являются 2'-дезоксирибонуклеотидами.

В восьмом варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, пятого, шестого и седьмого вариантов осуществления первого аспекта, центральный участок нуклеотидов состоит из рибонуклеотидов и 2'-дезоксирибонуклеотидов.

В девятом варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, пятого, шестого и седьмого вариантов осуществления первого аспекта, центральный участок нуклеотидов состоит из рибонуклеотидов.

В десятом варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, пятого, шестого, седьмого, восьмого и девятого вариантов осуществления первого аспекта, молекула нуклеиновой кислоты содержит в направлении 5'→3' первый концевой участок нуклеотидов, центральный участок нуклеотидов и второй концевой участок нуклеотидов, где

первый концевой участок нуклеотидов содержит от одного до пяти нуклеотидов и

второй концевой участок нуклеотидов содержит от одного до пяти нуклеотидов,

предпочтительно

первый концевой участок нуклеотидов содержит от трех до пяти нуклеотидов и

второй концевой участок нуклеотидов содержит от трех до пяти нуклеотидов,

более предпочтительно

первый концевой участок нуклеотидов содержит три нуклеотида и

второй концевой участок нуклеотидов содержит три нуклеотида.

В одиннадцатом варианте осуществления первого аспекта, который также является вариантом осуществления десятого варианта осуществления первого аспекта, первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' Z1Z2Z3Z4G 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' Z5Z6Z7Z8Z9 3', где

Z1 представляет собой G или отсутствует, Z2 представляет собой S или отсутствует, Z3 представляет собой S или отсутствует, Z4 представляет собой B или отсутствует, Z5 представляет собой C или dC, Z6 представляет собой V или отсутствует, Z7 представляет собой S или отсутствует, Z8 представляет собой S или отсутствует, Z9 представляет собой C или отсутствует, и

G, S, B, C, V являются рибонуклеотидами, и

dC представляет собой 2'-дезоксирибонуклеотид,

предпочтительно

a) Z1 представляет собой G, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой C, или

b) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

c) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

d) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует, или

e) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой C, или

f) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой C, или

g) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой C, или

h) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 отсутствует, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой C, или

i) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

j) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

k) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 отсутствует, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

l) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

m) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует, или

n) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 отсутствует, Z5 представляет собой C, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

o) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

p) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует, или

q) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 отсутствует, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует.

В двенадцатом варианте осуществления первого аспекта, который также является вариантом осуществления десятого и одиннадцатого вариантов осуществления первого аспекта, первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCCUG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CAGGC 3' или 5' dCAGGC 3', где

C, A, G и U представляют собой рибонуклеотиды, и

dC представляет собой 2'-дезоксирибонуклеотид.

В 13-м варианте осуществления первого аспекта, который также является вариантом осуществления двенадцатого варианта осуществления первого аспекта, второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAGGC 3'.

В 14-м варианте осуществления первого аспекта, который также является вариантом осуществления двенадцатого варианта осуществления первого аспекта, второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CAGGC 3'.

В 15-м варианте осуществления первого аспекта, который также является вариантом осуществления десятого и одиннадцатого вариантов осуществления первого аспекта,

первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CCUG 3' или 5' CUG 3'или 5' UG 3' или 5' G 3', и

второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAGGC 3', где

C, A, G и U представляют собой рибонуклеотиды, и

dC представляет собой 2'-дезоксирибонуклеотид.

В 16-м варианте осуществления первого аспекта, который также является вариантом осуществления 15-го варианта осуществления первого аспекта, первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CCUG 3'.

В 17-м варианте осуществления первого аспекта, который также является вариантом осуществления 15-го варианта осуществления первого аспекта, первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CUG 3'.

В 18-м варианте осуществления первого аспекта, который также является вариантом осуществления десятого и одиннадцатого вариантов осуществления первого аспекта,

a) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCUG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAGC 3'; или

b) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGGC 3'; или

c) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GGCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGCC 3'; где

C, A, G и U представляют собой рибонуклеотиды, и

dC представляет собой 2'-дезоксирибонуклеотид.

В 19-м варианте осуществления первого аспекта, который также является вариантом осуществления 18-го варианта осуществления первого аспекта,

первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GGCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGCC 3'.

В 20-м варианте осуществления первого аспекта, который также является вариантом осуществления десятого и одиннадцатого вариантов осуществления первого аспекта,

первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CUG 3' или 5' UG 3' или 5' CG 3' или 5' G 3', и

второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAGC 3', где

C, A, G и U представляют собой рибонуклеотиды, и

dC представляет собой 2'-дезоксирибонуклеотид.

В 21-м варианте осуществления первого аспекта, который также является вариантом осуществления десятого и одиннадцатого вариантов осуществления первого аспекта,

первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCUG 3', и

второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAC 3' или 5' dCC 3' или 5' dCA 3', где

C, A, G и U представляют собой рибонуклеотиды, и

dC представляет собой 2'-дезоксирибонуклеотид.

В 22-м варианте осуществления первого аспекта, который также является вариантом осуществления десятого и одиннадцатого вариантов осуществления первого аспекта,

a) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GUG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAC 3'; или

b) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' UG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCA 3'; или

c) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGC 3'; или

d) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGC 3'; или

e) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' G 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGC 3'; или

f) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCC 3'; или

g) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dC 3'; или

h) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCC 3';

i) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CGC 3'; где

C, A, U и G представляют собой рибонуклеотиды, и

dC представляет собой 2'-дезоксирибонуклеотид.

В 23-м варианте осуществления первого аспекта, который также является вариантом осуществления 22-го варианта осуществления первого аспекта, первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGC 3'.

В 24-м варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, пятого, шестого, седьмого, девятого, десятого, одиннадцатого, двенадцатого и 14-го вариантов осуществления первого аспекта, молекула нуклеиновой кислоты содержит нуклеотидную последовательность, выбранную из группы SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 90, или молекулы нуклеиновой кислоты, обладающей идентичностью по меньшей мере 85% с молекулой нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 90, или молекулы нуклеиновой кислоты, которая гомологична молекуле нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 90, где гомология составляет по меньшей мере 85%.

В 25-м варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, восьмого, десятого, одиннадцатого, двенадцатого, 13-го, 14-го, 15-го, 16-го, 17-го, 18-го, 19-го, 20-го, 21-го, 22-го и 23-го вариантов осуществления первого аспекта, молекула нуклеиновой кислоты содержит нуклеотидную последовательность, выбранную из группы SEQ ID NO: 14, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 37, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 91 и SEQ ID NO: 92, или молекулы нуклеиновой кислоты, имеющей идентичность по меньшей мере 85% с молекулой нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы SEQ ID NO: 14, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 37, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 91 и SEQ ID NO: 92, или молекулы нуклеиновой кислоты, которая гомологична молекуле нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы SEQ ID NO: 14, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 37, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 91 и SEQ ID NO: 92, где гомология составляет по меньшей мере 85%.

В 26-м варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, пятого, шестого, седьмого, восьмого, девятого, десятого, одиннадцатого, двенадцатого, 13-го, 14-го, 15-го, 16-го, 17-го, 18-го, 19-го, 20-го, 21-го, 22-го, 23-го, 24-го и 25-го вариантов осуществления первого аспекта, молекула нуклеиновой кислоты способна связывать C5a человека и C5a мыши.

В 27-м варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, пятого, шестого, седьмого, восьмого, девятого, десятого, одиннадцатого, двенадцатого, 13-го, 14-го, 15-го, 16-го, 17-го, 18-го, 19-го, 20-го, 21-го, 22-го, 23-го, 24-го, 25-го и 26-го варианта осуществления первого аспекта, молекула нуклеиновой кислоты содержит по меньшей мере одну связывающую часть, которая способна связывать C5a человека и C5a мыши, где такая связывающая часть состоит из L-нуклеотидов.

В 28-м варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, пятого, шестого, седьмого, восьмого, девятого, десятого, одиннадцатого, двенадцатого, 13-го, 14-го, 15-го, 16-го, 17-го, 18-го, 19-го, 20-го, 21-го, 22-го, 23-го, 24-го, 25-го, 26-го и 27-го вариантов осуществления первого аспекта, нуклеотиды молекулы нуклеиновой кислоты или нуклеотиды, образующие молекулу нуклеиновой кислоты, представляют собой L-нуклеотиды.

В 29-м варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, пятого, шестого, седьмого, восьмого, девятого, десятого, одиннадцатого, двенадцатого, 13-го, 14-го, 15-го, 16-го, 17-го, 18-го, 19-го, 20-го, 21-го, 22-го, 23-го, 24-го, 25-го, 26-го, 27-го и 28-го вариантов осуществления первого аспекта, молекула нуклеиновой кислоты представляет собой молекулу L-нуклеиновой кислоты.

В 30-м варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, пятого, шестого, седьмого, восьмого, девятого, десятого, одиннадцатого, двенадцатого, 13-го, 14-го, 15-го, 16-го, 17-го, 18-го, 19-го, 20-го, 21-го, 22-го, 23-го, 24-го, 25-го, 26-го, 27-го, 28-го и 29-го вариантов осуществления первого аспекта, нуклеиновая кислота представляет собой антагонист активности, опосредуемой C5a человека и/или мыши.

В 31-м варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, пятого, шестого, седьмого, восьмого, девятого, десятого, одиннадцатого, двенадцатого, 13-го, 14-го, 15-го, 16-го, 17-го, 18-го, 19-го, 20-го, 21-го, 22-го, 23-го, 24-го, 25-го, 26-го, 27-го, 28-го, 29-го и 30-го вариантов осуществления первого аспекта, молекула нуклеиновой кислоты содержит модифицирующую группу, где скорость экскреции молекулы нуклеиновой кислоты, содержащей модифицированную группу, из организма снижена по сравнению с нуклеиновой кислотой, не содержащей модифицированную группу.

В 32-м варианте осуществления первого аспекта, который также является вариантом осуществления первого, второго, третьего, четвертого, пятого, шестого, седьмого, восьмого, девятого, десятого, одиннадцатого, двенадцатого, 13-го, 14-го, 15-го, 16-го, 17-го, 18-го, 19-го, 20-го, 21-го, 22-го, 23-го, 24-го, 25-го, 26-го, 27-го, 28-го, 29-го и 30-го вариантов осуществления первого аспекта, молекула нуклеиновой кислоты содержит модифицирующую группу, где молекула нуклеиновой кислоты, содержащая модифицирующую группу, имеет увеличенное время удержания в организме по сравнению с молекулой нуклеиновой кислоты, не содержащей модифицирующую группу.

В 33-м варианте осуществления первого аспекта, который также является вариантом осуществления 31-го и 32-го вариантов осуществления первого аспекта, модифицирующая группа выбрана из группы, содержащей биодеградируемые и небиодеградируемые модификации, предпочтительно модифицирующая группа выбрана из группы, включающей полиэтиленгликоль, линейный полиэтиленгликоль, разветвленный полиэтиленгликоль, гидроксиэтилкрахмал, пептид, белок, полисахарид, стерин, полиоксипропилен, полиоксиамидат и поли-(2-гидроксиэтил)-L-глутамин.

В 34-м варианте осуществления первого аспекта, который также является вариантом осуществления 33-го варианта осуществления первого аспекта, модифицирующая группа представляет собой полиэтиленгликоль, предпочтительно состоящий из линейного полиэтиленгликоля или разветвленного полиэтиленгликоля, где молекулярная масса полиэтиленгликоля предпочтительно составляет от приблизительно 20000 до приблизительно 120000 Да, более предпочтительно от приблизительно 30000 до приблизительно 80000 Да и наиболее предпочтительно приблизительно 40000 Да.

В 35-м варианте осуществления первого аспекта, который также является вариантом осуществления 33-го варианта осуществления первого аспекта, модифицирующая группа представляет собой гидроксиэтилкрахмал, где предпочтительно молекулярная масса гидроксиэтилкрахмала составляет от приблизительно 50 до приблизительно 1000 кДа, более предпочтительно от приблизительно 100 до приблизительно 700 кДа и наиболее предпочтительно от 200 до 500 кДа.

В 36-м варианте осуществления первого аспекта, который также является вариантом осуществления 31-го, 32-го, 33-го, 34-го и 35-го вариантов осуществления первого аспекта, модифицирующая группа связана с молекулой нуклеиновой кислоты через линкер, при этом предпочтительно линкер является биодеградируемым линкером.

В 37-м варианте осуществления первого аспекта, который также является вариантом осуществления 31-го, 32-го, 33-го, 34-го, 35-го и 36-го вариантов осуществления первого аспекта, модифицирующая группа связана с 5'-концевым нуклеотидом и/или 3'-концевым нуклеотидом молекулы нуклеиновой кислоты и/или с нуклеотидом молекулы нуклеиновой кислоты между 5'-концевым нуклеотидом молекулы нуклеиновой кислоты и 3'-концевым нуклеотидом молекулы нуклеиновой кислоты.

В 38-м варианте осуществления первого аспекта, который также является вариантом осуществления 31-го, 32-го, 33-го, 34-го, 35-го, 36-го и 37-го вариантов осуществления первого аспекта, организм представляет собой организм животного или человека, предпочтительно организм человека.

Проблема, лежащая в основе настоящего изобретения, решается во втором аспекте, который также является первым вариантом осуществления второго аспекта, с помощью молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта, для применения в способе лечения и/или предотвращения заболевания.

Во втором варианте осуществления второго аспекта, который также является вариантом осуществления первого варианта осуществления второго аспекта, заболевание ассоциировано с активацией комплемента и опосредуемыми C5a патогенными механизмами и/или выбрано из группы, включающей аутоиммунное заболевание, воспалительное заболевание, синдром системного воспалительного ответа, заболевание глаза, повреждение при ишемии/реперфузии, замедленное функционирование трансплантата, отторжение трансплантата, сердечно-сосудистое заболевание, респираторное заболевание, острые реакции, инфекционное заболевание, неврологическое заболевание, нейродегенеративное заболевание, фиброзное заболевание, гематологическое заболевание, метаболическое заболевание, опухоли и клинические осложнения, ассоциированные с активацией комплемента биоматериалами, предпочтительно синдром системного воспалительного ответа выбран из группы, включающей сепсис и вторичные повреждения при травме или тяжелых ожогах.

Проблема, лежащая в основе настоящего изобретения, решается в третьем аспекте, который также является первым вариантом осуществления третьего аспекта, с помощью фармацевтической композиции, содержащей молекулу нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта, и необязательно дополнительный компонент, где дополнительный компонент выбран из группы, включающей фармацевтически приемлемый эксципиент, фармацевтически приемлемый носитель и фармацевтически активное вещество.

Во втором варианте осуществления третьего аспекта, который также является вариантом осуществления первого варианта осуществления третьего аспекта, фармацевтическая композиция содержит молекулу нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта, и фармацевтически приемлемый носитель.

Проблема, лежащая в основе настоящего изобретения, решается в четвертом аспекте, который также является первым вариантом осуществления четвертого аспекта, путем использования молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта для изготовления лекарственного средства.

Во втором варианте осуществления четвертого аспекта, который также является вариантом осуществления первого варианта осуществления четвертого аспекта, лекарственное средство предназначено для применения в медицине человека или для применения в ветеринарной медицине.

В третьем варианте осуществления четвертого аспекта, который также является вариантом осуществления первого и второго варианта осуществления четвертого аспекта, лекарственное средство предназначено для лечения и/или предотвращения аутоиммунного заболевания, воспалительного заболевания, синдрома системного воспалительного ответа, заболевания глаза, повреждений при ишемии/реперфузии, замедленной функции трансплантата, отторжения трансплантата, сердечно-сосудистого заболевания, респираторного заболевания, острых реакций, инфекционного заболевания, неврологического заболевания, нейродегенеративного заболевания, фиброзного заболевания, гематологического заболевания, метаболического заболевания, опухолей и клинических осложнений, ассоциированных с активацией комплемента биоматериалами, предпочтительно синдром системного воспалительного ответа выбран из группы, включающий сепсис и вторичные повреждения при травме или тяжелых ожогах.

Проблема, лежащая в основе настоящего изобретения, решается в пятом аспекте, который также является первым вариантом осуществления пятого аспекта, путем использования молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта, для изготовления диагностических средств.

Проблема, лежащая в основе настоящего изобретения, решается в шестом аспекте, который также является первым вариантом осуществления шестого аспекта, с помощью комплекса, содержащего молекулу нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта и C5a, где предпочтительно комплекс представляет собой кристаллический комплекс.

Проблема, лежащая в основе настоящего изобретения, решается в седьмом аспекте, который также является первым вариантом осуществления седьмого аспекта, путем использования молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта, для обнаружения C5a.

Проблема, лежащая в основе настоящего изобретения, решается в восьмом аспекте, который также является первым вариантом осуществления восьмого аспекта, с помощью способа скрининга антагониста активности, опосредуемой C5a, включающего следующие стадии:

- предоставление кандидата в антагонисты активности, опосредуемой C5a,

- предоставление молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта,

- предоставление тест-системы, которая обеспечивает сигнал в присутствии антагониста активности, опосредуемой C5a, и

- определение того, является ли кандидат в антагонисты активности, опосредуемой C5a, антагонистом активности, опосредуемой C5a.

Проблема, лежащая в основе настоящего изобретения, решается в девятом аспекте, который также является первым вариантом осуществления девятого аспекта, с помощью набора для обнаружения C5a, где набор содержит молекулу нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта и по меньшей мере листок с инструкцией или реакционную емкость.

Проблема, лежащая в основе настоящего изобретения, решается в десятом аспекте, который также является первым вариантом осуществления десятого аспекта, с помощью способа обнаружения нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта в образце, где способ включает стадии:

a) предоставление улавливающего зонда, где улавливающий зонд по меньшей мере частично комплементарен первой части молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта, и зонда для обнаружения, где зонд для обнаружения по меньшей мере частично комплементарен второй части молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта, или, альтернативно, улавливающий зонд по меньшей мере частично комплементарен второй части молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта, и зонд для обнаружения по меньшей мере частично комплементарен первой части молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта;

b) добавление улавливающего зонда и зонда для обнаружения отдельно или в комбинации с образцом, содержащим молекулу нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта, или предположительно содержащим молекулу нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта;

c) обеспечение возможности улавливающему зонду и зонду для обнаружения реагировать либо одновременно, либо в любом порядке последовательно с молекулой нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта или ее частью;

d) необязательно обнаружение того, гибридизуется ли улавливающий зонд с молекулой нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта, предоставленный на стадии a); и

e) обнаружение комплекса, образовавшегося на стадии c), состоящего из молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта и улавливающего зонда и зонда для обнаружения.

Во втором варианте осуществления десятого аспекта, который также является вариантом осуществления первого варианта осуществления десятого аспекта, зонд для обнаружения включает средство для обнаружения, и/или улавливающий зонд иммобилизован на подложке, предпочтительно твердой подложке.

В третьем варианте осуществления десятого аспекта, который также является вариантом осуществления первого и второго вариантов осуществления десятого аспекта, любой зонд для обнаружения, который не является частью комплекса, образовавшегося на стадии c), удаляют из реакционной смеси, так чтобы на стадии e) обнаруживался только зонд для обнаружения, который является частью комплекса.

В четвертом варианте осуществления десятого аспекта, который также является вариантом осуществления первого, второго и третьего вариантов осуществления десятого аспекта, стадия e) включает стадию сравнения сигнала, сгенерированного средством для обнаружения, когда улавливающий зонд и зонд для обнаружения гибридизуются в присутствии молекулы нуклеиновой кислоты в соответствии с первым, вторым, третьим, четвертым, пятым, шестым, седьмым, восьмым, девятым, десятым, одиннадцатым, двенадцатым, 13-м, 14-м, 15-м, 16-м, 17-м, 18-м, 19-м, 20-м, 21-м, 22-м, 23-м, 24-м, 25-м, 26-м, 27-м, 28-м, 29-м, 30-м, 31-м, 32-м, 33-м, 34-м, 35-м, 36-м, 37-м и 38-м вариантами осуществления первого аспекта и в соответствии с первым вариантом осуществления второго аспекта или ее части, и в ее отсутствие.

Без связи с какой-либо теорией, авторы настоящего изобретения неожиданно открыли, что молекула нуклеиновой кислоты в соответствии с настоящим изобретением связывается специфично и с высокой аффинностью как с C5a человека, так и с C5a человека, тем самым ингибируя связывание C5a с рецептором C5a, хотя гомология последовательностей C5a мыши и C5a человека составляет только 64% в гомологичной области и C5a мыши имеет 3 дополнительных N-концевых аминокислоты. Более того, в противоположность C5a человека, C5a мыши не является гликозилированным. Аспарагин 64, участок гликозилирования в C5a человека, заменен вследствие мутации на глутамат у мыши. В частности, показанная аффинность нескольких индивидуальных связывающих C5a нуклеиновых кислот в пикомолярном диапазоне не могла быть предугадана.

Более того, авторы настоящего изобретения неожиданно открыли, что молекула нуклеиновой кислоты в соответствии с настоящим изобретением является пригодной для блокирования взаимодействия C5a с рецептором C5a. Таким образом, молекулу нуклеиновой кислоты в соответствии с настоящим изобретением также можно рассматривать как антагониста рецептора C5a и, соответственно, как антагониста эффектов C5a, в частности, эффектов C5a на его рецептор. Антагонист C5a представляет собой молекулу, которая связывается с C5a - такую как молекулы нуклеиновой кислоты в соответствии с настоящим изобретением - и ингибирует функцию C5a, предпочтительно в анализе in vitro или в модели in vivo, как описано в примерах.

В рамках настоящего изобретения нуклеиновая кислота в соответствии с настоящим изобретением представляет собой молекулу нуклеиновой кислоты. Таким образом, термины "нуклеиновая кислота" и "молекула нуклеиновой кислоты" используют в настоящем описании в качестве синонимов, если не указано иное. Более того, такую нуклеиновую кислоту(ы) предпочтительно также в настоящем описании называют молекулой(ами) нуклеиновой кислоты в соответствии с настоящим изобретением, нуклеиновой кислотой(ами) в соответствии с настоящим изобретением, нуклеиновой кислотой(ами) по изобретению или молекулой(ами) нуклеиновой кислоты по изобретению.

Признаки нуклеиновых кислот в соответствии с настоящим изобретением, как описано в настоящем описании, могут быть реализованы в любом аспекте настоящего изобретения, где используется нуклеиновая кислота, либо отдельно, либо в любой комбинации.

Что касается различных заболеваний, состояний и нарушений, которые можно лечить или предотвращать с использованием молекулы нуклеиновой кислоты в соответствии с настоящим изобретением и композиций, предпочтительно фармацевтических композиций, содержащих ее, следует признать, что такие заболевания, состояния и нарушения представляют собой заболевания, состояния и нарушения, описанные в настоящем описании, в том числе и в частности, заболевания, состояния и нарушения, описанные и указанные в вводной части настоящей заявки. Таким образом, соответствующие фрагменты описания и вводной части описания образуют целую часть настоящего описания, описывающего пригодность молекулы нуклеиновой кислоты по настоящему изобретению для предотвращения и лечения, соответственно, указанных заболеваний, состояний и нарушений. Кроме того, молекула нуклеиновой кислоты в соответствии с настоящим изобретением является предпочтительной, если физиологический эффект системы C5a-рецептор C5a связан с более высокими уровнями C5a в плазме.

Как используют в рамках изобретения, термин C5a относится к любому C5a, включая, но не ограничиваясь ими, C5a млекопитающих. Предпочтительно, C5a млекопитающих выбран из группы, включающей C5a человека, крысы, мыши, обезьяны (см. выравнивание C5a для видов на фиг. 11). Более предпочтительно, C5a представляет собой C5a человека. C5a человека представляет собой основный белок, имеющий аминокислотную последовательность в соответствии с SEQ ID No: 50. C5a мыши представляет собой основный белок, имеющий аминокислотную последовательность в соответствии с SEQ ID No: 52.

Как более подробно описано в формуле изобретения и в примере 1, авторы настоящего изобретения смогли неожиданно идентифицировать ряд различных связывающих молекул нуклеиновых кислот, способных связывать C5a как человека, так и мыши.

Как более подробно описано в настоящем описании, авторы настоящего изобретения идентифицировали ряд различных связывающих C5a молекул нуклеиновых кислот, способных связывать C5a как человека, так и мыши, при этом молекулы нуклеиновой кислоты могут быть охарактеризованы по участкам нуклеотидов, которые также обозначают в настоящем описании, как указано (см. пример 1). Как экспериментально показано в примерах 8 и 9, авторы изобретения смогли неожиданно продемонстрировать в нескольких системах, что молекула нуклеиновой кислоты в соответствии с настоящим изобретением является пригодной для лечения сепсиса.

Каждая из различных типов связывающих C5a молекул нуклеиновых кислот по изобретению, которые связываются с C5a, содержит три различных участка нуклеотидов: первый концевой участок нуклеотидов, центральный участок нуклеотидов и второй концевой участок нуклеотидов. Как правило, связывающие C5a молекулы нуклеиновой кислоты по настоящему изобретению содержат на их 5'-конце и 3'-конце каждый из концевых участков нуклеотидов, т.е. первый концевой участок нуклеотидов или второй концевой участок нуклеотидов (также обозначаемые как 5'-концевой участок нуклеотидов и 3'-концевой участок нуклеотидов). Первый концевой участок нуклеотидов и второй концевой участок нуклеотидов могут, по принципу комплементарности оснований, гибридизоваться друг с другом, причем при гибридизации образуется двухцепочечная структура. Однако такая гибридизация не обязательно осуществляется в физиологических и/или нефизиологических условиях. Три участка нуклеотидов связывающих C5a молекул нуклеиновых кислот - первый концевой участок нуклеотидов, центральный участок нуклеотидов и второй концевой участок нуклеотидов - расположены друг относительно друга в направлении 5'→3': первый концевой участок нуклеотидов - центральный участок нуклеотидов - второй концевой участок нуклеотидов. Альтернативно, второй концевой участок нуклеотидов, центральный участок нуклеотидов и первый концевой участок нуклеотидов расположены друг относительно друга в направлении 5'→3'.

Длина центрального участка нуклеотидов нуклеиновых кислот в соответствии с настоящим изобретением предпочтительно составляет 34.

Длина первого концевого участка нуклеотидов нуклеиновых кислот в соответствии с настоящим изобретением составляет от одного до пяти нуклеотидов, предпочтительно от трех до пяти нуклеотидов, более предпочтительно три нуклеотида.

Длина второго концевого участка нуклеотидов нуклеиновой кислоты в соответствии с настоящим изобретением составляет от одного до пяти нуклеотидов, предпочтительно от трех до пяти нуклеотидов, более предпочтительно три нуклеотида.

Термины "участок" и "участок нуклеотидов" используют в настоящем описании в качестве синонимов, если не указано иное.

Различия последовательностей определенных участков между различными связывающими C5a молекулами нуклеиновых кислот могут влиять на аффинность связывания с C5a. На основе анализов связывания различных связывающих C5a молекул нуклеиновых кислот по настоящему изобретению центральный участок и нуклеотиды, образующие его, по отдельности и более предпочтительно в целом, необходимы для связывания связывающей C5a молекулы нуклеиновой кислоты с C5a.

В предпочтительном варианте осуществления молекула нуклеиновой кислоты в соответствии с настоящим изобретением представляет собой единичную молекулу нуклеиновой кислоты. В следующем варианте осуществления единичная молекула нуклеиновой кислоты присутствует в качестве множества единичных молекул нуклеиновой кислоты или в качестве множества типов единичных молекул нуклеиновых кислот.

Специалисту в данной области будет понятно, что молекула нуклеиновой кислоты в соответствии с изобретением предпочтительно состоит из нуклеотидов, которые ковалентно связаны друг с другом, предпочтительно через фосфодиэфирные связи или соединения.

В рамках настоящего изобретения молекула нуклеиновой кислоты в соответствии с настоящим изобретением содержит два или более участка или их часть(ей), которые могут, в принципе, гибридизоваться друг с другом. При такой гибридизации образуется двухцепочечная структура. Специалисту в данной области будет понятно, что такая гибридизация может происходить или может не происходить, в частности, в условиях in vitro и/или in vivo. Также, в случае гибридизации, не обязательно, чтобы такая гибридизация происходила на протяжении всей длины двух участков, где, по меньшей мере на основании правил спаривания оснований, такая гибридизация и, таким образом, образование двухцепочечной структуры могут, в принципе, произойти. Как предпочтительно используют в настоящем описании, двухцепочечная структура является частью молекулы или структуры нуклеиновой кислоты, образуемой двумя или более отдельными цепями или двумя пространственно разделенными участками одной цепи молекулы нуклеиновой кислоты, где существует по меньшей мере одна, предпочтительно две или более пар оснований, которые образуют пары оснований, предпочтительно согласно правилам спаривания оснований по принципу Уотсона-Крика. Также специалисту в данной области будет понятно, что другой тип спаривания оснований, такой как спаривание оснований по принципу Хугстена, может существовать в двухцепочечной структуре или формировать ее. Также будет понятно, что тот признак, что два участка гибридизуются, предпочтительно указывает на то, что такая гибридизация предположительно происходит вследствие комплементарности оснований двух участков, независимо от того, происходит ли такая гибридизация в действительности in vivo и/или in vitro. Применительно к настоящему изобретению такие участки представляют собой первый концевой участок нуклеотидов и второй участок нуклеотидов, которые в одном варианте осуществления могут гибридизоваться, как определено выше.

В предпочтительном варианте осуществления расположение терминов, как используют в настоящем описании, означает порядок или последовательность структурных или функциональных признаков или элементов, описанных в настоящем описании, применительно к молекуле(ам) нуклеиновой кислоты, описанной в настоящем описании.

Специалисту в данной области будет понятно, что нуклеиновые кислоты в соответствии с настоящим изобретением способны связываться как с C5a, так и с C5. Эта характеристика связывания является результатом того факта, что для идентификации нуклеиновых кислот использовали часть C5a, которая присутствует как в C5a, так и в C5. Таким образом, нуклеиновые кислоты в соответствии с настоящим изобретением пригодны для обнаружения либо C5a, либо C5, или обоих из них. Также специалисту в данной области будет понятно, что молекула нуклеиновой кислоты в соответствии с настоящим изобретением является антагонистом как C5, так и C5a. Вследствие этого, нуклеиновые кислоты в соответствии с настоящим изобретением пригодны для лечения или предотвращения, соответственно, любого заболевания, которое ассоциировано или вызывается либо C5a, либо C5, или обоими из них. Научное обоснование может быть взято из документов уровня техники, где установлено, что C5a и C5, соответственно, вовлечены в различные заболевания и состояния или ассоциированы с ними, соответственно, и они включены в настоящее описание в качестве ссылок.

Показано, что связывающая C5a молекула нуклеиновой кислоты по настоящему изобретению, описанная в настоящем описании, распознает C5a в контексте C5 (см. пример 1). Таким образом, было проведено исследование того, ингибируется ли расщепление C5 до анафилатоксина C5a и C5b, который является частью мембраноатакующего комплекса (MAC), связывающими C5a нуклеиновыми кислотами. MAC является конечным продуктом каскада комплемента - поры, состоящей из C5b-9. Полагают, что MAC встраивается в цитоплазматические мембраны патогенов и уничтожают их путем индукции утечки цитоплазмы. Анализ расщепления C5 был осуществлен с использованием теста комлемент-зависимого гемолиза эритроцитов овцы. Связывающая C5a молекула по изобретению не ингибировала гемолиз (см. пример 6). Связывающая C5a молекула нуклеиновой кислоты по изобретению не препятствует расщеплению C5 и образованию MAC, и, таким образом, она является селективным антагонистом только C5a. При использовании в качестве лекарственного средства это может быть преимущественным при многих заболеваниях, поскольку образование MAC, который является полезным при защите от патогенов, не нарушается в их присутствии.

Молекула нуклеиновой кислоты в соответствии с настоящим изобретением также включает нуклеиновые кислоты, которые по существу гомологичны конкретным последовательностям, описанным в настоящем описании. Термин "по существу гомологичный" следует понимать так, что гомология составляет по меньшей мере 75%, предпочтительно 85%, более предпочтительно 90% и наиболее предпочтительно более 95%, 96%, 97%, 98% или 99%.

Истинный процент гомологичных нуклеотидов, присутствующих в нуклеиновой кислоте по настоящему изобретению, зависит от общего количества нуклеотидов, присутствующих в нуклеиновой кислоте. Процентная модификация может быть основана на общем количестве нуклеотидов, присутствующих в нуклеиновой кислоте.

Гомологию между двумя молекулами нуклеиновой кислоты можно определять, как известно специалисту в данной области. Более конкретно, для вычисления процентной гомологии последовательностей для исследуемой последовательности(ей) относительно эталонной последовательности можно использовать алгоритм сравнения последовательностей, на основе заданных параметров программы. Исследуемая последовательность предпочтительно представляет собой последовательность или молекулу нуклеиновой кислоты, которую называют гомологичной или которая подлежит исследованию в отношении гомологии, и в случае ее наличия, то в какой степени, с другой молекулой нуклеиновой кислоты, причем такую другую молекулу нуклеиновой кислоты также называют эталонной последовательностью. В одном варианте осуществления эталонная последовательность представляет собой молекулу нуклеиновой кислоты, как описано в настоящем описании, предпочтительно молекулу нуклеиновой кислоты, имеющую последовательность согласно любой из SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 90, SEQ ID NO: 14, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 37, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 91 и SEQ ID NO: 92. Оптимальное выравнивание последовательностей для сравнения можно проводить, например, с помощью алгоритма локальной гомологии Smith & Waterman (Smith & Waterman, 1981) с помощью алгоритма выравнивания по гомологии Needleman & Wunsch (Needleman & Wunsch, 1970) способом поиска сходства Pearson & Lipman (Pearson & Lipman, 1988), с помощью компьютерных воплощений этих алгоритмов (GAP, BESTFIT, FASTA и TFASTA в Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), или с помощью визуального исследования.

Одним примером алгоритма, пригодного для определения процентной идентичности последовательностей, является алгоритм, используемый в базовом инструментарии поиска локальных блоков (далее в настоящем описании "BLAST"), см., например, Altschul et al. (Altschul et al., 1990 и Altschul et al., 1997). Программное обеспечение для проведения анализа BLAST является общедоступным через National Center for Biotechnology Information (далее в настоящем описании "NCBI"). Параметры по умолчанию, используемые в определении идентичности последовательностей с использованием программного обеспечения, доступного от NCBI, например, BLASTN (для нуклеотидных последовательностей) и BLASTP (для аминокислотных последовательностей) описаны в McGinnis et al. (McGinnis et al., 2004).

Нуклеиновые кислоты в соответствии с настоящим изобретением также включают нуклеиновые кислоты, которые обладают определенной степенью идентичности относительно нуклеиновых кислот, описанных в настоящем описании и определяемых их нуклеотидной последовательностью. Более предпочтительно, настоящее изобретение также включает молекулы нуклеиновой кислоты, которые обладают идентичностью по меньшей мере 75%, предпочтительно 85%, более предпочтительно 90% и наиболее предпочтительно более 95%, 96%, 97%, 98% или 99% относительно нуклеиновых кислот, описанных в настоящем описании и определяемых их нуклеотидной последовательностью, или их части.

Термины "нуклеиновая кислота по изобретению" или "нуклеиновая кислота в соответствии с настоящим изобретением" также включает нуклеиновые кислоты, содержащие последовательности нуклеиновых кислот, описанные в настоящем описании, или их части, предпочтительно в том смысле, что нуклеиновые кислоты или указанные части вовлечены в связывание с C5a человека. В одном варианте осуществления такая нуклеиновая кислота представляет собой одну из молекул нуклеиновой кислоты, описанных в настоящем описании, или их производное и/или метаболит, причем такое производное и/или метаболит предпочтительно представляют собой укороченную нуклеиновую кислоту по сравнению с молекулами нуклеиновой кислоты, описанными в настоящем описании. Укорочение может относиться к любому или к обоим концам нуклеиновых кислот, описанных в настоящем описании. Также укорочение может относиться к внутренней последовательности нуклеотидов нуклеиновой кислоты, т.е. оно может относиться к нуклеотиду(ам) между 5'- и 3'-концевым нуклеотидом, соответственно. Более того, укорочение включает делецию только одного нуклеотида из последовательности нуклеиновых кислот, описанных в настоящем описании. Укорочение также может относиться к одному участку нуклеиновой кислоты (кислот) по изобретению, причем участок может иметь длину только один нуклеотид. Связывание нуклеиновой кислоты в соответствии с настоящим изобретением могут определять специалисты в данной области с использованием стандартных экспериментов или с использованием заимствованного способа, как описано в настоящем описании, предпочтительно, как описано в настоящем описании в разделе "Примеры".

Молекула нуклеиновой кислоты в соответствии с настоящим изобретением может представлять собой либо молекулу D-нуклеиновой кислоты, либо молекулу L-нуклеиновой кислоты. Предпочтительно, молекула нуклеиновой кислоты в соответствии с настоящим изобретением представляет собой молекулу L-нуклеиновой кислоты. Более предпочтительно, молекула нуклеиновой кислоты по настоящему изобретению представляет собой шпигельмер.

В одном варианте осуществления в рамках настоящего изобретения, каждая и любая из молекул нуклеиновых кислот, описанных в настоящем описании в полном объеме с точки зрения их последовательности(ей) нуклеиновой кислоты, ограничивается конкретной указанной нуклеотидной последовательностью(ями). Иными словами, термины "включающий" или "включает(ют)" следует интерпретировать в таком варианте осуществления, как означающий "содержащий" или "состоящий из".

Также в рамках настоящего изобретения нуклеиновые кислоты в соответствии с настоящим изобретением являются частью более длинной нуклеиновой кислоты, причем эта более длинная нуклеиновая кислота содержит несколько частей, при этом по меньшей мере одна такая часть представляет собой нуклеиновую кислоту в соответствии с настоящим изобретением или ее часть. Другая часть(и) этих более длинных нуклеиновых кислот может представлять собой либо одну или несколько D-нуклеиновых кислот, либо одну или несколько L-нуклеиновых кислот. Применительно к настоящему изобретению можно использовать любую комбинацию. Эта другая часть(и) более длинной нуклеиновой кислоты, либо отдельно или взятые вместе, либо в целом, либо в конкретной комбинации, могут проявлять функцию, которая отличается от связывания, предпочтительно от связывания с C5a. Одной из возможных функций является обеспечение взаимодействия с другими молекулами, где такие другие молекулы предпочтительно отличаются от C5a, например, для иммобилизации, перекрестного связывания, обнаружения или амплификации. В следующем варианте осуществления настоящего изобретения нуклеиновые кислоты по изобретению содержат, в качестве индивидуальных или объединенных частей, несколько нуклеиновых кислот по настоящему изобретению. Такая нуклеиновая кислота, содержащая несколько нуклеиновых кислот по настоящему изобретению, также охватывается термином "более длинная нуклеиновая кислота".

L-нуклеиновая кислота, как используют в рамках изобретения, представляет собой нуклеиновую кислоту или молекулу нуклеиновой кислоты, состоящую из L-нуклеотидов, предпочтительно полностью состоящую из L-нуклеотидов.

D-нуклеиновая кислота, как используют в рамках изобретения, представляет собой нуклеиновую кислоту или молекулу нуклеиновой кислоты, состоящую из D-нуклеотидов, предпочтительно полностью состоящую из D-нуклеотидов.

Термины "нуклеиновая кислота" и "молекула нуклеиновой кислоты" используют в настоящем описании взаимозаменяемо, если нет иных указаний.

Также, если нет иных указаний, любая нуклеотидная последовательность указана в настоящем описании в направлении 5'→3'.

Как предпочтительно используют в настоящем описании, любое положение нуклеотида определено или указано относительно 5'-конца последовательности, участка или подучастка, содержащего такой нуклеотид. Таким образом, второй нуклеотид представляет собой второй нуклеотид, отсчитываемый с 5'-конца последовательности, участка и подучастка, соответственно. Также в соответствии с этим, предпоследний нуклеотид представляет собой второй нуклеотид, отсчитываемый с 3'-конца последовательности, участка и подучастка, соответственно.

Независимо от того, состоит ли нуклеиновая кислота по изобретению из D-нуклеотидов, L-нуклеотидов или их комбинации, причем комбинация является, например, случайной комбинацией или определенной последовательностью участков, состоящей из по меньшей мере одного L-нуклеотида и по меньшей мере одной D-нуклеиновой кислоты, нуклеиновая кислота может состоять из дезоксирибонуклеотида(ов), рибонуклеотида(ов) или их комбинаций.

Также в рамках настоящего изобретения молекула нуклеиновой кислоты состоит как из рибонуклеотидов, так и 2'-дезоксирибонуклеотидов. 2'-Дезоксирибонуклеотиды и рибонуклеотиды представлены на фиг. 22 и 23. Для различения рибонуклеотидов и 2'-дезоксирибонуклеотидов в последовательностях молекул нуклеиновых кислот в соответствии с настоящим изобретением в настоящем описании используют следующий условный код.

Молекула нуклеиновой кислоты в соответствии с настоящим изобретением состоит из 2'-дезоксирибонуклеотидов, где

dG представляет собой 2'-дезоксигуанозин-5'-монофосфат,

dC представляет собой 2'-дезоксицитидин-5'-монофосфат,

dA представляет собой 2'-дезоксиаденозин-5'-монофосфат,

dU представляет собой 2'-дезоксиуридин-5'-монофосфат.

Молекула нуклеиновой кислоты в соответствии с настоящим изобретением состоит из рибонуклеотидов, где

G представляет собой гуанозин-5'-монофосфат,

C представляет собой цитидин 5'-монофосфат,

A представляет собой аденозин-5'-монофосфат,

U представляет собой уридин-5'-монофосфат.

Для определения мотивов рибонуклеотидной последовательности используют сокращенные обозначения IUPAC для неопределенных нуклеотидов:

S сильный G или C;
W слабый A или U;
R пурин G или A;
Y пиримидин C или U;
K кето G или U;
M имино A или C;
B не A C или U или G;

D не C A или G или U;
H не G A или C или U;
V не U A или C или G;
N все A или G или C или U.

Конструирование молекулы нуклеиновой кислоты по изобретению в качестве молекулы L-нуклеиновой кислоты является преимущественным по нескольким причинам. Молекулы L-нуклеиновых кислот представляют собой энантиомеры встречающихся в природе нуклеиновых кислот. Однако молекулы D-нуклеиновых кислот не являются высокостабильными в водных растворах и, в частности, в биологических системах или биологических образцах вследствие обширного присутствия нуклеаз. Встречающиеся в природе нуклеазы, в частности, нуклеазы из клеток животных, не способны деградировать L-нуклеиновые кислоты. Вследствие этого, биологическое время полужизни молекулы L-нуклеиновой кислоты в такой системе, включая организм животного и человека, значительно увеличивается. Вследствие отсутствия способности к деградации L-нуклеиновой кислоты, не образуются продукты деградации нуклеазой и, таким образом, не наблюдается побочных эффектов, связанных с ними, в такой системе, включая организм животного и человека. Этот аспект отличает молекулу L-нуклеиновой кислоты фактически от всех других соединений, которые используют для лечения заболеваний и/или нарушений, вовлекающих присутствие C5. Молекула L-нуклеиновой кислоты, которая специфично связывается с молекулой-мишенью посредством механизма, отличного от спаривания оснований по принципу Уотсона-Крика, или аптамер, который состоит частично или полностью из L-нуклеотидов, в частности, где эти части аптамера вовлечены в связывание аптамера с молекулой-мишенью, также называют шпигельмером. Аптамеры и шпигельмеры по существу известны специалисту в данной области и, среди прочего, описаны в "The Aptamer Handbook" (eds. Klussmann, 2006).

Также в рамках настоящего изобретения молекула нуклеиновой кислоты по изобретению, независимо от того, присутствует ли она в качестве D-нуклеиновой кислоты, L-нуклеиновой кислоты или D,L-нуклеиновой кислоты, или от того, являются ли они ДНК или РНК, может присутствовать в качестве одноцепочечной или двухцепочечной молекулы нуклеиновой кислоты. Как правило, молекула нуклеиновой кислоты представляет собой одноцепочечную молекулу нуклеиновой кислоты, которая проявляет определенную вторичную структуру благодаря первичной последовательности, и, таким образом, также может образовывать третичную структуру. Однако молекула нуклеиновой кислоты также может быть двухцепочечной в том смысле, что две их цепи, которые комплементарны или частично комплементарны друг другу, являются гибридизованными друг с другом.

Молекула нуклеиновой кислоты по изобретению может быть модифицированной. Такая модификация может относиться к одному нуклеотиду молекулы нуклеиновой кислоты, и она хорошо известна в данной области. Примеры такой модификации описаны, среди прочих, в Venkatesan et al. (Venkatesan et al., 2003) и Kusser (Kusser 2000). Такая модификация может представлять собой атом H, атом F или группу O-CH3 или группу NH2 во 2'-положении одного, нескольких или всех нуклеотидов, из которых состоит молекула нуклеиновой кислоты. Также нуклеиновая кислота в соответствии с настоящим изобретением может содержать по меньшей мере один нуклеотид LNA. В одном варианте осуществления нуклеиновая кислота в соответствии с настоящим изобретением состоит из нуклеотидов LNA.

В одном варианте осуществления молекула нуклеиновой кислоты в соответствии с настоящим изобретением может представлять собой молекулу нуклеиновой кислоты из нескольких частей. Молекула нуклеиновой кислоты из нескольких частей, как используют в настоящем описании, представляет собой молекулу нуклеиновой кислоты, которая состоит по меньшей мере из двух отдельных цепей нуклеиновых кислот. Эти по меньшей мере две цепи нуклеиновых кислот образуют функциональную единицу, где функциональная единица является лигандом для молекулы-мишени и, предпочтительно антагонистом молекулы-мишени, в настоящем случае C5a. По меньшей мере две цепи нуклеиновых кислот могут происходить из любой из молекул нуклеиновых кислот по изобретению, либо путем расщепления молекулы нуклеиновой кислоты с получением по меньшей мере двух цепей, либо путем синтеза одной молекулы нуклеиновой кислоты, соответствующей первой части полноразмерной молекулы нуклеиновой кислоты по изобретению, и другой молекулы нуклеиновой кислоты, соответствующей другой части полноразмерной молекулы нуклеиновой кислоты по изобретению. В зависимости от количества частей, образующих полноразмерные молекулы нуклеиновой кислоты, синтезируется соответствующее количество частей, имеющих требуемую нуклеотидную последовательность. Также будет понятно, что для получения нуклеиновой кислоты из нескольких частей, где имеется более двух цепей, как объяснено выше, можно использовать как подход расщепления, так и подход синтеза. Иными словами, по меньшей мере две отдельные цепи нуклеиновой кислоты, как правило, отличаются от двух цепей, являющихся комплементарными и гибридизующимися друг с другом, хотя может существовать определенная степень комплементарности между указанными по меньшей мере двумя различными цепями нуклеиновой кислоты и при этом такая комплементарность может приводить к гибридизации указанных отдельных цепей.

Наконец, также в рамках настоящего изобретения является осуществимой полностью замкнутая, т.е. кольцевая структура молекулы нуклеиновой кислоты в соответствии с настоящим изобретением, т.е. молекула нуклеиновой кислоты в соответствии с настоящим изобретением является замкнутой, предпочтительно посредством ковалентной связи, где более предпочтительно такая ковалентная связь находится между 5'-концом и 3'-концом последовательности нуклеиновой кислоты молекулы нуклеиновой кислоты по изобретению, как описано в настоящем описании, или любого ее производного.

Определение констант связывания молекул нуклеиновых кислот в соответствии с настоящим изобретением возможно с использованием способов, описанных в примерах 3 и 4, в которых подтверждается описанное выше открытие, что нуклеиновые кислоты в соответствии с настоящим изобретением проявляют подходящий диапазон значений KD. Соответствующим показателем для выражения интенсивности связывания между индивидуальной молекулой нуклеиновой кислоты и мишенью, которой в данном случае является C5a, является так называемая величина KD, которая сама по себе, так же как и способ ее определения, известна специалисту в данной области.

Предпочтительно, величина KD, демонстрируемая нуклеиновыми кислотами в соответствии с настоящим изобретением, составляет менее 1 мкМ. Величину KD приблизительно 1 мкМ считают характерной для неспецифического связывания нуклеиновой кислоты с мишенью. Как будет понятно специалисту в данной области, величина KD группы соединений, таких как нуклеиновые кислоты в соответствии с настоящим изобретением, находится в определенном диапазоне. Упомянутая выше KD приблизительно 1 мкМ является предпочтительным верхним пределом для величины KD. Нижний предел для KD связывающих мишень нуклеиновых кислот может составлять только приблизительно 10 пикомоль или может быть более высоким. В рамках настоящего изобретения величины KD отдельных нуклеиновых кислот, связывающихся с C5a, предпочтительно находятся в этом диапазоне. Предпочтительные диапазоны можно определять путем выбора любого первого числа из этого диапазона и любого второго числа из этого диапазона. Предпочтительные верхние величины KD составляют 250 нМ и 100 нМ, предпочтительные нижние величины KD составляют 50 нМ, 10 нМ, 1 нМ, 100 пМ и 10 пМ. Более предпочтительной верхней величиной KD является 10 нМ, более предпочтительной нижней величиной KD является 100 пМ.

В дополнение к свойствам связывания молекул нуклеиновых кислот в соответствии с настоящим изобретением, молекулы нуклеиновой кислоты в соответствии с настоящим изобретением ингибируют функцию соответствующей молекулы-мишени, которая в данном случае представляет собой C5a. Ингибирования функции C5a - например, стимуляции соответствующих рецепторов, как описано ранее, - достигают путем связывания молекул нуклеиновой кислоты в соответствии с настоящим изобретением с C5a и образования комплекса молекулы нуклеиновой кислоты в соответствии с настоящим изобретением и C5a. Такой комплекс молекулы нуклеиновой кислоты и C5a не может стимулировать рецепторы, которые обычно стимулируются посредством C5a, т.е. C5a, который не находится в комплексе с молекулой нуклеиновой кислоты по изобретению. Таким образом, ингибирование функции рецептора молекулами нуклеиновой кислоты в соответствии с настоящим изобретением не зависит от соответствующего рецептора, который может стимулироваться C5a, но является результатом предотвращения стимуляции рецептора посредством C5a с помощью молекул нуклеиновой кислоты в соответствии с настоящим изобретением.

Определять константу ингибирования молекул нуклеиновой кислоты в соответствии с настоящим изобретением можно с использованием способов, как описано в примере 5, в котором подтверждаются указанные выше данные, что нуклеиновые кислоты в соответствии с настоящим изобретением проявляют подходящую константу ингибирования, которая позволяет использование указанных нуклеиновых кислот в схеме терапевтического лечения. Подходящим показателем для выражения интенсивности ингибиторного эффекта индивидуальной молекулы нуклеиновой кислоты на взаимодействие мишени, которой в данном случае является C5a, и соответствующего рецептора является так называемая полумаксимальная ингибиторная концентрация (сокращенно IC50), которая, так же как и способ ее определения, известна специалисту в данной области.

Предпочтительно, величина IC50, которую демонстрируют молекулы нуклеиновой кислоты в соответствии с настоящим изобретением, составляет менее 1 мкМ. Величину IC50, составляющую приблизительно 1 мкМ, считают характерной для неспецифического ингибирования функций мишени молекулой нуклеиновой кислоты. Как будет понятно специалисту в данной области, величина IC50 для группы соединений, таких как молекулы нуклеиновой кислоты в соответствии с настоящим изобретением, находится в определенном диапазоне. Упомянутая выше IC50, составляющая приблизительно 1 мкМ, является предпочтительным верхним пределом для величины IC50. Нижний предел IC50 у связывающих мишень молекул нуклеиновой кислоты может составлять только приблизительно 10 пикомоль или он может быть более высоким. В рамках настоящего изобретения величины IC50 индивидуальных нуклеиновых кислот, связывающихся с C5a, предпочтительно находится в этом диапазоне. Предпочтительные диапазоны можно выбирать путем выбора любого первого числа из этого диапазона и любого второго числа из этого диапазона. Предпочтительные верхние величины IC50 составляют 250 нМ и 100 нМ, предпочтительные нижние величины IC50 составляют 50 нМ, 10 нМ, 1 нМ, 100 пМ и 10 пМ. Более предпочтительная верхняя величина IC50 составляет 5 нМ, более предпочтительная нижняя величина IC50 составляет 100 пМ.

Молекулы нуклеиновой кислоты в соответствии с настоящим изобретением могут иметь любую длину при условии, что они все еще способны связываться с молекулой-мишенью. Специалисту в данной области будет понятно, что существуют предпочтительные длины нуклеиновых кислот в соответствии с настоящим изобретением. Как правило, длина составляет между 15 и 120 нуклеотидами. Специалистам в данной области будет понятно, что любое целое число между 15 и 120 является возможной длиной для нуклеиновых кислот в соответствии с настоящим изобретением. Более предпочтительными диапазонами для длины нуклеиновых кислот в соответствии с настоящим изобретением являются длины, составляющие приблизительно от 20 до 100 нуклеотидов, приблизительно от 20 до 80 нуклеотидов, приблизительно от 20 до 60 нуклеотидов, приблизительно от 38 до 44 нуклеотидов и приблизительно 40 нуклеотидов.

В рамках настоящего изобретения молекула нуклеиновой кислоты по настоящему изобретению содержит часть, которая предпочтительно представляет собой высокомолекулярную часть и/или которая предпочтительно позволяет модифицировать характеристики молекулы нуклеиновой кислоты с точки зрения, среди прочих, времени нахождения в организме животного, предпочтительно в организме человека. Особенно предпочтительным вариантом осуществления такой модификации является пегилирование и гесилирование нуклеиновых кислот в соответствии с настоящим изобретением. Как используют в настоящем описании, PEG означает поли(этиленгликоль), а HES означает гидроксиэтилкрахмал. Пегилирование, как предпочтительно используют в настоящем описании, представляет собой модификацию молекулы нуклеиновой кислоты в соответствии с настоящим изобретением, где такая модификация состоит из части PEG, которая присоединена к молекуле нуклеиновой кислоты в соответствии с настоящим изобретением. Гесилирование, как предпочтительно используют в настоящем описании, представляет собой модификацию молекулы нуклеиновой кислоты в соответствии с настоящим изобретением, причем такая модификация состоит из части HES, которая присоединена к молекуле нуклеиновой кислоты в соответствии с настоящим изобретением. Эти модификации, а также способ модификации молекулы нуклеиновой кислоты с использованием таких модификаций описаны в патентной заявке Европы EP 1306382, содержание которой включено в настоящее описание в качестве ссылки в полном объеме.

В случае, когда PEG представляет собой такую высокомолекулярную часть, молекулярная масса предпочтительно составляет от приблизительно 20000 до приблизительно 120000 Да, более предпочтительно от приблизительно 30000 до приблизительно 80000 Да и наиболее предпочтительно приблизительно 40000 Да. В случае, когда HES представляет собой такую высокомолекулярную часть, молекулярная масса предпочтительно составляет от приблизительно 50 кДа до приблизительно 1000 кДа, более предпочтительно от приблизительно 100 кДа до приблизительно 700 кДа и наиболее предпочтительно от 200 кДа до 500 кДа. HES проявляет молярное замещение от 0,1 до 1,5, более предпочтительно от 1 до 1,5, и проявляет степень замещения, выражаемую как соотношение C2/C6, приблизительно от 0,1 до 15, предпочтительно приблизительно от 3 до 10. Способ модификации посредством HES описан, например, в патентной заявке Германии DE 12004006249.8, содержание которой включено в настоящее описание в качестве ссылки в полном объеме.

Модификацию, в принципе, можно вносить в молекулу нуклеиновой кислоты по настоящему изобретению в любом ее положении. Предпочтительно такую модификацию проводят либо на 5'–концевом нуклеотиде, либо на 3'-концевом нуклеотиде и/или на любом нуклеотиде между 5'-нуклеотидом и 3'-нуклеотидом молекулы нуклеиновой кислоты.

Модификацию, и предпочтительно часть PEG и/или HES, можно присоединять к молекуле нуклеиновой кислоты по настоящему изобретению либо прямо, либо непрямо, предпочтительно непрямо через линкер. Также в рамках настоящего изобретения молекула нуклеиновой кислоты в соответствии с настоящим изобретением содержит одну или несколько модификаций, предпочтительно одну или несколько частей PEG и/или HES. В одном варианте осуществления отдельная линкерная молекула присоединяет более одной группы PEG или группы HES к молекуле нуклеиновой кислоты в соответствии с настоящим изобретением. Линкер, используемый применительно к настоящему изобретению, сам по себе может быть либо линейным, либо разветвленным. Этот тип линкеров известен специалистам в данной области и дополнительно описан в международных патентных заявках WO 2005/074993 и WO 2003/035665.

В предпочтительном варианте осуществления линкер представляет собой биодеградируемый линкер. Биодеградируемый линкер позволяет модифицировать характеристики молекулы нуклеиновой кислоты в соответствии с настоящим изобретением с точки зрения, среди прочих, времени нахождения в организме животного, предпочтительно в организме человека, благодаря отщеплению модификации от молекулы нуклеиновой кислоты в соответствии с настоящим изобретением. Использование биодеградируемого линкера может позволить лучший контроль времени нахождения молекулы нуклеиновой кислоты в соответствии с настоящим изобретением. Предпочтительно, вариантом осуществления такого биодеградируемого линкера является биодеградируемый линкер, как описано, но не ограничиваясь ими, в международных патентных заявках WO 2006/052790, WO 2008/034122, WO 2004/092191 и WO 2005/099768.

В рамках настоящего изобретения модификация или модифицирующая группа являются биодеградируемой модификацией, где биодеградируемая модификация может быть присоединена к молекуле нуклеиновой кислоты по настоящему изобретению либо прямо, либо непрямо, предпочтительно через линкер. Биодеградируемая модификация позволяет модификацию характеристик молекулы нуклеиновой кислоты в соответствии с настоящим изобретением с точки зрения, среди прочих, времени нахождения в организме животного, предпочтительно в организме человека, благодаря отщеплению модификации от молекулы нуклеиновой кислоты в соответствии с настоящим изобретением или ее деградации. Использование биодеградируемой модификации может позволить лучший контроль времени нахождения молекулы нуклеиновой кислоты в соответствии с настоящим изобретением. Предпочтительный вариант осуществления такой биодеградируемой модификации является биодеградируемым, как описано, но не ограничиваясь ими, в международных патентных заявках WO 2002/065963, WO 2003/070823, WO 2004/113394 и WO 2000/41647, предпочтительно в WO 2000/41647, стр. 18, строки 4-24.

Помимо модификаций, как описано выше, другие модификации можно использовать для модификации характеристик молекулы нуклеиновой кислоты в соответствии с настоящим изобретением, причем такие другие модификации могут быть выбраны из группы белков, липидов, таких как холестерин, и цепей Сахаров, таких как амилаза, декстран и т.д.

Без связи с какой-либо теорией, путем модификации молекулы нуклеиновой кислоты в соответствии с настоящим изобретением высокомолекулярной частью, такой как полимер и, более конкретно, один или несколько полимеров, описанных в настоящем описании, которые предпочтительно являются физиологически приемлемыми, кинетика экскреции модифицированной таким образом молекулы нуклеиновой кислоты по изобретению из организма животного или человека, которому вводят модифицированную молекулу нуклеиновой кислоты по изобретению, изменяется. Более конкретно, вследствие увеличенной молекулярной массы такой модифицированной молекулы нуклеиновой кислоты по изобретению и вследствие того, что молекула нуклеиновой кислоты по изобретению не подвергается метаболизму, в частности, когда она находится в L-форме, т.е. представляет собой молекулу L-нуклеиновой кислоты, экскреция из организма животного, предпочтительно из организма млекопитающего, и более предпочтительно из организма человека, снижается. Поскольку экскреция, как правило, осуществляется через почки, авторы настоящего изобретения полагают, что скорость гломерулярной фильтрации модифицированной таким образом нуклеиновой кислоты значительно снижается по сравнению с молекулой нуклеиновой кислоты, не имеющей этого типа высокомолекулярной модификации, что приводит к увеличению времени нахождения модифицированной молекулы нуклеиновой кислоты в организме животного. В связи с этим, особенно примечательно, что, несмотря на такую высокомолекулярную модификацию, на специфичность молекулы нуклеиновой кислоты в соответствии с настоящим изобретением не оказывается неблагоприятного влияния. Таким образом, молекула нуклеиновой кислоты в соответствии с настоящим изобретением имеет, среди прочих, неожиданную характеристику, которой обычно нельзя ожидать от фармацевтически активного соединения, состоящую в том, что для обеспечения замедленного высвобождения молекулы нуклеиновой кислоты в соответствии с настоящим изобретением не обязательно требуется фармацевтический состав, обеспечивающий замедленное высвобождение. Вместо этого молекулу нуклеиновой кислоты в соответствии с настоящим изобретением в ее модифицированной форме, содержащую высокомолекулярную часть, можно уже саму по себе использовать в качестве состава для замедленного высвобождения, поскольку она действует, вследствие этой модификации, уже так, как если бы она высвобождалась из состава с замедленным высвобождением. Таким образом, модификация(и) молекулы нуклеиновой кислоты в соответствии с настоящим изобретением, как описано в настоящем. описании, и, таким образом, модифицированная молекула нуклеиновой кислоты и любая композиция, содержащая ее, могут обеспечить особую, предпочтительно контролируемую ее фармакокинетику и биораспределение. Также эти характеристики включают время нахождения в кровотоке организма животного и человека и распределение в ткани у такого животного и человека. Такие модификации дополнительно описаны в патентной заявке WO 2003/035665.

Однако также в рамках настоящего изобретения молекула нуклеиновой кислоты в соответствии с настоящим изобретением не содержит никакой модификации и, в частности, высокомолекулярной модификации, такой как PEG или HES. Такой вариант осуществления является особенно предпочтительным, когда молекула нуклеиновой кислоты в соответствии с настоящим изобретением демонстрирует предпочтительное распределение в какой-либо орган-мишень или ткань-мишень в организме, или когда является желательным быстрое выведение молекулы нуклеиновой кислоты в соответствии с настоящим изобретением из организма после введения. Молекула нуклеиновой кислоты в соответствии с настоящим изобретением, как описано в настоящем описании, с предпочтительным профилем распределения в какой-либо орган-мишень или ткань-мишень в организме, может обеспечить установление эффективных локальных концентраций в ткани-мишени при сохранении низкой системной концентрации молекулы нуклеиновой кислоты. Это может обеспечить применение низких доз, что не только является выгодным с экономической точки зрения, но также снижает излишнее воздействие молекулы нуклеиновой кислоты на другие ткани, таким образом, снижая потенциальный риск побочных эффектов. Быстрое выведение молекулы нуклеиновой кислоты в соответствии с настоящим изобретением из организма после введения может быть желательным, среди прочих, в случае визуализации in vivo или конкретных терапевтических требований к дозированию с использованием молекулы нуклеиновой кислоты в соответствии с настоящим изобретением или лекарственных средств, содержащих ее.

Нуклеиновые кислоты по изобретению, которые также в настоящем описании называют нуклеиновыми кислотами в соответствии с настоящим изобретением, и/или антагонистами в соответствии с настоящим изобретением, можно использовать для получения или изготовления лекарственного средства. Такое лекарственное средство или фармацевтическая композиция в соответствии с настоящим изобретением содержат по меньшей мере одну из нуклеиновых кислот по изобретению, необязательно вместе с дополнительными фармацевтически активными соединениями, где сама нуклеиновая кислота по изобретению предпочтительно действует в качестве фармацевтически активного соединения. Такие лекарственные средства содержат, в предпочтительных вариантах осуществления, по меньшей мере один фармацевтически приемлемый носитель. Такой носитель может представлять собой, например, воду, буфер, PBS, раствор глюкозы, предпочтительно 5% сбалансированный солевой раствор глюкозы, крахмал, сахар, желатин или любое другое приемлемое вещество. Такие носители обычно известны специалистам в данной области. Специалисту в данной области будет понятно, что любые варианты осуществления, применение и аспекты лекарственного средства по настоящему изобретению, или варианты осуществления, применение и аспекты, связанные с ним, также применимы для фармацевтической композиции по настоящему изобретению, и наоборот.

Показания, заболевания и нарушения, для лечения и/или предотвращения которых пригодны нуклеиновые кислоты, фармацевтические композиции и лекарственные средства в соответствии с настоящим изобретением или полученные в соответствии с настоящим изобретением, являются следствием вовлечения, либо прямого, либо непрямого, С5а в соответствующий патогенный механизм.

Локальное высвобождение С5а в областях воспаления приводит к мощным провоспалительным стимулам. Таким образом, нейтрализация С5а может быть полезной при многих острых и хронических состояниях, таких как ассоциированные с иммунными комплексами заболевания в общем (Heller et al., 1999); нейродегенерация и воспаление, например, при болезни Альцгеймера (Bonifati & Kishore, 2007), где антагонист рецептора С5а комплемента РМХ205 улучшал поведенческие параметры и снижал патологические маркеры, такие как фибриллярные отложения и активированная глия (Fonseca et al., 2009). Другими воспалительными заболеваниями с вовлечением С5а являются системная красная волчанка (Jacob et al., 2010a; Jacob et al., 2010b), астма (Kohl, 2001); вторичные повреждения при травме (Yao et al., 1998); септический шок (Huber-Lang et al., 2001); сидром системного воспалительного ответа (SIRS); полиорганная недостаточность (MOF); острый респираторный дистресс-синдром (ARDS); синдром воспаленной кишки (IBD) (Woodruff et al., 2003); опосредуемое иммунными комплексами заболевание почек (Wang, 2006), например, в качестве осложнения системной красной волчанки (Manderson et al, 2004); инфекции и их последствия (например, сосудистая проницаемость или потеря костной массы, такие как вторичные для периодонтита (Breivik et al., 2011)); тяжелые ожоги (Piccolo et al., 1999); повреждение при реперфузии органов, таких как сердце, селезенка, мочевой пузырь, поджелудочная железа, желудок, легкое, печень, почка, конечности, головной мозг, скелетная мышца или кишечник (Riley et al., 2000) (Gueler et al., 2008; Khan et al., 2011; van der Pals et al., 2010; Zheng et al., 2008), которое может приводить, среди прочих, к замедлению функции трансплантата (Lewis et al., 2008) или фиброзу и/или ремоделированию органа, например, после инфаркта сердца, головного мозга или легкого, приводящего к вторичному повреждению; псориаз (Bergh et al., 1993); миокардит; рассеянный склероз (Muller-Ladner et al., 1996); пароксизмальная ночная гемоглобинурия (PNH), гемолиз, тромбоэмболия (Hillmern et al., 2007) и ревматоидный артрит (RA) (Woodruff et al., 2002), резекция почечноклеточного рака и активация остеокластов, ускоряющих разрушение кости, например, приводящее к остеоартриту или замедленному заживлению. С5а комплемента также был выявлен в увеличенных количествах в друзах при связанной со старением дегенерации желтого пятна, и было показано, что он приводит к увеличенной экспрессии VEGF и ускоряет хориоидальную неоваскуляризацию, которая может приводить к ухудшению и потере зрения (Nozaki et al., 2006).

Также показано, что активация системы комплемента повышает подверженность развитию церебральной малярии в модели на мышах. Блокада С5а или рецептора С5а с использованием сыворотки от мышей, иммунизированных этими молекулами, обеспечивала устойчивость к церебральной малярии. Таким образом, блокирование системы С5-С5а может быть полезным для предотвращения развития малярии, особенно церебральной малярии у человека (Patel et al., 2008).

Аутоиммунные воспалительные заболевания с вовлечением комплемента недавно были описаны (Chen et al., 2010). Экспертный обзор, касающийся возможной и уже используемой нацеленной на комплемент терапии, вышел в Nature Biotechnology (Ricklin & Lambris, 2007). Дополненная редакция была опубликована в Molecular Medicine в 2011 году (Ehrnthaller et al., 2011).

Безусловно, поскольку связывающие С5а нуклеиновые кислоты в соответствии с настоящим изобретением взаимодействуют или связываются с С5а человека, квалифицированный специалист в общем поймет, что связывающие С5а нуклеиновые кислоты в соответствии с настоящим изобретением можно без труда использовать для лечения, предотвращения и/или диагностики любого заболевания у человека и животных, как описано в настоящем описании. Применительно к этому, также следует признать, что молекулы нуклеиновой кислоты в соответствии с настоящим изобретением можно использовать для лечения и предотвращения любого заболевания, нарушения или состояния, описанных в настоящем описании, безотносительно механизма действия, лежащего в основе такого заболевания, нарушения и состояния.

Ниже и без связи с какой-либо теорией, предоставлено обоснование для применения молекул нуклеиновой кислоты в соответствии с настоящим изобретением применительно к различным заболеваниям, нарушениям и состояниям, что, таким образом, делает правдоподобной терапевтическую, профилактическую и диагностическую применимость молекул нуклеиновой кислоты в соответствии с настоящим изобретением. Во избежание какого-либо ненужного повторения, следует признать, что вследствие вовлечения системы С5а-рецептор С5а, как описано применительно к ним, можно осуществить нацеливание на указанную систему с помощью молекул нуклеиновой кислоты в соответствии с настоящим изобретением, так чтобы достигался заявленный терапевтический, профилактический и диагностический эффект. Более того, следует признать, что особенности заболеваний, нарушений и состояний пациентов и любая деталь режима лечения, описанного применительно к ним, могут быть объектом предпочтительных вариантов осуществления настоящей заявки.

Супрессорные клетки миелоидного происхождения (сокращенно MDS) первоначально были выявлены у пациента со злокачественной опухолью >30 лет назад, их роль в качестве факторов, нарушающих противоопухолевый иммунитет, начали признавать только в настоящее время. Являясь гетерогенной популяцией нормальных миелоидных клеток, застрявших на промежуточных стадиях дифференцировки, клетки MDS накапливаются в крови, лимфатических узлах и в областях опухолей практически у всех пациентов со злокачественной опухолью. У здоровых индивидуумов эти клетки дифференцируются в макрофаги, дендритные клетки и нейтрофилы, однако опухоли секретируют ряд факторов, которые нарушают дифференцировку иммунных клеток-предшественников (Ostrand-Rosenberg, 2008). Как показано для выделенных клеток MSD из периферической крови и селезенок здоровых мышей, клетки MDS экспрессируют рецептор С5а на их поверхности в сходной степени - с избыточной экспрессией - с экспрессией на их зрелых аналогах - гранулоцитах и моноцитах. Как и у имеющих опухоль мышей, клетки MDS экспрессируют рецептор С5а, однако уровень экспрессии является более низким на поверхности ассоциированных с опухолью клеток MSD, чем на клетках MSD, в периферической крови и селезенке. Причина состоит в том, что рецептор С5а интернализуется в ассоциированные с опухолью клетки, как показано Markiewski et al., антагонист рецептора С5а может блокировать функцию рецептора С5а на поверхности клеток MSD и приводить к нарушению роста опухоли (Markiewski et al., 2008). С5а также действует в качестве супрессора функции натуральных киллерных клеток (NK-клеток), что обеспечивает объяснение отрицательного влияния комплемента на опухолевый надзор и нарушения функции NK у пациентов с определенными иммунными заболеваниями (Li et al., 2012; Min et al., 2012).

Таким образом, заболевания и/или нарушения и/или болезненные состояния, для лечения и/или профилактики которых можно использовать лекарственное средство в соответствии с настоящим изобретением, включают, но не ограничиваются ими, ассоциированные с опухолью заболевания и/или нарушения и/или болезненные состояния.

В предпочтительном варианте осуществления опухоль или новообразование являются названиями для опухания или очага повреждения, образованного вследствие аномального роста клеток (называемого неопластическим). Опухоль может быть доброкачественной, предзлокачественной или злокачественной опухолью. Более того, опухоль может представлять собой солидную опухоль, предпочтительно карциному, саркому, аденому, фибросаркому и хондросому.

Опухоли, которые, в частности, можно лечить с помощью лекарственного средства или молекулы нуклеиновой кислоты в соответствии с настоящим изобретением, предпочтительно представляют собой опухоли, которые выбраны из группы, включающей опухоли эндокринной системы, глаза, желудочно-кишечного тракта, половой системы, гемопоэтической системы (включая смешанные и эмбриональные опухоли), молочной железы, нервной системы, дыхательной системы, скелета, кожи, мягких тканей, мочевыводящей системы.

Предпочтительно, эти опухоли выбраны из группы, включающей рак молочной железы, карциному яичника, карциному предстательной железы, остеосаркому, глиобластому, меланому, мелкоклеточную карциному легкого и карциному ободочной и прямой кишки.

В рамках настоящего изобретения лекарственное средство и фармацевтическая композиция, соответственно, содержащие нуклеиновую кислоту по настоящему изобретению, можно использовать для лечения таким образом.

В следующем варианте осуществления лекарственное средство содержит дополнительное фармацевтически активное средство для лечения опухолей. Такими дополнительными фармацевтически активными соединениями являются, среди прочих, но не ограничиваются ими, соединения, о которых известно, что они являются активными антинеопластическими веществами, такие как алкилирующие средства, антиметаболиты, антиангиогенные средства, ингибирующие митоз средства, ингибиторы топоизомеразы, ингибиторы клеточной передачи сигнала, гормоны, антитела, иммунные конъюгаты и слитые белки.

Другими фармацевтически активными соединениями являются, среди прочих, но не ограничиваются ими, соединения, известные как блеомицин, ингибиторы тимидилатсинтазы, такие как ралтитрексед и пеметрексед, ферменты, такие как L-аспарагиназа, милтефосин и анагрелид, ингибиторы протеасом, такие как бортезомиб.

Более того, лекарственное средство в соответствии с настоящим изобретением можно использовать для лечения и/или предотвращения хронического обструктивного заболевания легких.

Хроническое обструктивное заболевание легких (сокращенно COPD) представляет собой легочное заболевание, которое характеризуется постоянной блокадой потока воздуха из легких. Оно является плохо диагностируемым, угрожающим жизни заболеванием, которое препятствует нормальному дыханию и не является полностью обратимым. COPD включает несколько заболеваний легких: наиболее распространенными являются хронический бронхит и эмфизема. Многие люди с COPD имеют оба эти заболевания. Эмфизема представляет собой повреждение воздухоносных мешков на верхушках дыхательных путей, что затрудняет потребление организмом необходимого кислорода. В процессе хронического бронхита дыхательные пути становятся раздраженными, красными и производят чрезмерное количество вязкой слизи. Стенки дыхательных путей опухают и частично блокируют прохождение через них воздуха.

Нейтрофилы привлекаются по градиенту С5а, высвобождают супероксидные радикалы для уничтожения патогенов и высвобождают бета-глюкуронидазу для гидролиза комплексных глюкуронидных конъюгатов в области воспаления. Однако эти ценные механизмы защиты могут быть повреждающими для организма, если нейтрофилы привлекаются в области воспаления без патогенов, например, в области реперфузии после инфаркта, инсульта или трансплантации органа или в случаях аутоиммунного заболевания, болезни Альцгеймера и прочих, которые приведены ниже.

В свою очередь, чрезмерно высокие концентрации С5а, особенно если они повышаются не только локально, как происходит в случае сепсиса, - приводят к системной активации нейтрофилов (что приводит к повреждению органа) с последующим истощением и инактивацией путем сниженной экспрессии рецептора С5а на клеточной поверхности нейтрофилов. Это делает пациента еще более чувствительным к патогенам, которые персистируют в его организме (Huber-Lang et al., 2002).

Таким образом, связывающая С5а нуклеиновая кислота, которая также ингибирует опосредуемые С5а эффекты на его рецептор (CD88) (как показывают в анализах хемотаксиса с использованием дифференцированных клеток BAF-3), обладает потенциалом к блокированию указанных выше последствий передачи сигнала С5а и может оказаться полезной в качестве части лекарственного средства при ряде заболеваний и состояний, в которые вовлечена аберрантная передача сигнала С5а. Одним из этих состояний является полимикробный сепсис. Существует множество накопленных литературных данных о вредоносной роли передачи сигнала С5а при сепсисе (Ward, 2010b). Было обнаружено, что нуклеиновые кислоты в соответствии с настоящим изобретением увеличивают выживаемость у мышей и параметры функции органов в исследованиях по лигированию и проколу слепой кишки (CLP). CLP является общепринятой моделью на грызунах для полимикробного сепсиса. Недавно роль компонента комплемента С5 при сепсисе, индуцированном лигированием и проколом слепой кишки, исследовали у мышей дикого типа и у мышей с дефицитом С5 (Flieri et al., 2008). Мыши С5-/- не имели преимуществ выживания по сравнению с мышами WT и проявляли 400-кратное увеличение переносимых с кровью бактерий по сравнению с мышами дикого типа. Эти эффекты были связаны с неспособностью мышей С5 (-/-) собирать терминальный мембраноатакующий комплекс (MAC). Авторы сделали заключение, что при сепсисе селективная блокада С5а или его рецептора (вместо С5) оказалась более перспективной стратегией, поскольку блокада С5а все еще позволяет образование MAC, в то время как неблагоприятные эффекты С5а предотвращаются. В соответствии с этим, было показано, что генетическая делеция рецепторов С5а CD88 и C5L2, фармакологическая блокада CD88 или фармакологическая нейтрализация С5а являются защитными при индуцированном лигированием и проколом слепой кишки (CLP) сепсисе (Czermak et al., 1999; Rittirsch et al., 2008). Модель менингококкового сепсиса с трансляцией in vitro с использованием цельной крови человека подтверждает, что селективное ингибирование С5а (в противоположность блокаде расщепления С5) препятствует потенциально вредоносной активации лейкоцитов без нарушения выведения бактерий (Sprong et al., 2003). Ингибирование С5а препятствует полиорганной недостаточности при экспериментальном сепсисе путем ограничения системного воспаления, коагуляции и других патогенных механизмов (Huber-Lang et al., 2001; Huber-Lang et al., 2002; Laudes et al., 2002; Rittirsch et al., 2008; Ward, 2010a). Нуклеиновые кислоты в соответствии с настоящим изобретением, хотя и не связываются с С5, не блокируют расщепление С5 на С5а и С5b, которое требуется для образования MAC. Напротив, нуклеиновые кислоты по изобретению оккупируют белок С5, что также увеличивает терминальное время полужизни в плазме и селективно блокирует действие С5а после высвобождения, например, посредством С5-конвертазы. В модели сепсиса было показано, что нуклеиновые кислоты по настоящему изобретению ограничивают воспаление, препятствуют полиорганной недостаточности и формированию отека и повышают выживаемость.

Для пациентов с сепсисом часто требуется механическая вентиляция вследствие острого повреждения легких (ALI) и острого респираторного дистресс-синдрома (ARDS). ALI/ARDS также может развиваться из прямой инфекции легкого внебольничных или больничных инфекций при пневмонии. Существуют обширные данные о патогенетической роли С5а при ALI/ARDS. Индуцируемая С5а экспрессия тканевого фактора приводит к отложению фибрина в альвеолах легких у пациентов с ALI/ARDS (Kambas et al., 2008). Экспериментальный ALI является ослабленным у мышей С5-/-, и нейтрализация С5а или подавление C5aR в легких подавляют воспалительный ответ и препятствуют увеличению сосудистой проницаемости (Bosmann & Ward 2012).

Более того, другие заболевания и/или нарушения и/или болезненные состояния, для лечения и/или предотвращения которых можно использовать лекарственное средство в соответствии с настоящим изобретением, включают, но не ограничиваются ими, аутоиммунные заболевания, такие как ревматоидный артрит (сокращенно RA), анкилозирующий спондилит (сокращенно AS), системную красную волчанку (сокращенно SLE), рассеянный склероз (сокращенно MS), псориаз, очаговую алопецию, тепловую и холодовую аутоиммунную гемолитическую анемию (сокращенно AIHA), атипичную гемолитическую уремию, пернициозную анемию, острые воспалительные заболевания, аутоиммунный адреналит, хроническую воспалительную демиелинизирующую полиневропатию (сокращенно CIDP), синдром Черджа-Стросс, синдром Когана, синдром CREST, пемфигус обыкновенный и пемфигус листовидный, буллезный пемфигоид, ревматическую полимиалгию, полимиозит, первичный билиарный цирроз, панкреатит, перитонит, псориатический артрит, ревматическую атаку, саркоидоз, синдром Йоргенсена, склеродермию, глютеновую болезнь, синдром мышечной скованности, артериит Такаясу, временную непереносимость глютена, аутоиммунный увеит, витилиго, полихондрит, герпетиформный дерматит (сокращенно DH) или болезнь Дюринга, фибромиалгию, синдром Гудпасчера, синдром Гийена-Барре, тиреоидит Хашимото, аутоиммунный гепатит, воспалительное заболевание кишечника (сокращенно IBD), болезнь Крона, язвенный колит, миастению, иммунокомплексные нарушения, гломерулонефрит, узелковый полиартериит, антифосфолипидный синдром, полигландулярный аутоиммунный синдром, идиопатический легочный фиброз, идиопатическая тромбоцитопеническая пурпура (сокращенно ITP), крапивница, аутоиммунное бесплодие, ювенильный ревматоидный артрит, саркоидоз, аутоиммунную кардиомиопатию, синдром Ламберта-Итона, склероатрофический лишай, болезнь Лайма, болезнь Грэйвса, болезнь Бехчета, болезнь Меньера, реактивный артрит (синдром Рейтера); инфекции вирусами, такими как ВИЧ, HBV, HCV, CMV, или внутриклеточными паразитами, такими как лейшмании, риккетсии, хламидии, коксиеллы, плазмодии, бруцеллы, микобактерии, листерии, токсоплазма и трипаносома; вторичные повреждения при травме; локальное воспаление, шок, анафилактический шок, ожог, септический шок, геморрагический шок, синдром системного воспалительного ответа (сокращенно SIRS), полиорганную недостаточность (сокращенно MOF), астму и аллергию, васкулиты, такие как височный артериит, васкулит, повышение сосудистой проницаемости и атеросклероз; острые повреждения центральной нервной системы, миокардит, дерматомиозит, гингивит, острую дыхательную недостаточность, хроническое обструктивное заболевание легких, инсульт, инфаркт миокарда, повреждение при реперфузии, нейрокогнитивную дисфункцию, ожог, воспалительные заболевания глаза, такие как увеит, связанная со старением дегенерация желтого пятна (сокращенно AMD), диабетическая ретинопатия (сокращенно DR), диабетический отек желтого пятна (сокращенно DME), глазной пемфигоид, кератоконъюнктивит, синдром Стивенса-Джонсона и офтальмопатию Грэйвса; локальные проявления системных заболеваний, воспалительные заболевания сосудов, острые повреждения центральной нервной системы, диабет 1 и 2 типа, проявления диабета, SLE и ревматическое заболевание глаза, головного мозга, сосудов, сердца, легких, почек, печени, желудочно-кишечного тракта, селезенки, кожи, костей, лимфатической системы, крови или других систем органов, для предотвращения и/или поддержания и/или послеоперационного лечения при аорто-коронарном шунтировании (сокращенно CABG), аорто-коронарном шунтировании без искусственного кровообращения (сокращенно OPCABG), минимально инвазивное прямое аорто-коронарное шунтирование (сокращенно MIDCAB), чрескожную транслюминальную коронарную ангиопластику (сокращенно РТСА), тромболиз, трансплантацию органов и хирургическую операцию с кровеостанавливающим зажимом; для предотвращения повреждения трансплантированного органа или органа, подлежащего трансплантации, или для применения для лечения отторжения трансплантата для таких трансплантированных органов, как печень, почка, кишечник, легкое, сердце, кожа, конечности, роговица, островки Лангерганса, костный мозг, кровеносные сосуды и поджелудочная железа; отторжение эмбриона.

Различные заболевания и нарушения, для лечения и/или предотвращения которых можно использовать нуклеиновые кислоты, могут быть подразделены следующим образом:

1. Аутоиммунные/воспалительные заболевания.

1.1. Системные аутоиммунные и/или воспалительные заболевания, включающие аллергию, септический шок, вторичные повреждения при травме, тепловую и холодовую аутоиммунную гемолитическую анемию (сокращенно AIHA), синдром системного воспалительного ответа (сокращенно SIRS), геморрагический шок, диабет 1 типа, диабет 2 типа, проявления диабета, диффузную склеродермию, периодонтит и ассоциированную с ним потерю костной массы, полихондрит, полигландулярный аутоиммунный синдром, ревматоидный артрит, системную красную волчанку (сокращенно SLE) и ее проявления, реактивный артрит (также известный как синдром Рейтера).

1.2. Аутоиммунные и/или воспалительные заболевания желудочно-кишечного тракта, включающие болезнь Крона, язвенный колит, глютеновую болезнь, временную непереносимость глютена, воспалительное заболевание кишечника (сокращенно IBD), панкреатит, желудочно-кишечную аллергическую гиперчувствительность, некротизирующий энтероколит.

1.3. Аутоиммунные и/или воспалительные заболевания кожи, включающие псориаз, крапивницу, дерматомиозит, пемфигус обыкновенный, пемфигус листовидный, буллезный пемфигоид, очаговую склеродермию/линейную склеродермию, витилиго, герпетиформный дерматит (сокращенно DH) или болезнь Дюринга, склероатрофический лишай.

1.4. Аутоиммунные и/или воспалительные заболевания сосудов, включающие васкулиты (предпочтительно, височный артериит), васкулит, болезнь Шенлейна-Геноха, ассоциированный с антинейтрофильными цитоплазматическими антителами (ANCA) васкулит, повышение сосудистой проницаемости, ревматическую полимиалгию, атеросклероз, синдром Черджа-Стросс, артериит Такаясу, синдром Гудпасчера (=заболевание с антителами против гломерулярной базальной мембраны; по большей части поражающее гломерулы почек и легкие), гломерулонефрит, узелковый полиартериит, болезнь Бехчета.

1.5. Аутоиммунные и/или воспалительные заболевания нервной системы, включая рассеянный склероз (сокращенно MS), хроническую воспалительную демиелинизирующую полиневропатию (сокращенно CIDP), нейрокогнитивную дисфункцию, синдром мышечной скованности, синдром Гийена-Барре, миастению гравис, синдром Ламберта-Итона, оптический нейромиелит (синдром Девика).

1.6. Аутоиммунные и/или воспалительные заболевания скелетных мышц, включая ревматоидный артрит, ревматическое заболевание глаза, головного мозга, легкого, почек, сердца, печени, желудочно-кишечного тракта, селезенки, кожи, костей, лимфатической системы, крови или других органов, анкилозирующий спондилит (сокращенно AS), саркоидоз, периодонтит и ассоциированную с ним потерю костной массы, ревматическую полимиалгию, полимиозит, псориатический артрит, ревматическую атаку, полихондрит, фибромиалгию, ювенильный ревматоидный артрит, болезнь Лайма, реактивный артрит (также известный как синдром Рейтера).

1.7. Другие аутоиммунные и/или воспалительные заболевания, включая синдром Когана, аутоиммунный адреналит, иммунокомплексные нарушения, болезнь Меньера, локальные воспаления, очаговую алопецию, острые воспалительные заболевания, первичный билиарный цирроз, синдром Шегрена, склеродермию, диффузную склеродермию, синдром CREST, очаговую склеродермию/линейную склеродермию, аутоиммунный увеит, тиреоидит Хашимото (аутоиммунное разрушение щитовидной железы), болезнь Грэйвса, аутоиммунный гепатит, неалкогольный стеатогепатит, гломерулонефрит, перитонит, антифосфолипидный синдром, идиопатический легочный фиброз, фиброз почек, фиброз печени, аутоиммунное бесплодие, отторжение или невынашивание эмбриона и болезнь "трансплантат против хозяина".

2. Заболевания глаза, включающие увеит, конъюнктивит, связанную со старением дегенерацию желтого пятна (сокращенно AMD), диабетическую ретинопатию (сокращенно DR), диабетический отек желтого пятна (сокращенно DME), окклюзию сосудов сетчатки, глаукому, катаракту, аутоиммунное ретинальное и внутриглазное воспалительное заболевание, глазной пемфигоид, кератоконъюнктивит, синдром Стивенса-Джонсона и офтальмопатию Грэйвса.

3. Повреждения при реперфузии и отторжение трансплантатов, включая инсульт, инфаркт миокарда, повреждения при реперфузии, посттрансплационную тромботическую микроангиопатию или повреждение трансплантированных органов, таких как печень (Arumugam et al., 2004), почка (Arumugam et al., 2003), кишечник, легкое, сердце, кожа, конечность, роговица, островки Лангерганса (Tokodai et al., 2010), костный мозг, кровеносные сосуды и поджелудочная железа, повреждение почки после трансплантации органов или костного мозга.

4. Предотвращение отторжения трансплантата, включая отторжение трансплантата органов, таких как печень, почка, кишечник, легкое, сердце, кожа, конечность, роговица, островки Лангерганса, костный мозг, кровеносные сосуды и поджелудочная железа.

5. Сердечно-сосудистые заболевания, включая атеросклероз, миокардит, инфаркт миокарда, инсульт, артериальную гипертензию легких (РАН), аневризму брюшного отдела аорты, воспалительные заболевания сосудов, васкулиты, предпочтительно височный артериит, васкулит, повышение проницаемости сосудов, проявления диабета, преэклампсию, аутоиммунную кардиомиопатию, болезнь вен хозяина, аритмогенную правожелудочковую дисплазию/кардиомиопатию, предотвращение и/или поддержание и/или послеоперационное лечение при аорто-коронарном шунтировании (сокращенно CABG).

6. Метаболическая дисфункция, включающая резистентность к инсулину, непереносимость глюкозы, жировое воспаление и сердечно-сосудистую дисфункцию при индуцированном диетой ожирении.

7. Респираторные заболевания, включающие астму, острую дыхательную недостаточность, острое повреждение легких, обусловленное переливанием крови повреждение легких, взрослый респираторный дистресс-синдром, хроническое обструктивное заболевание легких, вентиляторное повреждение легких, пневмонию и их осложнения.

8. Воспалительные заболевания, включающие воспалительное заболевание глаза, аутоиммунный увеит (Copland et al., 2010), конъюнктивит, весенний конъюнктивит, локальные проявления системных заболеваний.

9. Острые реакции, включающие вторичные повреждения при травме и переломах, шок, ожог, геморрагический шок, полиорганную недостаточность (сокращенно MOF), острые повреждения центральной нервной системы, острые повреждения центральной нервной системы, острое повреждение вследствие избыточной продукции С5а активированной системой свертывания, такой как после трансплантации органа или островков.

10. Боль, острая боль, хроническая боль, нейропатическая боль, толерантность к морфину и индуцируемая отменой гипералгезия.

11. Неврологические и нейродегенеративные нарушения, включающие нейропатии, боковой амиотрофический склероз (ALS), болезнь Альцгеймера и болезнь Паркинсона (Farkas et al., 1998).

12. Инфекционные заболевания, включающие:

12.1. бактериальные инфекции, предпочтительно менингит, болезнь Лайма, реактивный артрит (также известный как синдром Рейтера), инфекцию мочевыводящих путей и почек, сепсис и его осложнения, такие как недостаточность органов, дисфункция сердца, системная гипоперфузия, ацидоз, взрослый респираторный дистресс-синдром, инфекции внутриклеточными патогенами (Klos et al., 2009);

12.2. вирусные инфекции, предпочтительно ВИЧ, HBV, HCV, CMV, вирусный менингит;

12.3. внутриклеточные паразиты, предпочтительно лейшмании, риккетсии, хламидии, коксиеллы, плазмодии, особенно церебральная малярия, бруцеллы, микобактерии, листерии, токсоплазмы и трипаносомы.

13. Гематологические заболевания, включающие заболевания, ассоциированные с активацией свертывающей и фибринолитической систем, диссеминированное внутрисосудистое свертывание (DIC) и/или тромбоз, пернициозная анемия, тепловую и холодовую аутоиммунную гемолитическую анемию (сокращенно AIHA), антифосфолипидный синдром и обусловленные им осложнения, артериальный и венозный тромбоз, осложнения беременности, такие как привычное невынашивание и гибель плода, преэклампсия, плацентарная недостаточность, задержка внутриутробного развития, ремоделирование шейки матки и преждевременные роды, идиопатическую тромбоцитопеническую пурпуру (сокращенно ITP), атипический гемолитический уремический синдром (aHUS), пароксизмальную ночную гемоглобинурию (PNH) и аллергические трансфузионные реакции.

14. Клинические осложнения, ассоциированные с активацией биоматериалами каскадов комплемента и свертывания, возникающие при процедурах, включающих гемодиализ, аферез, повышение вязкости в суставах при артрите, искусственное кровообращение, трансплантаты протезов сосудов и использование сердечнососудистых устройств.

Нуклеиновые кислоты в соответствии с настоящим изобретением также можно использовать во время хирургической операции во избежание вредоносных эффектов иммунной системы пациента, более предпочтительно для предотвращения и/или поддержания и/или послеоперационного лечения при аорто-коронарном шунтировании (сокращенно CABG), аорто-коронарном шунтировании без искусственного кровообращения (сокращенно OPCABG), минимально инвазивном прямом аорто-коронарном шунтировании (сокращенно MIDCAB), чрезкожной транслюминальной коронарной ангиопластике (сокращенно РТСА), тромболизисе, трансплантации органа, хирургической операции головного и спинного мозга, реконструктивной хирургии и хирургической операции с сосудистым зажимом, в ходе любого лечения с искусственной вентиляцией или вспомогательной вентиляцией во избежание индуцированного аппаратом искусственного дыхания повреждения легких или вторичных повреждений, таких как повышение проницаемости сосудов и/или эмфизема, для предотвращения повреждения трансплантированного органа или органа, подлежащего трансплантации, или для применения при лечении отторжения трансплантата и повреждения при реперфузии трансплантированных органов, таких как печень, почка, кишечник, легкое, сердце, кожа, конечность, роговица, островки Лангерганса, костный мозг, кровеносные сосуды и поджелудочная железа.

В рамках настоящего изобретения лекарственное средство и фармацевтическая композиция, соответственно, содержащие нуклеиновую кислоту в соответствии с настоящим изобретением, можно использовать для лечения таким образом.

В следующем варианте осуществления лекарственное средство включает дополнительное фармацевтически активное средство. Такие дополнительные фармацевтически активные соединения представляют собой, среди прочих, но не ограничиваясь ими, соединения, о которых известно, что они подавляют иммунную систему, такие как ингибиторы кальциневрина, циклоспорин А, метотрексат, азатиоприн, такролимус, рапамицин, хлорамбуцил, лефлуномид, микофенолата мофетил, бреквинар, мизорибин, талидомид или дезоксиспергуалин. Дополнительное фармацевтически активное соединение может представлять собой, в следующем варианте осуществления, также одно из соединений, которые снижают продукцию гистамина, такие как меклозин, клемастин, диметиндин, бамипин, кетотифен, цетиризин, ловецетиризин, цеслоратадин, азеластин, мизоластин, левокабастин, терфенадин, фексофенадин или эбастин. Такие соединения также могут представлять собой, но не ограничиваться ими, стероиды и они предпочтительно выбраны из группы, включающей кортикостероиды, такие как преднизон, метилпреднизолон, гидрокортизон, дексаметазон, триамцинолон, бетаметазон шипучий или будезонид. Кроме того, такое соединение может представлять собой один или несколько антибиотиков, таких как, но не ограничиваясь ими, аминогликозиды, р-лактамные антибиотики, ингибиторы гиразы, гликопептидные антибиотики, линкозамид, макролидные антибиотики, производные нитроимидазола, полипептидные антибиотики, сульфонамиды, триметоприм и тетрациклин. Кроме того, - более специфические противовоспалительные или антиангиогенные биологические вещества можно использовать в комбинации, такие как бевацизумаб, ранибизумаб, IL-10, эрлизумаб, толермаб, ритуксимаб, гомиликсимаб, базиликсимаб, даклизумаб, НиМах-ТАС, визилизумаб, HuMaxCD4, кленоликсимаб, MAX 16H5, TNX 100, торализумаб, алемтузумаб, CY 1788, галиксимаб, пекселизумаб, экулизумаб, РМХ-53, ETI 104, FG 3019, бертилимумаб, 249417 (антитело против фактора IX), абциксимаб, YM 337, омализумаб, тализумаб, фонтолизумаб, J695 (антитело против IL12), HuMaxIL-15, меполизумаб, элсилимомаб, HuDREG, анакинра, Хота-052, адалимумаб, инфликсимаб, цертолизумаб, афелимомаб, CytoFab, AME 527, вапаликсимаб, бевацизумаб, ранибизумаб, витаксин, белимумаб, MLN 1202, волоциксимаб, F200 (антитело против α5β1), эфализумаб, m60.11 (антитело против CDllb), этанерцепт, онерцепт, рилонацепт, абатацепт, натализумаб или сиплизумаб, тоцилизумаб, устекинумаб, АВТ-874. Наконец, дополнительное фармацевтически активное средство может представлять собой модулятор активности любого другого хемокина, который может представлять собой агонист или антагонист хемокина или агонист или антагонист рецептора хемокина, при этом хемокин также может представлять собой хемотактический липид. Примером является модулятор рецептора S1P финголимод. Альтернативно или дополнительно, такое дополнительное фармацевтически активное средство представляет собой дополнительную нуклеиновую кислоту в соответствии с настоящим изобретением. Альтернативно, лекарственное средство включает по меньшей мере одну дополнительную нуклеиновую кислоту, которая связывается с молекулой-мишенью, отличающейся от С5а, или проявляет функцию, которая отличается от функции нуклеиновых кислот в соответствии с настоящим изобретением.

Как правило, антагонист С5а можно комбинировать с ингибиторами других провоспалительных молекул или их рецепторов. Примерами провоспалительных молекул, действие которых можно ослаблять в комбинации с антагонистом С5а, являются IL-1, IL-2, IL-5, IL-6, IL-8, IL-10, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18, IL-23, TNF, α4β7, α5β1, BlyS, кадгерин, CCR2, CDlla, CDllb, CD125, CD130, CD16, CD18, CD2, CD20, CD22, CD23, CD25, CD28, CD3, CD30, CD4, CD40, CD40L, CD44, CD45R, CD54, CD62E, CD62L, CD68, CD8, CD80, CD86, CD95, СЕР, гастрин-R, С1, Cl-эстераза, С5, фактор D, MBL, рецептор 1 компонентов комплемента, CRTH2-рецептор, CTGF, Е- и Р-селектин, эотаксин, фактор IX, FGF-20, Fgl-2, GM-CSF, рецептор GP IIb/IIIa, HMG1, ICAM-1, IgE, тимоциты, IFNy, IFNr, IP-10, MCP-1, рецептор M-CSF, MIF, MMP9, PDGF-D, SDF-1, TGFβ1, тканевой фактор, тирозинкиназный рецептор, VAP-1, VCAM-1, VEGF, VLA1, фактор фон Виллебранда, сфингозин-1-фосфат, церамид-1-фосфат и ингибиторы митогенов, например ингибиторы лизофосфатидной кислоты.

Наконец, дополнительное фармацевтически активное средство может представлять собой модулятор активности любого другого хемокина, который может представлять собой агонист или антагонист хемокина, или агонист или антагонист рецептора хемокина. Альтернативно или дополнительно, такое дополнительное фармацевтически активное средство представляет собой дополнительную нуклеиновую кислоту в соответствии с настоящим изобретением. Альтернативно, лекарственное средство содержит по меньшей мере одну дополнительную нуклеиновую кислоту, которая связывается с молекулой-мишенью, отличной от С5а, или проявляет функцию, которая отличается от функции нуклеиновых кислот в соответствии с настоящим изобретением.

В рамках настоящего изобретения лекарственное средство используют, альтернативно или дополнительно, в принципе, для предотвращения любого из заболеваний, описанных применительно к применению лекарственного средства для лечения указанных заболеваний. Таким образом, соответствующие маркеры, т.е. для соответствующих заболеваний, известны специалистам в данной области. Предпочтительно, соответствующим маркером является С5а.

В одном варианте осуществления лекарственного средства по настоящему изобретению, такое лекарственное средство предназначено для применения в комбинации с другими способами лечения любых из заболеваний, описанных в настоящем описании, в частности, заболеваний, для которых намереваются использовать лекарственное средство по настоящему изобретению.

"Комбинированная терапия" (или "сотерапия") включает введение лекарственного средства по изобретению и по меньшей мере одного второго средства в качестве части конкретного режима лечения, предназначенного для обеспечения благоприятного эффекта вследствие совместного действия этих лекарственных средств, т.е. лекарственного средства по настоящему изобретению и указанного второго средства. Благоприятный эффект комбинации включает, но не ограничивается ими, фармакокинетическое или фармакодинамическое совместное действие в результате комбинирования лекарственных средств. Введение этих лекарственных средств в комбинации, как правило, проводят в течение определенного периода (как правило, минут, часов, суток или недель, в зависимости от выбранной комбинации).

"Комбинированная терапия" может включать, но обычно не включает, введение двух или более из этих лекарственных средств в качестве частей отдельных схем монотерапии, которые случайным образом и произвольно приводят к комбинациям по настоящему изобретению. "Комбинированная терапия" включает введение этих лекарственных средств последовательно, т.е. где каждое лекарственное средство вводят в отдельное время, а также введение этих лекарственных средств, или по меньшей мере двух из этих лекарственных средств, по существу одновременно. По существу одновременное введение можно проводить, например, путем введения индивидууму одной капсулы, имеющей фиксированную долю каждого лекарственного средства, или нескольких отдельных капсул для каждого из лекарственных средств.

Последовательное или по существу одновременное введение каждого лекарственного средства можно осуществлять любым пригодным способом, включая, но не ограничиваясь ими, местные способы, пероральные способы, внутривенные способы, внутримышечные способы и прямое всасывание через ткани слизистых оболочек. Лекарственные средства можно вводить одним и тем же или различными способами. Например, первое из выбранных лекарственных средств комбинации можно вводить путем инъекции, а другие лекарственные средства комбинации можно вводить местным путем.

Альтернативно, например, все лекарственные средства можно вводить местно или все лекарственные средства можно вводить путем инъекции. Последовательность, в которой вводят лекарственные средства, не является строго критичной, если нет иных указаний. "Комбинированная терапия" также может включать введение лекарственных средств, как описано выше, дополнительно в комбинации с другими биологически активными ингредиентами. Когда комбинированная терапия дополнительно включает немедикаментозное лечение, немедикаментозное лечение можно проводить в любое пригодное время, при условии достижения благоприятного эффекта совместного действия комбинации лекарственных средств и немедикаментозного лечения. Например, в соответствующих случаях, благоприятный эффект все еще достигается, когда немедикаментозное лечение удалено по времени от введения лекарственных средств, возможно на сутки или даже недели.

Как указано в общих терминах, выше, лекарственное средство в соответствии с настоящим изобретением можно вводить, в принципе, в любой форме, известной специалистам в данной области. Предпочтительным путем введения является системное введение, более предпочтительно парентеральное введение, предпочтительно инъекция. Альтернативно, лекарственное средство можно вводить местно. Другие пути введения включают внутримышечный, внутрибрюшинный и подкожный, пероральный, интраназальный, интратрахеальный или легочный, причем предпочтительным является способ введения, который является наименее инвазивным, но в то же время обеспечивающим эффективность.

Парентеральное введение, как правило, используют для подкожных, внутримышечных или внутривенных инъекций и инфузий. Кроме того, в одном подходе для парентерального введения используется имплантация систем с замедленным высвобождением или непрерывным высвобождением, которые обеспечивают поддержание дозирования на постоянном уровне и которые хорошо известны специалистам в данной области.

Более того, предпочтительные лекарственные средства по настоящему изобретению можно вводить в интраназальной форме посредством местного применения пригодных интраназальных носителей, ингаляторов, или трансдермальных способов с использованием форм трансдермальных накожных пластырей, хорошо известных специалистам в данной области. Для введения в форме трансдермальной системы для доставки, введение дозы, безусловно, будет непрерывным, а не прерывающимся, на протяжении режима дозирования. Другие предпочтительные местные препараты включают кремы, мази, лосьоны, аэрозольные спреи и гели, где концентрация активного ингредиента, как правило, может находиться в диапазоне от 0,01% до 15% масс./масс. или масс./об.

Лекарственное средство по настоящему изобретению, как правило, содержит эффективное количество активного компонента(ов) терапии, включая, но не ограничиваясь ими, молекулу нуклеиновой кислоты по настоящему изобретению, растворенную или диспергированную в фармацевтически приемлемой среде. Фармацевтически приемлемые среды или носители включают любые и все растворители, диспергирующие среды, покрытия, антибактериальные и противогрибковые средства, изотонические и замедляющие всасывание средства и т.п. Применение таких сред и средств для фармацевтически активных веществ хорошо известно в данной области. Также в лекарственное средство по настоящему изобретению могут быть включены дополнительные активные ингредиенты.

В следующем аспекте настоящее изобретение относится к фармацевтической композиции. Такая фармацевтическая композиция содержит по меньшей мере одну из нуклеиновых кислот в соответствии с настоящим изобретением и предпочтительно фармацевтически приемлемый носитель. Такой носитель может представлять собой любой носитель или любое связующее вещество, используемое и/или известное в данной области. Более конкретно, такое связующее вещество или носитель представляет собой любое связующее вещество или носитель, рассмотренные применительно к изготовлению лекарственного средства, описанного в настоящем описании. В следующем варианте осуществления фармацевтическая композиция содержит дополнительное фармацевтически активное средство.

Изготовление лекарственного средства и фармацевтической композиции станет известным специалистам в данной области с учетом настоящего описания. Как правило, такие композиции можно получать в качестве инъецируемых средств, в форме либо жидких растворов, либо суспензий; твердых форм, пригодных для растворения или суспендирования в жидкости перед инъекцией; в качестве таблеток или других твердых веществ для перорального введения; в качестве капсул для замедленного высвобождения; или в любой другой форме, применяемой в настоящее время, включая глазные капли, кремы, лосьоны, бальзамы, ингалируемые средства и т.п. Также может быть особенно пригодным применение стерильных составов, таких как средства для промывания на основе солевого раствора, хирургами, терапевтами или работниками по медицинскому уходу для обработки конкретной области операционного поля. Также композиции можно доставлять с помощью микроустройства, микрочастицы или губки.

После составления лекарственное средство можно вводить способом, совместимым с дозированным составом, и в таком количестве, которое является фармакологически эффективным. Составы без труда вводят в различных дозированных формах, таких как тип инъецируемых растворов, описанный выше, однако также можно использовать капсулы для высвобождения лекарственного средства.

В этом контексте, количество активного ингредиента и объем композиции, подлежащей введению, зависят от индивидуума или субъекта, подлежащего лечению. Конкретные количества активного соединения, требуемые для введения, зависят от мнения специалиста и являются индивидуальными для каждого индивидуума.

Как правило, используют минимальный объем лекарственного средства, требуемый для диспергирования активных соединений. Пригодные режимы для введения также варьируют, но в качестве примера может быть приведено исходное введение соединения и мониторинг результатов, а затем назначение дополнительных контролируемых доз через дополнительные промежутки времени.

Например, для перорального введения в форме таблетки или капсулы (например, желатиновой капсулы), активный лекарственный компонент, т.е. молекулу нуклеиновой кислоты по настоящему изобретению и/или любое другое фармацевтически активное средство, также называемое в настоящем описании лекарственным средством(ами) или активным соединением(ями), можно комбинировать с пероральным нетоксичным фармацевтически приемлемым инертным носителем, таким как этанол, глицерин, вода и т.п. Более того, когда желательно или необходимо, также в смесь можно включать пригодные связующие вещества, смазывающие вещества, дезинтегрирующие вещества и красители. Пригодные связующие вещества включают крахмал, алюмосиликат магния, крахмальную пасту, желатин, метилцеллюлозу, карбоксиметилцеллюлозу натрия и/или поливинилпирролидон, природные сахара, такие как глюкоза или бета-лактоза, кукурузные подсластители, природные и синтетические камеди, такие как гуммиарабик, трагакант или альгинат натрия, полиэтиленгликоль, воск и т.п. Смазывающие вещества, используемые в этих дозированных формах, включают олеат натрия, стеарат натрия, стеарат магния, бензоат натрия, ацетат натрия, хлорид натрия, диоксид кремния, тальк, стеариновую кислоту, ее соль с магнием или кальцием и/или полиэтиленгликоль, и т.п. Дезинтегрирующие вещества включают, но не ограничиваются ими, крахмал, метилцеллюлозу, агар, бентонит, крахмалы ксантановой смолы, агар, альгиновую кислоту или ее соль с натрием, или шипучие смеси и т.п. Разбавители включают, например, лактозу, декстрозу, сахарозу, маннит, сорбит, целлюлозу и/или глицин.

Лекарственное средство по изобретению также можно вводить в таких пероральных дозированных формах в виде таблеток или капсул с замедленным или непрерывным высвобождением, пилюль, порошков, гранул, эликсиров, настоек, суспензий, сиропов и эмульсий. Суппозитории преимущественно получают из жировых эмульсий или суспензий.

Фармацевтическая композиция или лекарственное средство могут быть стерилизованными и/или могут содержать адъюванты, такие как консерванты, стабилизаторы, смачивающие средства или эмульгаторы, промоторы растворов, соли для регуляции осмотического давления и/или буферы. Кроме того, также они могут содержать другие терапевтически полезные вещества. Композиции получают в соответствии с общепринятыми способами смешивания, гранулирования или нанесения покрытия, и, как правило, они содержат приблизительно от 0,1% до 75%, предпочтительно приблизительно от 1% до 50%, активного ингредиента.

Жидкие, в частности инъецируемые, композиции можно получать, например, путем растворения, диспергирования и т.д. Активное соединение растворяют в фармацевтически чистом растворителе, например, таком как вода, солевой раствор, водный раствор декстрозы, глицерин, этанол и т.п., или смешивают с ним, с получением, таким образом, инъецируемого раствора или суспензии. Кроме того, можно изготавливать твердые формы, пригодные для растворения в жидкости перед инъекцией.

Для твердых композиций эксципиенты включают маннит, лактозу, крахмал, стеарат магния, сахарин натрия, тальк, целлюлозу, глюкозу, сахарозу, карбонат магния и т.п.фармацевтической категории. Активное соединение, определенное выше, также можно составлять в качестве суппозиториев, с использованием в качестве носителя, например, полиалкиленгликоли, например, пропиленгликоль. В некоторых вариантах осуществления суппозитории преимущественно получают из жировых эмульсий или суспензий.

Лекарственные средства и молекулы нуклеиновой кислоты, соответственно, по настоящему изобретению также можно вводить в форме систем для доставки липосом, таких как небольшие однослойные везикулы, крупные однослойные везикулы и многослойные везикулы. Липосомы можно получать из различных фосфолипидов, включающих холестерин, стеариламин или фосфатидилхолины. В некоторых вариантах осуществления пленка липидных компонентов гидратирована водным раствором лекарственного средства с образованием липидного слоя, инкапсулирующего лекарственное средство, как хорошо известно специалисту в данной области. Например, молекулы нуклеиновой кислоты, описанные в настоящем описании, могут быть предоставлены в качестве комплекса с липофильным соединением или неиммуногенным высокомолекулярным соединением, сконструированного с использованием способов, известных в данной области. Кроме того, липосомы могут нести такие молекулы нуклеиновой кислоты на их поверхности для нацеливания и переноса цитотоксических средств внутрь клетки для обеспечения ее уничтожения. Примеры ассоциированных с нуклеиновой кислотой комплексов представлены в патенте США №6011020.

Лекарственные средства и молекулы нуклеиновой кислоты, соответственно, по настоящему изобретению также можно связывать с растворимыми полимерами в качестве носителей для нацеливаемого лекарственного средства. Такие полимеры могут включать поливинилпирролидон, сополимер пирана, полигидроксипропилметакриламидфенол, полигидроксиэтиласпанамидфенол или полиэтиленоксидполилизин, замещенный пальмитоильными остатками. Более того, лекарственные средства и молекулы нуклеиновой кислоты, соответственно, по настоящему изобретению можно связывать с классом биологически деградируемых полимеров, пригодных для обеспечения контролируемого высвобождения лекарственного средства, например, полимолочной кислотой, полиэпсилонкапролактоном, полигидроксимасляной кислотой, полиортоэфирами, полиацеталями, полидигидропиранами, полицианоакрилатами и поперечно-сшитыми или амфипатическими блок-сополимерами гидрогелей.

Если желательно, фармацевтическая композиция и лекарственное средство, соответственно, подлежащие введению, также могут содержать небольшие количества нетоксичных вспомогательных веществ, таких как смачивающие вещества или эмульгаторы, рН-буферные средства и другие вещества, например, такие как ацетат натрия и олеат триэтаноламина.

Режим дозирования с использованием молекул нуклеиновой кислоты и лекарственных средств, соответственно, по настоящему изобретению выбирают в соответствии с различными факторами, включая тип, вид, возраст, массу тела, пол и медицинское состояние пациента; тяжесть состояния, подлежащего лечению; путь введения; функцию почек и печени пациента; и конкретного используемого аптамера или его соли. Квалифицированный терапевт или ветеринар может легко определить и назначить эффективное количество лекарственного средства, требуемое для предотвращения, борьбы или остановки прогрессирования состояния.

Эффективные уровни в плазме нуклеиновой кислоты в соответствии с настоящим изобретением предпочтительно находятся в диапазоне от 500 фМ до 500 мкМ при лечении любых из заболеваний, описанных в настоящем описании.

Молекулы нуклеиновой кислоты и лекарственные средства, соответственно, по настоящему изобретению предпочтительно можно вводить в единичной суточной дозе, раз в двое или трое суток, раз в неделю, раз в две недели, в однократной ежемесячной дозе или раз в три месяца.

В рамках настоящего изобретения лекарственное средство, как описано в настоящем описании, представляет собой фармацевтическую композицию, описанную в настоящем описании.

В следующем аспекте настоящее изобретение относится к способу лечения индивидуума, нуждающегося в таком лечении, где способ включает введение фармацевтически активного количества по меньшей мере одной из нуклеиновых кислот в соответствии с настоящим изобретением. В одном варианте осуществления индивидуум страдает заболеванием или имеет риск развития такого заболевания, где заболевание представляет собой любое из заболеваний, описанных в настоящем описании, в частности, любое из заболеваний, описанных в связи с применением любой из нуклеиновых кислот в соответствии с настоящим изобретением для изготовления лекарственного средства.

Следует понимать, что нуклеиновую кислоту, а также антагонисты в соответствии с настоящим изобретением, можно использовать не только в качестве лекарственного средства или для изготовления лекарственного средства, но также для косметических целей, в частности, в связи с вовлечением С5а в воспаленные регионарные очаги повреждения кожи. Таким образом, следующим состоянием или заболеванием, для лечения или предотвращения которого можно использовать нуклеиновую кислоту, лекарственное средство и/или фармацевтическую композицию в соответствии с настоящим изобретением, являются воспаленные регионарные очаги повреждения кожи.

Как предпочтительно используют в настоящем описании, диагностическое средство или диагностический способ пригодны для обнаружения, либо прямо, либо непрямо, С5а, предпочтительно С5а, как описано в настоящем описании, и более предпочтительно С5а, как описано в настоящем описании применительно к различным нарушениям и заболеваниям, описанным в настоящем описании. Диагностическое средство пригодно для обнаружения и/или наблюдения любых нарушений и заболеваний, соответственно, описанных в настоящем описании. Такое обнаружение возможно посредством связывания нуклеиновых кислот в соответствии с настоящим изобретением с С5а. Такое связывание можно обнаруживать либо прямо, либо непрямо. Соответствующие способы и средства известны специалистам в данной области. Среди прочих, нуклеиновые кислоты в соответствии с настоящим изобретением могут содержать метку, которая позволяет обнаружение нуклеиновых кислот в соответствии с настоящим изобретением, предпочтительно нуклеиновой кислоты, связанной с С5а. Такую метку предпочтительно выбирают из группы, включающей радиоактивные, ферментные и флуоресцентные метки. В принципе, любые известные анализы, разработанные для антител, могут быть переняты для нуклеиновых кислот в соответствии с настоящим изобретением, где связывающее мишень антитело заменяют связывающей мишень нуклеиновой кислотой. В анализах антител с использованием немеченых связывающих мишень антител обнаружение предпочтительно проводят с помощью вторичного антитела, модифицированного радиоактивными, ферментными и флуоресцентными метками и связывающегося со связывающим мишень антителом в его Fc-фрагменте. В случае нуклеиновой кислоты, предпочтительно нуклеиновой кислоты в соответствии с настоящим изобретением, нуклеиновую кислоту модифицируют такой меткой, где предпочтительно такая метка выбрана из группы, содержащей биотин, Су-3 и Су-5, и такую метку подвергают обнаружению с помощью антитела, направленного против такой метки, например, антитела против биотина, антитела против Су3 или антитела против Су5, или - в случае, когда меткой является биотин, - обнаружение метки проводят с помощью стрептавидина или авидина, которые естественным образом связываются с биотином. Такое антитело, стрептавидин или авидин в свою очередь предпочтительно модифицируют соответствующей меткой, например радиоактивной, ферментной или флуоресцентной меткой (подобно вторичному антителу).

В следующем варианте осуществления обнаружение или анализ молекул нуклеиновых кислот в соответствии с изобретением проводят с помощью средств для вторичного обнаружения, где указанное средство для обнаружения представляет собой молекулярный маяк. Технология молекулярного маяка известна специалистам в данной области. В кратком изложении, зонды нуклеиновых кислот, которые также называют молекулярными маяками, являются обратными комплементарными последовательностями для образца нуклеиновых кислот, подлежащих обнаружению, и они вследствие этого гибридизуются с частью образца нуклеиновой кислоты, подлежащей обнаружению. При связывании с образцом нуклеиновой кислоты флуорофорные группы молекулярного маяка отделяются, что приводит к изменению флуоресцентного сигнала, предпочтительно изменению интенсивности. Это изменение коррелирует с количеством нуклеиновых кислот, имеющимся в образце.

Будет понятно, что обнаружение С5а с использованием нуклеиновых кислот в соответствии с настоящим изобретением может, в частности, позволить обнаружение С5а, как определено в настоящем описании.

Применительно к обнаружению С5а, предпочтительный способ включает следующие стадии:

(а) предоставление образца, подлежащего исследованию на наличие С5а,

(b) предоставление нуклеиновой кислоты в соответствии с настоящим изобретением,

(c) реакция образца с нуклеиновой кислотой, предпочтительно в реакционной емкости,

где стадию (а) можно проводить перед стадией (b), или стадию (b) можно проводить перед стадией (а).

В предпочтительном варианте осуществления предусмотрена дополнительная стадия а), которая состоит в обнаружении реакции образца с нуклеиновой кислотой. Предпочтительно, нуклеиновая кислота стадии b) иммобилизована на поверхности. Поверхность может представлять собой поверхность реакционной емкости, такой как реакционная пробирка, лунка планшета или поверхность приспособления, содержащегося в такой реакционной емкости, например, такого как гранула. Иммобилизацию нуклеиновой кислоты на поверхность можно проводить любым способом, известным специалистам в данной области, включая, но не ограничиваясь ими, нековалентное или ковалентное присоединение. Предпочтительно, связь образуют путем ковалентной химической связи между поверхностью и нуклеиновой кислотой. Однако также настоящее изобретение относится к тому, что нуклеиновая кислота непрямо иммобилизована на поверхности, где такая непрямая иммобилизация вовлекает применение дополнительного компонента или пары партнеров по взаимодействию. Такой дополнительный компонент предпочтительно представляет собой соединение, которое специфично взаимодействует с нуклеиновой кислотой, подлежащей иммобилизации, которую также называют партнером по взаимодействию, и, таким образом, он опосредует связывание нуклеиновой кислоты с поверхностью. Партнера по взаимодействию предпочтительно выбирают из группы, включающей нуклеиновые кислоты, полипептиды, белки и антитела. Предпочтительно, партнер по взаимодействию представляет собой антитело, более предпочтительно моноклональное антитело. Альтернативно, партнером по взаимодействию является нуклеиновая кислота, предпочтительно функциональная нуклеиновая кислота. Более предпочтительно, такая функциональная нуклеиновая кислота выбрана из группы, включающей аптамеры, шпигельмеры и нуклеиновые кислоты, которые по меньшей мере частично комплементарны нуклеиновой кислоте. В следующем альтернативном варианте осуществления связывание нуклеиновой кислоты с поверхностью опосредуется партнером по взаимодействию из нескольких частиц. Таким партнером по взаимодействию из нескольких частиц предпочтительно является пара партнеров по взаимодействию или партнер по взаимодействию, состоящий из первого члена и второго члена, где первый член содержится в нуклеиновой кислоте, или связан с ней, а второй член связан с поверхностью или содержится на ней. Партнер по взаимодействию предпочтительно выбирают из группы пар партнеров по взаимодействию, включающей биотин и авидин, биотин и стрептавидин, и биотин и нейтравидин. Предпочтительно, первым членом пары партнеров по взаимодействию является биотин.

Предпочтительным результатом такого способа является образование иммобилизованного комплекса С5а и нуклеиновой кислоты, где более предпочтительно указанный комплекс подвергают обнаружению. В одном варианте осуществления обнаружение С5а проводят из комплекса.

Соответствующим средством для обнаружения, которое согласуется с этим требованием, является, например, любое средство для обнаружения, которое является специфичным для этой/этих части(ей) С5а. Особенно предпочтительным средством для обнаружения является средство для обнаружения, которое выбрано из группы, включающей нуклеиновые кислоты, полипептиды, белки и антитела, получение которых известно специалистам в данной области.

Способ обнаружения С5а также включает удаление образца из реакционной емкости, которую предпочтительно используют для проведения стадии с).

В следующем варианте осуществления способ также включает стадию иммобилизации партнера С5а по взаимодействию на поверхности, предпочтительно на поверхности, как определено выше, где партнер по взаимодействию является таким, как определено в настоящем описании, и предпочтительно, как указано выше применительно к соответствующему способу, и более предпочтительно он включает нуклеиновые кислоты, полипептиды, белки и антитела в их различных вариантах осуществления. В этом варианте осуществления особенно предпочтительным способом обнаружения является нуклеиновая кислота в соответствии с настоящим изобретением, где такая нуклеиновая кислота предпочтительно может быть меченой или немеченой. В случае, когда такая нуклеиновая кислота является меченой, ее обнаружение можно проводить прямо или непрямо. Такое обнаружение также может вовлекать применение второго средства для обнаружения, которое, предпочтительно, также выбрано из группы, включающей нуклеиновые кислоты, полипептиды, белки и варианты осуществления в различных вариантах осуществления, описанных в настоящем описании. Такие средства для обнаружения предпочтительно являются специфичными к нуклеиновой кислоте в соответствии с настоящим изобретением. В более предпочтительном варианте осуществления вторым средством для обнаружения является молекулярный маяк. В предпочтительном варианте осуществления либо нуклеиновая кислота, либо второе средство для обнаружения, либо оба из них могут содержать метку для обнаружения. Метку для обнаружения предпочтительно выбирают из группы, включающей биотин, бром-дезоксиуридиновую метку, дигоксигениновую метку, флуоресцентную метку, УФ-метку, радиоактивную метку и хелатирующую молекулу. Альтернативно, второе средство для обнаружения взаимодействует с поддающейся обнаружению меткой, которая предпочтительно находится в нуклеиновой кислоте, включена в нуклеиновую кислоту или связана с ней. Особенно предпочтительными комбинациями являются следующие:

поддающейся обнаружению меткой является биотин, а вторым средством для обнаружения является антитело, направленное против биотина, или где

поддающейся обнаружению меткой является биотин, а вторым средством для обнаружения является авидин или несущая авидин молекула, или где

поддающейся обнаружению меткой является биотин, а вторым средством для обнаружения является стрептавидин или несущая стрептавидин молекула, или где

поддающейся обнаружению меткой является биотин, а вторым средством для обнаружения является нейтравидин или несущая нейтравидин молекула, или

где поддающейся обнаружению меткой является бром-дезоксиуридин, а вторым средством для обнаружения является антитело, направленное против бром-дезоксиуридина, или где

поддающейся обнаружению меткой является дигоксигенин, а вторым средством для обнаружения является антитело, направленное против дигоксигенина, или где

поддающейся обнаружению меткой является хелатирующий агент, а вторым средством для обнаружения является радионуклид, где предпочтительно, чтобы метка для обнаружения была связана с нуклеиновой кислотой. Также понятно, что этот тип комбинации также применим к варианту осуществления, где нуклеиновая кислота связана с поверхностью. В таком варианте осуществления предпочтительно, чтобы поддающаяся обнаружению метка была связана с партнером по взаимодействию.

Наконец, также в рамках настоящего изобретения обнаружение второго средства для обнаружения проводят с использованием третьего средства для обнаружения, предпочтительно третьим средством для обнаружения является фермент, более предпочтительно, демонстрирующий ферментативную реакцию при обнаружении второго средства для обнаружения, или третьим средством для обнаружения является средство для обнаружения излучения, более предпочтительно излучения, испускаемого радионуклидом. Предпочтительно, третье средство для обнаружения специфично обнаруживается вторым средством для обнаружения/или взаимодействует с ним.

Также в варианте осуществления с партнером С5а по взаимодействию, иммобилизованным на поверхности, и нуклеиновой кислотой в соответствии с настоящим изобретением, предпочтительно добавленной к комплексу, образованному между партнером по взаимодействию и С5а, образец можно удалять из реакционной смеси, более предпочтительно из реакционной емкости, где проводят стадию с) и/или d).

В одном варианте осуществления нуклеиновая кислота в соответствии с настоящим изобретением содержит флуоресцентную часть, где флуоресценция флуоресцентной части отличается при образовании комплекса между нуклеиновой кислотой и С5а и свободным С5а.

В следующем варианте осуществления нуклеиновая кислота представляет собой производное нуклеиновой кислоты в соответствии с настоящим изобретением, где производное нуклеиновой кислоты содержит по меньшей мере одно флуоресцентное производное аденозина, заменяющее аденозин. В предпочтительном варианте осуществления флуоресцентным производным аденозина является этеноаденозин.

В следующем варианте осуществления обнаружение комплекса, состоящего из производного нуклеиновой кислоты в соответствии с настоящим изобретением и С5а, проводят с использованием флуоресценции.

В одном варианте осуществления способа сигнал формируется на стадии (с) или стадии (а), и предпочтительно сигнал коррелирует с концентрацией С5а в образце.

В предпочтительном аспекте анализы можно проводить в 96-луночных планшетах, где компоненты иммобилизованы в реакционных сосудах, как описано выше, и в лунках, выступающих в качестве реакционных сосудов.

Кроме того, нуклеиновую кислоту по изобретению можно использовать в качестве исходного материала для конструирования лекарственных средств. В принципе, существует два возможных подхода. Одним из подходов является скрининг библиотек соединений, где такие библиотеки соединений предпочтительно представляют собой библиотеки низкомолекулярных соединений. В одном варианте осуществления скрининг представляет собой высокопроизводительный скрининг. Предпочтительно, высокопроизводительный скрининг представляет собой быструю эффективную и эмпирическую оценку соединений в анализе на основе мишени. В лучшем случае анализ проводят путем колориметрического определения. Библиотеки, используемые для этого, хорошо известны специалисту в данной области.

Альтернативно, нуклеиновую кислоту в соответствии с настоящим изобретением можно использовать для рационального конструирования лекарственных средств. Предпочтительно, рациональное конструирование лекарственных средств представляет собой конструирование основной структуры фармацевтического средства. Начиная с 3-мерной структуры мишени, которую, как правило, идентифицируют такими способами, как рентгеновская кристаллография или ядерная магнитно-резонансная спектроскопия, используют компьютерные программы для поиска по базам данных, содержащим структуры множества различных химических соединений. Выбор проводят с помощью компьютера, идентифицированные соединения затем можно исследовать в лаборатории.

Рациональное конструирование лекарственных средств можно начинать с любой нуклеиновой кислоты в соответствии с настоящим изобретением, и оно вовлекает структуру, предпочтительно трехмерную структуру, которая сходна со структурой нуклеиновых кислот по изобретению или идентична опосредующим связывание частям структуры нуклеиновых кислот по изобретению. В любом случае такая структура, тем не менее, демонстрирует такие же или сходные характеристики связывания, что и нуклеиновые кислоты по изобретению. Предпочтительно, либо на следующей стадии, либо в качестве альтернативной стадии рационального конструирования лекарственных средств, трехмерная структура этих частей нуклеиновых кислот, связывающихся с нейротрансмиттером, имитируется химическими группами, которые отличаются от нуклеотидов и нуклеиновых кислот. Путем этой имитации можно конструировать соединение, отличающееся от нуклеиновых кислот. Предпочтительно, такое соединение представляет собой низкомолекулярное соединение или пептид.

В случае скрининга библиотек соединений, например, с использованием конкурентного анализа, который известен специалисту в данной области, могут быть найдены соответствующие аналоги С5а, агонисты С5а или антагонисты С5а. Такие конкурентные анализы могут быть устроены следующим образом. Нуклеиновую кислоту по изобретению, предпочтительно шпигельмер, который представляет собой связывающую мишень L-нуклеиновую кислоту, связывают с твердой фазой. Для идентификации аналогов С5а в анализ можно добавлять меченый С5а. Потенциальный аналог может конкурировать с молекулами С5а, связывающимися со шпигельмером, что сопровождается снижением сигнала, полученного с помощью соответствующей метки. Скрининг агонистов или антагонистов может вовлекать применение анализа клеточной культуры, как известно специалистам в данной области.

Набор в соответствии с настоящим изобретением может содержать по меньшей мере одну или несколько из нуклеиновых кислот по изобретению. Кроме того, набор может содержать по меньшей мере один или несколько положительных или отрицательных контролей. Положительный контроль может представлять собой, например, С5а, в частности, против которого отбирают нуклеиновую кислоту по изобретению или с которым она связывается, предпочтительно в жидкой форме. Отрицательный контроль может представлять собой, например, пептид, который определен с точки зрения биофизических свойств, сходных с С5а, но который не распознается нуклеиновыми кислотами по изобретению. Более того, указанный набор может содержать один или несколько буферов. Различные ингредиенты могут содержаться в наборе в сухой или лиофилизированной форме или они могут быть растворены в жидкости. Набор может включать один или несколько контейнеров, которые, в свою очередь, могут содержать один или несколько ингредиентов набора. В следующем варианте осуществления набор содержит инструкцию или листок с инструкцией, на котором предоставлена информация для пользователя о применении набора и его различных ингредиентов.

Фармацевтическое и биоаналитическое определение нуклеиновой кислоты в соответствии с настоящим изобретением для оценки ее фармакокинетического и биодинамического профиля в различных жидкостях, тканях и органах организма человека и не человека, является элементарным. Для такой цели можно использовать любой из способов обнаружения, описанных в настоящем описании или известных специалисту в данной области. В следующем аспекте настоящего изобретения для обнаружения нуклеиновой кислоты в соответствии с настоящим изобретением предусмотрен сэндвич-анализ гибридизации. В анализе для обнаружения используют улавливающий зонд и зонд для обнаружения. Улавливающий зонд комплементарен первой части, а зонд для обнаружения комплементарен второй части нуклеиновой кислоты в соответствии с настоящим изобретением. Как улавливающий зонд, так и зонд для обнаружения могут быть образованы нуклеотидами ДНК, модифицированными нуклеотидами ДНК, модифицированными нуклеотидами РНК, нуклеотидами РНК, нуклеотидами LNA и/или нуклеотидами PNA.

Таким образом, улавливающий зонд содержит участок последовательности, комплементарный 5'-концу нуклеиновой кислоты в соответствии с настоящим изобретением, а зонд для обнаружения содержит участок последовательности, комплементарный 3'-концу нуклеиновой кислоты в соответствии с настоящим изобретением. В этом случае улавливающий зонд иммобилизуют на поверхности или матрице через его 5'-конец, где улавливающий зонд может быть иммобилизован непосредственно через его 5'-конец или через линкер между его 5'-концом и поверхностью или матрицей. Однако в принципе линкер может быть связан с каждым нуклеотидом улавливающего зонда. Линкер может быть образован гидрофильными линкерами, известными в данной области, или нуклеотидами D-ДНК, модифицированными нуклеотидами D-ДНК, нуклеотидами D-РНК, модифицированными нуклеотидами D-РНК, нуклеотидами D-LNA, нуклеотидами PNA, нуклеотидами L-РНК, нуклеотидами L-ДНК, модифицированными нуклеотидами L-РНК, модифицированными нуклеотидами L-ДНК и/или нуклеотидами L-LNA.

Альтернативно, улавливающий зонд содержит участок последовательности, комплементарный 3'-концу нуклеиновой кислоты в соответствии с настоящим изобретением, а зонд для обнаружения содержит участок последовательности, комплементарный 5'-концу нуклеиновой кислоты в соответствии с настоящим изобретением. В этом случае улавливающий зонд иммобилизуют на поверхности или матрице через его 3'-конец, где улавливающий зонд может быть иммобилизован непосредственного через его 3'-конец или через линкер между его 3'-концом и поверхностью или матрицей. Однако в принципе линкер может быть связан с каждым нуклеотидом участка последовательности, который комплементарен нуклеиновой кислоте по настоящему изобретению. Линкер может быть образован гидрофильными линкерами, известными в данной области, или нуклеотидами D-ДНК, модифицированными нуклеотидами D-ДНК, нуклеотидами D-РНК, модифицированными нуклеотидами D-РНК, нуклеотидами D-LNA, нуклеотидами PNA, нуклеотидами L-РНК, нуклеотидами L-ДНК, модифицированными нуклеотидами L-РНК, модифицированными нуклеотидами L-ДНК и/или нуклеотидами L-LNA.

Число нуклеотидов в улавливающем зонде и зонде обнаружения, которые могут гибридизоваться с нуклеиновой кислотой в соответствии с настоящим изобретением, варьирует и может зависеть от числа нуклеотидов в улавливающем зонде и/или зонде обнаружения и/или самой нуклеиновой кислоте в соответствии с настоящим изобретением. Общее число нуклеотидов в улавливающем зонде и зонде обнаружения, которые могут гибридизоваться с нуклеиновой кислотой в соответствии с настоящим изобретением, должно представлять собой максимальное количество нуклеотидов, которые содержатся в нуклеиновой кислоте в соответствии с настоящим изобретением. Минимальное число нуклеотидов (от 2 до 10 нуклеотидов) в зонде обнаружения и улавливающем зонде должно обеспечить гибридизацию с 5'-концом или 3'-концом, соответственно, нуклеиновой кислоты в соответствии с настоящим изобретением. Для достижения высокой специфичности и селективности для нуклеиновой кислоты в соответствии с настоящим изобретением относительно других нуклеиновых кислот, встречающихся в анализируемых образцах, общее количество нуклеотидов в улавливающем зонде и зонде обнаружения должно представлять собой максимальное число нуклеотидов, которые содержатся в нуклеиновой кислоте в соответствии с настоящим изобретением.

Более того, зонд для обнаружения предпочтительно содержит маркерную молекулу или метку, которую можно подвергать обнаружению, как описано в настоящем описании выше. Метка или маркерная молекула, в принципе, может быть связана с каждым нуклеотидом зонда для обнаружения. Предпочтительно, метка или маркер расположены на 5'-конце или 3'-конце зонда для обнаружения, где между нуклеотидами в зонде обнаружения, которые комплементарны нуклеиновой кислоте в соответствии с настоящим изобретением, и меткой может быть встроен линкер. Линкер может быть образован гидрофильными линкерами, известными в данной области, или нуклеотидами D-ДНК, модифицированными нуклеотидами D-ДНК, нуклеотидами D-РНК, модифицированными нуклеотидами D-РНК, нуклеотидами D-LNA, нуклеотидами PNA, нуклеотидами L-РНК, нуклеотидами L-ДНК, модифицированными нуклеотидами L-РНК, модифицированными нуклеотидами L-ДНК и/или нуклеотидами L-LNA.

Обнаружение нуклеиновой кислоты в соответствии с настоящим изобретением можно проводить следующим образом:

Нуклеиновая кислота в соответствии с настоящим изобретением гибридизуется одним из ее концов с улавливающим зондом, а другим концом с зондом для обнаружения. После этого не связавшийся зонд для обнаружения удаляют, например, посредством одной или нескольких стадий промывания. Затем можно измерять количество связавшегося зонда для обнаружения, который предпочтительно содержит метку или маркерную молекулу, например, как более подробно описано в WO/2008/052774, которая включена в настоящее описание в качестве ссылки.

Как предпочтительно используют в настоящем описании, термин "лечение" в предпочтительном варианте осуществления включает, дополнительно или альтернативно, предотвращение и/или наблюдение.

Как предпочтительно используют в настоящем описании, термины "заболевание и нарушение" используют взаимозаменяемо, если нет иных указаний.

Как используют в настоящем описании, термин "содержит" предпочтительно не предназначен для ограничения объекта, следующего после такого термина или описываемого им. Однако в альтернативном варианте осуществления термин "содержит" следует понимать в значении "состоит из" и, таким образом, как ограничивающий объект, следующий после такого термина или описываемый им.

Различные SEQ ID NO, химическая природа молекул нуклеиновых кислот в соответствии с настоящим изобретением и молекулы С5а-мишени, как используют в настоящем описании, их фактическая последовательность и внутренний номер для ссылки обобщены в следующей таблице.

Настоящее изобретение дополнительно иллюстрируется фигурами, примерами и списком последовательностей, из которых могут быть установлены дополнительные признаки, варианты осуществления и преимущества, где

на фиг. 1 представлено выравнивание последовательностей молекул нуклеиновых кислот, способных связывать С5а человека и мыши, включая величину KD и относительную активность связывания с С5а человека и мыши при определении с помощью измерения с использованием поверхностного плазменного резонанса;

на фиг. 2 представлены производные молекулы нуклеиновой кислоты NOX-D19001 с одной заменой рибонуклеотида на 2'-дезоксирибонуклеотид, включая величину KD и относительную активность связывания с С5а человека при определении с помощью измерения с использованием поверхностного плазменного резонанса;

на фиг. 3 представлены производные молекулы нуклеиновой кислоты NOX-D19001 с двумя, тремя, четырьмя, пятью или шестью заменами рибонуклеотида на 2'-дезоксирибонуклеотид, включая величину KD и относительную активность связывания с С5а человека при определении с помощью измерения с использованием поверхностного плазменного резонанса;

на фиг. 4А, В представлены укорочения молекулы нуклеиновой кислоты NOX-D19001-6xDNA, включая величину KD и относительную активность связывания с С5а человека при определении с помощью измерения с использованием поверхностного плазменного резонанса;

на фиг. 5 представлены производные молекулы нуклеиновой кислоты NOX-D20001 без замен, с одной, двумя, тремя или четырьмя заменами рибонуклеотида на 2'-дезоксирибонуклеотид, включая величину KD и относительную активность связывания с С5а человека при определении с помощью измерения с использованием поверхностного плазменного резонанса;

на фиг. 6 показана оценка кинетики с помощью измерения с использованием Biacore для молекул нуклеиновой кислоты NOX-D19001, NOX-D19001-D09 и NOX-D19001-D09-16-17-30-32-40 (также обозначаемая как NOX-D19001-6xDNA) в отношении С5а человека, где показаны данные для 500 нМ шпигельмера NOX-D19001, NOX-D19001-D09 (сокращенно D09) и NOX-D19001-D09-16-17-30-32-40 (сокращенно D09-16-17-30-32-40);

на фиг. 7 представлена диаграмма, демонстрирующая эффективность пегилированных на 5'-конце с помощью PEG массой 40 кДа связывающих С5а шпигельмеров NOX-D19001-5'PEG (также обозначаемый как NOX-D19), NOX-D20 (также обозначаемый как NOX-D19001-6xDNA-020-5'40kDa PEG) в анализах хемотаксиса, где клеткам позволяли мигрировать в направлении 0,1 нМ huC5a, предварительно инкубированного при 37°C с различными количествами шпигельмеров;

на фиг. 8 показана оценка кинетики с помощью измерения с использованием Biacore для молекул нуклеиновой кислоты NOX-D20 (также обозначаемая как NOX-D19001-6xDNA-020-5'40kDa PEG) в отношении С5а человека, С5а крысы, С5а мыши, С5а обезьяны; причем показаны данные для 1000, 500, 250, 125, 62,5, 31,3, 15,6, 7,8, 3,9 и 1,95-0 нМ шпигельмера NOX-D20;

на фиг. 9 показана оценка кинетики с помощью измерения с использованием Biacore для молекул нуклеиновой кислоты NOX-D20 (также обозначаемая как NOX-D19001-6xDNA-020-5'40kDa PEG) в отношении С5 человека и дез-Arg-С5а человека; причем показаны данные для 1000, 500, 250, 125, 62,5, 31,3, 15,6, 7,8, 3,9 и 1,95-0 нМ шпигельмера NOX-D20;

на фиг. 10 показана оценка кинетики с помощью измерения с использованием Biacore для молекул нуклеиновой кислоты NOX-D21 (также обозначаемая как NOX-D19001-2dU-ldC-020-5'40kDa PEG) в отношении С5а человека, С5 человека, дез-Arg-С5а человека, С5а мыши и дез-Arg-С5а мыши; причем представлены данные для 1000, 500, 250, 125, 62,5, 31,3, 15,6, 7,8, 3,9 и 1,95-0 нМ шпигельмера NOX-D21, связывающегося с С5а человека и С5 человека;

на фиг. 11 представлено выравнивание полипептидных последовательностей С5а из человека, макака-резус, мыши и крысы;

на фиг. 12А представлена диаграмма, демонстрирующая эффективность связывающих С5а шпигельмеров NOX-D20 в анализах хемотаксиса с С5а человека и С5а мыши, клеткам позволяли мигрировать в направлении 0,1 нМ huC5a или 0,3 нМ mС5а, предварительно инкубированными при 37°C с различными количествами шпигельмера; где а) количества клеток нормализовывали к наибольшей величине каждого набора данных и представляли в качестве процентного количества против концентрации шпигельмера, b) концентрации шпигельмера, при которых хемотаксис ингибируется на 50% (IC50), вычисляли с использованием нелинейной регрессии (четырехпараметрическая аппроксимация) с помощью программного обеспечения Prism5;

на фиг. 12В представлена диаграмма, демонстрирующая эффективность связывающих С5а шпигельмеров NOX-D21 в анализах хемотаксиса с С5а человека, клеткам позволяли мигрировать в направлении 0,1 нМ huC5a, предварительно инкубированными при 37°C с различными количествами шпигельмера; где а) количества клеток нормализовывали к наибольшей величине каждого набора данных и представляли в качестве процентного количества против концентрации шпигельмера, b) концентрации шпигельмера, при которых хемотаксис ингибируется на 50% (IC50), вычисляли с использованием нелинейной регрессии (четырехпараметрическая аппроксимация) с помощью программного обеспечения Prism5;

на фиг. 13 представлена диаграмма, на которой показана эффективность связывающих С5а шпигельмеров NOX-D19 и NOX-D20 в (А) анализах хемотаксиса и (В) анализах высвобождения эластазы для первичных PMN человека с С5а человека; где клеткам позволяли мигрировать в направлении 1 нМ huC5a и высвобождение эластазы стимулировали посредством 30 нМ huC5a, предварительно инкубированного при 37°C с различными количествами шпигельмера;

на фиг. 14 представлена диаграмма, демонстрирующая оценку ингибирования расщепления С5 с использованием анализа гемолиза эритроцитов овцы со шпигельмерами (A) NOX-19 и NOX-D20, и (В) NOX-D21. Представлены положительный (С5С6) и отрицательный контроли (revNOX-D19 и revNOX-D21);

на фиг. 15 представлена диаграмма, демонстрирующая выживаемость в модели полимикробного сепсиса на мышах с лигированием и проколом слепой кишки (CLP); NOX-D19 в указанных дозах или носитель инъецировали внутрибрюшинно каждые сутки, начиная сразу после хирургической операции CLP. Имитирующим животным проводили хирургическую операцию без CLP с последующими инъекциями носителя;

на фиг. 16 представлена диаграмма, демонстрирующая (А) уровни креатинина в сыворотке и (В) уровни азота мочевины в крови (BUN) до хирургической операции (сутки - 4) и через 1 сутки после хирургической операции CLP у мышей, которым вводили NOX-D19 в указанных дозах, у мышей, которым вводили носитель, и у имитирующих животных. Креатинин в сыворотке и BUN являются биомаркерами для функции почек;

на фиг. 17 представлена диаграмма, демонстрирующая (А) уровни в сыворотке аланинаминотрансферазы (ALT) и (В) уровни в сыворотке аспартатаминотрансферазы (AST) до хирургической операции (сутки - 4) и на 1 сутки после хирургической операции CLP у мышей, которым вводили NOX-D19 в указанных дозах, у мышей, которым вводили носитель, и у имитирующих животных. ALT в сыворотке является биомаркером гепатоцеллюлярного повреждения. AST в сыворотке является биомаркером полиорганной недостаточности;

на фиг. 18 представлена диаграмма, демонстрирующая выживаемость в модели полимикробного сепсиса на мышах и лигированием и проколом слепой кишки (CLP); NOX-D20 в указанных дозах или носитель инъецировали внутрибрюшинно каждые сутки, начиная сразу после хирургической операции CLP. Одной группе вводили одну дозу 1 мг/кг NOX-D20 сразу после хирургической операции CLP, а затем проводили инъекции носителя каждые сутки. Имитирующим животным проводили хирургическую операцию без CLP с последующими инъекциями носителя;

на фиг. 19 представлена диаграмма, демонстрирующая (А) уровни креатинина в сыворотке, (В) азот мочевины в крови (BUN) и (С) сывороточные уровни аланинаминотрансферазы (ALT) на 1 сутки после хирургической операции CLP у мышей, которым вводили NOX-D20 в указанных дозах, у мышей, которым вводили носитель, и у имитирующих животных. Креатинин в сыворотке и BUN являются биомаркерами для функции почек. ALT в сыворотке является биомаркером для гепатоцеллюлярного повреждения;

на фиг. 20 представлена диаграмма, демонстрирующая эффект введения NOX-D20 в указанных дозах на (А) лактатдегидрогеназу (LDH) в сыворотке, биомаркер повреждения тканей, (В) повышение сосудистой проницаемости, и (С) инфильтрацию PMN в брюшину на 1 сутки после хирургической операции CLP. Мыши, которым вводили носитель, и имитирующие животные представлены в качестве контролей;

на фиг. 21 представлена диаграмма, демонстрирующая выживаемость в модели индуцированного повреждением при ишемии/реперфузии острого повреждения почки; NOX-D21 в указанных дозах или носитель инъецировали внутривенно за 1 ч перед хирургической операцией, а затем внутрибрюшинно каждые 24 ч в течение 3 суток;

на фиг. 22 показаны 2'-дезоксирибонуклеотиды, из которых состоят молекулы нуклеиновой кислоты в соответствии с настоящим изобретением;

на фиг. 23 представлены рибонуклеотиды, из которых состоят молекулы нуклеиновой кислоты в соответствии с настоящим изобретением.

Пример 1: Молекулы нуклеиновой кислоты, способные связывать С5а человека и мыши

Было идентифицировано несколько связывающих С5а молекул нуклеиновой кислоты и их производных, нуклеотидные последовательности которых представлены на фиг.1-5. Связывающие С5а молекулы нуклеиновой кислоты были охарактеризованы как: a) аптамеры, т.е. D-молекулы нуклеиновой кислоты, с использованием прямого анализа "pull-down" (пример 3) и/или сравнительного конкурентного анализа "pull-down" (пример 3); b) шпигельмеры, т.е. L-молекулы нуклеиновой кислоты, с помощью измерения с использованием поверхностного плазменного резонанса (пример 4) и с помощью анализа in vitro с клетками, экспрессирующими рецептор С5а человека (пример 5). Более того, шпигельмеры исследовали в отношении ингибирования индуцируемой С5а активации первичных нейтрофилов человека (пример 6) и in vivo (пример 8, 9 и 10). Шпигельмеры и аптамеры синтезировали, как описано в примере 2. Молекулы нуклеиновой кислоты, полученные таким образом, обладают немного отличающимися последовательностями, причем последовательности могут быть обобщены или подразделены на семейства последовательностей. Для определения мотивов рибонуклеотидной последовательности используют сокращения IUPAC для неопределенных нуклеотидов:

Если нет иных указаний, любая последовательность нуклеиновой кислоты или последовательность участков, соответственно, указана в направлении 5'→3'.

Для различения 2'-дезоксирибонуклеотидов и рибонуклеотидов используют следующие сокращения:

Для 2'-дезоксирибонуклеотидов: dG, dC, dT, dA и dU (см. фиг. 22).

Для рибонуклеотидов: G, С, Т, U (см. фиг. 23).

Как представлено на фиг. 1 - фиг. 5, связывающие С5а молекулы нуклеиновой кислоты содержат один центральный участок нуклеотидов, определяющий потенциальный связывающий С5а мотив, причем на фиг. 1 представлены различные последовательности семейства последовательностей, на фиг. 2-5 представлены производные молекулы нуклеиновой кислоты NOX-D19001, включающие NOX-D20001 (также обозначаемое как NOX-D19001-6x-DNA-020, фиг. 4А) и NOX-D21001 (также обозначаемое как NOX-D19001-2dU-ldC-020, фиг. 5).

Как правило, связывающие С5а молекулы нуклеиновой кислоты содержат 5'-концевой и 3'-концевой участки нуклеотидов: первый концевой участок нуклеотидов и второй концевой участок нуклеотидов. Первый концевой участок нуклеотидов и второй концевой участок нуклеотидов могут гибридизоваться друг с другой, причем при гибридизации образуется двухцепочечная структура. Однако такая гибридизация не обязательно происходит в молекуле in vivo и in vitro.

Три участка нуклеотидов связывающих С5а молекул нуклеиновой кислоты - первый концевой участок нуклеотидов, центральный участок нуклеотидов и второй концевой участок нуклеотидов расположены друг относительно друга в направлении 5'→3': первый концевой участок нуклеотидов - центральный участок нуклеотидов - второй концевой участок нуклеотидов. Однако альтернативно первый концевой участок нуклеотидов, центральный участок нуклеотидов и второй концевой участок нуклеотидов расположены друг относительно друга в направлении 5'→3': второй концевой участок нуклеотидов - центральный участок нуклеотидов - первый концевой участок нуклеотидов.

Последовательности определенных участков могут отличаться между связывающими С5а молекулами нуклеиновой кислоты, которые влияют на аффинность связывания с С5а. На основе анализа связывания различных связывающих С5а молекул нуклеиновой кислоты, центральный участок нуклеотидов и его нуклеотидные последовательности, как описано ниже, индивидуально и более предпочтительно в целом необходимы для связывания с С5а человека.

Связывающие С5а молекулы нуклеиновой кислоты в соответствии с настоящим изобретением, как показано на фиг. 1, состоят из рибонуклеотидов и представлены на фиг. 1-5. Связывающую С5а молекулу нуклеиновой кислоты 274-Н6-002 исследовали в качестве аптамера в сравнительных конкурентных анализах "pull-down" (для протокола см. пример 3) против связывающей С5а нуклеиновой кислоты 274-D5-002. Связывающая С5а молекула нуклеиновой кислоты 274-Н6-002 продемонстрировала более слабую аффинность связывания по сравнению со связывающей С5а молекулой нуклеиновой кислоты 274-D5-002. Связывающие С5а молекулы нуклеиновой кислоты 274-В5-002, 274-D5-002, 274-С8-002, 274-C8-002-G14 (=NOX-D19001), 274-С5-002 и 274-G6-002 исследовали в качестве шпигельмеров в отношении их способности связывать С5а человека и мыши с помощью измерения с использованием плазменного резонанса (см. пример 4, фиг. 1).

Связывающая С5а молекула нуклеиновой кислоты 274-C8-002-G14 (=NOX-D19001) демонстрирует наилучшую аффинность связывания с KD 0,3 нМ в отношении С5а мыши и с KD 1,38 нМ в отношении С5а человека (фиг. 1).

Связывающие С5а молекулы нуклеиновой кислоты 274-В5-002, 274-D5-002, 274-С8-002, 274-C8-002-G14 (=NOX-D19001), 274-С5-002, 274-G6-002 и 274-Н6-002 обладают общей последовательностью

5' AUGUGGUGKUGARGGGHUGUKGGGUGUCGACGCA 3' [SEQ ID NO: 69],

где G, A, U, C, H, K и R представляют собой рибонуклеотиды.

Связывающие С5а молекулы нуклеиновой кислоты 274-С8-002, 274-C8-002-G14 (=NOX-D19001) и 274-С5-002 продемонстрировали наилучшую аффинность связывания с С5а и содержат следующие последовательности для центрального участка:

а) 274-С8-002: 5' AUGUGGUGUUGAAGGGUUGUUGGGUGUCGACGCA 3' [SEQ ID NO: 70],

b) 274-C8-002-G14: 5' AUGUGGUGGUGAAGGGUUGUUGGGUGUCGACGCA 3' [SEQ ID NO: 71],

c) 274-С5-002: 5' AUGUGGUGGUGAGGGGUUGUGGGGUGUCGACGCA 3' [SEQ ID NO: 72], где d G, A, U и С представляют собой рибонуклеотиды.

Авторы изобретения неожиданно продемонстрировали, что аффинность связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 улучшалась при замене рибонуклеотидов на 2'-дезоксирибонуклеотиды в последовательности центрального участка нуклеотидов и второго концевого участка нуклеотидов. В частности, замена вплоть до шести рибонуклеотидов на 2'-дезоксирибонуклеотиды в связывающей С5а молекуле нуклеиновой кислоты NOX-D19001 приводила к увеличению аффинности связывания с С5а человека на коэффициент 3,5. Более детально, авторы изобретения неожиданно открыли, что

a) замена одного рибонуклеотида на один 2'-дезоксирибонуклеотид в положении 4, 11, 12, 25 или 27 в центральном участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 приводила к увеличению аффинности связывания в отношении С5а человека по сравнению с аффинностью связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 (см. фиг. 2; шпигельмеры NOX-D19001-D09, NOX-D19001-D16, NOX-D19001-D17, NOX-D19001-D30, NOX-D19001-D32);

b) замена одного рибонуклеотида на один 2'-дезоксирибонуклеотид в положении 1 во втором концевом участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 приводила к увеличению аффинности связывания в отношении С5а человека по сравнению с аффинностью связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 (см. фиг. 2; шпигельмеры NOX-D19001-D40);

c) замена двух рибонуклеотидов на два 2'-дезоксирибонуклеотида в положении 4/25, 4/27 или 25/27 в центральном участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 приводила к увеличенной аффинности связывания с биотинилированным С5а по сравнению с аффинностью связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 (см. фиг. 3; шпигельмеры NOX-D19001-D09-30, NOX-D19001-D09-32, NOX-D19001-D30-32);

d) замена двух рибонуклеотидов, где один рибонуклеотид заменяли на один 2'-дезоксирибонуклеотид в положении 1 во втором концевом участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 и один рибонуклеотид заменяли на один 2'-дезоксирибонуклеотид в положении 4, 25 или 27 в центральном участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001, приводила к увеличению аффинности связывания в отношении С5а человека по сравнению с аффинностью связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 (см. фиг. 3; шпигельмеры NOX-D19001-D09-40, NOX-D19001-D30-40, NOX-D19001-D32-40);

e) замена трех рибонуклеотидов, где один рибонуклеотид заменяли на один 2-дезоксирибонуклеотид в положении 1 во втором концевом участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 и два рибонуклеотида заменяли на два 2'-дезоксирибонуклеотида в положении 4/25, 4/27, 25/27 в центральном участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001, приводила к увеличенной аффинности связывания с С5а человека по сравнению с аффинностью связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 (см. фиг. 3; шпигельмеры, NOX-D19001-D09-30-40, NOX-D19001-D09-32-40, NOX-D19001-D30-32-40);

f) замена трех рибонуклеотидов на три 2'-дезоксирибонуклеотида в положении 04/25/27 в центральном участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 приводила к увеличенной аффинности связывания с биотинилированным С5а по сравнению с аффинностью связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 (см. фиг. 3; шпигельмер NOX-D19001-D09-30-32);

g) замена четырех рибонуклеотидов, где один рибонуклеотид заменяли на один 2'-дезоксирибонуклеотид в положении 1 во втором концевом участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 и три рибонуклеотида заменяли на три 2'-дезоксирибонуклеотида в положении 04/25/27 в центральном участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001, приводила к увеличению аффинности связывания в отношении С5а человека по сравнению с аффинностью связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 (см. фиг. 3; шпигельмер NOX-D19001-D09-30-32-40);

h) замена пяти рибонуклеотидов, где один рибонуклеотид заменяли на один 2'-дезоксирибонуклеотид в положении 1 во втором концевом участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 и четыре рибонуклеотида заменяли на четыре 2'-дезоксирибонуклеотида в положении 04/11/25/27 или 04/12/25/27 в центральном участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001, приводила к увеличению аффинности связывания в отношении С5а человека по сравнению с аффинностью связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 (см. фиг. 3; шпигельмер NOX-D19001-D09-16-30-32-40, NOX-D19001-D09-17-30-32-40);

i) замена шести рибонуклеотидов, где один рибонуклеотид заменяли на один 2'-дезоксирибонуклеотид в положении 1 во втором концевом участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 и пять рибонуклеотидов заменяли на пять 2'-дезоксирибонуклеотидов в положении 04/11/12/25/27 в центральном участке нуклеотидов связывающей С5а молекулы нуклеиновой кислоты NOX-D19001, приводила к увеличению аффинности связывания в отношении С5а человека по сравнению с аффинностью связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 (см. фиг. 3; шпигельмер NOX-D19001-D09-16-17-30-32-40=NOX-D19-001-6xDNA).

На основе данных, показавших, что замена рибонуклеотидов на 2'-дезоксирибонуклеотиды в нескольких положениях центрального участка нуклеотидов связывающих С5а молекул нуклеиновой кислоты приводила к повышению связывания с С5а, центральный участок всех исследованных связывающих С5а молекул нуклеиновой кислоты может быть обобщен следующей формулой

5' AUGniGGUGKUn2n3RGGGHUGUKGGGn4Gn5CGACGCA 3' [SEQ ID NO: 61],

где n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой А или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и

G, А, U, С, Н, K и R являются рибонуклеотидами,

и dU, dG и dA являются 2'-дезоксирибонуклеотидами,

где

a) в предпочтительном варианте осуществления центральный участок нуклеотидов содержит последовательность

5' AUGn1GGUGUUn2n3AGGGUUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 62] (см. 274-В5-002); или

b) в предпочтительном варианте осуществления центральный участок нуклеотидов содержит последовательность

5' AUGn1GGUGUUn2n3GGGGUUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 63] (см. 274-D5-002); или

c) в предпочтительном варианте осуществления центральный участок нуклеотидов содержит последовательность

5' AUGn1GGUGUUn2n3AGGGUUGUUGGGn4Gn5CGACGCA 3' [SEQ ID NO: 64] (см. 274-С8-002); или

d) в предпочтительном варианте осуществления центральный участок нуклеотидов содержит последовательность

5' AUGn1GGUGGUn2n3AGGGUUGUUGGGn4Gn5CGACGCA 3' [SEQ ID NO: 65] (см. NOX-D19001); или

e) в предпочтительном варианте осуществления центральный участок нуклеотидов содержит последовательность

5' AUGn1GGUGGUn2n3GGGGUUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 66] (см. 274-С5-002); или

f) в предпочтительном варианте осуществления центральный участок нуклеотидов содержит последовательность

5' AUGn1GGUGGUn2n3GGGGAUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 67] (см. 274-G6-002); или

g) в предпочтительном варианте осуществления центральный участок нуклеотидов содержит последовательность

5' AUGn1GGUGUUn2n3GGGGCUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 68] (см. 274-Н6-002).

Связывающие С5а молекулы нуклеиновой кислоты NOX-D19001-D09, NOX-D19001-D16, NOX-D19001-D17, NOX-D19001-D30, NOX-D19001-D32, NOX-D19001-D09-30, NOX-D19001-D09-32, NOX-D19001-D09-40, NOX-D19001-D30-32, NOX-D19001-D30-40, NOX-D19001-D32-40, NOX-D19001-D09-30-32, NOX-D19001-D09-30-40, NOX-D19001-D09-32-40, NOX-D19001-D30-32-40, NOX-D19001-D09-30-32-40, NOX-D19001-D09-16-30-32-40, NOX-D19001-D09-17-30-32-40, NOX-D19001-D09-16-17-30-32-40 (см. фиг. 2 и 3) продемонстрировали наилучшую аффинность связывания с С5а и содержат следующую последовательность для центрального участка нуклеотидов:

a) 5' AUGdUGGUGGUGAAGGGUUGUUGGGUGUCGACGCA 3' [SEQ ID NO: 73] (см. NOX-D19001-D09, NOX-D19001-D09-40); или

b) 5' AUGUGGUGGUdGAAGGGUUGUUGGGUGUCGACGCA 3' [SEQ ID NO: 74] (см. NOX-D19001-D16); или

c) 5' AUGUGGUGGUGdAAGGGUUGUUGGGUGUCGACGCA 3' [SEQ ID NO: 75] (см. NOX-D19001-D 17); или

d) 5' AUGUGGUGGUGAAGGGUUGUUGGGdUGUCGACGCA 3' [SEQ ID NO: 76] (см. NOX-D19001-D30, NOX-D19001-D30-40); или

e) 5' AUGUGGUGGUGAAGGGUUGUUGGGUGdUCGACGCA 3' [SEQ ID NO: 77] (см. NOX-D19001-D32, NOX-D19001-D32-40); или

f) 5' AUGdUGGUGGUGAAGGGUUGUUGGGdUGUCGACGCA 3' [SEQ ID NO: 78] (см. NOX-D19001-D09-30, NOX-D19001-D09-30-40); или

g) 5' AUGdUGGUGGUGAAGGGUUGUUGGGUGdUCGACGCA 3' [SEQ ID NO: 79] (см. NOX-D19001-D09-32, NOX-D19001-D09-32-40);

h) 5' AUGUGGUGGUGAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 80] (см. NOX-D19001-D30-32, NOX-D19001-D30-32-40); или

i) 5' AUGdUGGUGGUGAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 81] (NOX-D19001-D09-30-32, NOX-D19001-D09-30-32-40); или

j) 5' AUGdUGGUGGUdGAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 82] (см. NOX-D19001-D09-16-30-32-40); или

k) AUGdUGGUGGUGdAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 83] (см. NOX-D19001-D09-17-30-32-40); или

l) 5' AUGdUGGUGGUdGdAAGGGUUGUUGGGdUGdUCGACGCA 3' [SEQ ID NO: 84] (см. NOX-D19001-D09-16-17-30-32-40=NOX-D19001-6xDNA),

где G, A, U и С представляют собой рибонуклеотиды, и dG, dA и dU представляют собой 2'-дезоксирибонуклеотиды.

Аффинность связывания связывающей С5а молекулы нуклеиновой кислоты NOX-D19001 значительно повышалась при замене от одного до шести рибонуклеотидов на 2'-дезоксирибонуклеотиды при определении с помощью измерения с использованием поверхностного плазменного резонанса, и она иллюстративно представлена для связывающих С5а нуклеиновых кислот NOX-D19001-D09 и NOX-D19001-D09-16-17-30-32-40 (также обозначаемых как NOX-D19001-6xDNA) (фиг. 6):

NOX-D19001: Ко 1,38 нМ,

NOX-D19001-D09: kd 709 пМ,

NOX-D19001-D09-16-17-30-32-40: kd 361 пМ.

NOX-D19001-6xDNA содержит центральный участок нуклеотидов с пятью 2'-дезоксирибонуклеотидами вместо рибонуклеотидов, первый концевой участок нуклеотидов с пятью рибонуклеотидами и второй концевой участок нуклеотидов с четырьмя рибонуклеотидами и одним 2'-дезоксирибонуклеотидом. Неожиданно, авторы изобретения смогли показать, что первый и второй концевой участок нуклеотидов может быть укорочен без снижения аффинности до четырех или трех нуклеотидов. Как показано в настоящем описании, первый и второй концевой участок нуклеотидов NOX-D19001-6xDNA может быть укорочен до от пяти до трех нуклеотидов (см. NOX-D19001-6xDNA-020, также обозначаемый как NOX-D20001) при сохранении аффинности (фиг. 4А).

На фиг. 4 продемонстрировано успешное комбинирование замены рибонуклеотида на 2'-дезоксирибонуклеотид и укорочения: исходная молекула NOX-D19001-6xDNA и NOX-D19001-6xDNA-020 (также обозначаемая как NOX-D20001), NOX-D19001, состоящая из рибонуклеотидов и первого и второго концевого участка нуклеотидов с пятью нуклеотидами в каждом, обладает аффинностью связывания (КD) 1,38 нМ. После шести замен рибонуклеотида на 2'-дезоксирибонуклеотид (что привело к NOX-D19001-6xDNA) и укорочения до первого и второго концевого участка нуклеотидов с тремя нуклеотидами (что привело к NOX-D19001-6xDNA-020, также обозначаемая как NOX-D20001) аффинность связывания в отношении С5а человека повышалась на коэффициент, превышающий четыре (NOX-D20001, KD 0,3 нМ). Укорочение первого или второго участков нуклеотидов до одного нуклеотида привело к снижению активности, однако такие молекулы все еще связывались с С5а с KD ниже 10 нМ (см. фиг. 4А, 4В).

Другой пример успешной замены рибонуклеотидов на 2'-дезоксирибонуклеотиды представлен на фиг. 5. Молекула NOX-D19001-020 представляет собой укороченное производное NOX-D19001, и она имеет KD 11,3 нМ (см. фиг. 5) вместо 1,38 нМ при определении для NOX-D19001 (см. фиг. 1 и 2). Обе молекулы содержат идентичный центральный участок рибонуклеотидов, однако NOX-D19001-020 содержит первый концевой участок только из трех вместо пяти рибонуклеотидов и второй концевой участок только из трех вместо пяти рибонуклеотидов. Путем замены двух или трех рибонуклеотидов на 2'-дезоксирибонуклеотиды в центральном участке нуклеотидов и необязательно одного рибонуклеотида на 2'-дезоксирибонуклеотид во втором концевом участке нуклеотидов аффинность связывания NOX-D19001-020 может быть увеличена на коэффициент, превышающий 10 (см. фиг. 5, NOX-D19001-2xDNA-020, NOX-D19001-3xDNA-020, NOX-D19001-2dU-ldC-020, также обозначаемая как NOX-D21001, NOX-Dl9001-3dU-ldC-020).

Взятые вместе, первый и второй концевые участки связывающих С5а молекул нуклеиновой кислоты содержат один, два, три, четыре или пять нуклеотидов (с фиг. 1 по фиг. 5), причем участки необязательно гибридизуются друг с другом, при этом при гибридизации образуется двухцепочечная структура. Эта двухцепочечная структура может состоять из от одной до пяти пар оснований. Однако такая гибридизация не обязательно происходит в молекуле.

При анализе первого концевого участка нуклеотидов и второго концевого участка нуклеотидов всех исследованных связывающих С5а молекул нуклеиновой кислоты, общая формула для первого концевого участка нуклеотидов представляет собой 5' Z1Z2Z3Z4G 3', и общая формула для второго концевого участка нуклеотидов представляет собой 5' Z5Z6Z7Z8Z9 3',

где

Z1 представляет собой G или отсутствует, Z2 представляет собой S или отсутствует, Z3 представляет собой S или отсутствует, Z4 представляет собой В или отсутствует, Z5 представляет собой С или dC, Z6 представляет собой V или отсутствует, Z7 представляет собой S или отсутствует, Z8 представляет собой S или отсутствует, Z9 представляет собой С или отсутствует, и

G, S, В, С, V являются рибонуклеотидами, и dC представляет собой 2'-дезоксирибонуклеотид,

причем в первом предпочтительном варианте осуществления

a) Z1 представляет собой G, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой С, или

b) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

c) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

d) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует, или

e) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой С, или

f) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой С, или

g) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой С, или

h) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 отсутствует, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой С, или

i) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

j) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

k) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 отсутствует, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

l) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

m) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует, или

n) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 отсутствует, Z5 представляет собой С, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

о) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

р) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 представляет собой V, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует, или

q) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой В, Z5 представляет собой С или dC, Z6 отсутствует, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует;

во втором предпочтительном варианте осуществления

а) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCCUG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CAGGC, или

b) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCCUG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAGGC 3', или

c) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CCUG 3' или 5' CUG 3' или 5' UG 3' или 5' G 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAGGC 3', или

d) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCUG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAGC 3', или

e) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGGC 3', или

f) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GGCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGCC 3', или

g) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CUG 3' или 5' UG 3' или 5' CG 3' или 5' G 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAGC 3', или

h) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCUG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAC 3' или 5' dCC 3' или 5' dCA 3', или

i) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GUG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCAC 3', или

j) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' UG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCA 3', или

k) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGC 3', или

l) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGC 3', или

m) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' G 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCGC 3', или

n) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCC 3', или

о) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dC 3', или

р) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' dCC 3', или

q) первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' GCG 3', и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' CGC 3'.

Для увеличения функциональности связывающие С5а молекулы нуклеиновой кислоты NOX-D19001, NOX-D20001 и NOX-D21001 синтезировали в качестве шпигельмера, содержащего аминогруппу на его 5'-конце. С указанными модифицированными аминогруппой шпигельмерами связывали часть PEG массой 40 кДа, что приводило к связывающим С5а шпигельмерам NOX-D19, NOX-D20 и NOX-D21. Синтез и пегилирование шпигельмера описан в примере 2.

Эффект увеличения аффинности связывания может быть показан для функциональности связывающих С5а молекул нуклеиновой кислоты. Как определено в анализе хемотаксиса (пример 5), связывающая С5а молекула нуклеиновой кислоты NOX-D19 (IC50=lf9 нМ), состоящая исключительно из рибонуклеотидов, была менее эффективной в отношении ингибирования функции С5а человека, чем NOX-D20, производное связывающей С5а молекулы нуклеиновой кислоты NOX-D19, содержащее шесть замен рибонуклеотида на 2'-дезоксирибонуклеотид (IС50=0,28 нМ) (фиг. 7).

NOX-D20 продемонстрировало очень высокую аффинность связывания с С5а мыши с константой диссоциации KD 19 пМ, в то время как для С5а человека была определена KD 299 пМ (пример 4, фиг. 8). NOX-D20 ингибирует функцию С5а человека с константой ингибирования IC50 275 пМ при определении в анализе хемотаксиса (пример 5, фиг. 7 и 12А). По причине стехиометрии чувствительность анализа хемотаксиса в отношении С5а мыши ограничена до 150 пМ вследствие того, что стимулирующая концентрация С5а мыши составляет 300 пМ. Таким образом, в случае С5а мыши для NOX-D20 была определена IC50 140 пМ (пример 5, фиг. 12А).

NOX-D20 продемонстрировал отсутствие связывания с С5а крысы или макака-резус, что указывает на очень высокую специфичность к мишени (фиг. 8). Исходя из выравнивания полипептидных последовательностей С5а человека, мыши, крысы и макака-резус и определенной специфичности, наиболее вероятно, что остатки серин 16 и валин 28 С5а человека являются необходимыми для связывания остатками на С5а (фиг. 11). Они являются консервативными в С5а человека и мыши, но отличаются у С5а макака-резус и крысы.

NOX-D21 содержит большинство повышающих аффинность участков NOX-D20, и он показал высокую аффинность в отношении С5а человека и мыши, как показано с помощью измерения с использованием Biacore (KD (С5а мыши)=29 пМ, KD (С5а человека)=815 пМ, KD (С5 человека)=413 пМ, см. фиг. 11). NOX-D21 ингибирует функцию С5а человека с константой ингибирования IC50 476 пМ, при определении с помощью анализа хемотаксиса (пример 5, фиг. 12В).

In vivo укороченная версия С5а образуется путем ферментативного отщепления С-концевого остатка аргинина, и она известна как дез-Аrg-С5а (также обозначается как С5а-дез-Аrg). Биологическая функция дез-Аrg-С5а не полностью понятна, однако существуют данные, что дез-Аrg-С5а сохраняет функцию активации лейкоцитов. Таким образом, исследовали, связывается ли NOX-D20 также с дез-Аrg-С5а. NOX-D20 продемонстрировал дозозависимое связывание с иммобилизованным рекомбинантным дез-Аrg-С5а человека (фиг. 9).

Детальная оценка кинетики, как описано, продемонстрировала, что дез-Аrg-С5а человека связывается посредством NOX-20 со сравнимой аффинностью с полноразмерным С5а человека с константой диссоциации 316 пМ и 299 пМ, соответственно. NOX-D21 связался с дез-Аrg-С5а мыши и человека с константами диссоциации 28 пМ и 854 пМ, соответственно (фиг. 10). Таким образом, даже после расщепления С5а до дез-Аrg-С5а связывающие С5а молекулы нуклеиновой кислоты, такие как NOX-20 и NOX-D21, все еще связываются с их мишенью.

Неожиданно, NOX-D20 и NOX-D21 также продемонстрировали связывание с С5, очищенным из плазмы человека, с аффинностью 164 пМ и 413 пМ, соответственно (фиг. 9 и 10). Это явление нельзя было предвидеть. Однако это является правдоподобным, поскольку С5а является частью С5, который расщепляется С5-конвертазой, когда система комплемента активируется, или тромбином или другими представителями активированной системы свертывания. Более того, С5, очищенный из плазмы человека, имеет нативную структуру гликозилирования на аспарагине 64. Гликозилирование отсутствовало на зеркальном изображении полипептида С5а мыши, который использовали для идентификации NOX-D19, NOX-D20, NOX-D21 и других молекул нуклеиновой кислоты в соответствии с настоящим изобретением.

Связывание с С5 может влиять на фармакокинетику вследствие ожидаемого низкого выведения крупного белка С5 и опубликованной концентрации в плазме 350-390 нМ. Связывание с С5 также может влиять на фармакодинамику. С5 связывается связывающими С5а молекулами нуклеиновой кислоты, такими как NOX-20 и NOX-D21, и, таким образом, С5а уже блокируется шпигельмером до его высвобождения и может приводить к передаче сигнала рецептором.

Пример 2: Синтез и преобразование аптамеров и шпигельмеров

Мелкомасштабный синтез

Аптамеры (нуклеиновые кислоты D-РНК) и шпигельмеры (нуклеиновые кислоты L-РНК) получали твердофазным синтезом с помощью устройства для синтеза ABI 394 (Applied Biosystems, Foster City, CA, США) с использованием 2'TBDMS РНК-фосфорамидитного химического соединения (Damha and Ogilvie, 1993). rA(N-Bz)-, rC(Ac)-, rG(N-ibu)- и rU-фосфорамидиты в D- и L-конфигурации приобретали от ChemGenes, Wilmington, MA. Аптамеры и шпигельмеры очищали гель-электрофорезом.

Крупномасштабный синтез с модификацией

Шпигельмеры получали твердофазным синтезом с помощью устройства для синтеза AktaPilotlOO (Amersham Biosciences; General Electric Healthcare, Freiburg) с использованием 2'TBDMS РНК-фосфорамидитного химического соединения (Damha and Ogilvie, 1993). L-rA(N-Bz)-, L-rC(Ac)-, L-rG(N-ibu)- и L-rU-фосфорамидиты приобретали от ChemGenes, Wilmington, MA. 5'-амино-модификатор приобретали от American International Chemicals Inc. (Framingham, MA, США). Синтез немодифицированного или 5'-амино-модифицированного шпигельмера начинали на модифицированном посредством L-рибо-С, L-рибо-С, L-рибо-А или L-рибо-U CPG с размером пор 1000 A (Link Technology, Glasgow, Великобритания). Для присоединения (15 мин на цикл) использовали 0,3 М бензилтиотетразол (CMS-Chemicals, Abingdon, Великобритания) в ацетонитриле и 3,5 эквивалентов соответствующего 0,1 М раствора фосфорамидита в ацетонитриле. Использовали цикл окисления-кэпирования. Дополнительные стандартные растворители и реагенты для олигонуклеотидного синтеза приобретали от Biosolve (Valkenswaard, NL). Синтезировали шпигельмер DMT-ON; после удаления защитной группы его очищали посредством препаративной ОФ-ВЭЖХ (Wincott et al., 1995) с использованием среды Sourcel5RPC (Amersham). 5'DMT-группу удаляли 80% уксусной кислотой (30 мин при RT(KT)). Затем добавляли водный 2 М раствор NaOAc, и шпигельмер обессоливали тангенциальной проточной фильтрацией с использованием регенерированной целлюлозной мембраны 5 K (Millipore, Bedford, MA).

Пегилирование шпигельмеров

Для, продления времени нахождения шпигельмера в плазме in vivo, шпигельмеры ковалентно связывали с частью полиэтиленгликоля (PEG) размером 40 кДа на 5'-конце.

Для пегилирования (для технических деталей способа пегилирования см. патентную заявку Европы ЕР 1306382) очищенный 5'-аминомодифицированный шпигельмер растворяли в смеси H2O (2,5 мл), DMF (5 мл) и буфера А (5 мл; полученной смешиванием лимонной кислоты ⋅ Н2O [7 г], борной кислоты [3,54 г], фосфорной кислоты [2,26 мл] и 1 М NaOH [343 мл] и добавлением H2O до конечного объема 1 л; рН=8,4, доводили с помощью 1 М НСl).

рН раствора шпигельмера доводили до 8,4 с помощью 1 М NaOH. Затем каждые 30 мин добавляли сложный эфир PEG-NHS массой 40 кДа (Nektar Therapeutics, Huntsville, AL) в шести порциях по 0,25 эквивалентов при 37°C до достижения максимального выхода от 75 до 85%. рН реакционной смеси в процессе добавления сложного эфира PEG-NHS держали при 8-8,5 с помощью 1 М NaOH.

Реакционную смесь смешивали с 4 мл раствора мочевины (8 М) и 4 мл буфера В (0,1 М ацетат триэтиламмония в H2O) и нагревали до 95°C в течение 15 мин. Затем пегилированный шпигельмер очищали посредством ОФ-ВЭЖХ со средой Source 15RPC (Amersham), с использованием градиента ацетонитрила (буфер В; буфер С: 0,1 М ацетат триэтиламмония в ацетонитриле). Избыток PEG элюировали при 5% буфере С, пегилированный шпигельмер - при 10-15% буфере С.Фракции продукта с чистотой >95% (как оценивают по ВЭЖХ) комбинировали и смешивали с 40 мл 3 М NaOAC. Пегилированный шпигельмер обессоливали тангенциальной проточной фильтрацией (регенерированная целлюлозная мембрана 5 К, Millipore, Bedford МА).

Пример 3: Определение констант связывания для аптамеров в отношении С5а (анализ "pull-down")

Прямой анализ "pull-down"

Аффинность связывающих С5а нуклеиновых кислот измеряли по связыванию аптамеров (нуклеиновые кислоты D-РНК) с биотинилированным D-C5a мыши (SEQ. ID. 89) в формате анализа "pull down" при 37°C. Аптамеры метили по 5'-фосфату Т4-полинуклеотидкиназой (Invitrogen) с использованием [γ-32P]-меченного АТР (Hartmann Analytic, Braunschweig, Германия). Удельная радиоактивность меченых аптамеров составляла 200000-800000 cpm/пмоль. Анализы осуществляли в буфере для селекции (20 мМ Tris-HCl рН 7,4; 150 мМ Nad; 5 мМ KCl; 1 мМ MgCl2; 1 мМ CaCl2; 4 Е/мл ингибитора РНКаз (RNaseOUT, Invitrogen); 0,1% [масс./об.] Tween-20), дополненном 50 мкг/мл бычьего сывороточного альбумина (Sigma) и 10 мкг/мл неспецифического шпигельмера для предотвращения адсорбции партнеров по связыванию на поверхностях используемых пластмассовых изделий или матрицы для иммобилизации). Аптамеры инкубировали после денатурации и ренатурации в концентрации 0,2-1 нМ при 37°C в буфере для селекции вместе с различными количествами биотинилированного D-С5а мыши в течение 3-4 часов для достижения равновесия при низких концентрациях. Диапазон концентраций биотинилированного D-C5a составлял от 640 пМ до 10 мкМ; общий объем реакции составил 80-200 мкл. Биотинилированный D-C5a мыши и комплексы аптамера и биотинилированного D-C5a мыши иммобилизовывали на 5-мкл частицах NeutrAvidin Agarose Plus (Pierce Biotechnology), которые были предварительно уравновешены буфером для селекции. Частицы держали в суспензии в течение 30 мин при 37°C в термомиксере. Иммобилизованную радиоактивность количественно определяли в сцинтилляционном счетчике после удаления супернатанта и соответствующего промывания. Процент связывания наносили на график против концентрации биотинилированного D-C5a мыши, и константы диссоциации получали с использованием алгоритмов программного обеспечения (GraphPad Prism), исходя из стехиометрии 1:1.

Конкурентный анализ "pull-down"

Для сравнения различных связывающих D-C5a нуклеиновых кислот проводили конкурентный анализ с ранжированием. Для этой цели наиболее аффинный доступный аптамер метили радиоактивной меткой (см. выше) и он служил в качестве эталона. После денатурации и ренатурации его инкубировали в буфере для селекции при 37°C с биотинилированным D-C5a мыши в условиях, которые приводили приблизительно к 5-10% связыванию с биотинилированным D-C5a мыши после иммобилизации и промывания 4 мкл на частицах NeutrAvidin Agarose Plus (Pierce Biotechnology) без конкуренции. Добавляли избыток денатурированных и ренатурированных немеченых вариантов D-РНК-аптамеров в концентрациях в диапазоне 9 пМ-400 нМ с меченым эталонным аптамером для параллельных реакций связывания; общий объем реакционной смеси составлял 160-400 мкл. После инкубации в течение 3-4 часов биотинилированный D-C5a мыши и комплексы аптамера и биотинилированного D-C5a мыши иммобилизовывали и проводили анализы, как описано выше. Аптамеры, подлежащие тестированию, конкурировали с эталонным аптамером за связывание мишени, таким образом, снижая сигнал связывания в зависимости от их связывающих характеристик. Аптамер, который был выявлен в качестве наиболее активного в этом анализе, затем мог служить в качестве нового эталона для сравнительных анализов других вариантов аптамеров.

Пример 4: Измерение с использованием Biacore связывания шпигельмеров с С5а и родственными пептидами

Устройство было установлено на поддержание температуры 37°С. Устройство Biacore 2000 очищали с использованием способа DESORB перед началом каждого эксперимента/иммобилизации на новом чипе. После установки поддерживающего чипа, устройство последовательно обрабатывали раствором для десорбции 1 (0,5% додецилсульфат натрия, SDS), раствором для десорбции 2 (50 мМ глицин, рН 9,5) и буфером HBS-EP. Наконец, систему обрабатывали буфером HBS-EP.

Для экспериментов Biacore связывающие С5а шпигельмеры приготавливали в стерильной воде, и они имели концентрацию 100 мкМ.

Чип СМ5 обрабатывали буфером HBS-EP и уравновешивали до тех пор, пока не наблюдали стабильный исходный уровень. Иммобилизацию на проточных ячейках проводили, начиная с проточной ячейки 4 по проточную ячейку 1. 100 мкл смеси 1:1 0,4 М EDC и 0,1 М NHS инжектировали с использованием команды QUICKINJECT при скорости потока 10 мкл/мин. Мониторинг активации проточной ячейки проводили по увеличению RU после инжекции NHS/EDC (как правило, 150-500 RU для чипов СМ5). Растворы 0,1-1 мкг/мл в 10 мМ NaAc pH5,5 для С5а или 10 мМ NaAc pH5,5 для С5 человека переносили во флакон и инжектировали с использованием команды MANUALINJECT при скорости потока 10 мкл/мин. 1000-3000 RU иммобилизовывали на чипе. Затем все проточные ячейки блокировали путем инжекции 70 мкл 1 М гидрохлорида этаноламина, рН 8, при скорости потока 10 мкл/мин. Инжекцию 30 мкл регенерирующего раствора (1 М NaCl) при скорости потока 30 мкл/мин проводили для удаления неспецифически связавшегося белка с поверхности чипа.

Параметры кинетики и константы диссоциации оценивали посредством серии инжекций шпигельмера при концентрациях 2000-1000-500-200-125-62,5-31,3-15,6(2х)-7,8-3, 9-1,95-0,98-0,48-0,24-0,12-0 нМ, разбавленного в подвижном буфере, начиная с наиболее низкой концентрации. Во всех экспериментах анализ проводили при 37°C с использованием команды Kinject, определяющей время ассоциации 240 и время диссоциации 240 секунд при скорости потока 30 мкл/мин. Анализ проводили с двумя эталонами, в то время как FC1 служил в качестве (блокированного) контроля поверхности (совокупный вклад каждой концентрации шпигельмера) и серия инжекций буфера без анализируемого соединения определяла объемное распределение самого буфера. По меньшей мере одну концентрацию шпигельмера инжектировали два раза для мониторинга эффективности регенерации и целостности чипа в ходе экспериментов. Регенерацию проводили путем инжекций 60 мкл 1 М NaCl при скорости потока 30 мкл/мин. Время стабилизации исходного уровня после каждого цикла регенерации было установлено на 1 мин при 30 мкл/мин.

Анализ данных и вычисление констант диссоциации (KD) проводили с помощью программного обеспечения BIAevaluation 3.1.1 (BIACORE AB, Uppsala, Швеция) с использованием модифицированного алгоритма стехиометрической аппроксимации Ленгмюра 1:1 с постоянным RI и оценкой переноса масс с коэффициентом переноса массы kt 1×107 [RU/M*c].

Пример 5: Определение ингибиторной концентрации в анализе хемотаксиса

Получение клеточной линии, экспрессирующей рецептор человека для С5а

Стабильно трансфицированную клеточную линию, экспрессирующую рецептор человека для С5а, получали путем трансфекции про-В-клеток мыши BA/F3 плазмидой, кодирующей рецептор С5а человека (номер доступа NCBI NM_001736 в pcDNA3.1+). Клетки, экспрессирующие C5aR, отбирали путем обработки генетицином и исследовали в отношении экспрессии с помощью ОТ-ПЦР и в отношении функциональности с помощью анализа хемотаксиса.

Анализ хемотаксиса

За сутки до эксперимента клетки высевали в новый флакон в количестве 0,3×106/мл. Для эксперимента клетки центрифугировали, промывали один раз в НВН (HBSS, содержащий 1 мг/мл бычьего сывороточного альбумина и 20 мМ HEPES) и ресуспендировали в количестве 1,33×106 клеток/мл. 75 мкл этой суспензии добавляли в верхние отделы 96-луночного планшета Corning Transwell Plate с порами размером 5 мкм (Costar Corning, #3388; NY, США). В нижних компартментах рекомбинантный С5а человека (SEQ. ID. 50) или С5а мыши (SEQ. ID. 54) предварительно инкубировали вместе со шпигельмерами в различных концентрациях в 235 мкл НВН при 37°C в течение от 20 до 30 мин перед добавлением клеток. Клеткам позволяли мигрировать при 37°C в течение 3 часов. После этого планшет-вставку (верхние отделы) удаляли и в нижние отделы добавляли 30 мкл 440 мкМ резазурина (Sigma, Deisenhofen, Германия) в фосфатно-солевом буфере. После инкубации при 37°C в течение 2,5 часов флуоресценцию измеряли при длине волны возбуждения 544 нм и длине волны испускания 590 нм.

В величины флуоресценции вносили поправку на фоновую флуоресценцию (без С5а в лунке) и наносили на график против концентрации шпигельмера. Величины IC50 определяли с нелинейной регрессией (4-параметрическая аппроксимация) с использованием GraphPad Prism. Альтернативно, величину для образца без шпигельмера (только С5а) устанавливают на 100% и величины для образцов со шпигельмером вычисляют в качестве процента этого. Процентные величины наносят на график против концентрации шпигельмера и величины IC50 определяют, как описано выше.

Определение полумаксимальной эффективной концентрации (EC50) для С5а человека и мыши

После миграции в течение 3 часов клеток BA/F3/huC5aR в направлении различных концентраций С5а человека или С5а мыши, получали кривые доза-ответ для С5а человека и мыши, показавшие половинные эффективные концентрации (EC50) 0,1 нМ в отношении huC5a и 0,3 нМ для mС5а. Для экспериментов по ингибированию хемотаксиса шпигельмерами использовали 0,1 нМ С5а человека и 0,3 нМ С5а мыши.

Пример 6: Ингибирование индуцированной С5а активации первичных нейтрофилов человека

Выделение PMN человека

Полиморфноядерные лейкоциты (PMN) выделяли из цельной крови путем непрерывного градиентного центрифугирования при комнатной температуре. Взятие крови проводили в пробирки для взятия крови, содержащие кислую цитратную декстрозу (Sarstedt). Декстран 500 (Accurate Chemical) добавляли до конечной концентрации 2% масс./об. и кровь/декстран наслаивали на Histopaque (1,077 г/мл, Sigma). После центрифугирования всю жидкость и клетки выше поверхности градиента отбрасывали. Осадок и приблизительно 80% оставшейся жидкости над ним собирали и разбавляли 1:1 смесью Voluven 80% об./об. (Fresenius Kabi), PBS 16% об./об. (Sigma) и ACD 4% об./об. (Sigma). Смесь центрифугировали при 400 об/мин в течение 15 минут. Супернатант собирали и центрифугировали при 1000 об/мин в течение 7 минут. Осадок осторожно ресуспендировали и оставшиеся эритроциты удаляли путем лизиса.

Ингибирование индуцированного С5а хемотаксиса PMN человека

С5а человека (1 нМ) предварительно инкубировали с указанными концентрациями NOX-D19 или NOX-D20 в HBSS+0,01% BSA+25 мМ HEPES в нижней камере планшета для хемотаксиса. Нейтрофилы человека добавляли в верхние камеры планшета для хемотаксиса и хемотаксис проводили в течение 25 мин при 37°C и 5% CO2. После инкубации верхнюю камеру приспосабливали к белому люминесцентному планшету, содержащему аккутазу, для сбора клеток, связавшихся с нижней частью сита для хемотаксиса. Добавляли реагент Glo (Promega) и уравновешивали в течение 10 мин. Люминесценцию измеряли с использованием устройства для считывания планшетов Biotek Synergy 2.

Ингибирование индуцированного С5а высвобождения эластазы из PMN человека

Нейтрофилы человека обрабатывали TNFα (10 нг/мл) и цитохалазином В (5 мкг/мл) в течение 30 минут при 37°C, 5% СO2. Клетки стимулировали в течение 45 мин посредством С5а человека (30 нМ), который предварительно инкубировали с NOX-D1 или NOX-D20 в указанных концентрациях. Затем клетки отделяли центрифугированием и 25 мкл супернатанта инкубировали с субстратом эластазы (Calbiochem) в Tris-HCl 0,1 М, рН 7,4, в течение 1 ч при 37°C, причем данные считывания получали при поглощении при 405 нм каждые 5 минут. Данные кинетики анализировали для определения Vmax для каждого образца. Для каждого образца вычисляли средний процент активности эластазы относительно контроля (фоновое значение не вычитали).

Результаты

NOX-D19 и NOX-D20 эффективно ингибируют активацию свежевыделенных PMN периферической крови человека посредством С5а. 10 нМ NOX-D19 или NOX-D20 было достаточно для блокирования более 85% индуцированного huC5a хемотаксиса PMN человека (фиг. 13А). Индуцированное HuC5a высвобождение противомикробной эластазы эффективно ингибировалось посредством NOX-D19 и NOX-D20 (фиг. 13В). 30 нМ NOX-D19 или NOX-D20 подавляли приблизительно 50% индуцированного С5а высвобождения эластазы. Следует отметить, что по причинам стехиометрии чувствительность этого анализа ограничена до IС50=15 нМ, поскольку высвобождение эластазы индуцируется посредством 30 нМ huC5a.

Пример 7: Связывающие С5а нуклеиновые кислоты не препятствуют комплементзависимому гемолизу

Конечным продуктом каскада комплемента является мембраноатакующий комплекс (MAC) - пора, состоящая из С5b-9. Полагают, что MAC встраивается в цитоплазматические мембраны патогенов и уничтожает их путем индукции выхода цитоплазмы.

Было показано, что связывающие С5а нуклеиновые кислоты (шпигельмеры), описанные в настоящем описании, распознают С5а в контексте С5 (см. пример 1, фиг. 9 и фиг. 10). Таким образом, исследовали, ингибируется ли расщепление С5 на анафилатоксин С5а и С5b, который является частью MAC, этими шпигельмерами. Это осуществляли с использованием теста комплементзависимого гемолиза эритроцитов овцы.

Способы

Восстановленную лиофилизированную сыворотку человека ("Human Complement Serum" (Sigma Aldrich, Германия)) предварительно инкубировали с пегилированными шпигельмерами NOX-D19, NOX-D20 и NOX-D21 в диапазоне от 10 нМ до 10000 нМ в 96-луночных планшетах (планшет Nunc-Immuno™, MaxiSorp Surface™). В качестве положительного контроля использовали связывающий С5 аптамер С5С6 с максимальным замещением 2'ОМе-пуринами и 2'-фторпиримидинами (Biesecker et al. 1999) (синтезированный в собственной лаборатории), который ингибирует расщепление С5 в том же диапазоне концентраций. В качестве контроля потенциальных неспецифических эффектов шпигельмера на анализируемые пегилированные шпигельмеры с обратной последовательностью NOX-D19 и NOX-D21, включали revNOX-D19 и revNOX-D21. Ранее было показано, что revNOX-D19 и revNOX-D21 ингибируют С5а в Biacore и клеточных анализах. После инкубации в течение 1 часа при 37°C эритроциты овцы, опсонизированные антителами кролика против антител овцы, известные как гемолитическая система (Institut Virion/Serion GmbH, Германия), добавляли в предварительно инкубированную смесь ингибиторов комплемента сыворотки. Комплемент активируется через классический путь, что приводит к расщеплению С5 на С5а и С5b. Затем С5b ассоциирует с С6-С9 с образованием лизирующего мембраноатакующего комплекса (MAC). Гемолиз эритроцитов овцы вследствие образования MAC определяли через 30 мин посредством колориметрического измерения после центрифугирования неизмененных клеток. Чем более высокой является степень гемолиза, тем более высоким является поглощение при 405 нм (измеренное в устройстве для считывания планшетов Fluo Star).

Результаты

Аптамер С5С6 ингибировал комплементзависимый лизис эритроцитов овцы с IC50 приблизительно 1 мкМ (фиг. 14А, В). Исследованные шпигельмеры, а именно, связывающие С5 и С5а нуклеиновые кислоты NOX-D19 и NOX-D20 (фиг. 14А) и NOX-D21 (фиг. 14В) и не связывающие С5 или С5а шпигельмеры revNOX-D19 (фиг. 14А) и revNOX-021 (фиг. 14В), не ингибировали гемолиз.

Обсуждение

Было показано, что связывающие С5а шпигельмеры не ингибируют образование MAC и, таким образом, являются селективными антагонистами только С5а. При использовании в медицине это может быть преимущественным, поскольку ингибирование образования MAC может нарушить механизм защиты организма от вторгающихся патогенов, а именно, грамотрицательных бактерий.

Пример 8: Связывающая С5а нуклеиновая кислота NOX-D19 демонстрирует эффективность в модели полимикробного сепсиса путем лигирования и прокола слепой кишки у мышей

Эффект внутрибрюшинных инъекций NOX-D19 на течение полимикробного сепсиса исследовали в модели" лигирования и прокола слепой кишки (CLP) на грызунах.

Способы

Модель на животных

Для исследования использовали самцов мышей C57BL/6 в возрасте 10-12 недель (Charles River Laboratories, Германия). Перитонит хирургически индуцировали под легкой анестезией изофлураном. Осуществляли разрезы в левом верхнем секторе брюшной полости (обычное положение слепой кишки). Слепую кишку обнажали и вокруг слепой кишки помещали плотную лигатуру со швами дистальней вхождения тонкой кишки (лигировали 75%). Одну рану путем прокола наносили с помощью шприца калибра 24 в слепой кишке и небольшие количества содержимого слепой кишки выдавливали через рану. Слепую кишку помещали обратно в брюшную полость и область лапаротомии закрывали. В качестве замещения жидкости подкожно вводили 500 мкл солевого раствора. Имитирующих животных подвергали той же процедуре, за исключением лигирования и прокола слепой кишки. Наконец, всех животных возвращали в их клетки со свободным доступом к пище и воде.

Исследуемые группы

Исследовали 4 группы (n=6 мышей для имитирующей хирургической операции и n=10 мышей для группы с хирургической операцией CLP): (1) имитирующая хирургическая операция с введением носителя (солевой раствор), (2) хирургическая операция CLP с введением носителя, (3) хирургическая операция CLP с введением низкой дозы NOX-D19 (1 мг/кг) и (4) хирургическая операция CLP с введением высокой дозы NOX D19 (10 мг/кг). Использовали слепой способ исследования для исследователей в отношении стратегии введения, и они не знали, какое соединение содержит носитель, а какое является настоящим. Введение проводили внутрибрюшинным путем каждые сутки в течение 6 суток, начиная с момента хирургической операции CLP.

Выживаемость

Наблюдение проводили в течение 7 суток в каждой группе. Мониторинг мышей проводили каждые сутки и кривые выживаемости Каплана-Мейера строили с использованием программного обеспечения GraphPad Prism 4.

Взятие крови

Образцы крови получали под легкой анестезией простым эфиром из кавернозного синуса с капиллярами перед хирургической операцией (исходный уровень, сутки - 4) и на 1 сутки после хирургической операции, чтобы позволить измерение стандартных сывороточных маркеров острого повреждения почек (креатинин сыворотки и азот мочевины крови, BUN) и острой печеночной недостаточности (аланинаминотрансфераза сыворотки, ALT сыворотки). Уровень аспартатаминотрансферазы (AST сыворотки) измеряли в сыворотке в качестве маркера полиорганной недостаточности. Измерение клинических химических параметров проводили на анализаторе Olympus (AU400).

Статистика

Статистическую значимость вычисляли с помощью Т-критерия Стьюдента. Для выживаемости строили кривые Каплана-Мейера и получали логарифмический ранговый критерий значимости. Использовали программное обеспечение GraphPad Prism 4.

Результаты

Выживаемость

Как и ожидалось, отсутствовала смертность у животных с имитирующей хирургической операцией без CLP (фиг. 15). У мышей, которым проводили хирургическую операцию CLP и вводили только носитель, средняя выживаемость составляла 1,5 суток. Введение NOX-D19 после хирургической операции CLP увеличивало среднюю выживаемость (фиг. 15). Мыши, которым вводили низкую дозу NOX-D19 (1 мг/кг), продемонстрировали наиболее длительную среднюю выживаемость (5 суток, р<0,0001 против носителя). Мыши, которым вводили высокую дозу NOX-D19 (10 мг/кг) имели среднюю выживаемость 3 суток, которая была значительно более длительной, чем у мышей, которым вводили носитель (р=0,0401), однако не отличалась значительно от введения низкой дозы NOX-D19 (р=0,4875). 100% мышей в группе носителя погибли в течение 4 суток после хирургической CLP операции. 100% и 90% смертность была достигнута не ранее чем через 7 суток у мышей, которым вводили низкую и высокую дозу NOX-D19, соответственно (фиг. 15).

Клиническая химия

Функция почек

Концентрация креатинина в сыворотке и азот мочевины в крови (BUN) являются параметрами функции почек. Функцию почек оценивали до начала исследования (сутки -4) и на 1 сутки после хирургической операции CLP.

На 1 сутки CLP индуцировала значительное увеличение уровней креатинина в сыворотке в группе мышей, которым вводили носитель. Введение низкой дозы NOX-D19 (1 мг/кг) предотвращало это увеличение (фиг. 16А). У мышей, которым вводили высокую дозу NOX-D19 (10 мг/кг), наблюдали умеренное, но статистически незначимое увеличение уровней креатинина в сыворотке (р=0,1873 против носителя) (фиг. 16А).

BUN (фиг. 16В), который является более чувствительным параметром функции почек, чем креатинин, был значительно увеличен на 1 сутки после хирургической операции CLP у мышей, которым вводили носитель. Введение мышам низкой и высокой дозы NOX-D19 значительно подавляло увеличение BUN при CLP (фиг. 16В).

Функция печени

Наиболее надежным маркером гепатоцеллюлярного повреждения или некроза является уровень аланинаминотрансферазы в сыворотке (ALT в сыворотке). Все группы продемонстрировали увеличение ALT в сыворотке на 1 сутки после хирургической операции CLP. Однако обе группы мышей с сепсисом, в которых вводили NOX-D19, продемонстрировали улучшенную функцию почек по сравнению с мышами, которым вводили носитель (фиг. 17А).

Полиорганная недостаточность

Уровень аспартатаминотрансферазы в сыворотке (AST в сыворотке) (фиг. 17В) измеряли в качестве маркера полиорганной недостаточности, поскольку было показано, что AST повышается при заболеваниях, поражающих другие органы, помимо печени, таких как инфаркт миокарда, острый панкреатит, острая гемолитическая анемия, тяжелые ожоги, острое заболевание почек, заболевания скелетных мышц и травма.

Аналогично ALT, все группы продемонстрировали увеличение уровней AST на 1 сутки после хирургической операции CLP (р<0,001 против имитации). Однако, аналогично функции печени, обе группы мышей с сепсисом, которым вводили NOX-D19, продемонстрировали менее выраженные уровни AST по сравнению с мышами, которым вводили носитель (фиг. 17В).

Пример 9: Усовершенствованная связывающая С5а нуклеиновая кислота NOX-D20 демонстрирует эффективность в модели полимикробного сепсиса с помощью лигирования и прокола слепой кишки у мышей

Эффект внутрибрюшинных инъекций NOX-D20 на течение полимикробного сепсиса исследовали в модели лигирования и прокола слепой кишки (CLP) у грызунов.

Способы

Модель на животных

Полимикробный сепсис индуцировали у самцов мышей C57BL/6 в возрасте 10-12 недель (Charles River Laboratories, Германия), как описано в примере 8, с лигированием 60-75% слепой кишки.

Выживаемость

Наблюдение проводили в течение 7 суток в каждой группе. Мониторинг мышей проводили каждые сутки и кривые выживаемости Каплана-Мейера строили с использованием программного обеспечения GraphPad Prism 4.

Исследуемые группы

Исследовали 5 групп (n=5 мышей для имитирующей хирургической операции и n=10 мышей на группу для хирургической операции CLP): (1) имитирующая хирургическая операция с введением носителя (солевой раствор), (2) хирургическая операция CLP с введением носителя, (3) хирургическая операция CLP с ежедневным введением низкой дозы NOX-D20 (1 мг/кг), (4) хирургическая операция CLP с каждодневным введением высокой дозы NOX-D20 (3 мг/кг) и (5) хирургическая операция CLP с однократной низкой дозой NOX-D20 (1 мг/кг) после хирургической операции с последующим ежедневным введением носителя. Использовали слепой способ исследования для исследователей в отношении стратегии введения, и они не знали, какое соединение содержит носитель, а какое является настоящим. Путь введения был внутрибрюшинным.

Клинические химические параметры и параметры воспаления

Образцы крови получали, как описано в примере 8, под легкой анестезией простым эфиром из кавернозного синуса с капиллярами на 1 сутки после хирургической операции. Измеряли стандартные сывороточные маркеры острого повреждения почек (креатинин в сыворотке и азот мочевины в крови, BUN), острой печеночной недостаточности (ALT сыворотки) и эндотелиального повреждения (лактатдегидрогеназа сыворотки, LDH сыворотки). Перитонеальный лаваж (PL) проводили с использованием 3 мл PBS. Объем собранной жидкости PL измеряли в каждом образце, и общее количество клеток оценивали с использованием гемоцитометра (Neubauer Zaehlkammer, Gehrden, Германия). Уровни в сыворотке и PL фактора некроза опухоли-альфа (TNF-α), интерлейкина-6 (IL-6) и CCL2 (= хемоаттрактантный белок макрофагов-1, МСР-1) количественно определяли с помощью проточного цитометрического анализа на основе гранул (набор СВА, BD Biosciences, Heidelberg, Германия). Концентрации в сыворотке и PL CXCL1 (= хемоаттрактант кератиноцитов, КС) и CXCL2 (= воспалительный белок макрофагов 2, MIP-2) определяли с помощью ELISA (R&D Systems, Wiesbaden, Германия). Дифференциальный подсчет клеток в PL проводили на окрашенных гематоксилином и эозином (Н&Е) центрифугированных клетках (cytospin4, Thermo Scientific).

Повышение проницаемости капилляров

Сразу после хирургической операции CLP внутривенно инъецировали 0,25% масс./об. Evans blue (200 мкл). Через 18 ч мышей умерщвляли и проводили PL, как описано выше. Концентрации красителя Evans Blue в сыворотке и жидкостях PL измеряли спектрофотометрически при 620 нм. Следующую формулу использовали для поправки оптической плотности на контаминацию пигментами гема: Е620 (с поправкой)=Е620 (исходный) - (Е405 (исходный) × 0,014). Экссудацию плазмы количественно определяли как соотношение экстинкции в жидкости PL и экстинкции в плазме.

Статистика

Статистическую значимость вычисляли с помощью одностороннего ANOVA и критерия Даннетта. Для выживаемости использовали логарифмический ранговый критерий значимости. Использовали программное обеспечение GraphPad Prism 4.

Результаты

Выживаемость

Как и ожидалось, отсутствовала смертность у мышей после имитирующей хирургической операции в течение 7 суток после операции (фиг. 18). У мышей с CLP, которым вводили носитель, средняя выживаемость составила 3 суток. Введение мышам каждые сутки 1 мг/кг NOX-D20 значительно продлевало выживаемость до 7 суток (р=0,0043 против носителя). Увеличение дозировки до 3 мг/кг NOX-D20 не имело дополнительного защитного эффекта со сходной средней выживаемостью 6,5 суток (р=0,0092 против носителя). Примечательно, что однократная инъекция 1 мг/кг NOX-D20 после хирургической операции CLP была настолько же эффективной, как и каждодневное введение, и значимо продлевала среднюю выживаемость до 6,5 суток (фиг. 18). В то время как 100% мышей в группе введения носителя погибают в течение 5 суток, 30-40% мышей, которым вводили NOX-D20, все еще были живы в конце эксперимента на 7 сутки (фиг. 18).

Функция органов

Системное воспаление часто вызывает полиорганную недостаточность. Увеличенные уровни в сыворотке креатинина и BUN являются параметрами сниженной скорости гломерулярной фильтрации и почечной недостаточности. Оба параметра были значительно увеличены у мышей, которым вводили носитель, через одни сутки после хирургической операции CLP по сравнению с имитирующими мышами. Введение NOX-D20 эффективно препятствовало увеличению обоих маркеров, что подразумевает защитный эффект NOX-D20 на функцию почек (фиг. 19А, В). Аланинаминотрансфераза (ALT) является общим маркером гепатоцеллюлярного повреждения и некроза, и индуцированный CLP сепсис был ассоциирован с увеличенными уровнями ALT в сыворотке. Мыши, которым вводили NOX-D20, продемонстрировали значительно сниженные уровни ALT в сыворотке по сравнению с мышами, которым вводили носитель, что указывает на улучшенную функцию печени (фиг. 19С). Увеличенные уровни в сыворотке лактатдегидрогеназы (LDH) встречаются после повреждения тканей, и, таким образом, они являются общим маркером недостаточности органов. Увеличение уровней LDH, вызванное CLP, эффективно блокировалось посредством NOX-D20 (фиг. 20А). Разрушение эндотелиального барьера и формирование отека являются распространенным фатальным событием при сепсисе. Индукция сепсиса приводила к двукратному увеличению относительной экстравазации белков плазмы в брюшную полость у мышей, которым вводили носитель, по сравнению с мышами с имитирующей операцией. Введение NOX-D20 значительно ингибировало повышение проницаемости капилляров (фиг. 20В). Для всех параметров, исследованных в данном примере, 1 мг/кг NOX-D20 было достаточно для значительного улучшения функции органов, которое отражается увеличенной выживаемостью мышей, которым вводили NOX-D20.

Воспаление

Операция CLP приводила к выраженной локальной и системной активации провоспалительных цитокинов и хемокинов. Блокада С5а посредством NOX-D20 эффективно снижала концентрации TNFα, IL-6, CCL2, CXCL1 и CXCL2 в брюшине и в сыворотке на 1 сутки после CLP. Активация этих хемокинов ассоциирована с привлечением полиморфноядерных лейкоцитов (PMN) в брюшину. Таким образом, ингибирование С5а посредством NOX-D20 ингибировало накопление PMN в брюшной полости (фиг. 20С). Аналогично, инфильтрация моноцитов блокировалась посредством NOX-D20.

Пример 10: Эффективность NOX-D21 в модели индуцированного ишемией/реперфузией острого повреждения почек

Эффект NOX-D21 на острое повреждение почек (AKI) исследовали в модели на грызунах повреждения почек при ишемии/реперфузии (IRI).

Способы

Модель на животных

Самцов мышей C57BL/6 в возрасте 12-15 недель (Charles River, Германия) подвергали анестезии с использованием изофлурана через маску на нос и помещали на спине на нагревающий столик для поддержания температуры тела приблизительно 32°C. Проводили срединный разрез и правую и левую сосудистые ножки почки зажимали с помощью зажима для микроаневризмы на 30 мин. После удаления зажима и наложения швов на кожу, мышей возвращали в клетки и подвергали мониторингу до полного пробуждения.

Исследуемые группы

Исследовали 3 группы (n=10 мышей на группу): (1) хирургическая операция IRI с введением носителя, (2) хирургическая операция IRI с введением низкой дозы NOX-D21 (1 мг/кг), (3) хирургическая операция IRI с введением высокой дозы NOX-D21 (10 мг/кг). Использовали слепой способ исследования для исследователей в отношении стратегии введения, и они не знали, какое соединение содержит носитель, а какое является настоящим. NOX-D21 вводили внутривенно за 1 ч до хирургической операции на d0, и в течение следующих 3 суток (d1-d3) его вводили внутрибрюшинно один раз в сутки.

Выживаемость

Наблюдение проводили в течение 14 суток. Кривые выживаемости Каплана-Мейера строили, и значимость определяли с использованием логарифмического рангового критерия с использованием программного обеспечения GraphPad Prism 4.

Результаты

Выживаемость значительно увеличивалась при введении высокой дозы NOX-D21 (фиг. 21). Введение низкой дозы NOX-D21 приводило к заметному, но, тем не менее, статистически незначимому увеличению выживаемости. В контрольной группе, в которой вводили только носитель, только одна мышь выжила до 14 суток. Введение NOX-D21 увеличивало процент выживших мышей до 45-55% (фиг. 21).

Ссылки

Полные библиографические данные документов, цитированных в настоящем описание, содержание которых включено в качестве ссылок, являются, если нет иных указаний, следующими.

Признаки настоящего изобретения, описанные в описании, формуле изобретения, списке последовательностей и/или чертежах, могут как по отдельности, так и в любом сочетании быть материалом для осуществления изобретения в его различных формах.

1. Молекула L-нуклеиновой кислоты, способная связываться с C5a человека, где молекула L-нуклеиновой кислоты содержит центральный участок нуклеотидов, где центральный участок нуклеотидов содержит нуклеотидную последовательность

5' AUGn1GGUGKUn2n3RGGGHUGUKGGGn4Gn5CGACGCA 3' [SEQ ID NO: 61], где

n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и

G, A, U, C, H, K и R являются рибонуклеотидами, и

dU, dG и dA являются 2'-дезоксирибонуклеотидами.

2. Молекула L-нуклеиновой кислоты по п.1, где центральный участок нуклеотидов содержит нуклеотидную последовательность, выбранную из группы:

a) 5' AUGn1GGUGUUn2n3AGGGUUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 62],

b) 5' AUGn1GGUGUUn2n3GGGGUUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 63],

c) 5' AUGn1GGUGUUn2n3AGGGUUGUUGGGn4Gn5CGACGCA 3' [SEQ ID NO: 64],

d) 5' AUGn1GGUGGUn2n3AGGGUUGUUGGGn4Gn5CGACGCA 3' [SEQ ID NO: 65],

e) 5' AUGn1GGUGGUn2n3GGGGUUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 66],

f) 5' AUGn1GGUGGUn2n3GGGGAUGUGGGGn4Gn5CGACGCA 3'[SEQ ID NO: 67], и

g) 5' AUGn1GGUGUUn2n3GGGGCUGUGGGGn4Gn5CGACGCA 3' [SEQ ID NO: 68],

где

n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и

G, A, U и C являются рибонуклеотидами, и

dU, dG и dA являются 2'-дезоксирибонуклеотидами.

3. Молекула L-нуклеиновой кислоты по любому из пп.1, 2, где центральный участок нуклеотидов состоит из рибонуклеотидов и 2'-дезоксирибонуклеотидов.

4. Молекула L-нуклеиновой кислоты по любому из пп.1, 2, где центральный участок нуклеотидов состоит из рибонуклеотидов.

5. Молекула L-нуклеиновой кислоты по любому из пп.1-4, где молекула L-нуклеиновой кислоты содержит в направлении 5'→3' первый концевой участок нуклеотидов, центральный участок нуклеотидов и второй концевой участок нуклеотидов, где

первый концевой участок нуклеотидов содержит от одного до пяти нуклеотидов и

второй концевой участок нуклеотидов содержит от одного до пяти нуклеотидов,

предпочтительно

первый концевой участок нуклеотидов содержит от трех до пяти нуклеотидов и

второй концевой участок нуклеотидов содержит от трех до пяти нуклеотидов,

более предпочтительно

первый концевой участок нуклеотидов содержит три нуклеотида и

второй концевой участок нуклеотидов содержит три нуклеотида.

6. Молекула L-нуклеиновой кислоты по п.5, где первый концевой участок нуклеотидов содержит нуклеотидную последовательность 5' Z1Z2Z3Z4G 3' и второй концевой участок нуклеотидов содержит нуклеотидную последовательность 5' Z5Z6Z7Z8Z9 3',

где

Z1 представляет собой G или отсутствует, Z2 представляет собой S или отсутствует, Z3 представляет собой S или отсутствует, Z4 представляет собой B или отсутствует, Z5 представляет собой C или dC, Z6 представляет собой V или отсутствует, Z7 представляет собой S или отсутствует, Z8 представляет собой S или отсутствует, Z9 представляет собой C или отсутствует, и

G, S, B, C, V являются рибонуклеотидами, и

dC представляет собой 2'-дезоксирибонуклеотид,

предпочтительно

a) Z1 представляет собой G, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой C, или

b) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

c) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

d) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует, или

e) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой C, или

f) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой C, или

g) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой C, или

h) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 отсутствует, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 представляет собой C, или

i) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

j) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

k) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 отсутствует, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 представляет собой S, Z9 отсутствует, или

l) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

m) Z1 отсутствует, Z2 представляет собой S, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует, или

n) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 отсутствует, Z5 представляет собой C, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

o) Z1 отсутствует, Z2 отсутствует, Z3 отсутствует, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 представляет собой S, Z8 отсутствует, Z9 отсутствует, или

p) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 представляет собой V, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует, или

q) Z1 отсутствует, Z2 отсутствует, Z3 представляет собой S, Z4 представляет собой B, Z5 представляет собой C или dC, Z6 отсутствует, Z7 отсутствует, Z8 отсутствует, Z9 отсутствует.

7. Молекула L-нуклеиновой кислоты по любому из пп.1, 2 и 4-6, где молекула L-нуклеиновой кислоты содержит нуклеотидную последовательность, выбранную из группы SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 90, или молекулы L-нуклеиновой кислоты, обладающей идентичностью по меньшей мере 85% с молекулой L-нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 90, или молекулы L-нуклеиновой кислоты, которая гомологична молекуле L-нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 90, где гомология составляет по меньшей мере 85%.

8. Молекула L-нуклеиновой кислоты по любому из пп.1-3 и 5, 6, где молекула L-нуклеиновой кислоты содержит нуклеотидную последовательность, выбранную из группы SEQ ID NO: 14, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 37, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 91 и SEQ ID NO: 92, или молекулы L-нуклеиновой кислоты, имеющей идентичность по меньшей мере 85% с молекулой L-нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы SEQ ID NO: 14, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 37, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 91 и SEQ ID NO: 92, или молекулы L-нуклеиновой кислоты, которая гомологична молекуле L-нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы 14, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 37, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 91 и SEQ ID NO: 92, где гомология составляет по меньшей мере 85%.

9. Молекула L-нуклеиновой кислоты по любому из пп.1-8, где молекула L-нуклеиновой кислоты способна связываться с C5a человека и C5a мыши.

10. Молекула L-нуклеиновой кислоты по любому из пп.1-9, где L-нуклеиновая кислота является антагонистом активности, опосредуемой C5a человека и/или мыши.

11. Молекула L-нуклеиновой кислоты по любому из пп.1-10, где молекула L-нуклеиновой кислоты содержит модифицирующую группу, где скорость экскреции молекулы L-нуклеиновой кислоты, содержащей модифицирующую группу, из организма снижена по сравнению с L-нуклеиновой кислотой, не содержащей модифицирующую группу.

12. Молекула L-нуклеиновой кислоты по любому из пп.1-10, где молекула L-нуклеиновой кислоты содержит модифицирующую группу, где молекула L-нуклеиновой кислоты, содержащая модифицирующую группу, имеет увеличенное время удержания в организме по сравнению с молекулой L-нуклеиновой кислоты, не содержащей модифицирующую группу.

13. Молекула L-нуклеиновой кислоты по любому из пп.11 и 12, где модифицирующая группа выбрана из группы, содержащей биодеградируемые и небиодеградируемые модификации, предпочтительно модифицирующая группа выбрана из группы, включающей полиэтиленгликоль, линейный полиэтиленгликоль, разветвленный полиэтиленгликоль, гидроксиэтилкрахмал, пептид, белок, полисахарид, стерин, полиоксипропилен, полиоксиамидат и поли-(2-гидроксиэтил)-L-глутамин.

14. Молекула L-нуклеиновой кислоты по любому из пп.1-13 для применения в способе лечения или предотвращения заболевания.

15. Молекула L-нуклеиновой кислоты по п.14, где заболевание ассоциировано с активацией комплемента и опосредуемыми C5a патогенными механизмами и/или выбрано из группы, включающей аутоиммунное заболевание, воспалительное заболевание, синдром системного воспалительного ответа, заболевание глаза, повреждение при ишемии/реперфузии, замедленное функционирование трансплантата, отторжение трансплантата, сердечно-сосудистое заболевание, респираторное заболевание, острые реакции, инфекционное заболевание, неврологическое заболевание, нейродегенеративное заболевание, фиброзное заболевание, гематологическое заболевание, метаболическое заболевание, опухоли и клинические осложнения, ассоциированные с активацией комплемента биоматериалами, предпочтительно синдром системного воспалительного ответа выбран из группы, включающей сепсис и вторичные повреждения при травме или тяжелых ожогах.

16. Фармацевтическая композиция для лечения или предотвращения заболевания, ассоциированного с активацией комплемента и опосредуемыми C5a патогенными механизмами, содержащая эффективное количество молекулы L-нуклеиновой кислоты по любому из пп.1-13 и необязательно дополнительный компонент, где дополнительный компонент выбран из группы, включающей фармацевтически приемлемый эксципиент, фармацевтически приемлемый носитель и фармацевтически активное вещество.

17. Фармацевтическая композиция по п.16, где указанное заболевание выбрано из группы, включающей аутоиммунное заболевание, воспалительное заболевание, синдром системного воспалительного ответа, заболевание глаза, повреждение при ишемии/реперфузии, замедленное функционирование трансплантата, отторжение трансплантата, сердечно-сосудистое заболевание, респираторное заболевание, острые реакции, инфекционное заболевание, неврологическое заболевание, нейродегенеративное заболевание, фиброзное заболевание, гематологическое заболевание, метаболическое заболевание, опухоли и клинические осложнения, ассоциированные с активацией комплемента биоматериалами, предпочтительно синдром системного воспалительного ответа выбран из группы, включающей сепсис и вторичные повреждения при травме или тяжелых ожогах.

18. Применение молекулы L-нуклеиновой кислоты по любому из пп.1-13 для изготовления лекарственного средства для лечения или предотвращения заболевания, ассоциированного с активацией комплемента и опосредуемыми C5a патогенными механизмами.

19. Применение молекулы L-нуклеиновой кислоты по любому из пп.1-13 для изготовления диагностического средства для диагностики заболевания, ассоциированного с активацией комплемента и опосредуемыми C5a патогенными механизмами.

20. Применение по п.18, где лекарственное средство предназначено для лечения и/или предотвращения аутоиммунного заболевания, воспалительного заболевания, синдрома системного воспалительного ответа, заболевания глаза, повреждений при ишемии/реперфузии, замедленной функции трансплантата, отторжения трансплантата, сердечно-сосудистого заболевания, респираторного заболевания, острых реакций, инфекционного заболевания, неврологического заболевания, нейродегенеративного заболевания, фиброзного заболевания, гематологического заболевания, метаболического заболевания, опухолей и клинических осложнений, ассоциированных с активацией комплемента биоматериалами, предпочтительно синдром системного воспалительного ответа выбран из группы, включающий сепсис и вторичные повреждения при травме или тяжелых ожогах.

21. Применение по п.19, где указанное диагностическое средство предназначено для диагностики заболевания, выбранного из группы, включающей аутоиммунное заболевание, воспалительное заболевание, синдром системного воспалительного ответа, заболевание глаза, повреждение при ишемии/реперфузии, замедленное функционирование трансплантата, отторжение трансплантата, сердечно-сосудистое заболевание, респираторное заболевание, острые реакции, инфекционное заболевание, неврологическое заболевание, нейродегенеративное заболевание, фиброзное заболевание, гематологическое заболевание, метаболическое заболевание, опухоли и клинические осложнения, ассоциированные с активацией комплемента биоматериалами, предпочтительно синдром системного воспалительного ответа выбран из группы, включающей сепсис и вторичные повреждения при травме или тяжелых ожогах.

22. Молекула L-нуклеиновой кислоты по любому из пп.1-13, указанная молекула нуклеиновой кислоты может образовывать комплекс с C5a, где указанный комплекс предпочтительно представляет собой кристаллический комплекс.

23. Применение молекулы L-нуклеиновой кислоты по любому из пп.1-13 для обнаружения C5a.

24. Способ скрининга антагониста C5a, включающий следующие стадии:

- предоставление кандидата в антагонисты,

- предоставление молекулы L-нуклеиновой кислоты по любому из пп.1-13,

- предоставление тест-системы, которая обеспечивает сигнал в присутствии антагониста C5a, где указанная тест-система выбрана из группы, включающей конкурентный анализ, анализ хемотаксиса и анализ расщепления C5a, и

- определение того, является ли кандидат в антагонисты антагонистом C5a, где указанный кандидат в антагонисты представляет собой антагонист, если он конкурирует в конкурентном анализе, если он ингибирует хемотаксис в анализе хемотаксиса, и если он ингибирует расщепление C5a в анализе расщепления C5a.

25. Набор для обнаружения C5a, где набор содержит молекулу L-нуклеиновой кислоты по любому из пп.1-13 и по меньшей мере листок с инструкцией или реакционную емкость.

26. Способ обнаружения L-нуклеиновой кислоты по любому из пп.1-13 в образце, где способ включает стадии:

a) предоставление улавливающего зонда, где улавливающий зонд по меньшей мере частично комплементарен первой части молекулы L-нуклеиновой кислоты по любому из пп.1-13, и зонда для обнаружения, где зонд для обнаружения по меньшей мере частично комплементарен второй части молекулы L-нуклеиновой кислоты по любому из пп.1-13, или, альтернативно, улавливающий зонд по меньшей мере частично комплементарен второй части молекулы L-нуклеиновой кислоты по любому из пп.1-13, и зонд для обнаружения по меньшей мере частично комплементарен первой части молекулы L-нуклеиновой кислоты по любому из пп.1-13;

b) добавление улавливающего зонда и зонда для обнаружения отдельно или в комбинации с образцом, содержащим молекулу L-нуклеиновой кислоты по любому из пп.1-13, или предположительно содержащим молекулу L-нуклеиновой кислоты по любому из пп.1-13;

c) обеспечение возможности улавливающему зонду и зонду для обнаружения реагировать либо одновременно, либо в любом порядке последовательно с молекулой L-нуклеиновой кислоты по любому из пп.1-13 или ее частью;

d) необязательно обнаружение того, гибридизуется ли улавливающий зонд с молекулой L-нуклеиновой кислоты по любому из пп.1-13, предоставленной на стадии a); и

e) обнаружение комплекса, образовавшегося на стадии c), состоящего из молекулы L-нуклеиновой кислоты по любому из пп.1-13 и улавливающего зонда и зонда для обнаружения.



 

Похожие патенты:

Изобретение относится к биотехнологии, в частности к композиции для ингибирования роста и стимуляции апоптоза клеток злокачественной опухоли колоректального рака путем блокирования функции генов МСМ4 и Livin.

Изобретение относится к генетической инженерии, в частности к генетически модифицированной свинье, которая является резистентной к инфекции вирусом репродуктивно-респираторного синдрома свиней (ВРРСС).

Изобретение относится к биотехнологии, конкретно к рекомбинантному получению белка теплового шока человека 70 (БТШ70), и может быть использовано для получения БТШ70 в молоке трансгенных животных.

Группа изобретений относится к среде для культивирования клеток млекопитающих, способу ее получения и способу продуцирования рекомбинантного полипептида с использованием указанной среды.

Изобретения касаются трехвалентной иммуногенной композиции, способа иммунизации, набора для осуществления такой иммунизации и способа получения иммуногенной композиции.

Представлен способ выявления ракового биомаркера у субъекта in vitro. Охарактеризованный способ включает получение от субъекта биологического образца; измерение уровня RISC-белка во фракции экзосом образца и/или активности процессинга первичной микроРНК или активности процессинга предшественника микроРНК во фракции экзосом образца и эталонного образца; идентификацию того, что субъект обладает раковым биомаркером, на основании (i) выявления RISC-белка во фракции экзосом образца, полученного от субъекта, или (ii) выявления активности процессинга микроРНК во фракции экзосом образца, которая отсутствует в эталонном образце.

Изобретения касаются молекулы нуклеиновой кислоты, кодирующей гомодимерный белок, гомодимерного белка, аминокислотной цепи, способной формировать гомодимерный белок, их применения для получения лекарственного средства, клетки-хозяина, фармацевтической и вакцинной композиций, способа получения гомодимерного белка или аминокислотной цепи и способа получения вакцины.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к способу получения белка с помощью микроорганизма. Настоящий способ включает введение экспрессионной конструкции в микроорганизм, которая содержит промотор и нуклеиновую кислоту, кодирующую белок, и экспрессию белка в микроорганизме.

Настоящее изобретение относится к новым ДНК-аптамерам, способным прочно и специфически связываться с гельзолином. Кроме того, изобретение относится к применению этих аптамеров для оценки уровня гельзолина в данном образце и для очистки немеченного гельзолина и его аналогов в большом объёме.

Настоящее изобретение относится к биохимии и генетической инженерии, в частности к рекомбинантному штамму Escherichia coli BL21(DE3; pQE-Nit2). Указанный штамм получен путём трансформации штамма Escherichia coli BL21(DE3) плазмидной конструкцией pQE-Nit2, которая находится под контролем промотора фага Т5, и предназначен для получения ω-амидазы человека (Nit2) при культивировании на питательных средах на основе пептона, дрожжевого экстракта и глюкозы.
Изобретение относится к области биохимии, в частности к способу борьбы с личинками металловидки серой, включающему использование инсектицида на основе нуклеиновой кислоты, с использованием короткого одноцепочечного антисмыслового фрагмента генома бакуловируса из консервативного домена RING гена IAP.

Представлены полинуклеотидная библиотека для получения спаренных последовательностей антител, способ получения представляющего интерес полинуклеотида и способ анализа и использования данных секвенирования.

Изобретение относится к биотехнологии, в частности к композиции для ингибирования роста и стимуляции апоптоза клеток злокачественной опухоли колоректального рака путем блокирования функции генов МСМ4 и Livin.

Изобретение относится к области биохимии, в частности к выделенной конструкции нуклеиновой кислоты для борьбы с западным кукурузным жуком, также к молекуле РНК, кодируемой вышеуказанной конструкцией.

Настоящие изобретения относятся к полицистронной экспрессии у грамположительной бактерии и касаются молочнокислой бактерии для экспрессии одного или нескольких экзогенных генов, фармацевтической композиции, содержащей такую молочнокислую бактерию, нуклеиновой кислоты и вектора.

Изобретение относится к области биотехнологии, а именно к способу одновременной детекции множества последовательностей нуклеотидов при проведении одной полимеразной цепной реакции.

Представлен способ выявления ракового биомаркера у субъекта in vitro. Охарактеризованный способ включает получение от субъекта биологического образца; измерение уровня RISC-белка во фракции экзосом образца и/или активности процессинга первичной микроРНК или активности процессинга предшественника микроРНК во фракции экзосом образца и эталонного образца; идентификацию того, что субъект обладает раковым биомаркером, на основании (i) выявления RISC-белка во фракции экзосом образца, полученного от субъекта, или (ii) выявления активности процессинга микроРНК во фракции экзосом образца, которая отсутствует в эталонном образце.

Изобретение относится к области биотехнологии, конкретно к химерному антигенному рецептору (CAR), обладающему специфичностью к CD22, что может быть использовано в медицине.

Изобретение относится к области биохимии, в частности к генетически модифицированной клетке растения сои, продуцирующей масло, содержащее 0,36-8,00% ДГК от общего количества жирных кислот и 0,30-3,98% ДПК(n-6) от общего количества жирных кислот, а также к способу ее получения.

Изобретение относится к области биохимии, в частности к трансгенной растительной клетке табака, трансгенному растению табака, растительному материалу табака для получения повышенного количества С2С16:0, С2С17:0 и С2С18:0 сложных эфиров сахарозы, а также к курительному изделию, содержащему вышеуказанный растительный материал или часть вышеуказанного растения.

Изобретение относится к соединениям 1-[m-карбоксамидо(гетеро)арил-метил]-гетероциклил-карбоксамида формулы (I) в которой Ar1 представляет собой группу фенилена или 5- или 6-членную группу гетероарилена, которая означает 5-6-членное моноциклическое или бициклическое ароматическое кольцо, содержащее от одного до максимально четырех гетероатомов, каждый из которых независимо выбран из кислорода, азота и серы; при этом группа -CHR4- и группа -NH-CO-X-R3 в Формуле (I) присоединены в мета-расположении к кольцевым атомам углерода Ar1; при этом указанный фенилен или 5- или 6-членный гетероарилен независимо является незамещенным или монозамещенным, где заместитель выбран из группы, которая включает (С1-4)алкил, (С1-4)алкокси, галоген, (С1-3)фторалкил и (С1-3)фторалкокси; X представляет собой • прямую связь; • -(С1-4)алкилен- который необязательно является монозамещенным, где заместитель представляет собой гидрокси; • -(С3-6)циклоалкилен-; • -СН2-О-, при этом кислород связан с группой R3; или • -СН=СН-; R3 представляет собой • арил или 5-10-членный гетероарил, который означает 5-10-членное моноциклическое или бициклическое ароматическое кольцо, содержащее от одного до максимально четырех гетероатомов, каждый из которых независимо выбран из кислорода, азота и серы; причем указанный арил или 5-10-членный гетероарил независимо является незамещенным, моно-, ди- или тризамещенным, где заместители независимо выбраны из группы, которая включает (С1-4)алкил; (С1-4)алкокси; (С1-3)фторалкил; (С1-3)фторалкокси; галоген; циано; (С3-6)циклоалкил; -СО-(С1-4)алкокси; -SO2-(C1-4)алкил; и -NR6R7, при этом R6 и R7 независимо представляют собой водород или (С1-3)алкил, или R6 и R7 совместно с атомом азота, к которому они присоединены, образуют 5- или 6-членное кольцо, выбранное из пирролидинила, морфолинила, пиперидинила и пиперазинила, необязательно замещенное на свободном атоме азота (С1-4)алкилом; при этом в случае если 5-10-членный гетероарил означает пиридин, то такой пиридин дополнительно может присутствовать в форме соответствующего N-оксида; • или, в случае если X означает прямую связь или группу метилена, R3 кроме того, может представлять собой частично ароматическую бициклическую кольцевую систему, состоящую из фенильного кольца, которое конденсировано с 4-6-членным насыщенным карбоциклическим кольцом, необязательно содержащим один или два гетероатома независимо выбранных из азота и кислорода; при этом указанная кольцевая система необязательно является моно- или дизамещенной (С1-4)алкилом или галогеном; (С3-8)циклоалкил, при этом циклоалкил необязательно может содержать кольцевой атом кислорода, и где указанный циклоалкил необязательно замещен до четырех групп метила; • или, в случае если X означает прямую связь, R3 кроме того, может представлять собой (С2-6)алкил; • или, в случае если X означает -СН=СН-, R3 может к тому же представлять собой водород, (С1-4)алкил или (диметиламино)метил; R1 представляет собой • (С1-6)алкил который необязательно является монозамещенным (С1-4)алкокси или гидрокси; • (С2-3)фторалкил; • (С3-8)циклоалкил или (С3-8)циклоалкил-(С1-3)алкил; при этом соответствующие (С3-8)циклоалкильные группы необязательно могут содержать кольцевой атом кислорода; где (С3-8)циклоалкил или (С3-8)циклоалкил-(С1-3)алкил независимо является незамещенным или замещенным, как изложено ниже: (С3-8)циклоалкильная группа является моно- или дизамещенной, где заместители независимо выбраны из группы, которая включает (С1-4)алкил, фтор, гидрокси-метил, гидрокси и циано; или (С1-3)алкильная группа является монозамещенной гидрокси; • арил-(С1-4)алкил- или 5- или 6-членный гетероарил-(С1-4)алкил-, который означает 5-6-членное моноциклическое или бициклическое ароматическое кольцо, содержащее от одного до максимально четырех гетероатомов, каждый из которых независимо выбран из кислорода, азота и серы; где указанное 5- или 6-членное моноциклическое или бициклическое ароматическое кольцо связано с остальной частью молекулы через (С1-4)алкиленовую группу, при этом арил или 5- или 6-членный гетероарил независимо является незамещенным, моно- или дизамещенным, где заместители независимо выбраны из группы, которая включает (С1-4)алкил, (С1-4)алкокси, галоген, циано, (С1-3)фторалкил и (С1-3)фторалкокси (в особенности (С1-4)алкил, (С1-4)алкокси, галоген и (С1-3)фторалкил); или • 1,2,3,4-тетрагидронафталинил или группу инданила, которые присоединены к остальной части молекулы через атом углерода, который является частью неароматического кольца; и R2 представляет собой водород или (С1-3)алкил; или R1 и R2 совместно с атомом азота, к которому они присоединены, представляют собой азетидиновое, пирролидиновое, пиперидиновое, морфолиновое или азепановое кольцо, при этом указанные кольца независимо являются незамещенными, или моно- или дизамещенными, где заместители независимо выбраны из группы, которая включает фтор и метил; R4 представляет собой водород или (С1-3)алкил; и • R5a представляет собой водород, метил или фтор; R5b представляет собой водород; и р представляет собой целое число 0, 1 или 2; или • R5a представляет собой водород; R5b представляет собой метил; и р представляет собой целое число 1; и к их применению в качестве модуляторов CXCR7 рецептора.

Настоящее изобретение относится к биохимии. Описана молекула L-нуклеиновой кислоты, способная связываться с C5a человека, где молекула L-нуклеиновой кислоты содержит центральный участок нуклеотидов, где центральный участок нуклеотидов содержит нуклеотидную последовательность 5 AUGn1GGUGKUn2n3RGGGHUGUKGGGn4Gn5CGACGCA 3 [SEQ ID NO: 61], где n1 представляет собой U или dU, n2 представляет собой G или dG, n3 представляет собой A или dA, n4 представляет собой U или dU, n5 представляет собой U или dU, и G, A, U, C, H, K и R являются рибонуклеотидами, и dU, dG и dA являются 2-дезоксирибонуклеотидами. Также описано использование данной молекулы для лечения или предотвращения заболевания, ассоциированного с активацией комплемента и опосредуемыми С5а патогенными механизмами. Также описано использование данной молекулы в диагностике такого заболевания. Также описан способ обнаружения указанной молекулы в образце. 8 н. и 18 з.п. ф-лы, 23 ил., 1 табл., 10 пр.

Наверх