Способ и устройство для очистки, разделения, модификации и/или иммобилизации химических или биологических объектов, находящихся в текучей среде, и опора из микропроволоки



Способ и устройство для очистки, разделения, модификации и/или иммобилизации химических или биологических объектов, находящихся в текучей среде, и опора из микропроволоки
Способ и устройство для очистки, разделения, модификации и/или иммобилизации химических или биологических объектов, находящихся в текучей среде, и опора из микропроволоки
Способ и устройство для очистки, разделения, модификации и/или иммобилизации химических или биологических объектов, находящихся в текучей среде, и опора из микропроволоки

 

C07K1/14 - Пептиды (пептиды в пищевых составах A23, например получение белковых композиций для пищевых составов A23J, препараты для медицинских целей A61K; пептиды, содержащие бета-лактамовые кольца, C07D; циклические дипептиды, не содержащие в молекуле любого другого пептидного звена, кроме образующего их кольцо, например пиперазин-2,5-дионы, C07D; алкалоиды спорыньи циклического пептидного типа C07D519/02; высокомолекулярные соединения, содержащие статистически распределенные аминокислотные единицы в молекулах, т.е. при получении предусматривается не специфическая, а случайная последовательность аминокислотных единиц, гомополиамиды и блоксополиамиды, полученные из аминокислот, C08G 69/00; высокомолекулярные продукты, полученные из протеинов, C08H 1/00; получение

Владельцы патента RU 2411291:

Дро Биосистемс, С.Л. (ES)

В изобретении раскрывается устройство на основе технологии SSB для очистки, разделения, модификации и/или иммобилизации химических объектов или биологических объектов в текучей среде. Устройство по изобретению содержит одну или несколько опор из микропроволоки, закрепленных своими концами и имеющих многослойную структуру, состоящую из центрального стержня и по меньшей мере одного покрывающего слоя, пригодных для связывания химических или биологических объектов с функциональным покрытием или лигандами, находящимися на поверхности опор из микропроволоки при отсутствии воздействия магнитного поля, создаваемого между опорами из микропроволоки и частицами, находящимися в текучей среде. Описан также способ очистки, разделения, модификации и/или иммобилизации химических или биологических объектов, находящихся в текучей среде посредством этого устройства. Изобретение позволяет осуществлять процесс очистки, разделения, модификации и/или иммобилизации объектов, находящихся в текучей среде, при более высокой скорости потока. 3 н. и 21 з.п. ф-лы, 2 табл.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к устройству для очистки, разделения, детектирования, модификации и/или иммобилизации химических объектов или биологических объектов, находящихся в текучей среде.

Уровень техники

Различные аналитические, биохимические и диагностические методы включают иммобилизацию специфического реагента или биологического связывающего партнера биологической молекулы на субстратах с высокоразвитой поверхностью.

С одной стороны, клетки часто культивируют в реакторах для получения биологических и фармакологических продуктов. Такими клетками могут являться клетки животного, растительного, грибкового или микробного происхождения. Для поддержания клеточной культуры, как правило, клетку необходимо подпитывать кислородом и другими питательными элементами. Клеточные культуры обычно поддерживают в реакторах путем перфузии, где среда для культивирования клетки, включающая кислород и другие питательные элементы, направляется через реактор для культивирования клеток. Реакторы для культивирования клеток, однако, могут поддерживать только маленькие загрузки клеток на единицу объема реактора. Они могут работать только при низкой скорости потока или в пределах скоростей перемешивания. Аналогично, в реакторах проводят биокаталитические реакции, где ферментный катализатор удерживается на пористой неорганической опоре.

С другой стороны, иммобилизация также уже используется для проведения химического и биологического разделения. Разделение макромолекул, например, белков, является дорогостоящей операцией при производстве фармакологических продуктов. Для проведения такого типа разделений временами используют хроматографию. В пищевой, биофармацевтической, биотехнологической и фармацевтической промышленностях при производстве коммерчески важных биомолекул в качестве стационарной фазы используют химически модифицированную целлюлозу или диоксид кремния. Альтернативные стационарные фазы могут включать металлы и оксиды металлов, например, дисперсный оксид алюминия. Также для хроматографии могут использоваться мембранные адсорбенты, т.е. мембраны с функционализированными центрами на поверхности.

Многие аналитические методы включают иммобилизацию биологического связывающего партнера биологической молекулы на поверхности. Поверхность подвергают воздействию среды, которая, как предполагается, содержит молекулу, после чего определяют наличие или размер молекулы, связанной с поверхностно-иммобилизованным связывающим партнером.

Подобным образом, большинство биотехнологических процессов получения фармацевтических или диагностических продуктов включают очистку биомолекул из различных источников. Очистку биомолекул часто начинают с проведения адсорбционной хроматографии на обычном уплотненном слое твердого носителя - адсорбента. Для этого часто требуется проведение очистки необработанной культуры перед тем как работать с ней в хроматографической колонке. Существующие методы продуцирования и очистки плазмидной ДНК из бактериальных лизатов основаны на обычной хроматографии с уплотненным слоем адсорбента. Этот метод затруднен физическими характеристиками этих соединений (такими как размер плазмидов, вязкость раствора, хрупкость плазмидов, химическая схожесть с другими нуклеиновыми кислотами у микроорганизма и т.д.), устанавливающими строгие ограничения в показателях рабочей емкости устройства и перепада давления. Более того, может возникнуть необходимость в элиминации плазмидной фракции, которая не вносит вклад в терапевтический эффект из-за того факта, что экспрессия генов, содержащихся в нетерапевтической части, влечет за собой опасность для рецептора такой плазмиды, риск возникновения неспецифических эффектов, риск хромосомной интеграции и т.д.

Методы адсорбционной хроматографии проводятся не только на обычном уплотненном слое (хроматография с уплотненным слоем адсорбента; РВС), но также и на вспученном слое (адсорбция на слой вспученного адсорбента; ЕВА) или в псевдоожижженном слое (адсорбция в псевдоожижженном слое; FBA). Во всех этих хроматографических методах в качестве адсорбционного носителя используются частицы.

В других хроматографических методах, применяемых при разделении и очистке, в качестве стационарной фазы используется волокнистый материал. Например, в J. Chromatography 1992, 598/2: pp.169-180 описывается непрерывная стационарная фаза, состоящая из нитей, сплетенных в ткань, которую сворачивают и упаковывают в жидкостные хроматографические колонки. Описываемые нити имеют характеристическую ширину 200-400 мкм и изготавливаются из 10-20 мкм волокон, состоящих на 95% из поли(м-фениленизофталемида) и на 5% из поли(п-фенилентере-фталемида).

В J. Oleo Science 2002, 51/12: 789-798 описывается метод жидкостной хроматографии с использованием в качестве стационарной фазы полиэфирных и целлюлозных филаментных нитей для удаления жирных пятен из волоконного субстрата при помощи водного мицеллярного раствора поверхностно-активного вещества.

В ЕР 328256 раскрывается стекловолокно, покрытое пористым гидрофильным связующим материалом, который производится для связывания подходящего лиганда или биологического материала в хроматографическом процессе.

WO 03/00407 относится к волокну из гидроксида алюминия, который обладает высоким положительным зарядом и составляет в диаметре приблизительно 2 нанометра. Таким волокном можно отфильтровать бактерии и наноразмерные частицы, например, вирусы и коллоидные частицы, при высокой скорости пропускания через фильтр. Они могут также использоваться для очистки и стерилизации воды, биологических, медицинских и фармацевтических жидкостей, в качестве коллектора/концентратора для детектирования и анализа микробов и вирусов, а также в качестве субстрата для выращивания клеток.

В данной области техники известна микропроволока, покрытая аморфным стеклом. Благодаря ее магнитным свойствам, проявляющимся при высоких частотах она используется в миниатюрных электронных компонентах и для фильтрации электромагнитных помех в печатных схемах и кабелях. Микропроволока также обладает проводящими свойствами, и поэтому ее можно использовать в таких электромагнитных элементах, как миниатюрные катушки, миниатюрные провода, высоковольтные трансформаторы и миниатюрные антенны. Тем не менее, еще не предлагалось использовать микропроволоку, покрытую аморфным стеклом, в способе очистки, разделения, детектирования, модификации и/или иммобилизации субстратов, содержащих текучую среду.

В J. Magnetism и Magnetic Materials 2002, 249: 357-367 описывается использование нанопористых мембран, частично наполненных магнитными полыми проводами, для разделения магнитных частиц, находящихся в текучей среде. Магнитные частицы, предварительно нагруженные определенными биологическими объектами, разделяются путем пропускания содержащей их текучей среде через мембрану при приложении внешнего магнитного поля таким образом, чтобы намагнитились ферромагнитные цилиндры, и поэтому биологические объекты, связанные с магнитными частицами, захватываются стенками капилляров, тогда как несвязанные объекты проходят мимо.

В J. Magnetism и Magnetic Materials 2005, 293: 671-676 описывается чувствительность аморфной микропроволоки, покрытой стеклом, к эффекту Гигантского магнитного сопротивления (GMI) при детектировании магнитных наночастиц, осаждаемых на их поверхности и располагаемых вблизи от нее при приложении магнитного поля. Микропроволоку покрывают полимером, содержащим специфические биорецепторы для биомолекул, находящихся на поверхности магнитных микрочастиц, которые впоследствии детектируются.

WO 2005/101464 относится к микропроволоке, покрытой метгласом, где биохимические реагенты и ферменты реакции ПЦР инкапсулированы или загружены в нано- или микропоры, вытравленные на стеклянной поверхности, которая либо является частью покрытой стеклом микропроволоки, либо наносится на нее путем погружения, распыления или каким-либо другим методом.

Раскрытие изобретения

Проблема, решаемая настоящим изобретением, состоит в разработке улучшенного способа очистки, разделения, детектирования, модификации и/или иммобилизации химических объектов или биологических объектов, находящихся в текучей среде, в котором были бы устранены или минимизированы некоторые недостатки, указанные выше для других методов.

Решение заключается в сопособе, который осуществляется с использованием устройства, содержащего одну или несколько опор из микропроволоки, закрепленных на концах и представляющих стационарную фазу. Упомянутые опоры из микропроволоки пригодны для связывания химических или биологических объектов и используются в так называемой технологии "Static Support Bed" (SSB), где указанное устройство помещают в колонку или реактор для использования в хроматографии или для выращивания клеточных культур.

Соответственно, первый аспект настоящего изобретения относится к устройству для очистки, разделения, детектирования, модификации и/или иммобилизация химических объектов или биологических объектов, находящихся в текучей среде, где указанное устройство содержит одну или несколько опор из микропроволоки, закрепленных своими концами. Эти опоры из микропроволоки имеют многослойную структуру, сегрегированную в центральный стержень, и один или несколько покрывающих слоев и пригодны для связывания химических объектов или биологических объектов, где поверхность микропроволоки модифицирована путем присоединения лигандов или нанесением на нее функционального покрытия и где указанная очистка, разделение, детектирование, модификация и/или иммобилизация происходит за счет связывания химического или биологического объекта с функциональным покрытием или лигандами, находящимися на поверхности опор из микропроволоки, с условием, что если магнитное поле оказывает влияние на указанное устройство, то его не используют для разделения восприимчивых действию магнитного поля частиц, находящихся в текучей среде, посредством магнитного взаимодействия между опорами из микропроволоки и указанными магнитовосприимчивыми частицами.

Опоры из микропроволоки также являются объектом изобретения. Таким образом, второй аспект изобретения относится к опорам из микропроволоки, которые интегрированы в устройство изобретения и имеют указанные выше характеристики. Итак, указанные опоры из микропроволоки имеют многослойную структуру, сегрегированную в центральный стержень, и один или несколько покрывающих слоев, где поверхность микропроволоки модифицируется путем:

а) присоединения лигандов или

б) покрытием ее функциональным слоем с условием, что функциональный слой не является полимерным покрытием.

Третий аспект изобретения относится к способу очистки, разделения, детектирования, модификации и/или иммобилизация химических объектов или биологических объектов, находящихся в текучей среде, с использованием устройства, определенного выше, где указанный способ включает в себя: а) загрузку жидкого образца, содержащего химические объекты или биологические объекты, во внутренний объем канала, содержащего устройство; б) связывание химических объектов или биологических объектов на опорах из микропроволоки, входящих в состав устройства; в) необязательно, проведение химической или биологической модификации объекта, например, биокаталитической модификации молекулы; г) необязательно, промывка канала и слив нежелательных компонентов и примесей жидкого образца; и д) элюирование конечных химических объектов или конечных биологических объектов с условием, что если магнитное поле оказывает влияние на указанное устройство, то оно не может использоваться для разделения чувствительных к действию магнитного поля частиц, находящихся в текучей среде, посредством магнитного взаимодействия между опорами из микропроволоки и указанными магнитовосприимчивыми частицами.

Этот способ, в частности, применим для разделения, очистки и/или модификации биомолекул, таких как белки, гликопротеины, нуклеиновые кислоты, например, РНК, ДНК, кДНК, олигонуклеотиды и плазмиды, пептиды, гормоны, антигены, антитела, липиды и комплексы, включающие одну или несколько таких молекул.

Определения

В последующем, будет подразумеваться, что термин "биологический объект" включает в себя компоненты биологического происхождения. Он включает в себя клетки животных, растений, грибковые или микробные клетки, тканевые культуры, антитела, антибиотики, антигены, плазмиды, олигонуклеотиды, пептиды, гормоны, коферменты, ферменты, белки, либо природного происхождения, либо рекомбинантно полученные, гликозилированные или негликозилированные, клеточные компоненты, нуклеиновые кислоты, вирусы, углеводы, текучей среде, содержащиеся в организме, компоненты крови, микроорганизмы и их производные, или их части, а также какие-либо другие биологические молекулы, представляющие интерес.

Используемое в данном контексте понятие "химический объект" включает в себя любое органическое или неорганическое соединение, включая лекарственные средства.

Используемое в данном контексте понятие "очистка" относится к процессу отделения интересующего вещества от чужеродных или загрязняющих элементов в образце за счет удаления примесей.

Используемое в данном контексте понятие "разделение" относится к процессу, при котором смесь веществ преобразуется в два или более отличающихся по составу продукта.

Используемое в данном контексте понятие "модификация" относится к видоизменению структуры молекулы химическими или биологическими способами.

Используемое в данном контексте понятие "иммобилизация" относится к процессу присоединения химического соединения или биомолекулы за счет ковалентных или нековалентныхсвязей. Иммобилизация клеток для получения вакцин, белков, эукариотических генов, тканевых трансплантатов, белков из рекомбинантной ДНК и т.д. является отдельным примером использования микропроволоки настоящего изобретения.

Используемое в данном контексте понятие "максимальный размер поперечного сечения" какого-либо заданного объекта относится к максимальному расстоянию, которое можно обнаружить между любыми двумя точками, находящимися в пределах самого большого периметра, определяемого по линии пересечения объекта и плоского перпендикуляра к самому длинному размеру объекта.

Используемый в данном контексте термин "микропроволока" относится к твердому веществу, т.е. неполому, тонкому элементу, имеющему круглое или некруглое поперечное сечение с максимальным размером менее 1000 мкм. Термины "микропроволока" и " опора из микропроволоки" используются в данном контексте взаимозаменяемо.

Используемое в данном контексте понятие "устройство" относится к подложке, состоящей из одной или нескольких опор из микропроволоки, которые сгруппированы в повторяющуюся конфигурацию и закреплены любым из двух концов.

Используемое в данном контексте понятие "связка опор из микропроволоки" относится к множеству опор из микропроволоки, т.е. несколько (более одной) опор из микропроволоки сгруппированы вместе в повторяющуюся конфигурацию.

Осуществление изобретения

Важной проблемой промышленных процессов на сегодняшний день является ограничение их применения в промышленных масштабах из-за используемой технологии. Данное ограничение может приводить к тому, что процесс, осуществляемый успешно в лабораторных масштабах, при приложении его к большим промышленным масштабам работает неудовлетворительно, не давая ожидаемые результаты.

Поэтому размеры устройств для неподвижных насадок, согласно настоящему изобретению, предпочтительно находятся в интервале от 0,5 см максимального размера поперечного сечения и 0,5 см длины до 1,5 м максимального размера поперечного сечения и 10 м длины. Однако из-за высокой производительности технологии SSB редко используют очень большие устройства на основе технологии SSB, более предпочтительно, когда размеры устройств для неподвижных насадок для промышленных процессов находятся в интервале от 0,5 см максимального размера поперечного сечения и 5 см длины до 50 см максимального размера поперечного сечения и 1,5 м длины.

Одним из преимуществ технологии SSB является ее способность предоставлять большую доступную площадь поверхности в сочетании с высокой пористостью в пределах границ устройства по технологии SSB. Это преимущество является результатом нитевидной формы опор из микропроволоки, используемых в настоящем изобретении, т.е. они придают устройству настоящего изобретения определенную пористость - чем более тонкая опора из микропроволоки используется, тем большей будет доступная площадь поверхности в пределах устройства по технологии SSB. Однако, более толстые опоры из микропроволоки более устойчивы к разрыву, по этой причине большие устройства или жесткие условия процесса требуют использования более толстых опор из микропроволоки.

Длина опор из микропроволоки, в частности, не ограничивается каким-либо особым диапазоном, который в определенной мере, как правило, равен или больше длины колонки или реактора. Тем не менее, из вышеуказанных соображений вытекает вывод об удобстве использования опор из микропроволоки, у которых предпочтительно максимальный размер поперечного сечения находится в интервале от 1 мкм до 1000 мкм, а для поддержания их нитевидной формы соотношение длины к максимальному размеру поперечного сечения должно быть более 5. Более предпочтительно, когда их максимальный размер поперечного сечения находится в интервале от 1 мкм до 100 мкм, а соотношение длины к максимальному размеру поперечного сечения более 50. Еще более предпочтительно, когда соотношение длины к максимальному размеру поперечного сечения более 500. Наиболее предпочтительно, когда соотношение длины к максимальному размеру поперечного сечения более 1000.

Технология с использованием устройства настоящего изобретения, как описано в данном тексте, является наиболее выгодной при использовании в технологических процессах, в которых применяются большие объемы текучей среды, большие скорости потока текучей среды, вязкие текучие среды и текучие среды с твердыми частицами в суспензии. В любом из этих четырех случаев применение существующих технологий приводит либо к низкой производительности, либо к ограничивающему противодавлению.

Противодавление возникает тогда, когда устройство для технологической обработки, устанавливаемое в подвергаемые обработке потоки текучей среды, оказывает сопротивление потоку. Это сопротивление является следствием большой вязкости или большой прилагаемой к потоку скорости в сопоставлении с пористостью при заданном поперечном сечении устройства. На пористость влияет конструкция устройства, размер и геометрия опор, находящихся в пределах устройства, а также эффект фильтрации на твердых частицах в суспензии, которые накапливаются в пределах устройства и понижают его эффективную пористость.

В технологии с использованием устройства по изобретению опоры из микропроволоки закрепляются любым из двух концов для того, чтобы получалилось устройство, где пространственное распределение опор из микропроволоки остается стабильным независимо от природы используемой текучей среды или от используемой скорости потока. Закрепление концов приводит к тому, что смежные опоры из микропроволоки образуют определенный угол. Для того чтобы предотвратить противодавление и эффект фильтрации на твердых частицах в суспензии, наиболее удобным вариантом распределения опор из микропроволоки в пределах устройства по изобретению является случай, когда смежные опоры из микропроволоки друг с другом образуют угол в ноль градусов. Однако, важно, чтобы твердые частицы с размером, превышающим расстояние между смежными опорами из микропроволоки, свободно проходили через устройство за счет раздвигания смежных опор из микропроволоки и временной деформации пространственного распределения смежных опор из микропроволоки, что приводит к тому, что смежные опоры из микропроволоки образуют угол вплоть до 10 градусов. Более того, из-за ограничений в дизайне и конструкции может потребоваться увеличение угла между смежными опорами из микропроволоки вплоть до 45 градусов.

Поэтому, согласно предпочтительному варианту осуществления настоящего изобретения, любая взятая в отдельности опора из микропроволоки образует угол от 0° до 45° с любой другой прилегающей опорой из микропроволоки. Более предпочтительно, любая взятая в отдельности опора из микропроволоки образует угол от 0° до 10° с любой другой прилегающей опорой из микропроволоки.

В предпочтительном варианте осуществления опоры из микропроволоки размещают в колонке или реакторе таким образом, чтобы они вытягивались полностью от одного до другого конца колонки или реактора, закрепляясь своими концами, а подаваемый поток протекал от одного конца к другому. В особенно предпочтительном варианте осуществления опоры из микропроволоки размещают таким способом, чтобы подаваемый поток образовывал угол от 0° до 45° с опорами из микропроволоки. Тем не менее, возможны и другие способы размещения.

Для полного охвата внутреннего объема колонки или реактора с опорами из микропроволоки требуется равномерное распределение по всей колонке или реактору опор из микропроволоки, как таковых или сгруппированных в связки. Такого равномерного распределения можно достигнуть путем закрепления опор из микропроволоки или связок своими концами на любом конце колонки или реактора таким образом, чтобы закрепленные концы образовывали сетчатую, зигзагообразную структуру или структуру в виде параллельных линий на любом конце колонки или реактора.

Соответственно, устройство по изобретению размещают в пределах колонки или реактора по схеме оптимизированного распределения таким образом, чтобы достигались желаемые размеры и равномерная пористость колонки. Эти значения сохраняются постоянными на всем протяжении срока службы любого устройства по изобретению.

В предпочтительном варианте осуществления изобретения, опоры из микропроволоки устройства по изобретению имеют центральный стержень и покрывающие слои, изготовленные из различных материалов. Поэтому опоры из микропроволоки согласно данному предпочтительному варианту осуществления не имеют полой структуры, в отличие от проводов, подобных полым волокнам. Материалы центрального стержня и покрывающих слоев выбираются из группы, включающей стеклянные, металлические, керамические, полимерные и пластиковые материалы. В более предпочтительном варианте осуществления центральный стержень указанных опор из микропроволоки изготавливают из металла, и, по меньшей мере, один покрывающий слой изготавливают из стекла. Металлический стержень опор из микропроволоки может иметь аморфную и/или кристаллическую микроструктуру. Предпочтительно, когда металлический стержень имеет аморфную микроструктуру.

В предпочтительном варианте осуществления, стержень опор из микропроволоки изготавливают из металла, металлических сплавов или комбинации по меньшей мере одного металла и металлического сплава. Предпочтительными металлами, используемыми как таковые, или металлическими сплавами являются медь, золото, серебро, платина, кобальт, никель, железо, кремний, германий, бор, углерод, фосфор, олово, молибден, индий, галлий, свиней, гафний и цирконий. В более предпочтительном варианте осуществления стержень опор из микропроволоки состоит из сплава, содержащего кобальт, железо, никель, хром, бор, кремний и молибден.

Примеры составов стержня, особо предпочитаемых в настоящем изобретении, показаны в Таблице 1.

Таблица 1
Со % Fe % Ni % Cr % B % Si % Mo %
1 68,7 4 1 0 13 11 0
2 50,7 3,98 0 23,65 11,96 9,71 0
3 60,51 3,99 0 12,13 13,53 9,84 0
4 59,85 3,94 0 11,7 13,06 13,06 0
5 58,34 3,84 0 11,7 13,06 13,06 0
6 58,14 4,17 0 11,66 13,02 13,01 0
7 58,9 4,19 0 12,42 13,13 11,36 0
8 58,64 4,67 0 12,36 13,05 11,28 0
9 57,33 4,7 0 13,14 13,02 11,19 0,62
10 56,51 4,84 0 13,08 14,16 11,41 0
11 58,04 4,62 0 12,92 12,8 11,01 0,61
12 58,25 4,49 0 12,52 13,47 10,68 0,59
13 57,96 4,73 0 12 13,2 11,11 1

Стекловидная покрывающая композиция может содержать наряду с другими оксидами металлов, такие оксиды, как SiO2, Al2O3, В2О3, Na2O и K2O.

В предпочтительном варианте осуществления изобретения, поверхность опор из микропроволоки модифицируется путем присоединения лигандов или нанесением на нее функционального покрытия, поэтому очистка, разделение, детектирование, модификация и/или иммобилизация происходит посредством связывания химического объекта или биологического объекта на функциональном покрытии или с лигандами, присутствующими на поверхности опор из микропроволоки.

В предпочтительном варианте осуществления изобретения, поверхность опор из микропроволоки подходящим образом модифицируется нанесением на поверхность белкового, желатинового или коллагенового покрытия. Следовательно, в данном случае поверхность опоры из микропроволоки модифицируется подходящим образом посредством функционального покрытия. Таким образом, используемый в данном контексте термин "функциональное покрытие", относится к покрытию, которое может взаимодействовать посредством ковалентного или нековалентного взаимодействия с целевым объектом.

В другом предпочтительном варианте осуществления изобретения поверхность опор из микропроволоки модифицируется подходящим образом посредством присоединения лиганда к поверхности опоры из микропроволоки, непосредственно или через линкер. Предпочтительными лигандами являются те, которые выбираются из группы, состоящей из клеток, биологических тканей, антител, антибиотиков, антигенов, нуклеиновых кислот, пептидов, гормонов, коферментов, биологических катализаторов, химических катализаторов, химических реагентов, липидов, сахаров, аминокислот, белков, нуклеотидов, соединения, содержащего функциональный заместитель, выбираемый из группы, состоящей из диэтиламиноэтила, четвертичного аминоэтила, четвертичного аммония, карбоксиметила, сульфопропила, метилсульфоната, бутила, октила, фенила и их смесей. В частности предпочтительными лигандами являются клетки, биологические ткани, антитела, антибиотики, антигены, нуклеиновые кислоты, пептиды, гормоны, коферменты, биологические катализаторы, химические катализаторы, химические реагенты, липиды, сахара, аминокислоты, белки, нуклеотиды и их смеси.

Предпочтительными линкерами являются те, которые выбираются из группы, включающей полимерный слой, белковый слой, желатиновый слой, коллагеновый слой, клетки, антитела, антигены, нуклеиновые кислоты, пептиды, коферменты, липиды, сахара, аминокислоты, белки, нуклеотиды, циануровый хлорид, хинин, п-ртутьбензоат, фенилборную кислоту и соединение, содержащее функциональный заместитель, выбираемый из группы, включающей альдегид, ароматический амин, нитрен, малеимид, карбоновую кислоту, изоцианат, диэтиламиноэтил, четвертичный аминоэтил, четвертичный аммоний, карбоксиметил, сульфопропил, метилсульфонат, бутил, октил, фенил и их смеси.

Микропроволоку со стеклянным покрытием можно получить любым подходящим методом, известным в данной области техники, например, методом Тэйлора-Улитовского (Fizika Metallov I Metallovedeneie 1987, 67: 73). Можно использовать различные металлические композиции стержней, а также можно использовать различные составы стеклянных покрытий.

Определенную выше функционализированную опору из микропроволоки со стеклянным покрытием можно получить по способу, включающему в себя следующие стадии: (1) заготовка опоры из микропроволоки со стеклянным покрытием; (2) окисление его поверхности; (3) активация поверхности полученной окисленной микропроволоки и (4) функционализация подходящим лигандом посредством ковалентного или нековалентного присоединения лиганда к линкеру, прикрепленному на стадии (3).

Предпочтительно стадия окисления (2) включает в себя обработку при помощи смеси H2O2 и водного раствора NH3 (1:4) с последующей обработкой концентрированной N2S04, Можно также использовать другие условия окисления (сравни J. Am. Chem. Soc; 2003, 125, 12096; Langimur, 2004, 20, 7753; Anal. Chem.; 1993, 65, 1635; J. Am. Chem. Soc; 1996, 118, 9033).

Предпочтительно, стадия активации (3) включает в себя присоединение подходящего линкера к поверхности микропроволоки, которая содержит подходящие функциоанльные группы для ковалентного или нековалентного (электростатическое, гидрофильное, гидрофобное или аффинное взаимодействие) связывания с лигандом. Стадию активации (3) опор из микропроволоки можно выполнить в один этап или через несколько реакционных стадий. Например, стадия активация (3) может быть проведена по способу, включающему в себя следующие этапы: (3-1) взаимодействие окисленной микропроволоки с силановым соединением и (3-2) взаимодействие полученного изделия из микропроволоки, полученного на этапе (3-1), с соединением, содержащим малеимидную, карбоксильную или изоцианатную группу. Предпочтительными силановыми соединениями являются 3-аминопропилэтоксисилан, 7-окт-1-енилтрихлорсилан и 3-изоцианатпропилэтоксисилан.

Стадию функционализации (4) можно провести путем соединения линкера, прикрепленного к поверхности опор из микропроволоки, с лигандом посредством электростатических взаимодействий, гидрофильных взаимодействий, гидрофобных взаимодействий, аффинных взаимодействий или ковалентных связей. Такого соединения можно достичь при помощи следующих комбинаций:

а) ковалентного связывания лигандов:

а. 1) аминной функцинальной группы на лиганде, связываемой через иминную связь с альдегидной функциональной группой на поверхности;

а. 2) аминной функциональной группы на лиганде, связываемой посредством нуклеофильного замещения на поверхности, функционализированной циануровым хлоридом;

а. 3) аминной функциональной группы на лиганде, связываемой посредством присоединения по Михаэлю к хиноновым функциональным группам на поверхности;

а. 4) тирозинового или гистидинового остатка на лиганде, связываемого через азогруппу с ароматическими аминами, присоединенными к поверхности;

а. 5) аминного остатка на лиганде, связываемого с нитреновой функциональной группой на поверхности, образуемой посредством фотохимической активации фенилазидных групп;

а. 6) тиольной функциональной группы на лиганде, связываемой с п-ртутьбензоатной, йодацетамидной или малеимидной группами на поверхности посредством силоксанового мостика, дисульфидных связей или присоединения по Михаэлю;

а. 7) цис-диольного центра (присутствующего на сахарах гликопротеинов) на лиганде, который может связываться с фенилборнокислотными группами на поверхности;

а. 8) карбоксильных или изоцианатных групп на поверхности, присоединяемых к аминным группам на лиганде;

б) нековалентное связывание лигандов:

б. 1) электростатическое взаимодействие, как, например, взаимодействие через заряженные тиолы между самособирающимся слоем октадецилтиола и додецилтиолом на поверхности и фумаратредуктазой,

б. 2) гидрофильное или гидрофобное взаимодействия, как, например, АТФаза, встроенная в липосому, связанную с поверхностью посредством взаимодействия липосомы со слоем димиристоилфосфатидилэтаноламина на поверхности,

б. 3) афинных взаимодействий, как, например, антитело-меченные лиганды, связанные с поверхностями, покрытыми антигеном, биотин-меченные лиганды, связанные с поверхностями, покрытыми авидином или стрептавидином, гликопротеины, связанные с поверхностями, покрытыми пектином, альфа-О-маннопираноза, содержащая лиганд, связанный с поверхностями, покрытыми конкавалином А, холинсвязывающий домен на лиганде, связанный с поверхностями, покрытыми холином, FAD-зависимый фермент, связанный с поверхностями, покрытыми FAD (флавин аденин динуклеотидом), и кофакторзависимые ферменты, связанные с поверхностями, покрытыми кофакторным аналогом.

Описываемый в этом документе метод адсорбции на устройстве по изобретению может использоваться в различных сферах применения. Так, он может использоваться в способе:

(1) как биокалатилический реактор посредством иммобилизации ферментов на поверхности опор из микропроволоки;

(2) для модификации химических или биологических молекул при помощи катализатора (который либо является биокатализатором, либо нет), связанного с поверхностью опоры из микропроволоки;

(3) для отделения химических или биологических молекул от текучей среды, в которой они содержатся, посредством взаимодействия указанных химических или биологических молекул с взаимодействующими объектами, связанными с поверхностью опоры из микропроволоки;

(4) для одновременного проведения разделения и модификации химических или биологических молекул, содержащихся в текучей среде, посредством воздействия катализатора на указанные химические или биологические молекулы при связывании их с взаимодействующим объектом, который при этом является как катализатором, так и взаимодействующим объектом или только одним из них, связанным с поверхностью опоры из микропроволоки;

(5) для иммобилизации химических или биологических молекул, которые дополнительно взаимодействуют с химическими или биологическими молекулами, содержащимися в текучей среде, любым из вышеописанных способов;

(6) для модификации состава текучей среды посредством активации клеток на компонентах указанной текучей среде, при этом указанные клетки связаны с поверхностью опоры из микропроволоки;

(7) для увеличения количества делящихся клеток путем деления указанных клеток на поверхности опоры из микропроволоки;

(8) для модификации состава текучей среды путем обмена химических или биологических молекул, содержащихся в указанной текучей среде на химические или биологические молекулы, связанные с поверхностью опоры из микропроволоки;

(9) для разработки химических реакций, включающих в себя одну или несколько стадий, посредством воздействия одного или нескольких агентов на молекулярные объекты, связанные с поверхностью опоры из микропроволоки, т.е. выступающего в качестве опоры из микропроволоки для твердофазного синтеза;

(10) для модификации физических свойств текучей среды за счет действия различных объектов, иммобилизованных на поверхности опоры из микропроволоки, или посредством воздействия физических сил, сообщаемых текучей среде через опору из микропроволоки;

(11) для очистки плазмидной ДНК посредством взаимодействия указанной плазмидной ДНК с поверхностью опор из микропроволоки, функционализированной подходящими олигонуклеотидами, которые комплементарны целевой последовательности, внедренной в плазмидную ДНК;

(12) для биокаталитической модификации плазмидов за счет функционализации поверхности опор из микропроволоки подходящими олигонуклеотидами, которые комплементарны целевой последовательности, внедренной в плазмиду, а также за счет функционализации рестрикционным ферментом и ферментом лигаза;

(13) для иммобилизации и культивирования клеток на поверхности опор из микропроволоки. Эту микропроволоку с иммобилизованными клетками на поверхности можно использовать в качестве биоферментера для выращивания клеток;

(14) для твердофазной ПЦР путем иммобилизации подходящих для этого метода затравок;

(15) для обеззараживания текучей среды путем иммобилизации загрязняющих агентов на поверхности опор из микропроволоки;

(16) для любого из вышеуказанных приложений при обращении с вязкими текучими средами с высокой концентрацией твердых частиц в суспензии и/или с высокой скоростью потока.

В отдельном варианте осуществления способа к устройству по изобретению прикладывают магнитное поле или пропускают через него электрический ток как вспомогательное средство для соответствующего перемешивания опоры из микропроволоки и элюирования связанных веществ с поверхности опоры из микропроволоки или для регулировки температуры опоры из микропроволоки. При пропускании через микропроволоку электрического тока можно регулировать температуру устройства.

Более того, при приложении к устройству магнитного поля способ настоящего изобретения можно использовать для отделения магнитовосприимчивых частиц от текучей среды, в которой они содержатся, посредством магнитного взаимодействия, устанавливаемого между опорами из микропроволоки и указанными магнитовосприимчивыми частицами.

В сравнении с другими хроматографическими методами, известными в данной области техники, способ адсорбции на устройстве по изобретению, описываемый в настоящем изобретении, имеет улучшенные характеристики, что показано в Таблице 2.

Таблица 2
хроматография с уплотненным слоем адсорбента адсорбция в псевдоожиженном слое адсорбция на слой вспученного адсорбента устройство
Разрешение очень высокое очень низкое среднее высокое
Максимальная вязкость текучей среды очень низкая низкая низкая очень высокая
Максимальное содержание твердых веществ очень низкое очень высокое высокое очень высокое
Максимальная скорость потока очень низкая средняя средняя очень высокая
Промышленная применимость плохая очень хорошая хорошая очень хорошая
Геометрия частицы частицы частицы микропроволока
Высота слоя как функция скорости потока постоянная переменная переменная постоянная
Пористость очень низкая (постоянная вместе с потоком) очень высокая (переменная вместе с потоком) очень высокая (переменная вместе с потоком) очень высокая (постоянная вместе с потоком)

Поэтому основной характеристикой технологии SSB является ее промышленная применимость. Опоры из микропроволоки можно получать с желаемой длиной и собирать для заполнения колонки с желаемым диаметром. Помимо стандартизованных размеров, устройства можно подгонять под такие размеры, которые бы удовлетворяли особым требованиям. Более того, технология SSB показывает три главных усовершенствования:

- сокращенное количество стадий технологии производства;

- эксплуатационные параметры, не зависящие от скорости потока;

- большая площадь специфической поверхности по сравнению с отдельными носителями процесса.

SSB является легкоинтегрируемой технологией, которая облегчает получение за счет улучшенных эксплуатационных характеристик:

- более высокого разрешения, чем у конкурирующих технологий;

- пригодность для высоковязких текучих сред и текучих сред с высоким содержанием твердых веществ;

- исключается утечка частиц носителя в продукт.

Поэтому, согласно способу для очистки, разделения, модификации и/или иммобилизация химических объектов или биологических объектов, находящихся в текучей среде, описываемому в этом документе, текучую среду, содержащую целевые объекты, пропускают через устройство по технологии SSB, затем целевой объект специфически связывают с функциональным слоем модифицированной поверхности опор из микропроволоки и/или вводят во взаимодействие с лигандом, присутствующим на поверхности опор из микропроволоки, в то время как примеси и текучие среды проходят беспрепятственно. При необходимости можно провести химическую или биологическую модификацию и на целевом объекте. Необязательно, можно провести дополнительные стадии промывки канала и слива нежелательных компонентов и примесей жидкого образца, после чего конечные химические объекты или конечные биологические объекты элюируют или десорбируют и выделяют обратно.

В предпочтительном варианте осуществления опоры из микропроволоки предоставляют отличную поверхность для выращивания смежных клеток. Одноразовые устройства по технологии SSB конструируют для обеспечения стерильной поверхности для выращивания и непрерывной подачи свежей среды для культивирования. Система подходит для непрерывного получения внеклеточных белков и для продуцирования клеток, за которой следует стадия сбора урожая.

В другом предпочтительном варианте осуществления при использовании устройства по технологии SSB в качестве твердой фазы для твердофазного синтеза показано увеличение производительности твердофазного синтеза за счет обеспечения более высокой удельной поверхности и более быстрых режимов потока с улучшенными эксплуатационными характеристиками.

На всем протяжении описания и формулы изобретения под словом "включает" и вариациями этого слова, например, "включающий", подразумевается, что они не исключают другие технические характеристики, добавки, компоненты или стадии. Дополнительные объекты, преимущества и характеристики изобретения будут очевидны для квалифицированного в данной области техники специалиста при рассмотрении описания или их можно изучить при практическом применении изобретения. Следующие примеры представлены с целью иллюстрации, но при этом подразумевается, что они не устанавливают ограничения по объему на настоящее изобретение.

Примеры

Пример 1. Пример получения опоры из микропроволоки

Описывается получение непрерывной опоры из микропроволоки с внешним диаметром 24,4 мкм.

Стеклянную трубку с внешним диаметром 7-10 мм и толщиной стенок 1,0-1,4 мм, заполненную металлическим сплавом, состоящим на 69% из кобальта, на 4% из железа, на 1% из никеля, на 13% из бора и на 11% из кремния загружают при скорости загрузки в интервале между 0,9 и 1,5 мм/мин в индукционную печь аппарата по производству микропроволоки. Устанавливают температуру печи в интервале между 1,260 и 1,330°С. Полученную опору из микропроволоки, заполненную металлом, охлаждают проточной водой и обматывают при скорости намотки в интервале между 150 и 250 м/мин для получения катушки и хранят при комнатной температуре до использования.

Можно менять толщину стеклянного слоя и суммарный диаметр опоры из микропроволоки путем регулирования температуры индукционной печи, скорости намотки и скорости загрузки.

Пример 2. Получение EcoR I-активированной опоры из микропроволоки (C-S связь)

Опору из микропроволоки обрабатывают смесью, состоящей из семи объемов серной кислоты и трех объемов 30% перекиси водорода, в течение тридцати минут при комнатной температуре. Носитель затем тщательно промывают проточной водой, затем этанолом, а после этого хлороформом. В конце опору высушивают под струей азота. Затем опору из микропроволоки обрабатывают 2% раствором (3-аминопропил)триэтоксисилана в воде в атмосфере азота при комнатной температуре. После этого опору промывают дихлорметаном и обдувают струей азота. После промывки этанолом опору из микропроволоки обрабатывают 2 мМ раствором сложного N-гидроксисукцинимидного эфира 4-малеимидомасляной кислоты в этаноле в течение 16 часов и промывают этанолом. Опору из микропроволоки затем обрабатывают EcoR I ферментом в количестве 600 единиц на метр опоры из микропроволоки в ТЕ буфере с рН 8,0 (0,1 М трис(гидроксиметил)аминометан и 1 мМ этилендиаминотетрауксусная кислота в воде; рН доводится до 8,0 соляной кислотой) в течение 16 часов и промывают ТЕ буфером.

Пример 3. Использование EcoR I-активированной опоры из микропроволоки для обработки плазмиды, чувствительной к EcoR I

2,5 мкг/мл раствор pCMS-EGFP плазмиды (BD Bioosciences, Catalogue number 6101-1), содержащий единственный целевой центр для EcoR I фермента, подвергают воздействию EcoR I-активированной опорой из микропроволоки в течение 4 часов в водном растворе, содержащем 50 мМ NaCl, 100 мМ трис(гидроксиметил)аминометана, 10 мМ MgCl2 и 0,025% Тритона Х-100, при рН 7,5 и температуре 37°С. Влияние EcoR I-активированной опоры из микропроволоки на плазмидную молекулу анализируют методом электрофореза на агарозном геле. Неактивированную опору из микропроволоки используют в качестве отрицательного контроля. Электрофоретический анализ активности EcoR I-активированной опоры из микропроволоки на плазмидных молекулах

600 мкл образцы надосадочной жидкости, получаемой после обработки с EcoR I-активированной опорой из микропроволоки, высаживают в 70% этаноле, растворяют в воде и подвергают электрофорезу на протяжении 40 минут при 10,5 В/см в 0,8% агарозном геле в ТАЕ (0,04 М трис(гидроксиметил)аминометан; 0,001 М этилендиаминтетрауксусная кислота, рН доводится до 8,5 при помощи ледяной уксусной кислоты), с использованием ТАЕ в качестве проточного буфера. Гель окрашивают в 0,5 мкг/мл растворе бромистого этидия в ТАЕ в течение 20 минут и наблюдают под ультрафиолетовым светом. Только EcoR I-активированная опора из микропроволоки оказывает какое-либо влияние на молекулу плазмиды.

Пример 4. Получение авидин-активированной опоры из микропроволоки (амидная связь и карбамидная связь)

Опору из микропроволоки выдерживают на протяжении 20 минут в растворе, состоящем из 1 объема 33% перекиси водорода и 4 объемов концентрированного аммиака. Опору из микропроволоки затем промывают три раза водой и обрабатывают дважды концентрированной серной кислотой в течение 30 минут. Опору из микропроволоки затем тщательно промывают водой и разрушают ультразвуком в течение 10 минут в воде, промывают этанолом и высушивают под струей азота. Затем следуют две различные процедуры, Процедура 1 или Процедура 2, которые проводят для получения авидин-активированной опоры из микропроволоки.

Процедура 1 (амидная связь)

Опору из микропроволоки затем выдерживают в дихлорметане, содержащем 2% 7-окт-1-енилтрихлоросила, на протяжении 16 часов при комнатной температуре под атмосферой азота, после чего промывают вначале дихлорметаном, второй раз - метанолом, а в конце - водой. Полученную опору из микропроволоки выдерживают в водном растворе 0,5 мМ КМnO4, 14,7 мМ NaIO4 и 3 мМ К2СО3, на протяжении 24 часов, а затем промывают водой и обрабатывают водным раствором 0,05 М N-гидроксисукцинимида и 0.2 М N-(3-диметиламинопропил)-N'-этилкарбодиимид гидрохлорида в течение 7 минут. Опору из микропроволоки затем промывают фосфатно-солевым буфером (PBS) с рН 7,0 и выдерживают на протяжении 16 часов в PBS, содержащем авидин в концентрации 0,2 мг/мл-1. Авидин-активированную опору из микропроволоки промывают водой, затем 20% этанолом, высушивают струей азота и хранят при комнатной температуре до тех пор, пока он не будет использоваться.

Процедура 2 (карбамидная связь)

Опору из микропроволоки затем обрабатывают 2% раствором 3-(изоцианопропил)-триэтоксисилана в дихлорметане при комнатной температуре в течение 16 часов под атмосферой азота. Полученную опору из микропроволоки выдерживают в диметилформамидном растворе, содержащем авидин в концентрации 0,2 мг/мл-1, на протяжении 1 часа при комнатной температуре и тщательно промывают водой.

Пример 5. Использование авидин-активированной опоры из микропроволоки для иммобилизации биотинсвязывающих субстратов

Способность авидин-активированной опоры связывать биотин анализируют следующим образом. Авидин-активированную опору из микропроволоки выдерживают вместе с конъюгатом флуоресцеин-биотин в фосфатно-солевом буфере (PBS) на протяжении 45 минут при комнатной температуре. Затем опору промывают при помощи PBS и наблюдают флуоресценцию, испускаемую биотинсвязывающим флуоресцеином на поверхности авидин-активированной опоры, в микроскопе под ультрафиолетовым светом. Неактивированную опору из микропроволоки используют в качестве негативного контроля.

Пример 6. Получение олигонуклеотид-активированной опоры

Процедура 1 (амидная связь)

Опору из микропроволоки выдерживают на протяжении 20 минут в растворе, состоящем из 1 объема 33% перекиси водорода и 4 объемов концентрированного аммиака. Опору из микропроволоки затем промывают три раза водой и обрабатывают дважды концентрированной серной кислотой в течение 30 минут. После этого, опору из микропроволоки тщательно промывают водой и разрушают ультразвуком в воде на протяжении 10 минут, промывают этанолом и высушивают струей азота. Опору из микропроволоки затем выдерживают в дихлорметане, содержащем 2% 7-окт-1-енилтрихлоросила, на протяжении 16 часов при комнатной температуре в атмосфере азота, а затем промывают вначале дихлорметаном, второй раз - метанолом, а в конце - водой. Полученную опору из микропроволоки выдерживают в водном растворе 0,5 мМ КМnO4, 14,7 мМ NaIO4 и 3 мМ К2СО3 на протяжении 24 часов, а затем промывают водой и обрабатывают водным раствором 0,05 М N-гидроксисукцинимида и 0,2 М N-(3-диметиламинопропил)-N'-этилкарбодиимид гидрохлоридом в течение 7 минут. Опору из микропроволоки затем промывают фосфатно-солевым буфером (PBS) с рН 7,0 и выдерживают на протяжении 16 часов в PBS, содержащем 10 нмоль H2N-d(CTT)7 олигонуклеотида на квадратный метр поверхности опоры.

Олигонуклеотид-активированную опору из микропроволоки промывают водой, затем этанолом, высушивают струей азота и хранят при комнатной температуре до тех пор, пока не используют.

Процедура 1 (авидино-биотиновый мостик)

В качестве альтернативы, олигонуклеотид-активированную опору из микропроволоки получают выдерживанием авидин-активированной опоры из микропроволоки в фосфатно-солевом буфере (PBS) с рН 7,5, содержащем 0,2 мкм биотин-d(CTT)7 олигонуклеотид, на протяжении 45 минут с последующей стадией промывки в PBS.

Пример 7. Использование опор из микропроволоки в качестве подложки для выращивания клеток

Стерильную опору из микропроволоки выдерживают на протяжении двух часов в канале, содержащем культивируемую среду для выращивания эукариотических клеток. Весь процесс проводят в стерильных условиях. Затем, суспензию эукариотической клеточной линии с концентрацией 1,5·106 клеток на мл заливают в канал, содержащий опору из микропроволоки, и выдерживают при 37°С на протяжении ночи в атмосфере 5% СО2. На следующий день культивируемую среду заменяют на свежую среду, а канал связывают с насосной системой для непрерывной замены среды. Клеточный рост на поверхности опоры из микропроволоки подтверждается путем непосредственного наблюдения за клетками на поверхности опоры из микропроволоки под микроскопом.

Пример 8. Использование опор из микропроволоки для конструирования устройства на основе технологии SSB

Для того чтобы получить устройство по изобретению на основе опоры из микропроволоки, устройства по изобретению по технологии SSB, опору из микропроволоки располагают таким образом, чтобы несколько непрерывных, параллельных элементов опоры из микропроволоки выравнивались от верха до низа каждой функциональной единицы, являющейся функциональной единицей длины устройства, которое содержит только целые элементы опоры из микропроволоки, и является индивидуальной длиной каждого элемента опоры из микропроволоки, который тянется от верха до низа функциональной единицы. Входное отверстие устройства опоры из микропроволоки соединяют с сосудом, заполненным исходным материалом, через кремниевую трубку, а выходное отверстие устройства соединяют также через кремниевую трубку с трехходовым клапаном, который ведет либо к резервуару, содержащему готовый продукт, либо к отходам в зависимости от положения регулировки клапана.

Пример 9. Использование олигонуклеотид-активированной опоры из микропроволоки для очистки плазмидной ДНК

Два олигонуклеотида, d[GATC(GAA)17GTATACT] (SEQ ID NO:2) и d[GATCAGTATAC(TTB)17] (SEQ ID NO:3) фосфорилируют по положению 5' и гибридизируют для образования двухцепочечной ДНК аффинной последовательности. Плазмиду рСМS-ЕСРР/GAA17 конструируют внедрением ДНК аффинной последовательности SEQ ID NO:2 в BgI II сайт рестрикции pCMS-EGFP. Олигонуклеотид-активированную опору из микропроволоки уравновешивают в течение 30 минут в связывающем буфере (2 М NaCl, 0,2 М ацетат натрия, рН 4,5). Затем олигонуклеотид-активированную опору из микропроволоки выдерживают на протяжении двух часов при комнатной температуре в связывающем буфере, содержащем плазмиду pCMS-EGFP/GAA17 в концентрации 10 мкг/мл-1. Плазмида рСMS-ЕGFР/GАА17 содержит (GAA)17 нуклеотидную последовательность (SEQ ID No.:4), которая связана с (СТТ)7 олигонуклеотидной последовательностью (SEQ ID NO:1) на олигонуклеотид-активированной опоре из микропроволоки. Носитель затем промывают в связывающем буфере, и вынимают образец для микроскопического анализа. Носитель затем выдреживают в течение 1 часа в элюирующем буфере (1 М трис(гидроксиметил)аминометан; 0,05 М этилендиаминтетрауксусная кислота, рН 9,5). Материал возвращают в элюирующий буфер, содержащий плазмиду pCMS-EGFP/GAA17 в концентрации 1,2 мкг/мл-1, что определяется методом спектрофлуориметрии. Плазмиду pCMS-EGFP, которая лишена комплементарной нуклеотидной последовательности (GAA)17, используют в качестве отрицательного контроля.

Изучение опоры из микропроволоки, нагруженной плазмидой

Олигонуклеотид-активированную опору из микропроволоки, нагруженную плазмидой pCMS-EGFP/GAA17 так, как описывается выше, промывают в визуализационном буфере (0,1 М NaCl, 0,02 М ацетат натрия, рН 4,5). Затем опору выдерживают в течение 10 минут в разбавленном 1:400 растворе PicoGreen (Molecular Probes; USA) - ДНК-связывающего флуоресцентного реагента - в визуализационном буфере. Носитель затем промывают в визуализационном буфере и наблюдают за ним с помощью микроскопа при люминисцентном излучении. Только олигонуклеотид-активированная опора из микропроволоки, обработанная pCMS-EGFP/GAA17 плазмидой, показывает флуоресценцию благодаря эмиссии света от ДНК-связывающего флуоресцентного реагента, связанного с плазмидой pCMS-EGFP/GAA17 на поверхности опоры.

Пример 10. Использование адсорбции на устройстве по технологии SSB для модификации иммобилизованной плазмидной ДНК молекулы

Опору из микропроволоки, активируемую d(CTT)7 олигонуклеотидом и BsrB I рестрикционным ферментом, применяют для получения устройства по технологии SSB, а это устройство связывают с сосудами при помощи кремниевой трубки, насоса и вентиля так, как описывается в предыдущих примерах. Связывающий буфер (2 М NaCl, 0,2 М ацетат натрия, рН 4,5), содержащий плазмиду pCMS-EGFP/GAA17 в концентрации 10 мкг/мл-1, которая содержит два центра для BsrB I фермента и ДНК последовательность, комплементарную к (СТТ)7, нагнетают насосом через систему при комнатной температуре на протяжении двух часов со скоростью 1 см/мин-1. Затем подаваемый в систему раствор заменяют на рестрикционный буфер (0,1 М NaCl, 0,02 М ацетат натрия, 10 мм MgCl2, рН 5,5) в течение 2 часов. Затем подаваемый в систему раствор заменяют на элюирующий буфер (1 М трис(гидроксиметил)аминометан; 0,05 М этилендиаминтетрауксусная кислота, рН 9,5), при этом проводят магнитное встряхивание так, как описано на следующих примерах. Эффект от активирования устройства по технологии SSB, оказываемый на плазмидную молекулу, оценивают путем измерения размера конечных ДНК фрагментов в агарозном геле после обрабокти модифицированной молекулы плазмиды pCMS-EGFP/GAA 17 при помощи EcoR I.

Пример 11. Разделение материала, содержащего частицы на устройствах на основе технологии SSB

Данная система может использоваться для разделения частиц от текучей среды, в которой они содержатся, что описывается на следующем примере.

Устройство по технологии SSB на основе опор из микропроволоки собирают так, как описывается выше. Это устройство устанавливают в систему так, как описывается в предыдущих примерах. Суспензию магнитных частиц в воде непрерывно нагнетают насосом при скорости потока 1 мл/мин через устройство по технологии SSB, в это же время прикладывают внешнее магнитное поле при помощи зафиксированных магнитов. После оседания магнитных частиц на поверхности опоры из микропроволоки их можно обнаружить по их магнитному взаимодействию с опорой из микропроволоки. Когда концентрация магнитных частиц, проходящих через устройство по технологии SSB становится такой же, как и в подаваемой суспензии, что измеряется методом турбидиметрии, входной поток заменяется на воду, а внешнее магнитное поле элиминируется путем извлечения магнитов. Магнитные частицы возвращаются в резервуар с готовым продуктом системы по технологии SSB.

Пример 12. Магнитное встряхивание устройства настоящего изобретения

Процедура магнитного встряхивания разработана как вспомогательное средство на стадии элюирования и десорбции из опоры из микропроволоки при проведении процесса на устройстве. Это иллюстрируется следующим описанием: устройство настоящего изобретения, активированное олигонуклеотидом, размещают так, как описывается в примере по получению устройств с опорами из микропроволоки.

10 мкг/мл-1 раствор плазмиды pCMS-EGFP/GAA17 в связывающем буфере (2 М NaCl, 0,2 М ацетата натрия, рН 4,5) рециркулируют через систему с помощью насоса со скоростью 1 мл/мин-1 в течение двух часов. Затем поток заменяют на промывной связывающий буфер (0,1 М NaCl, 0,02 М ацетат натрия, рН 4,5) в течение 5 минут. Затем с устройством на основе технологии SSB проводят встряхивающее движение путем приложения внешнего вибрирующего магнитного поля, в то время как внутренний поток заменяют на элюирующий буфер (1 М трис(гидроксиметил)аминометан; 0,05 М этилендиаминтетрауксусная кислота, рН 9,5). Материал возвращают в элюат, содержащий плазмиду pCMS-EGFP/GAA17 в концентрации 2,1 мкг/мл-1, что измеряется методом спектрофлуориметрии.

Пример 13. Твердофазный синтез ДНК на устройства по технологии SSB с использованием температурных сдвигов, вызываемых пропусканием электрического тока через опору из микропроволоки

Активированную затравкой опору из микропроволоки получают так, как описано в предыдущих примерах для опоры из микропроволоки, активированной олигонуклеотидом только с одним различием, заключающимся в замене H2N-d(TTTGTGATGCTCGTCAGGG) олигонуклеотида (SEQ ID NO:5) на H2N-d(CTT)7 олигонуклеотид (SEQ ID NO:1). Такую опору из микропроволоки, активированную затравкой, используют для получения устройства по технологии SSB так, как описывается в предыдущих примерах. Металлический стержень всех элементов опоры из микропроволоки в одном конце устройства связывают с положительным полюсом источника электропитания, тогда как металлический стержень всех элементов опоры из микропроволоки в другом конце неподвижного опорного слоя связывают с отрицательным полюсом источника электропитания. Это устройство по технологии SSB размещают таким образом, чтобы получалось устройство по технологии SSB так, как описывается в предыдущих примерах, где соединения с источником электричества любого из концов устройства электрически изолируют от внутреннего пространства устройства на основе технологии SSB. Пропусканием электрического тока различной величины между полюсами можно регулировать температуру устройства по технологии SSB в интервале от 30°С до 95°С. Два термостатических устройства связывают с концами устройства по технологии SSB таким способом, чтобы температура втекающей и вытекающей жидкостей поддерживалась в интервале от 30°С до 95°С. Эти устройства состоят из катушек, наполненных водой и окружающих внешнюю трубку, прикрепленную к устройству по технологии SSB. Водный раствор с рН 8,8, содержащий 200 мкМ dNTP, 20 мМ Трис-HCl, 10 мМ KCl, 10 мМ (NH4)2SO4, 0,1% Тритон Х-100, Тводн. ДНК полимеразу с концентрацией 0,3 единицы на мл-1, 0,5 мкМ d(TTTGTGATGCTCGTCAGGG) (SEQ ID NO:5) и 1 пкг/мл-1 фрагмента линейной двухцепочечной ДНК, содержащего последовательность TTTGTGATGCT CGTCAGGGAATTC (SEQ ID NO:6) на 5'-конце и последовательность GAATTCCCTGACGAGCATCACAAA (SEQ ID NO:7) на 3'-конце, непрерывно рециркулируют через описанную выше систему до тех пор, пока не проведут 30 циклов по сдвигу температуры, каждый цикл состоит из 2 минут при 90°С, 2 минут при 55°С и 5 минут при 72°С. Затем добавляют EcoR I фермент с концентрацией 1 ед./мл-1 к раствору, содержащемуся в системе, и поддерживают температуру при 37°С в течение 1 часа. В конце раствор, содержащийся в системе, возвращают и переносят в хроматографическую систему с гель-фильтрацией для отделения расширенного фрагмента двухцепочечной ДНК от ферментов и остаточных компонентов реакции.

Пример 14. Использование опор из микропроволоки для получения устройства по технологии SSB, используемого для выращивания клеток

Тринадцать связок опор из микропроволоки получают следующим образом: опоры из микропроволоки длиной 11 см распределяют по 13 группам, при этом на одну группу приходится 100 параллельных опор из микропроволоки. Связку получают из каждой групп опор из микропроволоки путем связывания вместе концов на одной стороне опор из микропроволоки и нанесением расплавленного пластикового материала. Затем ту же самую процедуру проводят и на другом конце опор из микропроволоки.

Восемь фильтровальных мембран с размером пор 0,2 мкм, длиной 10,75 см и конструкцию из полых волокон с размером полости 0,5 мм получают так, что полость при одном из концов каждого волокна блокируется путем свертывания волокна при том конце, в то время как другой конец остается открытым.

Затем связки и фильтровальные мембраны выравнивают параллельно друг к другу так, что фильтровальные мембраны имеют открытый конец на одной стороне группировки, а другие четыре имеют открытый конец на другой стороне. Затем все концы на одной стороны группировки вдавливают в пластиковый диск диаметром 15 мм и толщиной 5 мм. Концы на другой стороне группировки вдавливают в диск, аналогичный предыдущему, но продырявленный в центре, для того чтобы получить засевное отверстие, состоящее из 1 мм канала, проходящего через диск. Концы связок простираются вдоль диска точно до точки, где достигается поверхность другой стороны диска. Открытые концы фильтровальных мембран проходят через диски точно до точки, где находится открытый конец из другой стороны диска. Закрытые концы фильтровальных мембран проходят через диск наполовину расстояния между обеими сторонами диска.

Это устройство, содержащее связки, фильтровальные мембраны и диски стерилизуют, а канал на диске закупоривают с помощью съемного затвора. Затем устройство помещают в стерильных условиях в стеклянный цилиндр длиной 11 см и с внутренним диаметром 15 мм. Затем диски и открытые части стеклянного цилиндра закупоривают вместе для того, чтобы образовалось устройство по технологии SSB для клеточного роста.

Конец устройства по технологии SSB для выращивания клеток посредством воздействия катализатора связывают в стерильных условиях с кремниевой трубкой и культивируемой средой при 37°С и насыщают в атмосфере 5% CO2, после чего поддают вверх через трубку до тех пор, пока устройство по технологии SSB для клеточного роста частично не наполнится. Затем суспензию эукариотической клеточной линии с концентрацией 1,5·106 клеток на мл вводят в устройство по технологии SSB для клеточного роста через засевное отверстие, а засевное отверстие закупоривают. Кремниевую трубку связывают с открытой стороной устройства по технологии SSB для клеточного роста и культивируемой средой при 37°С, и насыщенную в атмосфере 5% CO2 непрерывно подают в устройство по технологии SSB для выращивания клеток.

1. Устройство для очистки, разделения, модификации и/или иммобилизации химических или биологических объектов, находящихся в текучей среде, посредством связывания химического или биологического объекта с функциональным покрытием или лигандами, находящимися на поверхности опор из микропроволоки при отсутствии воздействия магнитного поля, создаваемого между опорами из микропроволоки и частицами, находящимися в текучей среде, на разделение названных частиц, которое содержит по меньшей мере одну опору из микропроволоки, закрепленную своими концами и имеющую многослойную структуру, состоящую из центрального стержня и по меньшей мере одного покрывающего слоя и пригодную для связывания химических или биологических объектов, при этом поверхность микропроволоки модифицирована путем присоединения лигандов или нанесением на нее функционального покрытия.

2. Устройство по п.1, в котором центральный стержень и покрывающие слои выполнены из материала, выбранного из группы, включающей стеклянный, металлический, керамический, полимерный и пластиковый материал.

3. Устройство по п.2, в котором центральный стержень указанных опор из микропроволоки выполнен из металла, а по меньшей мере один покрывающий слой указанных опор из микропроволоки выполнен из стекла.

4. Устройство по п.1, которое имеет максимальный размер поперечного сечения от 0,5 см до 1,5 м, а длину от 0,5 см до 10 м.

5. Устройство по п.4, которое имеет максимальный размер поперечного сечения от 0,5 см до 50 см, а длину от 5 см до 1,5 м.

6. Устройство по п.1, в котором опоры из микропроволоки имеют максимальный размер поперечного сечения от 1 до 1000 мкм, а отношение их длины к максимальному размеру поперечного сечения составляет более 5.

7. Устройство по п.6, в котором опоры из микропроволоки имеют максимальный размер поперечного сечения от 1 до 100 мкм, а отношение их длины к максимальному размеру поперечного сечения составляет более 50.

8. Устройство по п.7, в котором для опор из микропроволоки отношение длины к максимальному размеру их поперечного сечения составляет более 500.

9. Устройство по п.8, в котором для опор из микропроволоки отношение длины к максимальному размеру их поперечного сечения составляет более 1000.

10. Устройство по п.1, в котором любая опора из микропроволоки, взятая в отдельности, образует угол от 0 до 45° с любой другой смежной опорой из микропроволоки.

11. Устройство по п.1, в котором угол между любой опорой из микропроволоки, взятой в отдельности, и любой другой смежной опорой из микропроволоки составляет от 0 до 10°.

12. Устройство по п.1, в котором поверхность опор из микропроволоки модифицирована путем нанесения на нее функционального покрытия, выбранного из группы, включающей полимерное, белковое, желатиновое и коллагеновое покрытие.

13. Устройство по п.1, в котором лиганд выбран из группы, включающей клетки, биологические ткани, антитела, антибиотики, антигены, нуклеиновые кислоты, пептиды, гормоны, коферменты, биологические катализаторы, химические катализаторы, химические реагенты, липиды, сахара, аминокислоты, белки, нуклеотиды, соединение, содержащее функциональную группу, выбираемую из нижеследующих: диэтиламиноэтил, четвертичный аминоэтил, четвертичный аммоний, карбоксиметил, сульфопропил, метилсульфонат, бутил, октил, фенил и их смеси.

14. Устройство по п.1, в котором лиганд выбран из группы, включающей клетки, биологические ткани, антитела, антибиотики, антигены, нуклеиновые кислоты, пептиды, гормоны, коферменты, биологические катализаторы, химические катализаторы, химические реагенты, липиды, сахара, аминокислоты, белки, нуклеотиды и их смеси.

15. Устройство по п.1, в котором указанные лиганды связаны с опорой из микропроволоки через линкер, который выбран из группы, включающей полимерное покрытие, белковое покрытие, желатиновое покрытие, коллагеновое покрытие, клетки, антитела, антигены, нуклеиновые кислоты, пептиды, коферменты, липиды, сахара, аминокислоты, белки, нуклеотиды, циануровый хлорид, хинин, п-ртутьбензоат, фенилборную кислоту, и соединение, содержащее функциональную группу, выбираемую из нижеследующих: альдегид, ароматический амин, нитрен, малеимид, карбоновая кислота, изоцианат, диэтиламиноэтил, четвертичный аминоэтил, четвертичный аммоний, карбоксиметил, сульфопропил, метилсульфонат, бутил, октил, фенил и их смеси.

16. Опора из микропроволоки, закрепленная своими концами и предназначенная для использования в составе устройства по п.1, имеющая многослойную структуру, состоящую из центрального стержня и по меньшей мере одного покрывающего слоя, при этом поверхность микропроволоки модифицирована путем присоединения лигандов непосредственно или через линкер или нанесения на нее функционального покрытия, которое может ковалентно или нековалентно связываться с объектом и при этом не является полимерным.

17. Опора по п.16, в которой центральный стержень и покрывающие слои выполнены из материала, выбранного из группы, включающей стеклянный, металлический, керамический, полимерный и пластиковый материал.

18. Опора по п.16, в которой стержень выполнен из металла, а по меньшей мере один покрывающий слой выполнен из стекла.

19. Опора по п.16, которая имеет максимальный размер поперечного сечения в интервале от 1 до 1000 мкм, а отношение ее длины к максимальному размеру поперечного сечения составляет более 5.

20. Способ очистки, разделения, модификации и/или иммобилизации химических или биологических объектов, находящихся в текучей среде, посредством устройства по п.1, в котором вначале осуществляют загрузку текучей среды, содержащей химические или биологические объекты, во внутренний объем канала, в который помещают вышеуказанное устройство, затем проводят связывание химических или биологических объектов с опорой вышеназванного устройства, после чего необязательно осуществляют химическую или биологическую модификацию объекта, необязательно промывают канал и сливают нежелательные компоненты и примеси текучей среды и после этого проводят элюирование полученных химических или биологических объектов, при этом если магнитное поле оказывает влияние на указанное устройство, то его не используют для разделения восприимчивых к магнитному полю частиц, находящихся в текучей среде, посредством магнитного взаимодействия между опорами из микропроволоки и указанными частицами.

21. Способ по п.20, в котором к указанному устройству подводят электрический ток.

22. Способ по п.20, в котором к указанному устройству прикладывают магнитное поле для встряхивания и/или нагревания системы.

23. Способ по п.20, в котором иммобилизуют и культивируют клетки.

24. Способ по п.23, в котором стадия загрузки текучей среды, содержащей химические или биологические объекты, во внутренний объем канала с указанным устройством включает в себя загрузку среды для культивирования и суспензии по меньшей мере одной клеточной линии и, необязательно, последующую непрерывную загрузку среды для культивирования во внутренний объем канала с указанным устройством.



 

Похожие патенты:
Изобретение относится к области электронной техники и может быть использовано в производстве газоразрядных индикаторных панелей (ГИП). .
Изобретение относится к области электронной техники и может быть использована в производстве газоразрядных индикаторных панелей, а именно в получении антибликового покрытия.

Изобретение относится к области электронной техники и может быть использовано в производстве газоразрядных индикаторных панелей (ГИП). .
Шликер // 2196366
Изобретение относится к области электротехники, в частности к производству газоразрядных индикаторных панелей (ГИП), где шликер используется при их герметизации. .

Изобретение относится к области электронной техники и может быть использовано при изготовлении газоразрядных индикаторных панелей постоянного и переменного тока.

Изобретение относится к области электронной техники и может быть использовано в производстве индикаторов, в том числе газоразрядных индикаторных панелей (ГИП), выполненных методом толстопленочной технологии.
Изобретение относится к области электронной техники и может быть использовано при изготовлении газоразрядных индикаторных панелей (ГИП). .

Изобретение относится к области генетической инженерии и может быть использовано в практических целях для ингибирования в клетках продукции целевых белков. .
Изобретение относится к биотехнологии, а именно к способу получения плазмидной ДНК из бактериальных клеток. .
Изобретение относится к биотехнологии, а именно к способу выявления РНК вируса респираторно-синцитиальной инфекции крупного рогатого скота, и может быть использовано в ветеринарии.

Изобретение относится к области биотехнологии, в частности к выделению физиологически активных соединений, и может быть использовано в медицине. .

Изобретение относится к области молекулярной биологии, а именно к способу выделения и очистки дезоксирибонуклеиновых кислот (ДНК) из образцов тканей растений, а также продуктов переработки растительного и животного происхождения.

Изобретение относится к способам праймер-зависимого размножения нуклеиновых кислот в иммобилизованных средах, в частности, к способам обнаружения продуктов такого размножения.

Изобретение относится к области биотехнологии, конкретно к множественной RT-PCR с удлинением цепи путем перекрывания. .

Изобретение относится к сельскому хозяйству, а именно к способу экстракции рибонуклеиновой кислоты (РНК) из растительных образцов различного происхождения. .

Изобретение относится к области биотехнологии и медицины, а именно к созданию полимерных материалов на основе хитозана, обладающих низкой токсичностью и повышенной биосовместимостью, в частности, пленок, микрокапсул, гидрогелей, раневых покрытий, скаффолдов и т.д.
Наверх