Способ структурной характеристики рекомбинантного поликлонального белка или поликлональной клеточной линии

Настоящее изобретение относится к способу структурной характеристики образца, содержащего гомологичные рекомбинантные антитела. Способ включает анализ аликвот указанного образца одним или несколькими методами характеристики белков, выбранными из хроматографических анализов. Также предлагается способ характеристики образца поликлональной клеточной линии, продуцирующей эти антитела. Данный способ основан на методах генетического анализа, выбранных из RFLP и Т-RFLP. Эти способы могут применяться как отдельно, так и в комбинации друг с другом. Предложенные способы позволяют получить информацию о наличии и относительных количествах различных индивидуальных белков или кодирующих последовательностей. Полученная информация может быть использована для оценки стабильности поликлональной клеточной линии в процессе ее получения, а также для оценки состава различных партий конечных поликлональных продуктов. Способы позволяют охарактеризовать композицию, состоящую более чем из 10, 20 или даже большего числа антител. 2 н. и 14 з.п. ф-лы, 18 ил., 18 табл.

 

Область, к которой относится изобретение

Настоящее изобретение относится к способу структурной характеристики рекомбинантного поликлонального белка или поликлональной клеточной линии, продуцирующей такой белок, для подтверждения состава различных партий конечных продуктов, а также стабильности композиции в процессе одного из производственных циклов. В частности, настоящее изобретение относится к способу характеристики рекомбинантного поликлонального антитела.

Предшествующий уровень техники

Уже давно известно, что введение антител в профилактических или терапевтических целях (так называемая пассивная иммунизация) может усиливать способность иммунной системы организма элиминировать инфекционные агенты. Такие терапевтические антитела исторически получали из плазмы человека (а поэтому такая композиция антитела была названа “иммуноглобулином” или “гамма-глобулином”). Для получения этих антител кровь иммунизованных людей-доноров объединяли и полученную иммуноглобулиновую фракцию экстрагировали и очищали. Специфичностью к данному конкретному антигену обладает только одна фракция иммуноглобулина. Терапевтическое применение иммуноглобулина имеет определенные трудности в связи с некоторыми ограничениями, такими как ограниченное число доноров, дорогостоящая процедура получения иммуноглобулина, риск передачи инфекционного загрязнения от доноров, неизбежное отличие одной партии от другой, а также сложность режимов введения.

Недавно были получены рекомбинантные моноклональные антитела, которые являются альтернативой продуктам иммуноглобулина. Однако они направлены только против одной мишени, а поэтому не могут быть эффективными против комплексных или динамичных мишеней, таких как инфекционные агенты. Для решения этой проблемы существует несколько примеров смешивания моноклональных антител (например, Novakowski et al., 2002, Proc. Natl. Acad. Sci., USA, 99, 11346-11350 и патент США № 5126130).

Недавно была разработана технология рекомбинантного продуцирования высокоспецифических поликлональных антител, подходящих для профилактического и терапевтического введения (WO 2004/061104). Рекомбинантное поликлональное антитело (rpAb) может быть выделено из промышленного биореактора в виде одного препарата без разделения, обработки, очистки или характеристики отдельных членов, составляющих рекомбинантный поликлональный белок. Однако такой способ получения требует проведения процедуры подтверждения идентичности и соответствующего состава полученной сложной смеси молекул антител в течение всего производственного цикла.

Кроме того, для получения разрешения Национальных и Наднациональных органов на проведение исследований по разработке и терапевтическому применению лекарственного средства поликлональное антитело, полученное рекомбинантным методом, должно быть, до некоторой степени, охарактеризовано. Поскольку технология получения рекомбинантного поликлонального антитела представляет собой абсолютно новую концепцию, то никогда ранее не были предприняты попытки охарактеризовать образец, содержащий множество различных, но в высокой степени гомологичных белков с точки зрения относительного соотношения отдельных белков в образце. Так, например, разрешение на применение выделенного из крови иммуноглобулина обычно получают только после получения данных о неклинической и клинической эффективности продукта, а в большинстве случаев - после предварительного получения данных о его безопасности, а также после проведения анализа на химическую структуру неочищенного продукта, оценки технологических данных и контрольных (СМС) параметров, таких как чистота, титр связывания и отсутствие посторонних агентов. Разумеется, что такой упрощенный подход не приемлем для белков, получаемых рекомбинантным способом. Поэтому Регуляторные органы постановили, что каждое антитело-компонент, входящее в состав смеси нескольких моноклональных антител, должно быть охарактеризовано отдельно в соответствии с известными методами химической характеристики в комбинации с биологическими анализами. Однако пока еще не существует технически осуществимого или подходящего способа определения истинного состава поликлональной композиции, состоящей из более чем 10, 20 или даже большего числа различных антител.

Сущность изобретения

Настоящее изобретение относится к способу структурной характеристики, проводимой для определения состава смеси различных гомологичных белков, такой как рекомбинантный поликлональный белок, а в частности рекомбинантное поликлональное антитело, продуцируемое поликлональной клеточной линией.

Описание изобретения

Необходимым требованием для промышленного получения рекомбинантного поликлонального белка для профилактического и терапевтического применения является сохранение его клонального разнообразия в процессе экспрессии. Поэтому очень важным фактором является возможность проведения мониторинга и определения клонального разнообразия поликлональной клеточной линии, продуцирующей поликлональное антитело, а также возможность получения относительного воспроизведения отдельных белков в поликлональном белке в любой нужный момент времени и в любом релевантном образце, что позволило бы проводить анализ на стабильность экспрессионной системы в процессе производства одной партии, а также проводить оценку различий между партиями конечного продукта.

Композиции гомологичных белков, такие как рекомбинантное поликлональное антитело или рекомбинантный поликлональный Т-клеточный рецептор (ТсR), состоят из различных белков с очень похожими физико-химическим свойствами. Это является преимуществом для очистки поликлонального белка, получаемого рекомбинантным способом, поскольку такая очистка может быть осуществлена тем же способом, как и в случае одного белка, но без потери разнообразия в составе поликлонального белка в процессе его очистки. Однако такое сходство физико-химических свойств связано с определенными трудностями, возникающими при характеристике относительного распределения отдельных членов поликлонального белка, поскольку такое сходство затрудняет дифференциацию одного конкретного члена этой композиции от другого.

Более конкретно, при получении рекомбинантного поликлонального белка его исходный состав является известным, поскольку последовательности, кодирующие этот поликлональный белок, были выделены, скринированы и секвенированы для получения поликлональной клеточной линии-продуцента, используемой для продукции рекомбинантного поликлонального белка. Описание получения такой клеточной линии можно найти в заявке WO 2004/061104, которая приведена в настоящей заявке в качестве ссылки. За редким исключением, могут возникать ситуации, когда для получения рекомбинантного поликлонального антитела непосредственно используется нескринированная или неотобранная библиотека, например, полученная у выздоравливающего пациента.

Для гарантии того, что после культивирования и очистки полученный продукт (рекомбинантный поликлональный белок) по своему разнообразию будет совпадать с исходным продуктом (библиотекой кодирующих последовательностей), необходимо получить информацию об относительном соотношении отдельных членов поликлонального белка и/или их кодирующих последовательностей в поликлональной клеточной линии-продуценте. Настоящее изобретение относится к способу структурной характеристики на основе генетических анализов, а также к способам характеристики белка, которые позволяют получать информацию о разнообразии поликлональных клеточных линий и поликлональных белков.

Определения

Термин “антиидиотипическое антитело” означает полноразмерное антитело или его фрагмент (например, Fv, scFv, Fab, Fab' или F(ab)2), которые специфически связываются с вариабельной частью отдельного члена поликлонального белка. Предпочтительно антиидиотипическое антитело по изобретению специфически связывается с вариабельной частью отдельного члена поликлонального антитела или поликлонального TcR. Такое антиидиотипическое антитело предпочтительно обладает специфичностью к антигенспецифической части отдельного члена поликлонального антитела или поликлонального Т-клеточного рецептора, т.е. так называемой V-области. Однако оно может быть специфичным к определенной субпопуляции отдельных членов, например к специфическому семейству генов VН, присутствующих в этой смеси.

Термин “антиидиотипический пептид” означает специфический пептидный лиганд, который может специфически связываться и тем самым идентифицировать отдельный член белка в смеси гомологичных белков. При этом предпочтительно, чтобы антиидиотипический пептид по изобретению специфически связывался с отдельным членом поликлонального антитела или поликлональным ТсR. Антиидиотипические пептиды по изобретению предпочтительно направлены против антигенспецифической части последовательности отдельного антитела или отдельного Т-клеточного рецептора. Один такой антиидиотипический пептид может также обладать специфичностью к определенной субпопуляции отдельных членов.

Термин ““групповое” N-концевое секвенирование” означает N-концевое секвенирование белка, присутствующего в образце, содержащем ряд вариантов гомологичных молекул белка, например поликлонального белка. Такое групповое секвенирование позволяет получить информацию о последовательностях всех отличающихся белков, одновременно присутствующих в данном образце. В положениях, где отдельные члены в образце отличаются по своему аминокислотному составу, они могут быть количественно оценены, и эти различные количества отдельных аминокислот в вариабельных положениях могут давать информацию о субпопуляции белка, имеющего конкретные модификации. Если белки, подвергаемые N-концевому секвенированию, содержат более чем одну субъединицу, то для снижения их вариабельности предпочтительно, чтобы перед секвенированием они были выделены; так, например, если указанный образец представляет собой поликлональное антитело, то перед секвенированием его тяжелые цепи могут быть отделены от легких цепей.

Термины “клональное разнообразие” или “поликлональность” означают вариабельность или разнообразие поликлональных белков, последовательностей нуклеиновой кислоты, кодирующих эти белки, или поликлональных клеточных линий, продуцирующих указанные белки. Такая вариабельность характеризуется различиями в аминокислотных последовательностях или в последовательностях нуклеиновой кислоты между отдельными членами поликлональных белков или библиотеки кодирующих последовательностей. Для поликлональных клеточных линий клональное разнообразие может быть оценено по вариабельности последовательностей нуклеиновой кислоты, присутствующих в клеточной линии, например по их односайтовой интеграции в геном отдельных клеток. Однако такое клональное разнообразие может быть оценено как вариабельность аминокислотных последовательностей, представленных на поверхности клеток в данной клеточной линии.

Термин “эпитоп” означает часть антигенной молекулы, с которой связывается Т-клеточный рецептор или антитело. Антиген или антигенная молекула, по существу, представляет одновременно несколько или даже множество эпитопов.

Термин “иммуноглобулин” обычно используется как общее название смеси антител, обнаруживаемых в крови или сыворотке. Следовательно, сывороточное поликлональное антитело часто называют иммуноглобулином или гамма-глобулином. Однако термин “иммуноглобулин” может также использоваться для обозначения смеси антител, происходящей от других источников, например рекомбинантного иммуноглобулина.

Используемый здесь термин “отдельный клон” означает изогенную популяцию клеток, экспрессирующих конкретный белок, например моноклональное антитело. Такие отдельные клоны могут быть, например, получены путем трансфекции клетки хозяина нужной нуклеиновой кислотой, и после отбора на положительные трансфектанты один отдельный клон может быть размножен либо могут быть собраны и размножены несколько отдельных клонов. Поликлональная клеточная линия может быть получена путем смешивания отдельных клонов, экспрессирующих различные отдельные члены поликлонального белка.

Термины “отдельный член” или “отличающийся член” означают молекулу белка белковой композиции, содержащей различные, но гомологичные друг другу молекулы, где отдельная молекула белка гомологична другим молекулами данной композиции, а также содержащей один или несколько фрагментов полипептидной последовательности, которые характеризуются тем, что аминокислотные последовательности отдельных членов поликлонального белка отличаются друг от друга, и которые также называются вариабельными областями. Так, например, в поликлональном антителе, состоящем из Ab1-Ab50, все белки с последовательностью Ab1 будут рассматриваться как отдельный член поликлонального антитела и белок Ab1 может, например, отличаться от белка Ab2 последовательностью в области CDR3. Субпопуляция отдельных членов может, например, состоять из антител, таких как Ab1, Ab12 и Ab33.

Термин “поликлональное антитело” означает композицию из различных молекул антител, способных связываться или реагировать с несколькими различными конкретными антигенными детерминантами на одних и тех же или других антигенах. Вариабельность поликлонального антитела наблюдается в так называемых вариабельных областях отдельных антител, составляющих поликлональное антитело, а в частности в комплементарность-определяющих областях (CDR1), CDR2 и CDR3.

Термины “поликлональная клеточная линия-продуцент”, “банк поликлональных клеток-хозяев, (рМСВ)” и “банк поликлональных рабочих клеток, (рWDC)” являются взаимозаменяемыми и относятся к популяции белок-экспрессирующих клеток, которые трансфецируют библиотекой представляющих интерес вариантов последовательностей нуклеиновой кислоты. Предпочтительно отдельные клетки, которые все вместе составляют рекомбинантную поликлональную клеточную линию-продуцент, несут только одну копию отдельной представляющей интерес последовательности нуклеиновой кислоты, кодирующей один член представляющего интерес рекомбинантного поликлонального белка, при этом каждая копия интегрируется в один и тот же сайт генома каждой клетки. Клетками, которые могут составлять такую клеточную линию-продуцент, могут быть, например, клетки бактерий, грибов, эукариотические клетки, такие как дрожжи, клетки насекомых или клетки млекопитающих, а в частности иммортализованные клеточные линии млекопитающих, такие как клетки СНО, клетки СОS, клетки ВНК, миеломные клетки (например, клетки Sp2/0, NS0), клетки NIH-3Т3, клетки YВ2/0 и иммортализованные человеческие клетки, такие как клетки НеLa, клетки НЕК 293 или клетки РЕR.С6.

Используемый здесь термин “поликлональный белок” означает белковую композицию, содержащую различные, но гомологичные молекулы белка, а предпочтительно молекулы, выбранные из суперсемейства иммуноглобулинов. Более предпочтительными являются гомологичные молекулы белка, которые представляют собой антитела или Т-клеточные рецепторы (ТсR). Таким образом, каждая молекула белка гомологична другим молекулам такой композиции, а также содержит один или несколько фрагментов вариабельной полипептидной последовательности, которые характеризуются тем, что аминокислотные последовательности отдельных членов поликлонального белка отличаются друг от друга, и которые также называются отдельными вариабельными членами поликлонального белка. Известными примерами таких поликлональных белков являются антитела, Т-клеточные рецепторы и В-клеточные рецепторы. Поликлональный белок может состоять из определенной субпопуляции молекул белка и определяется их общими признаками, такими как общая активность связывания с нужной мишенью, например, в том случае, когда поликлональное антитело направлено против нужного антигена-мишени. Рекомбинантный поликлональный белок обычно состоит из определенной субпопуляции молекул, где последовательность каждого такого члена является хорошо известной. Только в редких случаях рекомбинантный поликлональный белок может иметь сходство с сывороточным иммуноглобулином в том смысле, что этот рекомбинантный поликлональный белок также содержит значительное количество белков, не специфичных к данной мишени.

Термин “поликлональный Т-клеточный рецептор (ТсR)” означает композицию различных молекул ТсR, способных связываться или реагировать с несколькими различными специфическими антигенными детерминантами, происходящими от одних и тех же или от различных антигенов. Вариабельность поликлонального ТсR наблюдается в так называемых вариабельных областях отдельных молекул ТсR, составляющих поликлональный ТсR, а в частности в областях CDR1, CDR2, CDR3 и CDR4. Молекулами ТсR по изобретению являются сконструированные растворимые димеры, имеющие альфа-бета-цепи или гамма-дельта-цепи. Такие сконструированные ТсR описаны, например, в литературе (Willcox, B.E., et al., 1999, Protein Sci. 8, 2418-2423).

Термин “белок” означает любую аминокислотную цепь независимо от ее длины или посттрансляционных модификаций. Белки могут существовать в виде мономеров или мультимеров, содержащих две или более полипептидных цепей объединенных друг с другом, а также в виде их фрагментов, полипептидов, олигопептидов или пептидов.

Термин “белок-индикатор” означает отдельный компонент поликлонального белка, присутствие которого может быть детектировано в процессе продуцирования поликлонального белка или в различных партиях. Постоянное присутствие белка-индикатора в серии родственных образцов отражает стабильность экспрессии поликлонального белка в различных партиях или в течение одного производственного цикла. Кроме того, присутствие этого белка указывает на сохранение разнообразия в процессе последующей обработки, такой как очистка рекомбинантно продуцируемого поликлонального белка.

Термин “уникальные пептиды-маркеры” означает ряд пептидов, происходящих от вариабельной области отдельных компонентов поликлонального белка. Такие пептиды предпочтительно получают путем обработки протеазой или другими методами фрагментации белков, и пептиды, которые могут быть однозначно определены как один отдельный компонент поликлонального белка, называют уникальными пептидами-маркерами.

Описание графического материала

Фиг.1: Хроматограммы, полученные посредством катионообменной хроматографии, композиции рекомбинантного поликлонального антитела против RhD (анти-RhD rpAb), выделенного из аликвот 3948 и 3949 после культивирования в течение 9 недель. Нижняя хроматограмма соответствует аликвоте 3949, а верхняя хроматограмма соответствует аликвоте 3948. Ось Y верхней хроматограммы смещена для отделения ее от нижней хроматограммы. Пики А-J относятся к антителам, отличающимся по суммарному заряду, и отдельные антитела имеют различные заряды.

Фиг.2: Фотография геля, иллюстрирующая HinfI-анализ на RFLP ОТ-ПЦР-продукта, полученного из аликвот 3948+ и 3949+ (FCW065) поликлональной клеточной линии, продуцирующей анти-RhD rpAb, после ее культивирования в течение 11 недель. Идентифицированы полосы, которые могут быть приписаны специфическим клонам.

Фиг.3: Т-RFLP-профили легких цепей антитела против резус-фактора D, происходящих от поликлональной клеточной культуры, экспрессирующей анти-RhD rpAb, состоящее из восьми различных антител против резус-фактора D. Стрелки указывают на пики, которым приписаны восемь различных клонов антител против резус-фактора D.

Фиг.4: Т-RFLP-профили, полученные в данный момент времени для вариабельных областей тяжелых цепей антитела против резус-фактора D, происходящих от поликлональной клеточной культуры, экспрессирующей анти-RhD rpAb, состоящее из двадцати пяти различных антител против резус-фактора D. Стрелки указывают на пики, которым приписаны двадцать пять различных клонов антител против резус-фактора D.

Фиг.5: Распределение кДНК, оцениваемое по Т-RFLP-профилям последовательностей, кодирующих тяжелые цепи восьми различных антител против резус-фактора D и происходящих от поликлональной клеточной культуры, культивированной в течение пяти недель.

Фиг.6: Показано относительное содержание (%) анти-RhD rpAb, состоящего из восьми различных антител, проанализированных с использованием катионообменной хроматографии. Интегрированные хроматографические пики были приписаны отдельным антителам исходя из их времени удерживания, а профили пиков, полученных от отдельных антител, были проанализированы отдельно с использованием катионообменной хроматографии в идентичных условиях.

Фиг.7: Катионообменная хроматограмма анти-RhD rpAb, состоящего из двадцати пяти отдельных компонентов, для образца, полученного после культивирования в течение 4 недель. Пики АС1-25 относятся к антителам, отличающимся по суммарному заряду, и отдельные антитела имеют различные заряды.

Фиг.8: Профили элюирования при катионообменной хроматографии рекомбинантного поликлонального антитела против RhD, состоящего из десяти отдельных членов. Буквами показаны пики, подвергнутые ОТ-ВЭЖХ, проводимой по второму параметру.

Фиг.9: Показан профиль элюирования фракции В5, указанной на фиг.8, который был получен во время ОТ-ВЭЖХ.

Фиг.10: Проиллюстрирован композиционный 2-мерный (2D) ЖХ-анализ рекомбинантного поликлонального антитела против RhD, состоящего из десяти отдельных членов, визуализированных на карте белка с указанными цветовыми кодами (представленными в серой шкале).

Фиг.11: Показан профиль элюирования, полученный во время проведения катионообменной хроматографии Asp-N-гидролизата, очищенного с помощью жидкой хроматографии (ЖХ) из рекомбинантного поликлонального анти-RhD антитела, состоящего из восьми отдельных членов. Жирными горизонтальными линиями показаны фракции, подвергнутые анализу MALDI-TOF для идентификации маркерных пептидов.

Фиг.12: Показаны перекрывающиеся хроматограммы OD280-ИОХ, полученные для анти-RhD rpAb, состоящего из двадцати пяти отдельных членов, при этом ELISA-данные были получены из трех отдельных ELISA-анализов с использованием антиидиотипических пептидов РЕР162, РЕР202 и РЕР305. ELISA-анализы проводили для каждой фракции, полученной с помощью ионообменной хроматографии. ELISA-данные нормализовали по % от общего OD для того, чтобы эти три ELISA-анализа, проводимые с использованием РЕР162, РЕР202 и РЕР305 соответственно, можно было сравнивать друг с другом.

Фиг.13: Показано распределение трех антител-индикаторов против RhD162, 202 и 305 в различные периоды времени культивирования в процессе ферментации. G8 соответствует дню 8 после инокуляции содержимого биореактора.

Фиг.14: FACS-данные для трех клеточных линий, окрашенных тетрамерами РЕР202. (А) - РЕР202-негативная клеточная линия RhD162. (В) - клеточная линия RhD202, (С) - 50%-ная смесь клеточных линий RhD162 и RhD202 (соответствующая смеси (а) в эксперименте). На первой панели А, В и С представлены точечные графики FSC-SSC, где R1 представляет дискриминационное окно для живых и здоровых клеток, отобранных по размеру (FSC) и гранулярности (SSC). Гистограмма в середине панели иллюстрирует интенсивность флуоресценции клеток. Дискриминационное окно R6 охватывает окружающие клетки, окрашенные тетрамером. На последней панели приводится процент клеток в R6, используемой в вычислениях.

Фиг.15: Профили хроматограмм, записанных во время катионообменной хроматографии для образцов на различных стадиях во время последующей обработки образца анти-RhD rpAb, содержащего 25 отдельных членов, представленных материалом, собранным после элюирования с захватом (А), на сефадексе G-25 (В), DEAE-сефарозе (С) и Hypercel MEP (D).

Фиг.16: ИОХ-профили для трех репрезентативных моноклональных анти-RhD антител, представляющие три различных профиля распределения заряда. (А) - гомогенный профиль, (В) профиль с “3 пиками”, (С) комплексный профиль.

Фиг.17: ИОХ-анализ RhD189 и варианта RhD189E с модифицированным остатком в положении Glu.

Фиг.18: Активность связывания варианта RhD189E, модифицированного Glu и его природного аналога RhD189. Связывание антител с RhD-позитивными эритроцитами определяли с помощью FACS-анализа, а средняя интенсивность флуоресценции (MFI) представлена в зависимости от концентрации антитела.

Подробное описание изобретения

В одном из своих аспектов настоящее изобретение относится к способу структурной характеристики для получения информации об относительном количестве отдельных членов в образцах, содержащих (i) различные гомологичные белки, имеющие различные вариабельные области, или (ii) клеточные линии, продуцирующие такие белки. Такой способ характеристики может быть использован для оценки различных аспектов во время продукции или очистки или во время длительного хранения композиции, содержащей различные гомологичные белки. Предпочтительно указанный способ характеристики по изобретению используется для осуществления одной из нижеследующих целей: (i) для оценки относительного представления отдельных членов или некоторых из отдельных членов друг другу в одном образце, (ii) для оценки относительного количества одного или нескольких отдельных членов в различных образцах в целях определения состава различных партий и (iii) для оценки фактического содержания одного или нескольких отдельных членов. При этом может быть проведено сравнение, но необязательно, с библиотекой векторов, обычно используемых для продукции поликлональной клеточной линии-продуцента. Указанный способ характеристики может быть, в частности, использован для мониторинга клонального разнообразия поликлональной клеточной линии и/или для воспроизведения отдельных белков в поликлональном белке, продуцируемом такой клеточной линией. Может быть проведен мониторинг стабильности композиции различных партий в процессе отдельных производственных циклов и состава продукта в этих партиях. Альтернативно процедуры такого способа могут быть применены для очистки композиций различных смесей гомологичных белков, включая поликлональный белок или смесь моноклональных антител, например для оценки продолжительности сохранения стабильности отдельных членов в такой композиции.

В одном из вариантов настоящее изобретение относится к способу характеристики образцов, содержащих различные гомологичные белки, имеющие различные вариабельные области, или клетки, продуцирующие такие белки для получения данных об относительном содержании или присутствии отдельных членов указанного белка или их кодирующих последовательностей, где указанный способ включает анализ аликвот указанных образцов одним или несколькими методами характеристики белков и/или одним или несколькими методами генетического анализа белок-кодирующих последовательностей.

В другом варианте осуществления настоящего изобретения способ структурной характеристики состоит из ряда аналитических методов, выбранных из способов характеристики, а также генетических анализов. Таким образом, указанный способ структурной характеристики может состоять из любого числа отдельных вариантов, описанных в нижеследующих разделах. При этом может оказаться достаточным получение данных для образца путем проведения лишь одного из аналитических методов, описанных в указанных вариантах. Однако для разработки способа характеристики предпочтительно получить данные путем проведения по меньшей мере 2, 3, 4, 5, 6, 7, 8, 9 или 10 этих аналитических методов с последующим объединением отдельных вариантов, представленных ниже. Комбинация нескольких аналитических методов позволяет получать серию, в основном, описательных данных об относительном или абсолютном составе поликлональной смеси. Данные, полученные этими методами, могут иметь количественный, а также качественный характер, и при их объединении они дают полную характеристику анализируемых образцов.

В предпочтительных вариантах изобретения одним из аналитических методов является метод характеристики белка, а другим аналитическим методом является генетический анализ.

Термин “генетические анализы” означает такие методы, как анализ полиморфизма длин рестрикционных фрагментов (RFLP), концевой RFLP (Т-RFLP), анализ микромассивов, количественная ПЦР, такая как ПЦР, осуществляемая в реальном времени, и секвенирование нуклеиновой кислоты.

Термин “способы характеристики белка” означает способы, обычно используемые в области протеомики для характеристики неизвестных белков, такие как (i) хроматографические анализы, которые позволяют разделять белки по их физико-химическим свойствам, (ii) анализ протеолитического расщепления гомологичных белков, (iii) “групповое” N-концевое секвенирование и (iv) анализ с использованием специфических детекторных молекул для гомологичных белков.

В соответствии с настоящим изобретением была разработана дополнительная концепция, которая может быть применена в комбинации с описанными выше аналитическими методами для характеристики комплексного пула гомологичных белков. Такая концепция основана на отборе числа белков-индикаторов, присутствующих в данном пуле гомологичных белков (например, поликлонального антитела или поликлонального ТсR) или на поверхности пула клеток, продуцирующих указанные гомологичные белки (например, поликлональной клеточной линии-продуцента). Белки-индикаторы подвергают количественной и качественной характеристике для подтверждения того, что эта субполуляция белков присутствует в соответствующем количестве либо в супернатанте поликлональной клеточной культуры, либо на клеточной поверхности в процессе продуцирования этих белков. Белки-индикаторы могут быть, например, проанализированы с использованием детекторных молекул, которые являются специфичными к отдельным членам гомологичных белков, например, таких как антиидиотипические молекулы. Концепция белка-индикатора может быть также применена для оценки постоянства состава различных партий клеточных культур. Концепция белка-индикатора может также распространяться на уникальные пептиды, происходящие от поликлонального белка в результате его обработки протеазой, где указанные белки-индикаторы предпочтительно содержат часть CDR в том случае, если указанным поликлональным белком является поликлональное антитело или ТсR. В анализах, осуществляемых на генетическом уровне, может быть также использован принцип белков-индикаторов, основанный на уникальных последовательностях нуклеиновой кислоты, выделенных из отдельных членов библиотеки, кодирующей поликлональный белок. В частности, последовательности нуклеиновой кислоты, соответствующие областям CDR антител или ТсR, могут быть отобраны в качестве последовательностей индикаторной нуклеиновой кислоты, а наиболее предпочтительной областью является область CDR3. В каждом отдельном аналитическом методе последовательности белков-индикаторов, пептидов или нуклеиновых кислот могут варьироваться в зависимости от конкретных членов поликлонального белка или от последовательностей нуклеиновой кислоты, кодирующих эти белки, и эти последовательности могут быть идентифицированы выбранными аналитическими методами.

Генетические анализы на клональное разнообразие поликлональной клеточной линии-продуцента

Некоторые варианты настоящего изобретения включают мониторинг поликлональности в экспрессионной системе, продуцирующей поликлональный белок, путем оценки количества клеток, кодирующих конкретный член поликлонального белка, и/или уровней мРНК, кодирующей отдельные члены такого поликлонального белка. Такой мониторинг может быть проведен на уровне мРНК или на геномном уровне с применением, например, RFLP- или Т-RFLP-анализа, анализа олигонуклеотидных микромассивов, количественной ПЦР, такой как ПЦР в реальном времени, и секвенирования нуклеиновых кислот вариабельных областей генных последовательностей, полученных из клеточной линии-продуцента. Альтернативно, аналогичные методы могут быть использованы для качественной оценки разнообразия белков в поликлональной клеточной линии. Мониторинг последовательностей нуклеиновой кислоты, кодирующих поликлональных белок, может быть проведен на образцах, полученных из одной поликлональной клеточной культуры в различные периоды времени культивирования, и таким образом, может быть проведен мониторинг относительных количеств отдельных кодирующих последовательностей в процессе производственного цикла для оценки их композиционной стабильности. Альтернативно, может быть проведен мониторинг последовательностей нуклеиновых кислот, кодирующих поликлональный белок в образцах, полученных из различных поликлональных клеточных культур в конкретные периоды времени культивирования, и тем самым, может быть проведен мониторинг относительных количеств отдельных кодирующих последовательностей в различных партиях продукта для оценки изменений в этих различных партиях.

Предпочтительным образцом, используемым в генетических анализах, является фракция клеточной культуры, обогащенная клетками этой культуры, например, путем осаждения. Такой образец обычно получают путем сбора фракции клеточной культуры в нужный период времени с последующим удалением среды, например, путем центрифугирования. Образцы для сравнения состава различных партий, предпочтительно, получают из клеток in vitro при определенном ограничении их возраста клеток для продуцирования.

RFLP/Т-RFLP

RFLP- и Т-RFLP-анализ может быть осуществлен на геномном уровне или на уровне мРНК. Если поликлональная клеточная линия-продуцент была получена так, чтобы каждая клетка содержала только одну копию представляющей интерес последовательности, то анализ на геномном уровне позволяет получить данные об относительном количестве клеток в клеточной линии-продуценте, продуцирующей отдельный член поликлонального белка. С другой стороны, анализ на уровне мРНК позволяет получить данные о потенциальных уровнях экспрессии отдельных членов поликлонального белка. Анализ на уровне мРНК обычно осуществляют посредством обратной транскрипции мРНК с получением кДНК с последующим проведением рестрикционного анализа. Однако может быть также проведен анализ непосредственно на мРНК.

В RFLP-анализе концевой последовательности, прямой(ые) и/или обратный(е) праймер(ы), используемый(е) для ПЦР или ОТ-ПЦР, метят с получением меченных на концах ПЦР-фрагментов. После гидролиза соответствующими рестриктирующими ферментами получают фрагменты различных размеров, и эти фрагменты могут быть разделены с помощью электрофореза, а предпочтительно капиллярного электрофореза, после чего полученные фрагменты могут быть обнаружены с помощью меченого ампликона (Liu et al., 1997, Applied and Environmental Microbiology 63, 4516-4522). Подходящими метками могут служить сигналы, определяемые по интенсивности флуоресценции, радиоактивности, цветовым свойствам, дифракции рентгеновских лучей или абсорбции, магнетизму или ферментативной активности, и такими метками являются, например, флуорофоры, хромофоры, радиоактивные изотопы (в частности, 32Р, 33Р, 35S и 125I), электронно-плотные реагенты, ферменты и лиганды, имеющие специфических партнеров по связыванию. В качестве метки предпочтительно используют флуорофор.

При использовании поликлональной клеточной линии-продуцента с большим клональным разнообразием может оказаться невозможным получить уникальный рестрикционный фрагмент для каждой отдельной кодирующей последовательности. Если возникает такая ситуация, то последовательности индикаторных нуклеиновых кислот могут быть отобраны для мониторинга клонального разнообразия поликлональной клеточной линии продуцента. Альтернативно, фрагменты, которые не могут быть разделены по размеру, могут быть секвенированы для оценки распределения всех отдельных кодирующих последовательностей.

Анализ олигонуклеотидных микромассивов

Олигонуклеотидные микромассивы, такие как ДНК-чипы, могут быть использованы для измерения уровней геномной ДНК или уровней мРНК в поликлональной клеточной линии путем определения уровня гибридизации меченой ДНК, генерированной из клеточной линии, с зондом, связанным с твердой поверхностью (Guo Z. et al., 1994, Nucleic Acids Res. 22, 5456-5465).

Такие зонды могут представлять собой либо двухцепочечные последовательности кДНК, характерные для последовательностей, которые, как предполагается, присутствуют в поликлональной клеточной линии (либо происходят от самой поликлональной клеточной линии, либо из библиотеки кДНК, используемой для трансфекции клеток-хозяев, содержащихся в поликлональной клеточной линии), либо смысловые олигонуклеотиды (длиной 20-90 нуклеотидов). Зонды присоединяют к твердой поверхности, такой как стекло, пластик или гелевая матрица, а при использовании двухцепочечного зонда его денатурируют перед проведением анализа. При анализе поликлональной клеточной линии, экспрессирующей гомологичные белки, например поликлональное антитело или поликлональный ТсR, предпочтительно использовать точно сконструированные олигонуклеотидные зонды для предупреждения нежелательной перекрестной гибридизации между зондом и меченой кДНК, происходящей от поликлональной клеточной линии. Такие зонды конструируют исходя из сопоставления последовательностей, кодирующих вариабельную область, которые были использованы для генерирования поликлональной клеточной линии-продуцента в целях конструирования специфических зондов для каждого отдельного члена поликлонального продукта. Кодирующие последовательности для антител отличаются, главным образом, по своим областям CDR, при этом наивысшую степень вариабельности имеет область CDR3. Для конструирования смысловых олигонуклеотидных зондов предпочтительно использовать области с наибольшей вариабельностью. При этом предпочтительно, чтобы последовательность этих зондов была комплементарна отдельным членам, присутствующим в поликлональной клеточной линии, и, по возможности, значительно отличалась от последовательности других членов этой клеточной линии. Может быть использован один или несколько зондов, специфичных для каждой вариабельной области. В целях стандартизации могут быть использованы зонды, гибридизирующиеся с последовательностями в константная области. Указанные зонды либо наносят пятнами непосредственно на поверхность, используемую для гибридизации, либо синтезируют in situ на этой поверхности (Pease et al., 1994. PNAS 91:5022-5026, Singh-Gasson et al., 1999, Nature Biotech. 17:974-978).

Меченую анализируемую ДНК получают путем сбора популяции и поликлональных клеток и получения из этих клеток геномной ДНК, полноразмерной ДНК или мРНК. При использовании геномной ДНК мечение осуществляют посредством ПЦР-амплификации соответствующих кодирующих последовательностей, либо с использованием соответствующим образом меченных праймеров, либо с использованием меченых нуклеотидов. При использовании полноразмерной РНК или мРНК меченая кДНК может быть получена посредством обратной транскрипции, проводимой отдельно или в комбинации с стадией ПЦР, осуществляемой с использованием меченых праймеров или нуклеотидов. Подходящими метками могут служить сигналы, детектируемые по флуоресценции, радиоактивности, цветовым свойствам, дифракции рентгеновских лучей или абсорбции, магнетизму или ферментативной активности, и такими метками являются, например, флуорофоры, хромофоры, радиоактивные изотопы (в частности, 32Р, 33Р, 35S и 125I), электронно-плотные реагенты, ферменты и лиганды, имеющие специфических партнеров по связыванию. В качестве метки предпочтительно использовать флуорофор. Если анализируемыми кодирующими последовательностями являются кДНК, кодирующие тяжелые и легкие цепи антитела, то кДНК первой цепи получают посредством обратной транскрипции посредством гибридизации с антисмысловыми праймерами, находящимися в константной области, расположенной в 3'-положении по отношению к вариабельной области. В случае если дополнительную ПЦР не проводят, то синтез предпочтительно осуществлять с использованием меченых нуклеотидов. Если после обратной транскрипции проводят ПЦР, то используют набор смысловых праймеров, которые будут гарантировать осуществление амплификации всех членов семейства вариабельных областей. Альтернативно, могут быть использованы смысловые праймеры, гибридизующиеся с областями, которые являются идентичными во всех мРНК (например, 5'-нетранслируемая область или последовательность, кодирующая сигнальный пептид). В этом методе могут быть использованы смысловые и/или антисмысловые праймеры, которые могут быть флуоресцентно меченными, либо меченые нуклеотиды.

При получении зондов и меченых кДНК, анализ макромассивов осуществляют путем гибридизации денатурированной меченой ДНК с иммобилизованными олигонуклеотидами в условиях, оптимизированных для достижения низкого уровня фона и высокого специфического сигнала. После промывки каждый из гибридизованных зондов измеряют и вычисляют количество специфических транскриптов.

Количественная ПЦР

ПЦР-методы были предварительно адаптированы для детекции и количественной оценки последовательностей нуклеиновой кислоты в образце, см., например, публикацию Higuchi R. et al., 1993. Kinetic Biotechnology 11, 1026-1030; Holland P.M. et al., 1991. PNAS 88, 7276-7280; Livak, K.J. et al., 1995 PCR Methods Appl. 4, 357-362. В этих методах используются прямые и обратные праймеры, как и в стандартной ПЦР, а также одна или несколько дополнительных последовательностей нуклеиновой кислоты, которые гибридизуются с амплифицируемой нуклеиновой кислотой. Эта дополнительная последовательность нуклеиновой кислоты, называемая “зондом”, гибридизуется с областью амплифицируемой нуклеиновой кислоты, расположенной между частями, гибридизующимися с двумя праймерами, и помечена так, чтобы каждый последующий цикл ПЦР приводил к модификации последовательности зонда или его метки. Такая модификация зонда или его метки приводит к активации или интенсификации метки до определенной степени, при которой она будет связываться с различными дополнительными копиями амплифицированной нуклеиновой кислоты в процессе каждого цикла ПЦР. Такие методы обычно называются ПЦР “в реальном времени” и позволяют осуществлять детекцию возрастающего количества ПЦР-продукта путем объединения процедуры периодического проведения тепловых циклов с процедурой детекции метки. В конкретном варианте ПЦР в реальном времени, модификация зонда или его метки возникает в результате экзонуклеазной активности полимеразы, например полимеразы Taq, а поэтому такой метод обычно называют Taq- или TaqMan-ПЦР в реальном времени (например, Holland P.M. et al., 1991, PNAS 88, 7276-7280).

Подходящими метками могут служить сигналы, детектируемые по флуоресценции, радиоактивности, цветовым свойствам, дифракции рентгеновских лучей или абсорбции, магнетизму или ферментативной активности, и такими метками являются, например, флуорофоры, хромофоры, радиоактивные изотопы (в частности, 32Р, 33Р, 35S и 125I), электронно-плотные реагенты, ферменты и лиганды, имеющие специфических партнеров по связыванию. Наиболее часто используемой меткой для зонда является флуоресцентная метка, продуцирующая флуоресцентный сигнал. Это может быть достигнуто с помощью зонда, который был дважды помечен флуоресцентным репортерным красителем у одного конца, обычно у 5'-конца, и гасящим красителем у другого конца, то есть у 3'-конца (например, Livak K.J. et al., 1995, PCR Methods Appl. 4, 357-362). Если этот зонд является интактным, то близость гасящего красителя к репортерному красителю подавляет интенсивность флуоресценции репортерного красителя. Подходящие красители описаны в публикации Wilhelm J. & Pingoud A., 2003. Chembiochem. 4, 1120-1128. Во время каждого цикла ПЦР, 5'→ 3' экзонуклеазная активность ДНК-полимеразы приводит к расщеплению зонда, который отделяет репортерный краситель от гасящего красителя. Это разделение приводит к увеличению интенсивности флуоресценции репортерного красителя.

В процессе ПЦР, если в образце присутствует представляющая интерес мишень, то зонд специфически гибридизуется между сайтами прямого и обратного ПЦР-праймеров. Указанная экзонуклеазная активность ДНК-полимеразы приводит к расщеплению зонда между репортерным и гасящим красителями только в том случае, если указанный зонд гибридизуется с молекулой-мишенью. Такие зонды часто называют зондами TaqMan. Увеличение интенсивности флуоресценции детектируется только в том случае, если указанная последовательность-мишень комплементарна указанному зонду и амплифицирована в процессе ПЦР. В соответствии с такими требованиями неспецифическая амплификация не будет детектироваться. То есть только амплифицированные продукты, содержащие последовательность, комплементарную указанному зонду, распознаются по присутствию флуоресцентного сигнала, в результате чего происходит элиминация некоторых элементов, идентифицированных в данном анализе как ложноположительные. Кроме того, для ограничения амплификации внесенных извне продуктов транскрипции могут быть использованы один или несколько других ферментов.

Этот тип количественной ПЦР позволяет осуществлять нормализацию за внесение ошибки и изменение объема, которая может быть осуществлена путем деления интенсивности флуоресценции репортерной молекулы на интенсивность пассивного стандарта, содержащегося в каждой реакционной смеси, для определения нормализованного репортерного сигнала для каждой отдельной реакции. Для оценки увеличения интенсивности флуоресценции от цикла к циклу и сравнения этих данных со стандартами в целях определения числа исходных копий для проведения абсолютной количественной оценки или для сравнения этих данных с данными других неизвестных образцов в целях проведения относительной количественной оценки могут быть использованы компьютерные программы.

В частности, было обнаружено, что ПЦР-реакция в реальном времени с использованием TaqMan, проводимая в соответствии с настоящим изобретением, является подходящей для характеристики поликлональной клеточной линии. Таким образом, при применении такой ПЦР к клеточной линии, экспрессирующей поликлональное антитело, этот метод позволяет осуществлять количественную оценку относительного содержания последовательностей, кодирующих отдельные антитела, поскольку уникальный зонд TaqMan может быть сконструирован для тяжелой цепи и/или легкой цепи каждого члена, представленного в поликлональной клеточной линии. Для конструирования зонда TaqMan предпочтительно выбирают одну из областей CDR, CDR1, CDR2 или CDR3. Наиболее предпочтительно для конструирования зонда TaqMan выбирают область CDR3. Примеры зондов TaqMan, сконструированных на основе CDR3 вариабельной области тяжелой цепи, можно найти в публикации Rassmussen, T et al., 2000, Exp. Hematol. 28, 1039-1045, которая вводится в настоящее описание посредством ссылки.

Секвенирование нуклеиновых кислот

Секвенирование нуклеиновых кислот является хорошо известным методом, который может быть применен в настоящем изобретении для качественной оценки вариабельности поликлональной клеточной линии-продуцента. Такое секвенирование может быть осуществлено на отдельных клетках, происходящих от поликлональной клеточной линии, путем клонирования одной клетки, или оно может быть осуществлено на необработанном образце вариантов клеток, полученных из поликлональной клеточной линии-продуцента.

Секвенирование на уровне одной клетки позволяет получить данные об относительном количестве клеток в клеточной линии-продуценте, которая продуцирует отдельный член поликлонального белка. В этой процедуре образец поликлональной клеточной линии-продуцента получают в нужный период времени, и клетки, содержащие последовательность, кодирующую характеризуемый поликлональный белок, подвергают клонированию на уровне одной клетки, например, посредством лимитирующего разведения или на клеточном сортере, таком как FACS Aria. Число отдельных клеток, которое должно быть получено из образца поликлональной клеточной линии, зависит от разнообразия последовательностей, которые, как предполагается, присутствуют в указанной клеточной линии. При этом предпочтительно, чтобы число отдельных кодирующих последовательностей в начале цикла генерирования клеточной линии, по меньшей мере, в 3 раза превышало число последовательностей в одной отсортированной клетке и чтобы вероятность их полного повторного обнаружения в тест-образце составляла 95%. Таким образом, если для генерирования клеточной линии используется библиотека из 25 различных кодирующих последовательностей, то для секвенирования из этого образца должно быть получено, по меньшей мере, 75 отдельных клеточных клонов, при условии что 25 других последовательностей представлено в равных количествах. Это должно гарантировать то, что большинство отдельных кодирующих последовательностей, представленных в данной поликлональной клеточной линии, находятся среди отдельных клеточных клонов, если они не были потеряны в процессе продуцирования. Эти одиночные клетки культивируют до конфлюентности в отдельных лунках, и аликвоты, взятые из каждой лунки, используют в реакциях секвенирования нуклеиновой кислоты в качестве матрицы. Секвенирование может быть осуществлено на уровне мРНК или на геномном уровне с использованием реакции ОТ-ПЦР или в стадии ПЦР-амплификации соответственно, которую проводят перед секвенированием. Данные о последовательности, полученные на уровне мРНК или на геномном уровне, позволяют определить процент клеток, продуцирующих каждое из отдельных антител-компонентов. Кроме того, данные о последовательности, полученные на уровне мРНК, могут быть использованы для оценки уровня экспрессии каждого отдельного антитела, присутствующего в данной поликлональной композиции. Помимо секвенирования для получения данных о потенциальном уровне экспрессии одного клеточного клона может быть осуществлена ПЦР с использованием TaqMan в реальном времени на уровне мРНК. RFLP и Т-RFLP-анализы, описанные выше, могут быть аналогичным образом осуществлены на уровне одной клетки.

Секвенирование непроцессированного образца вариантов клеток, полученных из поликлональной клеточной линии-продуцента, позволяет также получить данные о потенциальном уровне экспрессии отдельного члена поликлонального белка, продуцированного из данной клеточной линии, исходя из относительного уровня мРНК кодирующих последовательностей отдельных членов поликлонального белка. В этой процедуре образец из поликлональной клеточной линии-продуцента получают в нужный момент времени. ОТ-ПЦР осуществляют непосредственно на лизированных клетках, присутствующих в данном образце. Для осуществления ОТ-ПЦР-реакции конструируют набор праймеров, используемых в данной ПЦР-реакции, так чтобы этот набор праймеров гарантировал ожидаемую амплификацию всех кодирующих последовательностей с одинаковой эффективностью в том случае, когда смысловой и антисмысловой праймеры гибридизируются с областями, являющимися идентичными во всех мРНК (например, может быть, но необязательно, использован смысловой праймер в 5'-нетранслируемой области или в последовательности, кодирующей сигнальный пептид, и антисмысловой праймер в последовательности константной области). Амплифицированные ПЦР-фрагменты клонируют в секвенирующий вектор и переносят в клетку-хозяина, предпочтительно в E.coli. Плазмидную ДНК, взятую от одиночных колоний, представляющих отдельные кодирующие последовательности, происходящие от данной поликлональной клеточной линии-продуцента, секвенируют, и содержание полученных отдельных кодирующих последовательностей будет зависеть от уровня мРНК каждой отдельной кодирующей последовательности в данной поликлональной клеточной линии, а также от потенциального уровня экспрессии отдельных членов белка.

В другом варианте настоящего изобретения описанные выше генетические анализы применяются как отдельные анализы. Один или несколько из этих анализов предпочтительно осуществляют на аликвотах, взятых от одного и того же образца, в целях получения, по возможности, как можно больше информации о клональном разнообразии данной клеточной линии. Альтернативно указанные генетические анализы могут быть объединены в многомерный анализ, например, после указанного анализа могут быть проведены анализы микромассивов на RFLP- или Т-RFLP-фрагментах либо RFLP-фрагменты могут быть секвенированы после проведения RFLP-анализов. В частности, может оказаться предпочтительным проводить секвенирование RFLP-фрагментов, которые представляют более чем один отдельный компонент и которые не могут быть разделены из-за идентичности размеров их рестрикционных фрагментов.

Способы характеристики белков для оценки поликлональности

В вариантах настоящего изобретения проводят мониторинг поликлональности пула гомологичных белков или экспрессионной системы для продуцирования гомологичных белков одним или несколькими способами характеристики белков. Термин “способ характеристики белков” означает любой способ, применение которого отдельно или в комбинации с другими способами позволяет получать информацию о присутствии и об относительном количестве отдельных членов смеси моноклональных белков или рекомбинантного поликлонального белка в растворе или на поверхности клетки, присутствующей в поликлональной клеточной линии. В зависимости от сложности состава рекомбинантного поликлонального белка могут быть применены один или несколько из нижеследующих способов: (i) способы хроматографического разделения, (ii) анализ протеолитических гидролизатов поликлонального белка для идентификации уникального маркерного пептида, представляющего отдельные члены поликлонального белка, (iii) “объемное” N-концевое секвенирование и (iv) анализ с использованием специфических детекторных молекул, например, для характеристики белков-индикаторов, являющихся компонентами поликлонального белка.

Образец, содержащий различные гомологичные белки, может представлять собой смесь очищенных моноклональных белков или поликлональный белок. Поликлональный белок может быть, например, получен из супернатанта клеточной культуры, выделенного из поликлональной клеточной культуры, например, в форме “сырого” супернатанта, который был только отделен от клеток, например, путем центрифугирования, или супернатантов, которые были очищены, например, путем аффинной очистки на белке А, иммунопреципитации или гель-фильтрации. Однако эти стадии предварительной очистки не являются частью способа характеристики рекомбинантного поликлонального белка, поскольку они не обеспечивают какого-либо разделения различных гомологичных белков в данной композиции. Предпочтительно, чтобы образец, подвергаемый характеристике в соответствии с настоящим изобретением, был подвергнут, по меньшей мере, одной стадии очистки. Наиболее предпочтительными являются образцы, содержащие гомологичные белки, очищенные на 90%, 95% или 99%.

Образцы, полученные из одной поликлональной клеточной культуры, могут быть подвергнуты мониторингу на различные гомологичные белки, входящие в состав поликлонального белка, в различные моменты времени в процессе культивирования, и тем самым, мониторингу относительного содержания отдельных членов поликлонального белка за один производственный цикл для оценки композиционной стабильности данного поликлонального белка. Альтернативно, образцы, полученные из различных поликлональных клеточных культур, могут быть подвергнуты мониторингу на различные гомологичные белки, входящие в состав поликлонального белка, в данный момент времени, а следовательно, может быть проведен мониторинг относительного содержания отдельных кодирующих последовательностей в различных партиях для оценки постоянства состава различных партий продукта.

Способы хроматографического разделения

Хроматографическое разделение отдельных членов поликлонального белка может быть основано на различиях их физико-химических свойств, таких как (i) суммарный заряд (например, при ионообменной хроматографии (ИОX)), (ii) гидрофобность (например, при обращенно-фазовой хроматографии (ОФ-ВЭЖХ) и при гидрофобной хроматографии, проводимой с использованием повышенной концентрации соли (ГФХ)), (iii) изоэлектрические точки (величины рI)(например, при хроматофокусировании) или (iv) аффинность (например, при аффинной хроматографии с использованием антиидиотипических пептидов/антител или при хроматографии на L-белке для разделения легких цепей каппа и лямбда антител). Пятый хорошо известный хроматографический метод основан на таком физико-химическом свойстве, как размер. Однако этот метод не является подходящим для характеристики гомологичных белков, таких как поликлональное антитело или поликлональный ТсR, поскольку все их члены имеют, в основном, один и тот же размер. Разделение по размерам может быть полностью исключено из описанного способа характеристики. Некоторые из вышеупомянутых хроматографических методов были применены для выделения иммуноглобулинов таких классов, как IgА, IgG и IgМ (Gallo P. et al., 1987, J. Chromatogr. 416, 53-62) или таких подклассов, как IgG1, IgG2, IgG3 (Scharf O. et al., 2001, J. Virol. 75, 6558-6565) из человеческой сыворотки. Однако разделение на основе разнообразия отдельных антител в выделенном из сыворотки иммуноглобулине или в рекомбинантном поликлональном антителе ранее никогда не проводилось.

а) Ионообменная хроматография

В вариантах по изобретению для разделения отдельных членов рекомбинантного поликлонального белка или субпопуляции отдельных членов поликлонального белка применяют ионообменную хроматографию. Разделение с помощью ионообменной хроматографии осуществляют исходя из суммарного заряда отдельных белков разделяемой композиции. В зависимости от величин рI рекомбинантного поликлонального белка, величин рН и концентраций соли в выбранном колоночном буфере отдельные члены рекомбинантного поликлонального белка могут быть разделены, по меньшей мере, до некоторой степени, с помощью либо анионообменной, либо катионообменной хроматографии. Так, например, все отдельные члены рекомбинантного поликлонального белка обычно связываются с отрицательно заряженной катионообменной средой, при условии что величина рН значительно ниже наименьшей величины рI отдельных членов композиции рекомбинантного поликлонального белка. Отдельные члены связанного рекомбинантного поликлонального белка могут быть затем элюированы с колонки в зависимости от суммарного заряда отдельных белков с использованием, обычно, возрастающего градиента соли (например, хлорида натрия) или возрастающей величины рН. В процессе элюирования может быть получено несколько фракций. Одна фракция предпочтительно содержит отдельный член поликлонального белка, но она может также содержать 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 или более отдельных членов поликлонального белка. Общие принципы катионного и анионного обмена хорошо известны специалистам, а колонки для ионообменной хроматографии являются коммерчески доступными.

b) Хроматофокусирование

В других вариантах по изобретению для разделения отдельных членов рекомбинантного поликлонального белка или субпопуляции отдельных членов поликлонального белка применяют хроматофокусирование. Разделение путем хроматофокусирования основано на различиях величин рI отдельных белков и осуществляется с использованием колоночного буфера, который имеет величину рН, превышающую величину рI рекомбинантного поликлонального белка. Рекомбинантный поликлональный белок, отдельные члены которого имеют относительно низкие величины рI, будут связываться с относительно слабо заряженной анионообменной средой. Отдельные члены связанного рекомбинантного поликлонального белка могут быть затем элюированы с колонки в зависимости от величин рI отдельных членов путем создания снижающегося градиента рН в колонке с использованием полибуфера, полученного так, чтобы интервал значений рН охватывал интервал величин рI отдельных членов. В процессе элюирования получают несколько фракций. Одна фракция предпочтительно содержит отдельный член поликлонального белка, но она может также содержать 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 или более других членов поликлонального белка. Общие принципы хроматофокусирования с использованием анионообменников хорошо известны специалистам, а колонки для анионообменной хроматографии являются коммерчески доступными. Хроматофокусирование с использованием катионообменников также хорошо известно специалистам (см. публикацию Kang X. & Frey D.D. 2003, J. Chromatogr. 991, 117-128, которая вводится в настоящее описание посредством ссылки).

с) Гидрофобная интерактивная хроматография

В других вариантах настоящего изобретения для разделения отдельных членов рекомбинантного поликлонального белка или субпопуляции отдельных членов поликлонального белка применяют гидрофобную интерактивную хроматографию. Разделение с помощью гидрофобной хроматографии основано на различиях в гидрофобности отдельных белков в разделяемой композиции. Рекомбинантно продуцированный поликлональный белок связывают с хроматографической средой, модифицированной гидрофобным лигандом в буфере, который благоприятствует гидрофобным взаимодействиям. Обычно это достигается в буфере, содержащем низкий процент органического растворителя (ОФ-ВЭЖХ), или в буфере, содержащем достаточно высокую концентрацию выбранной соли (ГФХ). Отдельные члены связанного рекомбинантного поликлонального белка будут затем элюироваться с колонки в зависимости от гидрофобности отдельных членов, обычно, в возрастающем градиенте органического растворителя (ОФ-ВЭЖХ) или в снижающемся градиенте выбранной соли (ГФХ). В процессе элюирования может быть получено несколько фракций. Одна фракция предпочтительно содержит отдельный член поликлонального белка, но она может также содержать 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 или более других членов поликлонального белка. Общие принципы гидрофобной хроматографии хорошо известны специалистам, а колонки для ОФ-ВЭЖХ, а также для ГФХ являются коммерчески доступными.

d) Аффинная хроматография

В других вариантах настоящего изобретения для разделения отдельных членов рекомбинантного поликлонального белка или субпопуляции отдельных членов поликлонального белка применяют аффинную хроматографию. Разделение с помощью аффинной хроматографии основано на различиях в аффинности по отношению к специфической детекторной молекуле, лиганду или белку. Детекторная молекула, лиганд или белок или несколько этих молекул (далее все эти варианты будут называться одним термином “лиганд”) иммобилизуют на хроматографической среде и на аффинную колонку наносят рекомбинантный поликлональный белок в условиях, благоприятствующих взаимодействию между отдельными членами и иммобилизованным лигандом. Белки, не обнаруживающие сродства к иммобилизованному лиганду, собираются в проточной колонке, а белки, обладающие сродством к иммобилизованному лиганду, затем элюируют с колонки в условиях, которые не благоприятствуют связыванию (например, при низком рН, при высокой концентрации соли или высокой концентрации лиганда). В процессе элюирования может быть получено несколько фракций. Одна фракция предпочтительно содержит отдельный член поликлонального белка, но она может также содержать 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 или более других членов поликлонального белка. Лигандами, которые могут быть использованы для характеристики рекомбинантного поликлонального белка, являются, например, антигены-мишени, антиидиотипические молекулы или L-белок для разделения антител с легкими цепями каппа или лямбда.

Аффинная хроматография с антигенами-мишенями является особенно подходящей в том случае, когда рекомбинантный поликлональный белок обладает сродством к более чем одному эпитопу. Такой мишенью могут быть, например, раковая клетка или вирус, или комбинация мишеней, содержащих множество эпитопов. Эти эпитопы могут быть синтезированы искусственно и могут быть иммобилизованы на хроматографической среде. Может быть разработан анализ с одним эпитопом на колонку или с несколькими различными эпитопами на колонку, что позволяет проводить характеристику смеси рекомбинантных поликлональных белков с точки зрения распределения отдельных членов по отношению к конкретным эпитопам. Альтернативно, на хроматографической среде могут быть иммобилизованы целые антигены или молекулы-мишени.

Аффинная хроматография с антиидиотипическими молекулами (например, с антиидиотипическими пептидами или антиидиотипическими антителами), которые специфически связываются с отдельными членами поликлонального белка или с субпопуляцией таких отдельных членов, может быть осуществлена для получения информации об относительном количестве выбранных членов рекомбинантного поликлонального белка (также называемого белком-индикатором) или субпопуляции его отдельных членов. В идеальном случае каждая отдельная антиидиотипическая молекула специфически связывается только с одним отдельным членом и не связывается с другими членами рекомбинантного поликлонального белка, хотя в настоящем изобретении также используется антиидиотипическая молекула, которая связывается с определенной субпопуляцией указанных членов. При этом предпочтительно, чтобы антиидиотипические молекулы вырабатывались ко всем отдельным членам, для того чтобы можно было охарактеризовать целую поликлональную композицию. Если указанным рекомбинантным поликлональным белком является поликлональное антитело или ТсR, то антиидиотипические молекулы направлены против антигенспецифической части последовательности антитела или Т-клеточного рецептора. Антиидиотипические молекулы могут быть иммобилизованы на хроматографической среде по отдельности, так чтобы одна колонка содержала одну антиидиотипическую молекулу, что позволяет получать информацию о конкретном члене белка или о субпопуляции таких белков. Затем выходящий поток может быть подан во вторую колонку со второй иммобилизованной антиидиотипической молекулой и т.п. Альтернативно, несколько различных антиидиотипических молекул иммобилизуют на той же самой хроматографической среде, нанесенной на колонку. Затем осуществляют элюирование в условиях, позволяющих отдельным белкам элюироваться в различных фракциях, например, путем добавления возрастающих количеств свободных идиотипических молекул в колонку или использования соответствующего градиента рН или соли. Такой способ позволяет получить данные о содержании нескольких членов поликлонального белка путем проведения одномерного анализа.

Если указанным рекомбинантным поликлональным белком является поликлональное антитело, то оно может состоять из отдельных членов, которые содержат либо легкую цепь каппа, либо легкую цепь лямбда. Антитела с легкой цепью лямбда, содержащиеся в таком поликлональном антителе, могут быть отделены от антител с легкой цепью каппа благодаря отсутствию у антител с легкой цепью лямбда сродства к L-белку. Таким образом, субпопуляция членов данного антитела, содержащих легкую цепь лямбда, может быть отделена от субпопуляции членов антитела, содержащих легкую цепь каппа, с помощью аффинной хроматографии на L-белке. Субпопуляции антител каппа и лямбда могут быть затем дополнительно охарактеризованы альтернативными хроматографическими методами для количественной оценки отдельных антител, например, как описано выше.

Многомерная хроматография

В зависимости от количества различных вариантов гомологичных белков в анализируемом образце, например, в рекомбинантном поликлональном белке, может оказаться желательными объединение двух или более хроматографических методов, описанных выше в пунктах (а)-(d), в двумерном, трехмерном или многомерном формате. Во всех этих форматах вместо двумерного гель-электрофореза предпочтительно использовать жидкостную хроматографию. Однако это не исключает возможности использования гель-электрофореза или преципитации в одном или нескольких форматах характеристики рекомбинантного поликлонального белка.

Жидкостная двумерная хроматография описана, например, в публикации, Lubman D.M. et al., 2002, J. Chromatogr. B. Analyt. Technol. Biomed. Life Sci. 782, 183-196; в WO 01/58925 и в WO 01/58926. Такой метод был использован для сравнения уровня экспрессии белка в нормальных клетках и в раковых клетках, что позволяет генерировать дифференциальное отображение на уровне белка. Кроме того, в WO 03/102539 была описана трехмерная хроматография, в которой третьим параметром характеристики является размер и которая была использована для разделения белков, например, в клеточных экстрактах, и тем самым, для генерирования дифференциального отображения.

В других вариантах настоящего изобретения многомерная хроматография используется для характеристики различных гомологичных белков в образце. В частности, с помощью многомерной хроматографии могут быть охарактеризованы образцы гомологичных белков, имеющих различные вариабельные области, такие как антитела и Т-клеточные рецепторы. Предпочтительно дополнительную характеристику проводят на фракциях, полученных в процессе элюирования в предшествующих форматах. Однако выходящий поток может быть также использован для последующих анализов по другому параметру. Это особенно предпочтительно, если таким предшествующим форматом является аффинная хроматография.

В одном из вариантов настоящего изобретения для выделения отдельных молекул антитела по их вариабельности либо из поликлонального антитела (сывороточного иммуноглобулина или рекомбинантного антитела), либо из смеси моноклональных антител применяют многомерную хроматографию. Предпочтительной многомерной хроматографией является жидкостная хроматография.

В другом варианте настоящего изобретения многомерную хроматографию используют для выделения отдельных молекул Т-клеточного рецептора по их вариабельности либо из поликлонального Т-клеточного рецептора, либо из смеси моноклональных Т-клеточных рецепторов. Предпочтительной многомерной хроматографией является жидкостная хроматография.

В общих чертах, была предпринята попытка использовать хроматографические методы, основанные на различных физико-химических свойствах, в различных вариантах многомерной хроматографии, например разделение по заряду в первом варианте, разделение по гидрофобности во втором варианте и разделение по аффинности в третьем варианте. Однако некоторые хроматографические методы могут давать дополнительное разделение при их применении в следующем варианты, даже если они основаны на аналогичных физико-химических свойствах белка. Так, например, дополнительное разделение может быть достигнуто в том случае, если после хроматофокусирования проводят ионообменную хроматографию или последующую аффинную хроматографию с различными лигандами.

В таблице 1 представлено пять вариантов, в которых хроматографические методы могут быть применены как часть способа характеристики настоящего изобретения. Однако указанное число вариантов не должно рассматриваться как обязательное. При разделении, которое оказалось достаточным для характеристики рекомбинантного поликлонального белка и которое было достигнуто после проведения одномерной, двумерной, трехмерной или четырехмерной хроматографии, хроматографию следующего порядка можно не проводить. Следовательно, если разделение, достигнутое с помощью ионообменной хроматографии (ИОХ), является достаточным, то необязательно проводить хроматофокусирование, ОФ-ВЭЖХ и т.п. С другой стороны, если проведение пятимерного разделения оказалось недостаточным, то может быть проведено дополнительное разделение следующего порядка. Кроме того, таблица 1 не должна рассматриваться как исчерпывающий список возможных комбинаций хроматографических методов или как исчерпывающий список самих этих методов.

В предпочтительных вариантах настоящего изобретения указанный многомерной жидкостной хроматографией (ЖХ) является двумерная ЖХ, выбранная из первых двух вариантов, указанных в таблице 1.

В других предпочтительных вариантах настоящего изобретения указанной многомерной жидкостной хроматографией (ЖХ) является трехмерная ЖХ, выбранная из первых трех вариантов, указанных в таблице 1.

В качестве альтернативы многомерной ЖХ для характеристики рекомбинантного поликлонального белка может быть использована иммунопреципитация в комбинации с подходящим методом электрофореза, таким как гель-электрофорез или капиллярный электрофорез, с последующей количественной оценкой антигенов. Этот метод является особенно подходящим для характеристики рекомбинантного поликлонального антитела, направленного против комплексных антигенов. Рекомбинантное поликлональное антитело, направленное, например, против комплексного вирусного антигена, может быть подвергнуто иммунопреципитации с использованием меченой смеси антигенов и сфер с белком А. Затем такие антигены могут быть разделены с помощью изоэлектрического фокусирования или двумерного электрофореза с ДСН-ПААГ с последующей количественной оценкой отдельных антигенов, позволяющей измерять количество антител в рекомбинантном поликлональном антителе, направленном против конкретных антигенов.

Элиминация гетерогенности N-концевого заряда в рекомбинантных белках

В способах характеристики белков, описанных выше, гетерогенность отдельного белка в пуле гомологичных белков может еще больше осложнять характеристику, поскольку один белок может давать несколько пиков, например, в ИОХ-профиле. Гетерогенность в антителах и в других рекомбинантных белках является обычным явлением, которое обусловлено ферментативными или неферментативными посттрансляционными модификациями. Эти модификации могут приводить к гетерогенности размера или заряда. Стандартными посттрансляционными модификациями являются N-гликозилирование, окисление метионина, протеолитическая фрагментация и дезамидирование. Гетерогенность может быть также обусловлена модификациями на генетическом уровне, такими как мутации, внесенные в процессе трансфекции (Harris J.R. et al., 1993, Biotechnology 11, 1293-7) и события кроссинговера, происходящие между генами вариабельных областей тяжелой и легкой цепей в процессе транскрипции (Wan, M. et al., 1999, Biotechnol. Bioeng. 62, 485-8). Эти модификации являются эпигенными и не могут быть предсказаны исходя из генетической структуры отдельной конструкции.

Некоторые из этих посттрансляционных модификаций, которые могут приводить к гетерогенности, могут быть устранены еще до характеристики. Изменение заряда, возникающее в результате ферментативного удаления С-концевого лизина, можно предотвращать благодаря использованию специфических ингибиторов карбоксипептидазы или обработки антитела карбоксипептидазой для упрощения общей процедуры характеристики (Perkins М. et al., Pharm. Res. 17, 1110-7). Изменение размера, вызванного различиями в характере гликозилирования, может быть также предотвращено путем проведения ферментативного дегликозилирования с использованием, например, ПНГазы F, эндо-Н, О-гликозидазы или нейраминидазы.

Было показано, что химическая деградация белков, такая как дезамидирование в процессе получения и хранения белка, связана с серьезными проблемами и может приводить к гетерогенности заряда. Дезамидирование Asn с образованием Asp и изо-Asp (изоспартил-пептидных связей) происходит в мягких условиях (Aswad D.W. et al. 2000, J. Pharm. Biomed. Anal. 21, 1129-36). Такие перегруппировки наиболее часто происходят в последовательностях Asn-Gly, Asn-Ser и Asp-Gly, где наблюдается высокая степень гибкости локальной полипептидной цепи.

Другой причиной гетерогенности заряда может быть N-концевое блокирование пироглутаминовой кислотой (PyroGlu), происходящее в результате циклизации N-концевых глутаминовых остатков (дезамидирования). Такие посттрансляционные модификации были описаны для IgG, а также для других белков. Частичная циклизация N-концевой последовательности антитела, а особенно если она затрагивает НС и LС, может приводить к гетерогенности заряда и давать сложный профиль ИОХ. Потенциальные профили ИОХ, полученные в результате образования N-концевой PyroGlu на одной или нескольких цепях VH и VL антитела, представлены на фиг.16. Если образец, содержащий различные гомологичные белки, имеющие различные вариабельные области, такие как рекомбинантное поликлональное антитело, характеризуют методами, основанными на суммарном заряде, то, очевидно, что такой анализ будет затруднен, даже если несколько компонентов данного образца имеют ИОХ-профили, показанные на фиг.16В и С, поскольку в этом случае будет замаскировано клональное разнообразие в ИОХ-профиле, например, композиции поликлональных антител. Эта проблема не может быть решена с использованием специфического фермента пироглутамат-аминопептидазы, во-первых, потому что блокирование, проводимое на восстановленных и алкилированных антителах в целях получения высоких выходов деблокированных антител (Mozdzanowski J. et al., 1998 Anal. Biochem. 260, 183-7) несовместимо с последующим ИОХ-анализом, и во-вторых, потому что невозможно достичь 100%-ного расщепления всех антител.

Поэтому в другом своем аспекте настоящее изобретение относится к способу элиминации гетерогенности заряда, вызываемой циклизацией N-концевых глутаминовых остатков. Этот аспект настоящего изобретения является особенно предпочтительным, если такую циклизацию осуществляют в комбинации с любыми из ранее описанных методов характеристики, основанных на таком физико-химическом свойстве, как суммарный заряд, например, в комбинации с ионообменной хроматографией и хроматофокусированием. Предотвращение образования N-концевых остатков PyroGlu может быть гарантировано только в том случае, если полипептидная цепь не будет содержать N-концевого глутамина, например, путем замены указанного N-концевого глутаминового остатка другой аминокислотой. Если указанным белком является гетеромерный белок, состоящий из различных субъединиц, то предпочтительно, чтобы все N-концевые остатки Gln были заменены другими остатками. В антителах остатки Gln заменяют у N-конца тяжелой цепи и/или легкой цепи. Это достигается с помощью сайт-направленного мутагенеза последовательностей нуклеиновой кислоты, кодирующих полипептиды с N-концевым глутамином. При этом предпочтительно, чтобы N-концевые глутаминовые остатки были заменены остатками глутаминовой кислоты, поскольку глутаминовая кислота является незаряженным производным глутамина. В рекомбинантном поликлональном белке отдельные последовательности, кодирующие указанные члены, должны быть заменены и снова встроены в экспрессионный вектор для генерирования новой клеточной линии, экспрессирующей модифицированный белок. Затем эта клеточная линия может быть включена в совокупность клеток, продуцирующих поликлональный белок.

Анализ протеолитического расщепления вариабельной области гомологичных белков

Образец белка, содержащий различные гомологичные белки, имеющие различные вариабельные области, может быть охарактеризован, как описано выше, исходя из физико-химических свойств интактных белков с применением различных хроматографических методов. Данные, полученные из вышеописанных анализов, могут быть пополнены данными, полученными из анализа протеолитического расщепления гомологичных белков. Протеолитическое расщепление предпочтительно осуществляют на аликвоте того же образца, который был использован в хроматографическом анализе интактных белков.

В других вариантах настоящего изобретения идентификацию уникальных маркерных пептидов, происходящих от вариабельной области отдельных членов композиции гомологичных белков, применяют для качественной характеристики композиции белков на присутствие отдельных членов этой композиции. Эти уникальные маркерные пептиды получают путем протеолитического расщепления композиции белков (образца), содержащей(его) различные гомологичные белки.

Для осуществления пептидного картирования вариабельных областей смеси гомологичных белков важно, чтобы часть или части вариабельных областей, которые позволяют дифференцировать отдельные члены этой смеси от других ее членов, оставались интактными после такого протеолитического расщепления. Следовательно, одна или несколько протеаз должны быть выбраны так, чтобы для каждого отдельного члена рекомбинантного поликлонального белка могла быть получена, по меньшей мере, одна уникальная последовательность, также называемая маркерным пептидом. Если смесью гомологичных белков является рекомбинантное поликлональное антитело или рекомбинантный поликлональный ТсR, то последовательности, которые позволяют дифференцировать отдельные члены этой смеси от других ее членов, обычно характеризуют по областям CDR. Выбор протеаз или химических соединений, используемых для продуцирования уникальных маркерных пептидов, осуществляют исходя из анализа последовательностей белка, составляющих образец гомологичного белка. Обычно такие протеазы или химические соединения должны расщеплять белок в определенных сайтах с высокой специфичностью. Такие протеазы с протеолитической специфичностью хорошо известны специалистам, и примерами таких протеаз могут служить трипсин, эндо-Glu-С, лизилэндопептидаза, эндо-Arg-С, эндо-Asp-N или эндо-Asn-С. Эти протеазы приведены лишь в качестве примеров и не должны рассматриваться как ограничение данного варианта изобретения.

Если образец поликлонального белка расщепляют одной или несколькими выбранными протеазами, то может быть получен пул пептидов, происходящих как от константной, так и от вариабельной областей всех отдельных членов этого белка. Часть уникальных маркерных пептидов по своим физико-химическим свойствам будет отличаться от главной популяции пептидов, происходящих от константных областей. Поэтому уникальные маркерные пептиды могут быть выделены с применением одного из вышеописанных хроматографических методов. Для выделения уникальных пептидов из главной фракции пептидов константной области предпочтительно использовать ионообменную хроматографию или ОФ-ВЭЖХ, специально разработанную для разделения пептидов. Аналогичным образом для разделения уникальных маркерных пептидов могут быть также применены методы многомерной хроматографии, описанные выше. После разделения по одному или нескольким параметрам для идентификации различных пептидов может быть применена масс-спектрометрия (МС). МС-методы, известные специалистам в области протеомики, могут быть использованы для идентификации пептидов. Предпочтительными МС-методами является матричная Уф-лазерная десорбционная/ионизирующая (MALDI), времяпролетная (TOF) масс-спектрометрия и времяпролетная масс-спектрометрия с ионизацией электрораспылением (ESI-TOF).

Альтернативно протеолитическое расщепление может быть осуществлено на интактных белках, разделенных с помощью одномерной или многомерной хроматографии, описанной выше в пунктах (а)-(d) и в разделе “Многомерная жидкостная хроматография”, с последующим протеолитическим расщеплением выделенных фракций белка. Эти гидролизаты могут быть затем проанализированы с помощью МС (Kachman M.T. et al., 2002, Anal. Chem. 74, 1779-1791). Этот метод может оказаться предпочтительным для характеристики очень сложных поликлональных белков, поскольку он может быть селективным по отношению к части фракций, полученных посредством одномерного или многомерного анализа интактных белков, проводимого для их дополнительной характеристики.

При этом может быть осуществлено дополнительное протеолитическое расщепление для выделения N-концевых маркерных пептидов, если они содержат уникальные вариабельные области. N-концевые пептиды могут быть выделены в основном, как описано в публикации Gevaert K. et al., 2003. Nat. Biotechnol. 21, 566-569, которая вводится в настоящее описание посредством ссылки. Вкратце, свободные аминогруппы в рекомбинантном поликлональном белке блокируют, например, путем ацетилирования, а затем смесь белков расщепляют подходящей протеазой. В результате такого расщепления образуется свободная N-концевая аминогруппа на внутренних пептидах, которые затем блокируют соединением, позволяющим отделять внутренние пептиды от N-концевых пептидов. Такими соединениями могут быть i) 2,4,6-тринитробензолсульфоновая кислота (TNBS), описанная Gevaert, которая может быть использована для выделения посредством гидрофобных взаимодействий, ii) биотин, который затем удаляют после его связывания с иммобилизованным стрептавидином, или iii) предварительно активированные матрицы (например, NHS-активированная матрица, CNBr-активированная матрица, ECH-сефароза или бис-акриламидный носитель UltraLink с азалактоновыми группами), которые затем подвергают центрифугированию для отделения связанных внутренних пептидов от ацетилированных N-концевых пептидов, присутствующих в супернатанте. Выделенные ацетилированные N-концевые пептиды могут быть затем проанализированы с помощью одномерной или мультимерной жидкостной хроматографии, проводимой в комбинации с МС-анализом, как описано выше. Альтернативно N-концы интактных пептидов блокируют соединением, позволяющим осуществлять их специфическое разделение, а внутренние пептиды, образующиеся после расщепления, ацетилируют или блокируют вторым соединением.

Кроме того, идентификация уникальных маркерных пептидов после протеолитического расщепления может быть осуществлена с использованием характерных функциональных групп боковой цепи аминокислот. При этом может быть применен(а) один метод или комбинация методов, основанных на различии аффинности и включающих захват пептидов, содержащих конкретные аминокислотные остатки с релевантными модификациями боковой цепи аминокислотных остатков или без такой модификации. Пептиды, содержащие, например, цистеин, метионин, триптофан, гистидин и тирозин, могут быть очищены с использованием колоночного материала или иммобилизованных сфер со специфическими аффинными метками, которые захватывают пептиды, содержащие указанные аминокислотные остатки (Bernhard O.K. et al. 2003, Proteomics 3, 139-146; Chelius D. & Shaler T.A., 2003. Bioconjug. Chem. 14, 205-211; Gevaert K. et al. 2002. Mol. Cell Proteomics 1, 896-903; Gygi S.P. et al., 1999. Nat. Biotechnol. 17, 994-999). Уникальные пептиды вариабельной области, содержащие цистеин и тирозин, могут быть, например, иммобилизованы на колонке со стрептавидином после биотинилирования цистеинового остатка с последующим элюированием цистеин-содержащих пептидов, которые могут быть нанесены либо на колонку, либо на сферы, которые специфически связываются с тирозиновыми остатками. Такой захват пептидов, основанный на аффинности к специфическим аминокислотным остаткам, может быть осуществлен как дополнительный метод к ранее описанным хроматографическим методам, таким как ОФ-ВЭЖХ и ионообменная хроматография. Сначала протеолитический гидролизат рекомбинантного поликлонального белка подвергают хроматографии по одному или несколькими параметрам, а затем в конечной стадии осуществляют специфический захват аминокислот на одной или нескольких фракциях с последующим проведением анализа с помощью МС. Выделение пептидов исходя из функциональных групп боковых цепей может быть дополнительно осуществлено в комбинации с методом выделения N-концевого пептида.

Если рекомбинантным поликлональным белком, проанализированным посредством протеолитического расщепления с последующими выделением пептида, является мультимерный белок, то для упрощения анализа протеолитического гидролизата методом “фингерпринтов”, разделение субъединиц предпочтительно проводить перед протеолизом. Это может быть осуществлено, например, путем восстановления и алкилирования свободных цистеиновых остатков с последующей гель-фильтрацией для разделения субъединиц, например разделения тяжелых цепей от легких цепей или альфа-цепей от бета-цепей, если поликлональным белком является антитело или ТсR соответственно. Альтернативно протеолитическое расщепление может быть осуществлено в естественных условиях. Такое расщепление является особенно подходящей альтернативой для антител, поскольку четвертичная структура антител является причиной их высокой резистентности к протеолитическому расщеплению в константных областях. Таким образом, протеолитическое расщепление интактного невосстановленного поликлонального антитела может быть также осуществлено для генерирования пептидов, главным образом, из вариабельных областей.

Описанный выше метод протеолитического гидролиза может быть также применен в соответствии с концепцией индикаторных белков путем отбора индикаторных пептидов, которые могут быть охарактеризованы в протеолитическом гидролизате.

“Объемное” N-концевое секвенирование

Как описано выше, N-концевая последовательность может быть выделена и использована для анализа протеолитического гидролизата поликлонального белка методом “фингерпринтов”. Альтернативно, N-концевая последовательность может быть секвенирована непосредственно из интактного белка, без проведения стадии гидролиза. “Объемный” анализ N-концевой последовательности в образце белка, содержащем различные гомологичные белки, имеющие вариабельные области, может быть использован для сравнения очищенных продуктов данной партии, например, рекомбинантного поликлонального белка. Если поликлональным белком является рекомбинантное поликлональное антитело или ТсR, “объемное” N-концевое секвенирование предпочтительно осуществлять в пуле разделенных тяжелых и легких цепей или разделенных альфа- и бета-цепей соответственно. Например, в пуле гомологичных тяжелых цепей аминокислоты в некоторых положениях могут быть полностью консервативными, тогда как в других положениях они могут варьироваться, и это может быть определено путем сопоставления аминокислотных последовательностей путем их выравнивания. Таким образом, несколько различных аминокислот могут быть получены во время проведения отдельных раундов секвенирования. Так, например, в 4-положении поликлонального образца могут присутствовать пять различных аминокислот, как было ранее определено путем сопоставления гомологичных последовательностей. В процессе анализа путем “объемного” секвенирования N-концевой последовательности эти варьирующиеся аминокислоты могут быть количественно оценены, и различные количества отдельных аминокислот, присутствующих, например, в положении 4 рекомбинантного поликлонального антитела, могут быть использованы для сравнения относительного состава различных образцов.

Характеристика сложных смесей гомологичных белков с использованием специфических детекторных молекул

В способах характеристики по изобретению также применяются специфические детекторные молекулы, каждая из которых способна идентифицировать отдельный член белка в сложной смеси гомологичных белков, что, тем самым, позволяет проводить мониторинг на присутствие данного конкретного члена в образце. Такими специфическими детекторными молекулами могут быть, например, специфические лиганды, такие как небольшие органические молекулы, пептиды или белки, обладающие специфичностью к отдельному члену поликлонального белка. В частности, предпочтительными вариантами настоящего изобретения являются пептиды- или белки-лиганды, такие как антиидиотипические пептиды или антиидиотипические антитела. В настоящем изобретении также используется детекторная молекула, которая связывается с определенной субпопуляцией сложной смеси гомологичных белков.

Специфические детекторные молекулы могут быть использованы для характеристики сложных смесей гомологичных белков благодаря тому, что (i) они позволяют определять концентрации или относительные количества одного или нескольких отдельных белков в образце, содержащем сложную смесь гомологичных белков; (ii) они служат в качестве дополнительного параметра для измерения в хроматографических анализах; (iii) они позволяют определять концентрации отдельных белков в образцах, полученных в процессе ферментации сложной смеси гомологичных белков; (iv) они позволяют детектировать клетки, продуцирующие отдельный белок в поликлональной клеточной линии, такой как банк рабочих клеток или образец клеток в биореакторе, и экспрессирующие смесь гомологичных белков. Стадия (iv) может быть осуществлена либо на поликлональной клеточной линии, либо на отдельных клетках, которые были распределены по отдельным пробиркам из поликлональной клеточной линии с последующим их культивированием.

Для продуцирования специфических пептидов-лигандов, способных идентифицировать отдельные члены белка в сложной смеси гомологичных белков, могут быть аффинно скринированы обширные библиотеки экспрессионных векторов, полученных на основе нитчатых фагов, представляющих чужеродные олигомерные пептиды на поверхности вириона, с последующей очисткой фагов, которые представляют чужеродный пептид, связывающийся с антителом, ТсR или с другим нужным отдельным членом данного белка (Scott & Smith, 1990, Science 249, 386-90). В ЕР 1106626 конкретно описано генерирование пептидов, способных связываться с анти-RhD антителами и используемых в целях иммунизации. Представленные пептидные библиотеки имеют длину приблизительно от 5 до 50 аминокислот, а предпочтительно от 7 до 20 аминокислот, еще более предпочтительно от 8 до 15 аминокислот, а наиболее предпочтительно от 9 до 12 аминокислот. Если были идентифицированы релевантные пептиды, то они могут быть синтезированы.

Генерирование антиидиотипических антител, по существу, известно специалистам. Вкратце, мышей иммунизируют антителом, против которого направлены нужные антиидиотипические антитела. После вырабатывания моноклональных антител у иммунизованных мышей их скринируют на продуцирование антиидиотипического антитела с нужной специфичностью, например, гибридомным методом или методом фагового представления. Антиидиотипические пептиды или антиидиотипические антитела должны быть охарактеризованы в отношении их специфичности и потенциальной перекрестной реактивности. Этот анализ позволяет подтвердить, распознает ли антиидиотипический пептид или антиидиотипическое антитело конкретный член или, альтернативно, субпопуляцию близкородственных членов в поликлональном белке (для антител родственными членами могут быть, например, семейство специфических генов VH).

Антиидиотипические пептиды/антитела могут быть использованы в иммунодетекторных анализах, таких как ELISA, FLISA или РИА, применяемых для прямой количественной оценки отдельных членов белков (например, специфического антитела или специфического ТсR). Альтернативно антиидиотипические пептиды/антитела могут быть использованы в аффинной хроматографии либо отдельно, либо в качестве первого или дополнительного варианта после других хроматографических разделений, описанных выше. Иммунопреципитация представляет собой дополнительную процедуру, в которой детекторные молекулы могут быть использованы для разделения и характеристики отдельных членов поликлонального белка. Кроме того, антиидиотипический пептид или антиидиотипическое антитело могут быть использованы для выделения и/или определения клеток, продуцирующих отдельный белок в поликлональной клеточной линии. Методы, описанные в публикациях Borth N. et al., 2000-2001., Biotechnol. Bioeng. 71, 266-273 и Brezinsky S.C. et al., 2003, J. Immunol. Methods 277, 141-155, применяются для выделения клеток, продуцирующих отдельный белок, из клеточной культуры.

В принципе, в целях полной характеристики можно продуцировать специфические детекторные молекулы для всех и каждого отдельного члена поликлонального белка. Однако в соответствии с настоящим изобретением для мониторинга стабильности экспрессии или состава различных партий достаточно идентифицировать число отдельных членов, так называемых белков-индикаторов, в рекомбинантном поликлональном белке в целях количественной и/или качественной характеристики, проводимой для гарантии того, что данная совокупность отдельных членов белка будет экспрессироваться на одном и том же уровне и присутствовать в чистом виде в различных партиях рекомбинантно продуцированного поликлонального белка. Этот подход может быть, в частности, применен для облегчения процедуры характеристики сложного пула молекул белка. Концепция белков-индикаторов как представителей рекомбинантного поликлонального белка может применяться не только для специфической детекторной молекулы, а фактически такая концепция белков-индикаторов или пептидов может быть применена в любом из описанных ранее способов характеристики или их комбинаций. Кроме того, белки-индикаторы могут варьироваться в различных методах. Некоторые специфические члены поликлонального белка могут быть, в частности, разделены исходя из различия их физико-химических свойств, однако для разделения белков с идентичными физико-химическими свойствами особенно подходящими являются антиидиотипические пептиды с высокой аффинностью.

В некоторых вариантах настоящего изобретения для мониторинга относительного количества одного или нескольких белков-детекторов в образцах, содержащих различные гомологичные белки, имеющие различные вариабельные области, используются одна или несколько специфических детекторных молекул. Постоянное количество одного или нескольких белков-индикаторов в серии родственных образцов будет отражать композиционную стабильность экспрессии поликлонального белка в различных партиях, а также в течение всего времени продуцирования за один производственный цикл. Кроме того, композиционная стабильность может быть оценена во время длительного хранения рекомбинантного поликлонального белка или смеси моноклональных белков.

В предпочтительных вариантах настоящего изобретения белки-индикаторы рекомбинантного поликлонального белка подвергают характеристике одним или несколькими из нижеследующих методов, таких как (i) аффинная хроматография на антиидиотипическом пептиде/антителе; (ii) иммунодетекция с использованием антиидиотипических пептидов/антител; (iii) выделение посредством многомерной хроматографии интактных членов по их характерным физико-химическим свойствам, (iv) картирование протеолитических пептидов с использованием хроматографии и МС.

Состав смеси различных характеризуемых гомологичных белков

Образец, характеризуемый в соответствии со способом настоящего изобретения, содержит определенную субпопуляцию различных гомологичных белков, имеющих различные вариабельные области, например поликлональный белок или антитела с различными CDR-областями (например, поликлональное антитело или смесь моноклональных антител) или Т-клеточные рецепторы с различными CDR-областями (например, поликлональный ТсR или смесь моноклональных ТсR). При этом предпочтительно, чтобы различными гомологичными белками, имеющими различные вариабельные области, были рекомбинантные белки. Кроме того, предпочтительно, чтобы отдельные члены поликлонального белка или смеси моноклональных белков были определены по их общим признакам, таким как активность связывания с нужной мишенью, например, в случае антител или ТсR, направленных против нужного антигена-мишени. Обычно поликлональный белок, анализируемый в соответствии со способом характеристики по изобретению, имеет в своем составе, по меньшей мере, 3, 4, 5, 10, 20, 50, 100, 1000, 104, 105 или 106 отдельных различных членов. Обычно ни один из различных членов не составляет более 75% от общего числа других членов в данной композиции поликлонального белка. Предпочтительно ни один из отдельных членов не превышает 50%, более предпочтительно 25%, а наиболее предпочтительно 10% от общего числа отдельных членов в конечной поликлональной композиции.

В случае антител на число различных членов в композиции поликлонального белка, характеризуемых в соответствии со способом настоящего изобретения, будет влиять состав антигена(ов)-мишени(ей). В небольших или в не очень сложных мишенях, например в небольшом белке-мишени, для характеристики может быть выбрана композиция поликлональных белков, содержащая от 3 до 100 различных отдельных членов и предпочтительно, чтобы число этих вариантов не превышало 90, или даже 80 или 70. Во многих случаях число отдельных вариантов не должно превышать 60 или 50, а предпочтительно, чтобы число таких вариантов составляло в пределах от 5 до 40, например от 5 до 30. В противоположность этому для более сложных мишеней, например в вирусах со сложными или взаимозаменяемыми поверхностными белками или в мишенях, охватывающих вирусы нескольких подтипов, может быть проведена характеристика композиции поликлональных белков, содержащей от 20 до 500 различных членов. Для очень сложных мишеней, где антиген содержит множество различных молекул, в соответствии с настоящим изобретением может потребоваться характеристика композиции поликлональных белков, содержащей от 50 до 10000 различных компонентов.

В одном из вариантов настоящего изобретения образцом, содержащим различные гомологичные белки, имеющие различные вариабельные области, является поликлональное антитело. Такое поликлональное антитело может состоять из одного или нескольких антител различных изотипов, таких как человеческие изотипы IgG1, IgG2, IgG3, IgG4, IgА1 и IgА2, или мышиные изотипы IgG1, IgG2а, IgG2b, IgG3 и IgА.

В одном из вариантов настоящего изобретения образцом, содержащим различные гомологичные белки, имеющие различные вариабельные области, является поликлональный ТсR.

Примеры

В нижеследующих примерах для иллюстрации способа структурной характеристики по изобретению были использованы различные композиции рекомбинантных поликлональных антител против RhD (анти-RhD rpAb), состоящие из различных отдельных анти-RhD антител-компонентов, или клеточные линии, продуцирующие анти-RhD rpAb. Отдельные анти-RhD-специфические антитела и клеточные линии, продуцирующие эти антитела, соответствуют указанным антителам и клеточным линиям, описанным в переуступленной заявке на патент Дании РА 2004 01133, поданной 20 июля 2004. Вкратце, комбинаторную библиотеку фагового представления вариабельных областей тяжелой цепи и легких цепей каппа/лямбда антител получали от отрицательных по резус-фактору D доноров, иммунизованных RhD-позитивными эритроцитами. Эту библиотеку подвергали пэннингу на клоны, продуцирующие специфическое анти-RhD антитело. Пары генов вариабельных областей тяжелой и легкой цепей, полученные из антиген-специфических фагов, переносили в экспрессионный вектор млекопитающего. Указанные векторы млекопитающих по отдельности переносили в клеточную линию СОН Flp-In (Invitrogen, СА) сайт-специфическим методом с использованием системы рекомбинации Flp-FRT. Последовательности нуклеиновой кислоты (нуклеотидов), а также белка (аминокислот) для полноразмерных легких цепей (LC), а также для вариабельной области тяжелых цепей (VH) идентифицировали по числу идентичных последовательностей (SEQ ID), представленных в таблице 2. Эти числа соответствуют последовательностям SEQ ID №№, указанным в переуступленной Международной патентной заявке РСТ/DК2005/000501, озаглавленной “ANTI-RHESUS D RECOMBINANT POLYCLONAL ANTIBODY AND METHODS OF MANUFACTURE” и поданной 18 июля 2005. Идентификационные номера (SEQ ID) в таблице 2 должны отличаться от SEQ ID NO: настоящей заявки, поскольку они не являются идентичными. Константная область тяжелых цепей соответствует человеческому IgG1.

Пример 1

В данном примере проиллюстрированы генерирование поликлональной клеточной линии-продуцента и характеристика изменений в различных партиях на уровне белка с применением хроматографического метода разделения по одному параметру и на генетическом уровне с помощью RFLP-анализа.

Получение клеточной линии-продуцента для генерирования рекомбинантного поликлонального антитела против резуса-фактора D

Было отобрано десять клеточных линий, каждая из которых в специфическом сайте своего генома экспрессировала отличающееся от других рекомбинантное антитело против резус-фактора D (RhD157.119D11, RhD158.119В06, RhD159.119В09, RhD161.119Е09, RhD163.119А02, RhD190.119F05, RhD191.119E08, RhD192.119G06, RhD197.127A08 и RhD204.128А03), и эти клеточные линии смешивали для получения клеточной линии, продуцирующей рекомбинантное поликлональное антитело. RhD197 и RhD204 представляют собой клоны лямбда, а остальные представляют собой клоны каппа.

После того как клеточные культуры, экспрессирующие отдельные антитела против резус-фактора, были полностью адаптированы для культивирования в бессывороточной суспензионной культуре в шейкерных колбах, их смешивали в равном клеточном соотношении, в результате чего была получена поликлональная клеточная линия СНО-Flp-In (019). Смешанную клеточную культуру центрифугировали и замораживали в аликвотах 10×106 клеток/пробирку.

Две пробирки (3948 FСW065 и 3949 FСW065) оттаивали и отдельно культивировали в течение 11 недель в 1000-миллилитровых шейкерных колбах, содержащих 100 мл бессывороточной среды Excell302 с неомицином.

Супернатант собирали и фильтровали с последующей очисткой анти-RhD rpAb.

Клональное разнообразие

Клональное разнообразие анализировали на уровне белка, а также на уровне мРНК. Образец супернатанта, используемый для анализа композиции антител, брали после культивирования в течение 9 недель, а образец клеток, используемый для анализа композиции мРНК, брали после культивирования в течение 11 недель.

Композиция антител:

Антитело rpAb против RhD, экспрессируемое из поликлональной клеточной линии СНО-Flp-In (019), представляет собой антитело изотипа IgG1. Анти-RhD rpAb выделяли из обеих аликвот (3948 и 3949) на колонке с иммобилизованным белком А. Отдельные антитела взаимодействовали с иммобилизованным белком А при рН 7,4, а примесные белки вымывались из колонки. Затем связанные антитела элюировали с колонки при низком рН (рН 2,7). Фракции, содержащие антитела, детектировали путем измерения оптической плотности при 280 нм, затем объединяли и диализовали против 5 мМ ацетата натрия, рН 5.

Композиции анти-RhD rpAb, полученные из аликвот 3948 и 3949 (FСW065) после 9-недельного культивирования, анализировали с помощью катионообменной хроматографии. Анти-RhD rpAb, очищенное на белке А, наносили на колонку PolyCatA (4,6×100 мм) в 25 мМ ацетате натрия, 150 мМ хлориде натрия, рН 5,0, при скорости потока 60 мл/ч-1 и при комнатной температуре. Затем антитела-компоненты элюировали линейным градиентом 150-350 мМ хлорида натрия в 25 мМ ацетата натрия, рН 5,0, при скорости потока 60 мл/ч-1. Антитела-компоненты детектировали на спектрофотометре при 280 нм. Затем строили хроматограмму (фиг.1), и для количественной оценки антител-компонентов использовали площади отдельных пиков А-J (таблица 3). Общую площадь пиков принимали за 100%. Хроматограммы, полученные от двух аликвот, обнаруживали идентичное распределение пиков, а также аналогичные концентрации компонентов в каждом пике. Исходя из этих данных можно сделать вывод, что аликвоты от одной и той же поликлональной клеточной линии, культивированной в идентичных условиях, продуцировали анти-RhD rpAb с аналогичным распределением отдельных антител-компонентов.

Отдельные члены анти-RhD rpAb были приписаны одному или нескольким конкретным пикам (данные систематизированы в таблице 3). Такое присвоение было сделано исходя из хроматограмм, полученных для отдельных антител, анализируемых в идентичных условиях. Для Ab RhD158 не была получена отдельная хроматограмма, а поэтому этот клон не был приписан ни к одному из пиков. Однако предполагается, что RhD158, по всей вероятности, относится к пику D, но такое антитело может быть также представлено и в некоторых других пиках, что обусловлено его гетерогенностью. В частности, антитело, полученное из клона RhD197, обнаруживало высокую степень гетерогенности в ИОХ-профиле. Ab RhD190 должно наблюдаться при времени удерживания 15,3 мин. Однако оно не было детектировано, что указывает на то, что этот клон был либо потерян либо он альтернативно продуцировался в рекомбинантной поликлональной клеточной линии-продуценте в количестве ниже детектируемого предела. Потеря клона RhD190 указывает на 10%-ное снижение разнообразия, которое считается допустимым в конечной композиции анти-RhD rpAb.

Таблица 3
Пик Количество 3948 (% площади) Количество 3949 (% площади) Обозначение Ab Комментарии
А 5,1 5,1 RhD157 Это Ab также присутствует в пике В
В 12,0 10,2 RhD157
RhD159
RhD192
Этот пик представляет, по меньшей мере, три различные Ab
С 5,2 5,3 RhD191
D 1,2 0,8 (RhD158) Фактически не приписан этому пику, но, вероятно, он соответствует этому пику. RhD158 может быть также представлен в других пиках
E 10,9 14,4 RhD204
F 24,3 23,0 RhD197
G 13,6 12,5 RhD197 Этот клон разделен на несколько пиков, что обусловлено его гетерогенностью
Н 3,3 4,0 RhD197
I 14,0 13,7 RhD161
J 10,5 10,5 RhD163
RhD190 Это Ab не было обнаружено

Композиция мРНК:

Клональное разнообразие в поликлональной клеточной линии СНО-Flp-In (019) после 11-недельного культивирования оценивали с помощью RFLP-анализа посредством ОТ-ПЦР. Вкратце, клеточные суспензии, состоящие из 200 клеток, подвергали процедуре замораживания-оттаивания, и эти лизаты использовали в качестве матрицы в ОТ-ПЦР, проводимой с использованием набора для одностадийной ОТ-ПЦР (Qiagen) и с использованием праймеров для амплификации легкой цепи. Используемые праймеры имели следующие последовательности:

Прямой праймер: 5'-TCTCTTCCGCATCGCTGTCT (SEQ ID NO:1)

Обратный праймер: 5'-AGGAAAGGACAGTGGGAGTGGCAC (SEQ ID NO:2)

ОТ-ПЦР-продукты гидролизовали ферментом HinfI, анализировали с помощью электрофореза на агарозном геле и рестрикционный продукт визуализировали путем окрашивания этидийбромидом (фиг.2)

Предполагаемый размер рестрикционных фрагментов, полученных путем HinfI-гидролиза легких цепей, амплифицированных с помощью ОТ-ПЦР, показаны в таблице 4 для каждого отдельного клона. Шесть уникальных по размеру фрагментов на геле, которые могут быть приписаны отдельным членам генов, кодирующих поликлональное антитело против резус-фактора D, показаны жирным шрифтом. Не все уникальные фрагменты могли быть идентифицированы на геле, и эти фрагменты показаны курсивом. Однако нельзя исключать, что эти клоны фактически присутствуют в культуре, поскольку указанные фрагменты могут быть не полностью отделены от других идентифицируемых фрагментов, или альтернативно, их концентрация может быть слишком мала по сравнению с концентрацией фрагментов, соответствующих более ярким полосам. Это может быть более характерно для коротких фрагментов, поскольку они связываются с меньшим числом молекул этидийбромида, а поэтому являются менее заметными.

Таблица 4
RhD # 157 158 159 161 163 190 191 192 197 204
Размер HinfI-фрагмента 825 671 505 696 505 502 475 671 743 521
138 138 320 138 166 191 268 149 138 167
76 126 138 126 154 138 138 138 85 138
76 77 76 138 126 85 76 76 88
22 76 76 76

Две аликвоты (3948 и 3949) от одной и той же поликлональной клеточной линии обнаруживали аналогичный профиль экспрессии в геле, хотя по своей интенсивности эти полосы не являются полностью идентичными. Это указывает на то, что аликвоты от одной и той же поликлональной клеточной линии, культивированной в идентичных условиях, продуцируют анти-RhD rpAb с аналогичным клональным разнообразием.

Выводы

Десять клеточных линий, каждая из которых экспрессировала моноклональное анти-RhD антитело, смешивали для генерирования клеточной линии, продуцирующей анти-RhD rpAb, и эта клеточная линия после ее культивирования в течение 9 недель все еще сохраняла 90% своего исходного клонального разнообразия. После 11-недельного культивирования мРНК, выделенная из шести различных клонов, могла быть однозначно идентифицирована, а несколько других клонов, вероятно, присутствуют в полосе примерно 500 п.н.

Тот факт, что две аликвоты поликлональных клеточных линий СНО-Flp-In (019) обнаруживали аналогичные результаты в отношении клонального разнообразия, указывает на то, что различные партии могут быть получены с репродуцируемыми результатами.

Пример 2

В данном примере проиллюстрирована характеристика поликлональной клеточной культуры с восьмью членами в течение определенного периода времени. Клональное разнообразие культуры оценивали на генетическом уровне с помощью RFLP-анализа и на белковом уровне с помощью хроматографии путем разделения по одному параметру.

RFLP-анализ для оценки клонального разнообразия в поликлональных клеточных культурах

Распределение отдельных клонов в поликлональной клеточной культуре, экспрессирующей восемь различных антител против резус-фактора D, оценивали с помощью RFLP-анализа концевой последовательности (Т-RFLP) ОТ-ПЦР-продуктов, полученных из поликлональной клеточной линии. В Т-RFLP-процедуре, прямой и/или обратный праймеры являются флуоресцентно меченными, а поэтому часть рестрикционных фрагментов, генерированных из ампликонов, будет содержать метку. Меченые фрагменты могут быть затем разделены с помощью капиллярного электрофореза и детектированы по интенсивности флуоресценции. Такой анализ может быть проведен на последовательностях, кодирующих легкую цепь и вариабельную область тяжелой цепи, в зависимости от используемых праймеров.

Вкратце, клеточную суспензию, состоящую из 200 клеток, один раз промывали в PBS и подвергали процедуре замораживания-оттаивания и полученные лизаты использовали в качестве матрицы в ОТ-ПЦР-амплификации, проводимой с использованием набора для одностадийной ОТ-ПЦР (Qiagen) и подходящих праймеров.

ОТ-ПЦР проводили в стандартной термоячейке в следующем режиме:

Обратная транскрипция: 55°С в течение 30 мин.

Денатурация: 95°С в течение 15 мин.

Начальный раунд (35 циклов)

Денатурация: 95°С в течение 30 сек.

Отжиг: 60°С в течение 30 сек.

Удлинение: 72°С в течение 5 мин.

Конечный раунд:

Удлинение: 72°С в течение 15 мин.

Конечная стадия: всегда при 8°С

Для анализа легкой цепи с помощью ОТ-ПЦР-амплификации использовали указанные ниже праймеры. Обратный праймер был помечен 6-карбоксифлуоресцеином (FАМ), и эти праймеры имели следующие последовательности:

VL: Прямой праймер: 5'-TCTCTTCCGCATCGCTGTCT (SEQ ID NO:1)

СL: Обратный праймер: 5'-AGGAAAGGACAGTGGGAGTGGCAC (SEQ ID NO:2).

20 мкл ОТ-ПЦР-продукта гидролизовали 1 ед. NheI, 1 ед. PstI и 1 ед. HinfI (все ферменты поставлялись фирмой New England Biolabs) в NЕВ1 в течение 2 часов.

Меченые фрагменты детектировали с помощью флуоресцентного капиллярного электрофореза на АВI3700 (Apрlied Biosystems) в Государственном институте сыворотки, Копенгаген, Дания (Statens Serum Institute, Copenhagen, DK).

Предполагаемые фрагменты для каждого клеточного клона, продуцирующего анти-RhD антитело, приводятся в таблице 5, а FАМ-меченые фрагменты показаны жирным шрифтом.

Таблица 5
RhD # 191 196 201 203 244 306 319 324
Размер NheI/PstI/HinfI-фрагмента 475 696 516 422 690 682 761 513
210 138 166 318 138 138 138 166
138 76 138 138 76 76 76 138
76 67 76 76 67 67 67 76
67 59 76 67 41 59 76
58 67 18 18 17 67
18

Т-RFLP-профиль представлен на фиг.3, а все восемь клонов, продуцирующих антитело против резус-фактора D, приписаны конкретным пикам. Если предположить, что в процессе ОТ-ПЦР не происходит конкуренции матрицы с праймером, то относительная площадь пика будет соответствовать относительному количеству мРНК, транскрибируемой из гена легкой цепи каждого антитела, присутствующего в поликлональной клеточной линии.

Для анализа вариабельной области тяжелой цепи в той же самой поликлональной клеточной линии проводили ОТ-ПЦР-амплификацию с использованием VH-специфических праймеров. Эти праймеры имели следующие последовательности:

VН: Прямой праймер: 5'-FАМ-CGTАGCTCTTTTAAGAGGTG (SEQ ID NO:3)

VH: Обратный праймер: 5'-НЕХ-ACCGATGGGCCCTTGGTGGA (SEQ ID NO:4).

20 мкл ОТ-ПЦР-продукта гидролизовали 1 ед. RsaI и 1 ед. NdeI (все ферменты поставлялись фирмой New England Biolabs) в NЕВ2 в течение 2 часов.

Меченые фрагменты детектировали с помощью флуоресцентного капиллярного электрофореза на АВI3700. Анализ проводили в Государственном институте сыворотки, Копенгаген, Дания (Statens Serum Institute, Copenhagen, DK).

Предполагаемые Т-RFLP-профили представлены в таблице 6, где FАМ-меченые фрагменты показаны жирным шрифтом, а фрагменты, меченные НЕХ (сукцинимидиловым эфиром 6-карбокси-2',4,4',5,7,7'-гексахлорфлуоресцеина), подчеркнуты.

Таблица 6
RhD # 191 196 201 203 244 306 319 324
Размер RsaI/NdeI-фрагмента 203 429 186 350 435 328 232 266
166 142 88 79 118 157
63 79 22 79
22 9 9
9

Поликлональную клеточную линию культивировали в течение 5 недель и через неделю образцы брали для проведения Т-RFLP-анализов. Анализ проводили на вариабельной области тяжелой цепи, но его можно также проводить и на легкой цепи, если это необходимо.

После капиллярного электрофореза рестрикционных фрагментов относительные площади пиков суммировали и использовали для оценки клонального разнообразия поликлональной клеточной культуры. Относительные количества, полученные за определенный период времени, приводятся на фиг.5.

Исходя из этих данных можно сделать вывод, что за этот период времени количество RhD196 увеличивается, а количество RhD203 снижается. Количество других клонов остается абсолютно стабильным в период культивирования, а все восемь кДНК могут быть детектированы после культивирования в течение пяти недель.

Путем проведения Т-RFLP-анализа на легкой цепи и на тяжелой цепи, а также на уровне мРНК и ДНК, можно получить точный фингерпринт клонального разнообразия в поликлональной клеточной культуре, например, для клеток in vitro на определенной фазе их развития или в данный момент времени в процессе культивирования.

Следовательно, этот способ может быть использован для мониторинга стабильности клонального разнообразия в клеточной культуре в определенный период времени продуцирования антитела. Этот способ может быть также использован для мониторинга композиционного состава различных партий, например в различных замороженных ампулах, полученных из того же самого банка поликлональных рабочих клеток (рWCB), или в клетках, собранных после проведения двух или более производственных циклов.

Анализ, проводимый с помощью катионообменной хроматографии для оценки клонального разнообразия в поликлональной клеточной культуре

Анти-RhD rpAb, полученное из той же самой поликлональной клеточной культуры, которая была использована в Т-RFLP-анализе, описанном выше, анализировали с помощью катионообменной хроматографии. Рекомбинантно продуцированное поликлональное антитело, очищенное на белке А, наносили на колонку PolyCatA (4,6×100 мм) в 25 мМ ацетате натрия, 150 мМ хлориде натрия, рН 5,0, при скорости потока 60 мл/ч-1 и при комнатной температуре. Затем антитела-компоненты элюировали линейным градиентом 150-350 мМ хлорида натрия в 25 мМ ацетата натрия, рН 5,0, при скорости потока 60 мл/ч-1. Антитела-компоненты детектировали на спектрофотометре при 280 нм и строили хроматограмму, после чего площадь отдельных пиков использовали для количественной оценки антител-компонентов. Относительные количества, полученные в определенные периоды времени, приводятся на фиг.6.

Выводы

Проводили сравнение результатов, полученных на генетическом уровне с помощью RFLP-анализа и на уровне белка с помощью катионообменной хроматографии. На фиг.5 и 6 ясно проиллюстрировано, что большинство отдельных клонов в поликлональной клеточной линии, а также отдельные антитела, входящие в состав этих поликлональных антител, экспрессируемых из указанной клеточной линии, обнаруживали аналогичные профили в течение всех 5 недель культивирования. Таким образом, анализы, проведенные на генетическом уровне и на уровне белка, показали хорошее соответствие с точки зрения композиционного разнообразия клеточной линии на генетическом уровне, а также композиционного разнообразия рекомбинантного поликлонального белка, продуцированного из этой клеточной линии.

Пример 3

В данном примере проиллюстрирована характеристика поликлональной клеточной культуры, состоящей из двадцати пяти членов, в течение определенного периода времени. Клональное разнообразие культуры оценивали на генетическом уровне с помощью Т-RFLP-анализа и на белковом уровне с помощью хроматографии путем разделения по одному параметру.

Т-RFLP-анализ генов вариабельной области тяжелой цепи, происходящих от поликлональной клеточной культуры, экспрессирующей двадцать пять различных антител против резус-фактора D за период культивирования 5 недель

Поликлональная клеточная культура, оцениваемая в данном примере, состоит из смеси клеточных культур, экспрессирующих двадцать пять различных антител против резус-фактора D (полученных, как описано в примере 1). Поликлональную клеточную культуру культивировали в течение 5 недель и через неделю брали образцы для проведения Т-RFLP-анализов.

ОТ-ПЦР осуществляли с использованием VH-специфических праймеров, описанных в примере 2, и аналогичным образом проводили фрагментацию рестриктирующими ферментами.

Полиморфизм длин рестрикционных последовательностей концевых последовательностей (T-RFLP), кодирующих двадцать пять различных антител против резус-фактора D, в случае присутствия всех генотипов будет приводить к образованию семнадцати различных FAM-меченых фрагментов. Некоторые фрагменты будут представлять до трех различных генотипов, а другие фрагменты будут представлять один генотип. Предполагаемые размеры FAM-меченых фрагментов приводятся в таблице 7 вместе с относительными количествами различных FАМ-меченых фрагментов, измеренными в течение определенного периода времени. Кроме того, один пример Т-RFLP-профиля приводится на фиг.4.

Таблица 7
RhD # Размер RsaI/NdeI-FAM-фрагмента (п.н.) Группа Неделя 1
Площадь, %
Неделя 2
Площадь, %
Неделя 3
Площадь, %
Неделя 4
Площадь, %
Неделя 5
Площадь, %
Rhd157 63 1 9,5 5,0 5,3 4,8 4,6
Rhd159 63 1
Rhd191 63 1
Rhd319 118 2 0,8 0,2 0,2 0,2 0,0
Rhd201 186 3 1,5 0,8 0,9 1,1 0,7
Rhd192 187 3
Rhd199 203 4 0,9 0,3 0,3 0,4 0,4
Rhd162 260 5 7,4 3,6 1,7 1,0 0,0
Rhd324 266 6 1,0 0,8 0,6 0,5 0,0
Rhd306 328 7 10,3 8,0 7,2 7,9 7,8
Rhd203 350 8 6,0 3,4 3,8 5,9 8,9
Rhd305 350 8
Rhd197 356 9 5,1 1,8 1,7 1,8 1,3
Rhd202 359 10 3,8 4,3 5,6 5,2 3,7
Rhd240 369 11 3,3 1,8 1,3 0,8 0,0
Rhd207 414 12 11,7 10,5 10,1 9,9 11,1
Rhd160 426 13 11,3 17,1 17,5 18,1 17,2
Rhd293 426 13
Rhd196 426 13
Rhd245 429 14 6,5 7,1 8,3 11,0 16,8
Rhd321 432 15 6,8 9,4 8,3 7,5 4,9
Rhd241 435 16 4,8 13,7 12,5 7,2 4,0
Rhd189 438 17 9,4 12,3 14,8 16,8 18,7
Rhd301 438 17
Rhd317 438 17

Рестрикционные фрагменты могут быть разделены до той степени, которая позволяет получить данные о двадцати отдельных клонах из двадцати пяти клонов, составляющих данную клеточную линию. Остальные фракции могут быть подвергнуты секвенированию для получения дополнительной информации об этих оставшихся клонах.

Анализ, проводимый с помощью катионообменной хроматографии для оценки клонального разнообразия в поликлональной клеточной культуре, экспрессирующей двадцать пять различных антител против резус-фактора D

Анти-RhD rpAb, полученное из той же самой поликлональной клеточной культуры, которая была использована в Т-RFLP-анализе, описанном выше, анализировали с помощью катионообменной хроматографии. Рекомбинантно продуцированное поликлональное антитело, очищенное на белке А, наносили на колонку PolyCatA (4,6×100 мм) в 25 мМ ацетате натрия, 150 мМ хлориде натрия, рН 5,0, при скорости потока 60 мл/ч-1 и при комнатной температуре. Затем антитела-компоненты элюировали линейным градиентом 150-350 мМ хлорида натрия в 25 мМ ацетата натрия, рН 5,0, при скорости потока 60 мл/ч-1. Антитела-компоненты детектировали на спектрофотометре при 280 нм и строили хроматограмму, после чего площадь отдельных пиков использовали для количественной оценки различных антител-компонентов. На фиг.7 представлена хроматограмма, построенная по данным для образца, полученного через 4 недели, где антитело-содержащие пики пронумерованы от 1 до 25. Эти данные полностью совпадают с данными хроматограммы, на которой число пиков идентично числу отдельных антител в анализируемом поликлональном антителе. В таблице 8 указано относительное содержание в процентах всех антител-компонентов (АС1-АС25), а также представленность отдельных антител в каждом антителе-компоненте (пик). Присваивание отдельных антител интегрированным хроматографическим пикам проводят исходя из их времени удерживания и профилей пиков, полученных от моноклональных антител, проанализированных с помощью катионообменной хроматографии в идентичных условиях.

Таблица 8
Пик Представленное Ab, RhD # Неделя 1
Относит. площадь, %
Неделя 2
Относит. площадь, %
Неделя 3
Относит. площадь, %
Неделя 4
Относит. площадь, %
Неделя 5
Относит. площадь, %
AC 1 293,319 2,06 2,3 1,7 1,06 0,81
AC 2 157,293 3,63 3,83 3,97 3,89 3,06
AC 3 157,192 2,66 2,8 2,89 2,83 2,34
AC 4 159,189,199 6,11 5,52 5,1 4,1 2,99
AC 5 319 2,18 1,94 1,33 1,08 1,26
AC 6 241,191 6,01 6,4 6,32 5,42 4,1
AC 7 189, 192,199, 201 3,89 4,21 3,38 2,95 2,63
AC 8 160 12,1 15,77 18,71 17,59 15,56
AC 9 203,191 2,65 3,89 3,69 3,99 4,14
AC 10 162,202 6,78 10,22 13,52 12,29 9,75
AC 11 203, 306, 301 2,86 3,63 4,35 3,66 3,92
AC 12 245 1,43 1,63 1,5 2,27 2,02
AC 13 301, 321 2,5 3,35 3,92 4,16 3,64
AC 14 305 2,44 2,61 3,12 4,23 6,07
AC 15 196, 197, 240, 305, 321 8,33 7,22 7,36 8,49 4,01
AC 16 197 3,82 2,71 2,15 1,86 7,86
AC 17 196, 240, 324 7,57 5,12 4,86 6,89 7,79
AC 18 197, 321 2,27 1,44 1,51 1,39 2,83
AC 19 196, 240 3,8 2,63 2,87 3,98 6,35
AC 20 317 4,58 1,39 0,77 0,71 0,86
AC 21 317 2,86 0,59 0,36 0,83 0,42
AC 22 207 2,07 2,61 1,58 1,65 1,93
AC 23 207 3,33 3,87 2,56 2,41 2,87
AC 24 207 2,46 3,48 1,73 1,52 1,92
AC 25 Неизвестное 1,58 0,83 2 0,75 0,87

Катионообменная хроматография позволяет выделить отдельные - антитела-компоненты из поликлонального антитела исходя из различий суммарного заряда указанных отдельных членов, и кроме того, она позволяет выделить формы отдельных антител, обнаруживающих гетерогенность по заряду. Поэтому несколько антител представлены в одном пике, например в пике АС1, содержащем RhD293 и RhD319 (см. таблицу 8), а некоторые отдельные антитела были, кроме того, представлены в нескольких хроматографических пиках, например RhD319, которое присутствует в АС1 и АС5 (см. таблицу 8).

Пики, содержащие более чем одно отдельное антитело, могут быть подвергнуты дополнительной химической характеристики на уровне белков, такой как количественный анализ с использованием антиидиотипических пептидов, картирование протеолитических пептидов, N-концевое секвенирование или хроматография по второму параметру.

Выводы

В данном примере проиллюстрировано комбинированное применение Т-RFLP-анализов и катионообменной хроматографии для оценки распределения первичных транскриптов и антител-компонентов соответственно в течение всего времени культивирования. Т-RFLP-анализ позволяет осуществлять уникальную идентификацию 12 отдельных клонов из 25 клонов, экспрессируемых в поликлональной клеточной линии, и в данном примере показано, что эти 12 клонов могут быть детектированы в течение 4-недельного культивирования с помощью Т-RFLP-анализа. В принципе, многие клоны могут быть идентифицированы путем проведения анализа последовательности фрагментов, представляющих более чем один клон. Распределение антител-компонентов было проанализировано с помощью катионообменной хроматографии, и в данном примере показано, что распределение 25 проанализированных компонентов в процессе культивирования является относительно стабильным. Хотя уникальная идентификация всех отдельных антител представляет определенные трудности, обусловленные присущей экспрессируемым антителам гетерогенности в отношении заряда, однако в данном примере было продемонстрировано, что антитело-компонент 8, представляющее антитело RhD160, продуцировалось на наивысшем уровне в процессе культивирования, что соответствовало высоким уровням Т-RFLP, полученным для группы 13, представляющей клоны RhD160, 293 и 196. Кроме того, компонент RhD207, который был уникально идентифицирован в Т-RFLP-анализе, а также с помощью катионообменной хроматографии, обнаруживал Т-RFLP-уровни, составляющие 10-11% и слегка пониженные уровни, то есть 5,5-10%, полученные на уровне антител. В целом, эти два метода в комбинации друг с другом продемонстрировали относительно стабильное продуцирование на уровне мРНК и на уровне антител в процессе культивирования, однако, как можно также заметить, эти два метода в принципе отличаются друг от друга, на что указывают данные о явном снижении уровней транскрипции некоторых клонов после 5-недельного культивирования, которые отличаются от данных, полученных на уровне антител. Таким образом, данный пример подтвердил возможность дополнительного применения обоих методов для определения интервалов культивирования, в течение которых может поддерживаться стабильное продуцирование сложного поликлонального белка.

Пример 4

В данном примере проиллюстрирован композиционный анализ поликлонального анти-RhD антитела, состоящего из десяти отдельных членов, происходящих из поликлональной клеточной культуры. Клональное разнообразие образца поликлонального антитела оценивали с помощью двумерной жидкостной хроматографии, которая позволяет разделять антитела исходя из различий суммарного заряда и гидрофобности, а именно с помощью катионообменной хроматографии для разделения по первому параметру и обращенно-фазовой (ОФ)-ВЭЖХ для разделения по второму параметру соответственно.

Образец поликлонального анти-RhD антитела, состоящего из десяти отдельных членов, получали из поликлональной клеточной культуры. Анти-RhD rpAb выделяли из супернатанта на колонке с белком А (колонка с белком А HiTrapTM, Amersham Biosciences GE Healthcare, England).

Первую хроматографию проводили путем нанесения очищенного поликлонального антитела на колонку ProPac WCE10 (4×250 мм) в 25 мМ ацетате натрия, 150 мМ хлориде натрия, рН 5,0, при скорости потока 60 мл/ч-1 и при комнатной температуре, установленную на системе Ettan LC (Amersham Biosystems, GE Healthcare, England). Затем антитела-компоненты элюировали линейным градиентом 150-350 мМ NаСl в 25 мМ ацетата натрия, рН 5,0, при скорости потока 60 мл/ч-1. Антитела-компоненты детектировали на спектрофотометре при 280 нм и фракции, соответствующие конкретным пикам, собирали, концентрировали, а затем анализировали с помощью ОФ-ВЭЖХ.

Фракции, представленные на фиг.8, дополнительно разделяли по второму параметру с помощью ОФ-ВЭЖХ. Вторую хроматографию проводили на ВЭЖХ-системе Summit (Dionex, CA) с использованием колонки Zorbax Poroshell 300SB-C8 (2,1×75 мм (5 мкм)), и эта ВЭЖХ-система была сконструирована в соответствии с инструкциями фирмы-производителя колонок Poroshell (Agilent Technologies, CA). Антитела-компоненты, собранные после катионообменной хроматографии, наносили на колонку (5 мкл) в 10% СН3CN, 0,1% TFA, 0,3% ПЭГ при скорости потока 120 мл/ч-1, и элюировали линейным градиентом 90% СН3CN, 0,08% TFA, 0,3% ПЭГ. Колоночную хроматографию проводили при 70°С. Все образцы, содержащие антитела-компоненты, давали на хроматограммах один или два узких пика. ОФ-ВЭЖХ-профиль компонента-антитела В5 представлен на фиг.9.

Выводы

Поскольку катионообменная хроматография, проводимая для разделения по первому параметру, позволяет разделять отдельные антитела, отличающиеся по своему суммарному заряду, а также отдельные антитела, обнаруживающие гетерогенность по заряду, то несколько антител могут быть представлены в одном пике.

Несколько антител-компонентов были разделены с получением более сложного профиля, показанного на фиг.8. Как проиллюстрировано в примерах 2 и 3, можно идентифицировать отдельные компоненты в каждом пике путем проведения сравнительного анализа моноклональных антител, проанализированных в идентичных условиях. Однако этот анализ не был проведен в настоящем эксперименте, поскольку его целью является получение фингерпринта для сравнения образцов друг с другом без идентификации каждого моноклонального антитела в rpAb. Таким образом, комбинация катионообменной хроматографии и последующей ОФ-ВЭЖХ позволяют получить данные по двум параметрам, и могут быть составлены подробные карты белка с указанными цветовыми кодами (программное обеспечение ProteoVue, Eprogen, USA), как показано на фиг.10, для оценки состава различных партий, при этом необязательно проводить анализ моноклональных антител для характеристики отдельных членов комплекса rpAb.

Пример 5

В данном примере проиллюстрирована характеристика поликлонального анти-RhD антитела, состоящего из восьми отдельных членов и происходящего от поликлональной клеточной культуры. Клональное разнообразие поликлонального антитела оценивали с помощью “объемного” анализа N-концевой последовательности.

N-концевые последовательности отдельных членов, присутствующих в образце поликлонального анти-RhD антитела, которые были проанализированы в данном примере, представлены ниже в таблице 9. Последовательности легкой цепи лямбда показаны курсивом.

Очищенное на белке А анти-RhD rpAb анализировали посредством электрофореза в восстанавливающем ПААГ с ДСН (NuPAGЕ 4-12%). Полипептиды подвергали электрофоретическому анализу на PVDF-мембрану, а затем окрашивали кумасси синим в соответствии с инструкциями производителя.

Одна полоса размером приблизительно 53 кДа, соответствующая тяжелой цепи (НС), и две полосы размером приблизительно 25 и 30 кДа, соответствующие легким цепям каппа и лямбда + каппа соответственно, были хорошо видны на PVDF-мембране, окрашенной кумасси синим. Эти полосы вырезали и их N-концевые последовательности анализировали на секвенаторе белков АВI Procise (Apрlied Biosystems, СА) с использованием стандартных программ. Результаты секвенирования систематизированы ниже в таблице 10.

Таблица 10
Цикл # НС LС (~25 кДа) LС (~30 кДа)
1 Q, E E, D E, D, Q
2 V I I, T
3 Q V, Q V, Q
4 L L, M L, M, V
5 V T T
6 E Q ND
7 S S ND
ND = не определяли

Последовательности тяжелых цепей являются идентичными за исключением первого остатка, тогда как легкие цепи каппа являются консервативными по остаткам 2, 5, 6 и 7, а легкие цепи лямбда являются консервативными по остаткам 1, 5 и 6 (см. таблицу 9).

Данные, полученные в результате секвенирования тяжелых цепей, соответствуют предполагаемым последовательностям, представленным в таблице 10. Данные, полученные для последовательности полосы легкой цепи каппа размером ~25 кДа, указывали на присутствие антител с N-концевой последовательностью EIVLTQS (SEQ ID NO:7), соответствующей RhD191, 324, 201 и 306, и антител с N-концевой последовательностью DIQMTQS (SEQ ID NO:8), соответствующей RhD244 и 196. Однако этим способом невозможно определить, присутствуют ли в данном образце поликлонального антитела все отдельные члены этого антитела. Секвенирование полосы LС размером ~30 кДа выявило присутствие антитела RhD319, на что указывало присутствие Val в третьем и четвертом циклах. Присутствия антитела RhD203 не было обнаружено (не было обнаружено ни S, ни А во втором и третьем циклах соответственно). Однако ионообменная хроматография и анализ N-концевой последовательности этого рекомбинантного моноклонального антитела дают все основания предполагать, что LС антитела RhD203 имеет частично блокированный N-конец. Таким образом, с помощью анализа N-концевой последовательности невозможно точно определить, присутствует ли указанное антитело в этой анализируемой смеси. Кроме того, считается, что полоса размером 30 кДа также содержит некоторое количество легких цепей каппа, поскольку в цикле 1 присутствуют остатки Е и D, а в цикле 4 присутствует остаток М.

В целом, массовый анализ N-концевой последовательности может быть применен для идентификации присутствия отдельных антител, если они отличаются по своим последовательностям в тяжелой и легкой цепях и не являются блокированными по своему N-концу. Этот метод позволяет проводить количественную оценку, при условии что N-концы отдельных полипептидов не являются частично блокированными.

Пример 6

В данном примере проиллюстрирована характеристика поликлонального анти-RhD антитела, состоящего из восьми отдельных членов и продуцированного поликлональной клеточной культурой. Клональное разнообразие этого антитела было проанализировано путем выделения уникальных маркерных пептидов, происходящих от вариабельной области, с помощью ОФ-ВЭЖХ или ионообменной хроматографии (ИОХ) для разделения пептидов.

Генерирование пептидов путем гидролиза выделенных тяжелых цепей и легких цепей

Образец поликлонального анти-RhD антитела, состоящего из восьми отдельных членов, выделяли из супернатанта поликлональной клеточной культуры с помощью аффинной хроматографии на колонках с рекомбинантным белком А НiTrap. Лиофилизованный материал растворяли в 6М гидрохлориде гуанидия, 0,5 М EDTA, 0,2М Трис-HCl, рН 8,4, восстанавливали (ДТТ) и подвергали карбоксиметилированию (иодуксусной кислотой). Тяжелые и легкие цепи разделяли с помощью гель-фильтрации на колонке с суперозой (Suрerose 12)(10/300, поставляемой Amersham Bioscience, GE Healthcare) в 6М гуанидия-HCl, 50 мМ фосфата натрия, рН 8,4, на системе Ettan LC (Amersham Bioscience, GE Healthcare, England). Разделенные тяжелые цепи (НС) (~3,5 мг/мл) и легкие цепи (LС)(6,5 мг/мл) гидролизовали эндопротеиназой Asp-N (Roche, 1054589) при концентрации фермент:субстрат = 1:500 в фосфате натрия, рН 8.

Выделение уникальных пептидов с помощью ОФ-ВЭЖХ

Аликвоты отдельных Asp-N-гидролизатов выделенных НС и LС, полученных из образца поликлонального антитела, наносили на систему Agilent 1100 LC/MSD SL, снабженную 5 мкм-колонкой Zorbax 300SB-C18 (2,1×150 мм), соединенной с предохраняющей колонкой (Zorbax 300SB-C8, 2,1×12,5 мм, 5 мкм), уравновешенной в 0,1% ТFA, при скорости потока 0,2 мл/мин. Пептиды элюировали линейным градиентом 0,08% ТFA, 70% ацетонитрила. Пептиды детектировали на спектрофотометре при 220 нм и анализировали с помощью МС в режиме он-лайн (при атмосферном давлении, с ионизацией электрораспылением (АРI). Для усиления сигнала в подвижную фазу после ее выхода из колонки добавляли смесь 75% пропионовой кислоты/25% изопропанола. Полученные масс-спектры анализировали с помощью программы Chemstation (Agilent Technologies, CA) и программы BioLynx (Micromass, Water Corporation, MA).

Результаты, полученные из МС-анализа Asp-N-гидролизатов НС и LС, были систематизированы в таблицах 11 и 12 соответственно. В этих таблицах указаны теоретические и детектированные массы, которые представлены как средние массы.

Таблица 11
Результаты для тяжелой цепи
RhD# Пептиды Теоретическая масса (Да) Найденная масса (Да) Теоретический индекс ВЭЖХ Время удерживания (мин)
191 D2 5891,6 5891,3 156,5 137,0
D8 4208,8 4208,4 133,8 110
196 D1 5795,6a∗ 5795,1 196,7 161,7
D1-2 6297,1 6296,7 179,1 158,0
D7 4196,7b 4196,4 114,6 98,1
201 D6 4196,77b 4196,4 114,6 98,1
D1 5710,5 5709,5 184,8 159
203 D1 5840,6 5840,4 188,0 156,3
D6 4196,8b 4196,5 111,2 95,1
244 D1 5795,6а∗ 5795,1 194,9 161,7
D1-2 6644,5 6644,0 210,5 171,2
D7 4196,7b 4196,4 114,6 98,1
306 D1 5796,6a∗ 5795,1 196,7 161,7
D1-2 6694,5 6693,9 198,2 162,5
D8 4168,6 4168,4 118,4 94,7
319 D1 5809,6 5809,2 201,6 162,5
D1-2 6659,5 6659,1 191,5 159,6
D7 4196,7b 4196,4 114,6 98,1
324 D1 5919,8 5919,4 183,7 146,3
D1-2 6729,7 6729,3 181,7 166,5
D7 4224,8 4224,6 111,3 96,1
а) Различные пептиды с одной и той же массой. b) Пептиды (четыре идентичных и один отличающийся) почти с одинаковыми массами. ∗ означает N-концевой циклизованный Gln (PyroGlu).
Таблица 12
Результаты для легкой цепи
RhD# Пептиды Теоретическая масса (Да) Найденная масса (Да) Теоретический индекс ВЭЖХ Время удерживания (мин)
191 d1 6537,3 6537,2 167,5 74,2
d1-2 7530,3 7530,2 168,9 71,7
d1-4 10281,4 10281,1 259,0 91,0
d1-6 13719,3 13718,8 367,2 109,8
d5-6 3455,9 3455,5 114,8 95,1
196 d2 7151,0 7150,7 186,6 93,9
d3 4649,2 4648,8 150,4 84,8
201 d1 8504,5 8504,1 229,7 82,5
203 d5 6356,1 6355,6 168,5 90,6
244 d2-3 7165,1 7164,7 180,5 88,2
d4 4520,1 4520,0 122,2 75,2
306 d1-d2 6565,6 6565,2 231,7 90,2
d1-d5 11727,2 11726,8 380,0 105,2
d2 3206,7 3206,5 152,9 80,3
319 d1 8668,7∗ 8668,2 255,1 85,2
часть d1(7-83) 8029,0 8028,6 246,8 84,3
324 d1 8518,5 не определяли 232,8 не определяли
d2 4862,5 не определяли 164,2 не определяли

Как видно из таблицы 11, тринадцать пептидов, происходящих от вариабельной области НС, и шестнадцать пептидов, происходящих от вариабельной области LС, могут быть идентифицированы как уникальные маркерные пептиды и некоторые пептиды от вариабельной области НС (например, D1 от RhD196, RhD244 и RhD306, отмеченных a) имеют одинаковую массу, а поэтому эти массы не могут быть однозначно идентифицированы. Однако поскольку другие массы могут быть однозначно приписаны уникальным пептидам, то во всех случаях была достигнута положительная идентификация всех восьми антител. Для LС уникальные пептиды были приписаны семи из восьми антител (таблица 12). Антителом, для LС которого не была получена информация, было антитело RhD324. Таким образом, объединенные МС-данные для НС и LС продемонстрировали, что все восемь антител могут быть идентифицированы в образце анти-RhD rpAb благодаря детекции уникальных пептидов, происходящих от каждого из этих антител.

Выделение уникальных пептидов с помощью катионообменной хроматографии

Asp-N-гидролизаты НС и LС разделяли с помощью катионообменной хроматографии на сильных катионообменниках следующим образом. Аликвоты отдельных Asp-N-гидролизатов выделенных НС и LС, полученных из поликлонального антитела, как описано выше, наносили на колонку с полисульфоэтилом А (2,1×100 мм), уравновешенную в 10 мМ фосфата калия, 20% (об/об) ацетонитрила, рН 3,0, при скорости потока 0,2 мл/мин и при комнатной температуре на системе Ettan LC (Amersham Bioscience, GE Healthcare, England). Затем пептиды элюировали линейным градиентом 0-500 мМ хлорида калия в 10 мМ фосфата калия, 20% или 30% (об./об.) ацетонитрила, рН 3,0. Проэлюированные пептиды детектировали в спектрофотометре при 215 нм и фракции собирали во время фракционирования. Аликвоты (1 мкл) фракций смешивали с 1 мкл раствора α-циано-4-гидроксикоричной кислоты (20 мг/мл) в 70% ацетонитриле/30%, 0,1% ТFA, наносили на МС-мишень и промывали 0,1% ТFA. Образцы анализировали с помощью MALDI-TOF на устройстве Autoflex TOF (Bruker Daltronics, Bremen, Germany), а калибровку внешней массы осуществляли с использованием калибровочных смесей от Bruker Daltronics (Bremen, Germany). MALDI-спектры анализировали (путем поиска по массе и внутренней калибровки) с использованием программы GPMAW 6.1 (Lighthouse data, Odense, Denmark).

Репрезентативная хроматограмма, содержащая несколько пиков от Asp-N-гидролизата LС, представлена на фиг.11. Результаты MALDI-TOF-анализа фракций Asp-N-гидролизатов LС и НС приводятся в таблицах 13 и 14 соответственно. Теоретические и найденные массы даны как моноизотопные массы для масс <3500 Да и как средние массы для масс >3500 Да.

Таблица 13
Результаты для легкой цепи
RhD# Пептиды Наблюдаемая масса (Да) Теоретическая масса (Да) Фракция SCX № Теоретическая рI
191 d4 1365,54 1365,53 B10 4,15
d3 1419,74a 1419,72 B10 3,87
часть d3-6 (часть) 3090,33 3090,31 В3 3,42
d6 (часть) 1256,60 1256,59 В9 3,0
d2 1010,45 1010,44 B7 7,04
d6 (часть) 1858,05b 1858,04 B7 10,10
d1 6536,30 6537,33 B1 и B2 10,28
d1+d2 (часть) 7530,25 7530,34 В1 9,91
196 d3 (часть) 1858,05b 1858,04 B7 10,10
201 d3 1844,01c 1844,02 B7 и B8 10,15
203 d4 2251,11 2251,11 B6 7,03
d3 1068,57 1067,57 B4 10,15
d2 2756,42 2756,41 B2 9,44
d4+d5 (часть) 2566,23 2566,21 B7 4,11
244 d4 (часть) 1858,05b 1858,04 B7 10,10
d4 4519,42 4520,10 B1 9,47
306 d5 2771,21 2771,18 B9 5,27
d3-4 2423,21 2423,20 B8 4,11
d1 3374,77 3374,75 B7 6,55
d4 1419,74a 1419,72 B10 3,87
d6 1844,01c 1844,02 B7 и D8 10,15
d2 (часть) 1794,91 1794,90 B2 8,91
319
324 d2 (часть) 1858,05b 1858,04 B7 10,10
а) Одинаковые пептиды. b) Одинаковые пептиды. с) Одинаковые пептиды.
Таблица 14
Результаты для тяжелой цепи
RhD# Пептиды Теоретическая масса (Да) Наблюдаемая масса (Да) Фракция SCX № Теоретическая рI
191 D4 1953,0 1953,01 B3 6,98
часть D2-4 (46-89) 5134,76 5136,35 C1 и C4 10,08
196 часть D6 (99-113)b 1888,89 1888,93 B1 9,51
часть D1-4 (6-72) 7343,21 7344,01 C4 9,41
D5 1981,95 1981,95 B6 7,01
201 D4 1995,97a 1995,98 B6 и B7 7,01
203 D4 1995,97a 1995,98 B6 и В7 7,01
244 D4 1982,95 1982,94 B1 7,04
D6 2002,97 2002,94 B1 и B3 10,12
306 D4 1809,90 1809,91 B6 10,23
319 D6 2401,03 2401,01 B5 9,27
D4 1995,97a 1995,98 B6 и B7 7,01
324
а) Одинаковые пептиды. b) Подтвержденные путем идентификации одинаковых пептидов с окисленным Met.

Как видно из таблиц 13 и 14, пятнадцать пептидов, происходящих от вариабельной области LС, и девять пептидов, происходящих от вариабельной области НС, могут быть идентифицированы как уникальные пептидные маркеры, а некоторые пептиды, происходящие от вариабельной области НС, а также от LС, имеют одинаковую массу и не могут быть однозначно идентифицированы. Таким образом, уникальные пептиды для НС RhD201, RhD203 и RhD324 и для LС RhD201 и RhD319 не могут быть идентифицированы с помощью катионообменной хроматографии на сильных катионообменниках.

Выводы

Результаты, полученные из анализов по двум различным маркерным пептидам, являются достаточными для подтверждения того, что объединенные данные, полученные с помощью МС-анализов НС и LС, позволяют идентифицировать уникальные пептиды, происходящие от вариабельных областей всех восьми антител, составляющих анти-RhD rpAb, и выделенные с помощью ОФ-ВЭЖХ. С помощью катионообменной хроматографии на сильных катионообменниках могли быть идентифицированы шесть из восьми отдельных членов в композиции анти-RhD rpAb. Результаты МС-анализа до сих пор не были проанализированы полностью, а лишь частично, как показано в таблицах 11-14.

Пример 6А

В данном примере проиллюстрирована характеристика рекомбинантного поликлонального анти-RhD антитела, состоящего из 25 отдельных членов, происходящих от поликлональной клеточной культуры (цикл биореактора). Клональное разнообразие данного антитела анализировали путем выделения уникальных маркерных пептидов, происходящих от вариабельных областей LС или НС, с использованием ОФ-ВЭЖХ в комбинации с масс-спектрометрией для идентификации пептидов.

Генерирование пептидов путем гидролиза выделенных тяжелых цепей и легких цепей

Образец поликлонального анти-RhD антитела, состоящего из 25 отдельных членов, выделяли из супернатанта поликлональной клеточной культуры, полученной за один цикл работы биореактора. Очистку осуществляли с помощью аффинной хроматографии на колонке MabSelect (Amersham Bioscience, GE Healthcare), а затем обессоливали на колонке G25 (Amersham Bioscience, GE Healthcare). Лиофилизованный материал растворяли в 6М гидрохлориде гуанидия, 0,2М Трис-HCl, рН 8,4, восстанавливали (ДТТ) и подвергали карбоксиметилированию (иодуксусной кислотой). Тяжелые и легкие цепи разделяли с помощью гель-фильтрации на колонке с суперозой (Suрerose 12)(10/300, поставляемой Amersham Bioscience, GE Healthcare, в 6М гуанидия-HCl, 50 мМ фосфата натрия, рН 8,4. Разделенные тяжелые цепи (НС) и легкие цепи (LС) гидролизовали эндопротеиназой Asp-N (Roche, 1054589) при концентрации фермент:субстрат = 1:200 в 1М мочевине, 50 мМ фосфате натрия, рН8, в течение ночи при 37°С.

Выделение уникальных пептидов с помощью ЖХ-МС

Аликвоты отдельных Asp-N-гидролизатов выделенных НС и LС, полученных из образца поликлонального антитела, наносили на систему Agilent 1100 LC/MSD SL, снабженную 5 мкм-колонкой Zorbax 300SB-C18 (2,1×150 мм), соединенной с предохраняющей колонкой (Zorbax 300SB-C8, 2,1×12,5 мм, 5 мкм), уравновешенной в 0,1% ТFA, 14% ACN, при скорости потока 0,2 мл/мин. Пептиды элюировали линейным градиентом 0,08% ТFA, 70% ацетонитрила. Пептиды детектировали на спектрофотометре при 220 нм и анализировали с помощью МС в режиме он-лайн (при атмосферном давлении, с ионизацией электрораспылением (АРI). Для усиления сигнала в подвижную фазу после ее выхода из колонки добавляли смесь 75% пропионовой кислоты/25% изопропанола. Полученные масс-спектры анализировали с помощью программы Chemstation (Agilent Technologies, CA) и программы GPMAW 6.2 (Lighthouse data, Odense, Denmark).

Результаты, полученные из МС-анализа Asp-N-гидролизатов НС и LС, были систематизированы в таблице 14А, где теоретические и детектированные массы представлены как средние массы.

Таблица 14А
Идентификация уникальных гидрофобных пептидов, происходящих из 25 антител, присутствующих в анти-RhD rpAb, путем Asp-N-расщепления и ЖХ-МС-анализа
RhD# Пептидыа Теоретическая масса (Да) Найденная масса (Да) Время удерживания (мин)
157 d1 7358,2 7357,2 211
159 d4 4483,0 4482,2 213
160 d2 5585,3 5584,5 216
162 d2 4322,0 4321,1 245
189 d1 8536,5 8535,3 203
191 d1 6537,3 6536,4 179
192 d2 5667,4 5665,5 217
196 D1-D2∗b 6297,1 6295,8 303
197 d1∗ 8696,8 8695,5 206
199 d2 5709,4 5708,6 212
201 d1 8504,5 8503,3 202
202 d1 6448,2 6447,3 188
203 d5 6356,1 6355,4 184
207 d1∗ 8626,7 8625,5 198
240 d2 7056,0 7054,9 235
241 d1 6464,4 6463,4 215
245 d2 5749,4 5748,6 226
293 D1 5854,7 5854,1 277
301 d4 4559,3 4558,5 221
305 d4 4510,1 4509,3 187
306 d2 3206,7 3206,1 189
317 d1 6364,2 6363,2 225
319 d1∗ 8668,7 8667,4 210
321 d7 4945,6 4944,9 222
324 D1 5919,8 5919,3 280
а) D и d означают пептиды, происходящие от НС и LС и полученные путем Asp-N-гидролиза соответственно, и эти пептиды пронумерованы от N-конца до С-конца предсказанных последовательностей. Следовательно, d4 означает пептид, полученный путем расщепления в 3-м и 4-м Asp-N-сайте полипептида LС. b) Этот пептид не содержит сайт расщепления. * означает N-концевой циклизованный Gln (PyroGlu).

Как видно из таблицы 14А, 22 пептида, происходящие от вариабельной области LС, и 3 пептида, происходящие от вариабельной области НС, могут быть идентифицированы как уникальные маркерные пептиды. Таким образом, МС-данные для НС и LС однозначно продемонстрировали, что все 25 антител могут быть идентифицированы в образце анти-RhD rpAb благодаря детекции уникальных пептидов, происходящих от каждого из этих антител.

Пример 7

В данном примере проиллюстрировано генерирование антиидиотипических пептидов со специфичностью к отдельным членам рекомбинантного поликлонального анти-RhD антитела, а также оценка концентрации одного отдельного члена в рекомбинантном поликлональном антителе.

Генерирование анти-RhD антитела, специфичного к пептидам-лигандам

Для аффинного отбора пептидов, связывающихся с отдельными анти-RhD антителами, использовали фаговую библиотеку, представляющую семь аминокислот, расположенных в произвольном порядке в последовательности у N-конца рIII (New England Biolabs). Для отбора использовали как линейный, так и конформационно ограниченный вариант пептидной библиотеки. Микротитрационные планшеты (Maxisorb, NUNC) сенсибилизировали при 4°С в течение 12-16 часов очищенным моноклональным анти-RhD антителом при концентрации 10 мкг/мл в объеме 100 мкл на лунку. Для скрининга антиидиотипических пептидов использовали все двадцать пять отдельных антител, содержащихся в рекомбинантном поликлональном анти-RhD антителе. Однако в случае если рекомбинантное поликлональное антитело содержит большое число отдельных членов (например, больше 50), для скрининга могут быть отобраны антитела-индикаторы. Предпочтительно выбирают ряд антител-индикаторов, составляющих, по меньшей мере, 4% от общего числа антител, входящих в рекомбинантный поликлональный белок, а более предпочтительно отбирают антитела-индикаторы, составляющие, по меньшей мере, 8%, 12%, 16%, 20%, 30% или 50% от общего числа антител, входящих в рекомбинантный поликлональный белок. Сенсибилизированные планшеты промывали в PBS, 0,05% твина-20, после чего блокировали 2% сепарированным молоком/PBS. Для каждого раунда пэннинга использовали бактериофаги в количестве ~1011 б.о.е./100 мкл. Конформационно ограниченные и линейные библиотеки смешивали и подвергали совместному пэннингу в виде смеси в 2% сепарированном молоке/PBS. После инкубирования в течение 1 часа при комнатной температуре, связанные фаги элюировали глицином/HCl, рН 2,2, в течение 10 минут, а затем нейтрализовали Трис-HCl, рН 9,0. После проведения 3-4 раундов пэннинга одиночные клоны выделяли и ДНК экстрагировали и секвенировали в области, соответствующей рандомизированной пептидной области. В нижеследующей таблице 15 проиллюстрированы выравнивания аминокислотных последовательностей, выделенных из одиночных клонов.

Три синтетических пептида со специфической аффинностью по отношению к антителам против RhD162, 202 или 305 соответственно были синтезированы в соответствии с выведенной консенсусной аминокислотной последовательностью из групп родственных последовательностей. Каждый синтетический пептид присоединяли к биотину у С-конца.

Специфичность каждого пептида тестировали с помощью ELISA. Вкратце, ELISA-планшеты сенсибилизировали стрептавидином при концентрации 5 мкг/мл в объеме 100 мкл/лунку при 4°С в течение 12-16 часов. Затем добавляли пептид, разведенный до ~10 мкг/мл в PBS, и инкубировали в течение 1 часа с последующим удалением избытка пептида путем промывки. После этого планшеты блокировали в 2% сепарированном молоке/PBS и три раза промывали в PBS. Каждое отдельное анти-RhD антитело добавляли отдельно при различных разведениях, начиная с 10 мкг/мл. Связанное антитело детектировали с использованием конъюгата антитела против человеческого IgG (CalTag cat # H10307). Планшеты пять раз промывали и детектировали путем добавления 25 мкл хромогена (ТМВ, Kem-En-Tech). Через 15-25 минут реакции завершали добавлением 25 мкл 1М Н2SO4. Величины оптической плотности измеряли при 450 нм. Тестирование каждого пептида на специфичность к панели моноклональных анти-RhD антител показало, что такая реактивность является специфичной для соответствующего отдельного белка-компонента. Следовательно, РЕР162 связывается только с анти-RhD162 антителом, РЕР202 связывается только с анти-RhD202 антителом, а РЕР305 связывается только с анти-RhD305 антителом, где отношение “сигнал-шум” превышает 10.

Определение количества анти-RhD305 антитела в рекомбинантном поликлональном анти-RhD антителе

Путем соответствующих разведений очищенного моноклонального анти-RhD305 антитела, используемого в качестве стандарта, можно определить количество анти-RhD305 антитела по отношению к общему количеству антител в смеси рекомбинантного поликлонального анти-RhD антитела. Вкратце, ELISA-планшеты сенсибилизировали стрептавидином и инкубировали с РЕР305, разведенным до ~10 мкг/мл в PBS, в течение 1 часа. После инкубирования избыток пептида удаляли путем промывки. Затем планшеты блокировали в 2% сепарированном молоке/PBS и три раза промывали. Рекомбинантное поликлональное анти-RhD антитело, состоящее из 25 отдельных анти-RhD антител (образец), добавляли при разведениях от 1× до 16384×. Образец анализировали с четырьмя повторностями. Для построения стандартной кривой в отдельные лунки того же самого планшета добавляли серийные разведения (с тремя повторностями) моноклонального анти-RhD305 антитела начиная с 10 мкг/мл в качестве эталонных образцов. Связанное антитело детектировали с использованием конъюгата антитела против человеческого IgG (CalTag cat # H10307). Планшеты пять раз промывали и детектировали путем добавления 25 мкл хромогена (ТМВ, Kem-En-Tech). Через 15-25 минут реакции завершали добавлением 25 мкл 1М Н2SO4. Величины оптической плотности измеряли при 450 нм.

Стандартная кривая была прямо пропорциональна концентрации в следующем интервале:

Моноклональное анти-RhD305 Ab антитело (мкг/мл) 0,156 0,078 0,039 0,0195
OD450 1,509 0,990 0,567 0,338

Эти данные были получены исходя из стандартной кривой по уравнению y=0,116х-0,0256 и R2=0,9812.

Концентрацию анти-RhD305 антитела в образце рекомбинантного поликлонального анти-RhD антитела вычисляли по уравнению, определенному исходя из стандартной кривой, а также по кратности разведения образца.

При 32-кратном разведении средняя OD450, измеренная для данного образца, составляла 1,24±0,14, что соответствовало концентрации анти-RhD305 антитела в поликлональном анти-RhD антителе, составляющей 3,8±0,5 мкг/мл. Общая концентрация антитела в образце рекомбинантного поликлонального анти-RhD антитела составляла 100 мкг/мл. Таким образом, анти-RhD305 антитело в образце поликлонального антитела составляло 3,8%.

Пример 8

В данном примере проиллюстрировано использование антиидиотипических пептидов для идентификации антител-индикаторов в конкретных фракциях/пиках после разделения по одному параметру с помощью анализа рекомбинантного поликлонального анти-RhD антитела, проводимого посредством жидкостной ионообменной хроматографии.

Рекомбинантное поликлональное анти-RhD антитело, состоящее из 25 отдельных анти-RhD антител, разделяли с помощью катионообменной хроматографии и фракции собирали. Каждую фракцию оценивали с помощью ELISA с использованием трех антиидиотипических пептидов (описанных в примере 7) для детекции присутствия конкретного анти-RhD антитела в каждой фракции. Перекрывание данных, полученных по хроматограмме, с данными ELISA-анализа, проведенного для каждой фракции, показало, что этот метод может быть применен для идентификации отдельных антител в конкретной фракции (фиг.12). Таким образом, путем сравнения оптической плотности в конкретном пике с данными ELISA можно проводить полуколичественную оценку состава сложных смесей гомологичных белков.

Пример 9

Композиционная стабильность представляет собой ключевой фактор, гарантирующий возможность промышленного производства поликлональных белков для их применения в качестве лекарственных средств. Специфические пептиды-лиганды, позволяющие идентифицировать отдельные белки-компоненты в сложной смеси гомологичных белков, могут быть использованы для мониторинга композиционной стабильности поликлонального белка во время его получения путем забора образцов среды в процессе ферментации в различные моменты времени продуцирования и осуществления количественной детекции, например, методами ELISA, описанными в примере 7.

В данном примере фактическое количество трех белков-индикаторов, а именно антител против RhD162, RhD202 и RhD305, оценивали в процессе перфузионной ферментации клеток рWCB, продуцирующих рекомбинантное поликлональное анти-RhD антитело, состоящее из 25 уникальных анти-RhD антител. На фиг.13 проиллюстрировано распределение трех антител-индикаторов (антител против RhD162, 202 и 305) на различных стадиях культивирования в процессе ферментации, при этом G8 означает 8-й день после инокуляции биореактора.

Пример 10

В данном примере проиллюстрирован способ идентификации клеток, продуцирующих конкретное анти-RhD антитело в смеси клеточных культур. В этом примере смесь, состоящую из двух различных антитело-продуцирующих клеточных линий, анализировали с использованием антиидиотипического пептида и проточной цитометрии для детекции.

Две отдельные клеточные линии, продуцирующие антитело против RhD, а именно против RhD162 и RhD202, смешивали в определенных соотношениях. Проценты клона RhD202 приводятся в таблице 16.

Биотинилированный пептид 202 (РЕР202, полученный, как описано в примере 7) инкубировали со стрептавидином, конъюгированным с фикоэритрином (SА-РЕ) и получали пептидные тетрамеры. Эти тетрамеры инкубировали со смесями клеточных линий в течение 20 минут при комнатной температуре и клетки пропускали через проточный цитометр FAСS САlibur (Becton Diсkinson). Положительные по тетрамерам клетки сортировали, как показано R1 на фиг.14. Также измеряли отдельные несмешанные клеточные линии (фиг.14А и В).

Характерным признаком, наблюдаемыми для клеточных линий, продуцирующих анти-RhD антитело, является присутствие в данной клеточной линии клеток, экспрессирующих и не экспрессирующих антитело. Для оценки числа РЕР202-позитивных клеток в смеси необходимо определить общее число экспрессирующих клеток. В данном примере авторы исходили из предположения, что доля клеток в смеси клеточных клонов, экспрессирующих RhD162 и RhD202, идентична доле клеток лишь в одном RhD202-экспрессирующем клоне. Это можно определить путем двойного окрашивания клеток пептидом Рер202 и анти-IgG антителом (не проводили). Однако полученные результаты подтвердили правильность этого предположения. Процент клеток RhD202, связанных с тетрамером РЕР202, в этих смесях вычисляли по проценту клеток в дискриминационном окне 6 (R6), как показано на фиг.14.

Процент RhD202-экспрессирующей клеточной линии в смеси а) вычисляли по нижеследующему уравнению, проиллюстрированному измерениями для смеси (а).

Таблица 16
Смесь Истинный % RhD202 Измеренный % RhD202
а 50 45
b 83 79
c 96 87
d 17 15

Пример 11

В данном примере проиллюстрировано применение ПЦР в реальном времени для оценки распределения отдельных клонов или для селективного отбора таких клонов в поликлональной клеточной культуре.

Этот способ основан на различиях последовательностей нуклеиновой кислоты, кодирующих отдельные антитела. Вследствие разнообразия последовательностей, кодирующих отдельные антитела, может быть сконструирован уникальный зонд TaqMan для тяжелой цепи и/или легкой цепи для каждого члена, представленного в поликлональной клеточной линии. При этом для конструирования зонда TaqMan выбирают одну из CDR-областей CDR1, CDR2 или CDR3. Более предпочтительно для конструирования зонда TaqMan выбирают область CDR3.

Конструирование олигонуклеотидов

Были сконструированы предпочтительные праймеры, такие как ампликоны, состоящие из 70-150 нуклеотидов. Некоторыми из возможных конструкций праймеров являются: прямой праймер, полученный на основе консенсусной последовательности и предназначенный для гибридизации с FR3-областью вариабельной области тяжелой и легкой цепей; и обратный праймер, предназначенный для гибридизации с константной областью. Для каждого представляющего интерес клона конструировали зонд TaqMan, специфичный к той части CDR-области, которая варьировалась у двух отдельных членов в образце, предпочтительно в области CDR3.

Потенциальная серия праймеров и зондов для анализа поликлональной клеточной линии, экспрессирующей нижеследующие восемь анти-RhD антител, может быть сконструирована, как описано ниже.

Прямой и обратный праймер для всех клонов:

Прямой праймер: CАC GGC TGA GTA TTA CTG TGC (SEQ ID NO:24)

Обратный праймер: TTG GTG GAG CCA CTC GA (SEQ ID NO:25)

Зонды TaqMan для всех отдельных клонов представлены в таблице 17.

Таблица 17
RhD# Зонды TaqMan
191 AGA AAT TTG TTC GGT GAC TAC GAT CTT AAG TCC (SEQ ID NO:26)
196 AGA GAA TTG AGC ACG CAA CGT GGA TAC A (SEQ ID NO:27)
201 AGA GAG AGT ACT CTA TAT AGC AGC AGC TGG TAC A (SEQ ID NO:28)
203 GAT GGT CTC CTA TAG CAG CAG CTG GTA CC (SEQ ID NO:30)
244 GAG AGA CTC TGT TCG GGG AGT CAG TAG AT (SEQ ID NO:30)
306 GGG TAC TCT GTA TAG CAG CAG CTG GTA CA (SEQ ID NO:31)
319 AGA GAC CTA CAA GGG TAT AGA AGC AGC TGG TAC (SEQ ID NO:32)
324 CCG ACG ATT TTT GGA GTG GGC C (SEQ ID NO:33)

Конструирование альтернативных праймеров для последовательностей, кодирующих тяжелую цепь, а именно прямого праймера, гибридизующегося в области стыка VН-DН, и обратного праймера, гибридизирующегося с константной областью, а также зонда TaqMan для области стыка JН-С, описано в публикации Rasmussen, et al., 2000, Exp. Hematol., 28, 1039-1045.

Количественная ПЦР в реальном времени

мРНК или геномную ДНК экстрагировали из клеточного дебриса. Если в качестве матрицы используют мРНК, то перед проведением ПЦР в реальном времени ее подвергают обратной транскрипции с получением кДНК. Число реакций ПЦР в реальном времени соответствует числу анализируемых клонов.

Анализы, проводимые в реальном времени, оптимизировали по концентрациям праймера и TaqMan-зонда. Реакции осуществляли с тремя повторностями в 96-луночных планшетах, герметично закрытых оптическими адгезивными покрытиями. ПЦР-реакции осуществляли в коммерчески доступной маточной ПЦР-смеси и проводили на приборе АВI Prism 7000 (Apрlied Biosystems), после чего смесь анализировали с использованием прибора АВI Prism 7000 SDS и компьютерной программы.

Анализ на клональное разнообразие

Величины СТ для различных клонов сравнивали друг с другом и определяли распределение каждого клона в поликлональной клеточной линии. Этот метод может быть применен для оценки изменений между отдельными партиями, а также клональной стабильности в течение всего времени отдельного производственного цикла.

Пример 12

В данном примере проиллюстрирован метод оценки и продемонстрирована поликлональная природа поликлональной клеточной линии (например, рWCB), способной продуцировать рекомбинантное поликлональное антитело, посредством ДНК-секвенирования генов вариабельной области тяжелой и/или легкой цепи антитела в одноклеточных клонах, происходящих от поликлональной клеточной линии.

Клонирование из одной клетки

Ампулу с клетками рWCB оттаивали и культивировали в течение нескольких дней в полной среде для восстановления хорошей жизнеспособности клеток. Затем получали одноклеточные клоны путем лимитирующего разведения и клетки высевали на 96-луночные планшеты при плотности 1 клетка/лунку в полной культуральной среде для культивирования клеток. Эти клетки инкубировали при 37оС, 5% СО2 в течение 10-20 дней, после чего планшеты визуально оценивали под микроскопом на наличие лунок с одиночными колониями. Альтернативно одноклеточные клоны из клеточной линии рWCB получали с использованием клеточного сортера FAСS. Жизнеспособные клетки рWCB отбирали и сортировали на 96-луночных планшетах, предварительно заполненных 100 мкл кондиционированной полной среды при плотности 1 клетка/лунку. Эти клетки инкубировали и оценивали на одиночные колонии, как описано выше.

Секвенирование нуклеиновой кислоты

Когда одиночные клеточные колонии, культивируемые в лунках, достигали конфлюэнтности, аликвоты (10-20 мкл) от каждой нужной лунки (например, от 100 лунок) переносили в новые 96-луночные планшеты, используемые в реакциях секвенирования ДНК в качестве матрицы. Секвенирование проводили либо на уровне мРНК, либо на уровне геномной ДНК с использованием 1-100 или 1-1000 клеток соответственно. В первом случае ПЦР-фрагмент, охватывающий достаточную часть вариабельной области для выявления различных генов тяжелой и легкой цепей антител, присутствующих в рWCB (обычно, по меньшей мере, области CDR3), генерировали с применением стандартной ОТ-ПЦР-технологии, например с использованием коммерчески доступного набора для проведения одностадийной ОТ-ПЦР Qiagen в соответствии с инструкциями производителя. Перед проведением ПЦР клетки подвергали лизису. Полученный ПЦР-фрагмент подвергали гель-очистке, например, с помощью набора для гель-экстракции Qiagen Qiaquick и использовали в качестве матрицы в стандартной реакции секвенирования ДНК с последующим проведением анализа на автоматическом ДНК-секвенаторе, таком как генный анализатор АВI PrismТМ 3100 (Apрlied Biosystems). Альтернативно секвенирование ДНК осуществляли на геномной ДНК, как описано выше, за исключением того, что стадию обратной транскрипции не проводили.

Для характеристики рекомбинантного поликлонального анти-RhD антитела использовали следующие праймеры:

ПЦР-праймеры для амплификации VH:

RhD#001: 5'TCTCTTCCGCATCGCTGTCT (SEQ ID NO:34)

RhD#007: 5'AGGAAAGGACAGTGGGAGTGGCAC (SEQ ID NO:35)

ПЦР-праймеры для амплификации VL:

RhD#005: 5'CGTTCTTTTTCGCAACGGGTTTG (SEQ ID NO:36)

RhD#008: 5'AAGACCGATGGGCCCTTAGGTGGA (SEQ ID NO:37)

Для секвенирования использовали праймеры:

VH: 5'AACGGGTTTGCCGCCAGAACA (SEQ ID NO:38)

VL: 5'CCGAGGGACCTGAGCGAGT (SEQ ID NO:39)

ELISA, проводимый на одиночных клетках с использованием антиидиотипических пептидов

В дополнение к секвенированию нуклеиновой кислоты может быть оценен клональный состав смеси антитело-продуцирующих клеток, таких как банк поликлональных рабочих клеток, с помощью ELISA для антиидиотипических пептидов.

Отсортированные одиночные клетки культивировали примерно в течение 14 дней, в результате чего из одиночных клонов были получены изогенные клеточные культуры. Супернатант от этих культур может быть проанализирован на присутствие специфических анти-RhD антител с использованием антиидиотипических пептидов в ELISA-анализе, описанном в примере 7. В результате этого получают информацию о числе клонов, продуцирующих конкретный отдельный компонент. При сравнении количества отдельных компонентов с общим количеством антитело-продуцирующих клеток (например, путем измерения IgG во всех изогенных клеточных культурах) может быть осуществлена количественная оценка фракции клеток, продуцирующей отдельные анти-RhD антитела в поликлональной клеточной культуре.

Пример 13

В данном примере продемонстрировано применение катионообменной хроматографии для оценки клонального разнообразия рекомбинантного поликлонального антитела в процессе постадийной обработки (DSP).

Постадийная обработка

Образец анти-RhD rpAb, содержащего 25 отдельных членов, взятый из опытного биореактора в процессе производственного цикла, очищали путем проведения нижеследующих стадий DSP:

1) иммобилизации антитела на колонке МаbSelect;

2) инактивации вирусов при рН 3;

3) замены буфера на колонке с сефадексом G-25;

4) анионообменной хроматографии на колонке с DЕАЕ-сефарозой;

5) фильтрации вируса через фильтр Planova 15N;

6) гидрофобной хроматографии с индуцированием заряда на колонке с МЕР Hypercel; и

7) ультрафильтрации/диафильтрации с использованием фильтра Мillipore Biomax.

Анализ клонального разнообразия после проведения отдельных стадий DSP

Катионообменную хроматографию использовали для анализа клонального разнообразия композиции рекомбинантных поликлональных антител в процессе постадийной обработки (DSP). Образцы, взятые после проведения 1, 3, 4 и 6 стадии DSP анти-RhD rpAb, наносили на колонку PolyCatA (4,6×100 мм) в 25 мМ ацетате натрия, 150 мМ хлориде натрия, рН 5,0, при скорости потока 60 мл/ч-1 и при комнатной температуре. Затем антитела-компоненты элюировали линейным градиентом 150-500 мМ хлорида натрия в 25 мМ ацетата натрия, рН 5,0, при скорости потока 60 мл/ч-1. Антитела-компоненты детектировали на спектрофотометре при 280 нм и хроматограммы сравнивали (фиг.15) для выявления возможной потери клонального разнообразия в процессе DSР. В данном примере продемонстрировано, что при проведении катионообменной хроматографии клональное разнообразие рекомбинантного поликлонального антитела в основном не изменяется в процессе его постадийной обработки (DSР).

Пример 14

ИОХ-анализ более чем 40 антител против RhD выявил, что большинство отдельных антител обнаруживают “профили из 3 пиков”, как показано на фиг.16В. Обработка карбоксипептидазой В, а также анализ на углеводы показали, что такая гетерогенность зарядов не вызвана удалением С-концевого лизина или присутствием сиаловой кислоты (данные не приводятся).

В данном примере продемонстрировано, что такая гетерогенность зарядов обусловлена образованием PyroGlu и что для получения гомогенных ИОХ-профилей может быть использован сайт-направленный мутагенез.

Экспрессия и очистка антител

Стабильные клеточные линии (полученные, как описано в заявке на патент Дании РА 2004 01133, поданной 20 июля 2004), каждая из которых экспрессирует отдельное рекомбинантное моноклональное антитело против резус-фактора D из специфического сайта генома этих клеток, адаптировали для суспензионной культуры в бессывороточной среде Excell 302 (JRH Bioscience, Andover, UK), в которую были добавлены 4 мМ L-глутамин (Invitrogen) и агент, препятствующий агрегации (Invitrogen), разведенные 1:250, после чего эти клеточные линии размножали и хранили в банке клеток при -150°С в соответствии со стандартными процедурами замораживания.

Перед помещением в клеточный банк для хранения супернатанты клеточных культур собирали и фильтровали, после чего проводили очистку моноклональных анти-RhD антител с помощью аффинной хроматографии (на белке А), в основном, как описано в примере 1.

Катионообменная хроматография на сильных катионообменниках

Моноклональные антитела, очищенные в предыдущих стадиях, подвергали ИОХ на сильных ионообменниках, в основном, как описано в примере 1. В таблице 18 в столбце “ИОХ” указано число пиков, присутствующих в ИОХ-профилях выбранных антител, таких как ИОХ-профили, также представленные на фиг.16.

Анализ N-концевой последовательности

Анализ N-концевой последовательности отдельных пиков, проводимый с помощью ионообменной хроматографии 2 выбранных антител (RhD198 и RhD307), осуществляли в растворе путем секвенирования по Эдману на секвенаторе Procise 494 Sequencer (Apрlied Biosystems, СА) в соответствии с инструкциями производителя. Анализ последовательности продемонстрировал, что гетерогенность заряда обусловлена частичной циклизацией N-концевого Gln тяжелой цепи (НС) (см. таблицу 18). Таким образом, первый пик соответствовал антителам с полностью блокированными N-концевыми тяжелыми цепями (N-концы НС имели заряд 0); второй пик соответствовал антителам, в которых одна из N-концевых тяжелых цепей была блокирована (N-концы НС имели заряд +1), а третий пик, по всей вероятности, соответствовал антителам, в которых N-концевой Gln тяжелой цепи не был модифицирован (N-концы НС имели заряд +2). Циклизация N-концевого глутаминового остатка с образованием PyroGlu не дает возможности проводить секвенирование по Эдману.

Анализ N-концевой последовательности ряда других анти-RhD антител, обнаруживающих такой “профиль из 3 пиков” или “профиль из 1 пика”, проводили аналогичным образом с помощью электрофореза в ДСН-ПААГ, а затем подвергали электроблоттингу на PVDF-мембранах. НС- и LС-полосы на этих блотах подвергали секвенированию по Эдману.

Было показано, что несколько антител, имеющих N-концевой Gln в НС (RhD162, RhD240), были полностью блокированы в соответствии с их ИОХ-профилями (профиль из одного пика), и было обнаружено, что антитела (RhD196, RhD305 и RhD306) с “профилями из 3 пиков”, как предполагалось, были частично блокированы (см. таблицу 18). Такая интерпретация основана на данных секвенирования последовательности, а также на данных об относительном процентном содержании вариантов с различными зарядами (0, +1 и +2) в ИОХ-профиле.

Таблица 18
RhD# Анализ последовательности НСа Анализ последовательности НСа ИОХ-профиль Комментарии
162b QVQLV; не секвенировали d, SEQ ID NO:40 DIQLT; DIQ, SEQ ID NO:42 1 пик Полностью блокированные N-концы HC
196b QVQLV; QVQLV, SEQ ID NO:40 n.d. 3 пика Частично блокированные N-концы НС
306b QVQLV; QVQLV, SEQ ID NO:40 EIVLTOS; EIVLTQS, SEQ ID NO:7 3 пика Частично блокированные N-концы НС
240b QLQLQ; не секвенировали d, SEQ ID NO:41 DIQMT; DIQMT, SEQ ID NO:43 1 пик Полностью блокированные N-концы HC
305b QVQLV; QVQLV, SEQ ID NO:40 n.d. 3 пика Частично блокированные N-концы HC
198b P1: QVQLV; не секвенировали d, P2: QVQLV; QVQLV; SEQ ID NO:40 P1: DIQMT; DIQMT
P1: DIQMT; DIQMT, SEQ ID NO:43
3 пика Полностью блокированные и частично блокированные N-концы HC представлены р1 и р2, соответственно
307b P1: QVQLV; не секвенировали d, P2: QVQLV; QVQLV; SEQ ID NO:40 Р1:DIQLT; DIQLT
P1:DIQLT; DIQLT, SEQ ID NO:42
3 пика Полностью блокированные и частично блокированные N-концы HC представлены р1 и р2, соответственно
а) Предполагаемые и полученные N-концевые последовательности показаны обычным и жирным шрифтом соответственно. b) Данные, полученные от блота. с) Данные, полученные из выделенных фракций (пик 1 и 2), в результате ИОХ-анализа (проведенного в растворе). d) Циклизация N-концевого глутаминового остатка с образование PyroGlu не дает возможности проводить секвенирование по Эдману; n.d. - не определяли.

Сайт-направленный мутагенез

Сайт-направленный мутагенез использовали для устранения гетерогенности заряда выбранного антитела путем замены N-концевого остатка Gln остатком Glu. Для этого использовали экспрессионную плазмиду RhD189, кодирующую полноразмерное антитело с N-концевым Gln в тяжелой цепи и N-концевым Glu в легкой цепи. Область VH в этой плазмиде фланкирована АsсI-сайтом в 3'-конце области, кодирующей сигнальный пептид и молчащим XhoI-сайтом в J-области.

Мутагенез проводили с использованием следующих праймеров:

Прямой праймер RhD189: TGGGCGCGCC GAGGTGCAGCTGGTGGAGTCTGG (SEQ ID NO:44)

Обратный праймер RhD189: GGAGGCGCTCGAGACGGTGACCGTGGTCCC (SEQ ID NO:45)

АsсI-сайт в прямом праймере и XhoI-сайт в обратном праймере подчеркнуты, а кодон Glu (GAG) в N-конце области VH обозначен жирным шрифтом. Плазмида RhD189 была использована в качестве матрицы в ПЦР-реакциях с использованием вышеуказанных праймеров. ПЦР-реакции проводили с использованием ДНК-полимеразы Phusion (Finnzymes, Finland) в 25 циклов в соответствии с инструкциями производителя. VH-полосу размером приблизительно 400 п.н. очищали на 1% агарозном геле, инкубировали с ДНК-полимеразой BioTaq, снова очищали на агарозном геле и клонировали в вектор рСR2.1ТОРО (Invitrogen, СА) в соответствии с инструкциями производителя. Клоны, содержащие VH-вставку, подтверждали путем секвенирования. Исходный VH-фрагмент вырезали из плазмиды RhD189 ферментами АsсI и XhoI и вместо него встраивали мутированный фрагмент из плазмиды рСR2.1ТОРО. Для подтверждения присутствия “правильного” фрагмента плазмидный препарат Midiprep (Macherey-Nagel, Germany), не содержащий эндотоксина, получали из позитивной колонии путем клонирования и секвенирования.

Антитело подвергали электрофорезу в ДСН-ПААГ, электроблоттингу, а затем N-концевому секвенированию НС-полосы для подтверждения замены Gln на Glu (данные не приводятся).

Замена N-концевого Gln на Glu тяжелой цепи антитела RhD189, обнаруживающего ИОХ-профиль из 3 пиков, приводила к значимому изменению этого профиля на профиль лишь с одним пиком (фиг.17). Таким образом, путем замены N-концевого остатка Gln на остаток Glu была успешно устранена гетерогенность заряда.

Анализ на связывание

Для того чтобы определить, влияет ли N-концевая мутация на функциональные свойства антитела, нативное антитело, RhD189, а также его мутированный Glu-аналог, RhD189Е, анализировали на связывание с RhD-позитивными эритроцитами.

Эритроциты получали из цельной крови, взятой из банка крови при клинике Aalborg Hospital, DK, полученного от здоровых доноров с их информированного согласия, путем 3-кратной промывки крови в PBS (Gibco, Invitrogen, United Kingdom), содержащем 1% альбумин бычьей сыворотки (BSA, Sigma-Aldrich, Germany). Эритроциты ресуспендировали и хранили при 4°С в виде 10% раствора в ID-Cellstab (DiaMed, Switzerland).

Связывающую способность антител определяли с использованием RhD-позитивных эритроцитов при плотности 5·104 клеток/мкл в PBS, 1% ВSA. Разведения антител получали в PBS, 1% ВSA с тремя повторностями в 96-луночных планшетах (Becton Dickinson Labware, NJ, USA). 50 мкл раствора антител смешивали с 50 мкл эритроцитов и инкубировали при 37°С в течение 40 минут. Клетки два раза промывали (300 г, 2 мин) в PBS, 1% ВSA. В каждый образец добавляли 80 мкл конъюгированного с фикоэритрином козьего антитела против человеческих IgG (Beckman Coulter, CA, USA), разведенных 1:20 в PBS, 1% ВSA, образец выдерживали при 4°С в течение 30 минут. Образцы промывали в PBS, 1% ВSA и в реагенте FacsFlow (Becton Dickinson, Belgium) (300 г, 2 мин) и ресуспендировали в 200 мкл FACSFlow. Образцы пропускали через клеточный сортер FACSCalibur (Becton Dickinson, СА, USA) и анализ данных проводили с использованием программы CellQuest Pro и Excel.

Как показано на фиг.18, какого-либо значимого различия в способности Glu-варианта и его нативного аналога связываться с RhD-позитивными эритроцитами не наблюдалось.

Выводы

Гетерогенность, наблюдаемая в ИОХ-профилях многих анти-RhD антител, обусловлена частичной циклизацией N-концевого остатка Gln в этих антителах. Замена N-концевого остатка Gln на остаток Glu тяжелой цепи в анти-RhD антителах приводит к элиминации присущей этим антителам гетерогенности заряда у N-конца и, как предполагается, не влияет на эффективность связывания с RhD-позитивными эритроцитами.

1. Способ характеристики образца поликлональной клеточной линии, содержащей клетки, продуцирующие различные известные гомологичные рекомбинантные антитела с различающимися вариабельными областями, где рекомбинантные антитела связываются с заданным антигеном-мишенью, при котором получают информацию об относительной пропорции белоккодирующих последовательностей указанных отдельных гомологичных антител указанного образца, где указанный образец поликлональной клеточной линии представляет собой фракцию клеточной культуры, содержащую клетки указанной культуры, причем указанный способ включает анализ аликвот указанного образца поликлональной клеточной линии с помощью одного или нескольких методов генетического анализа белок-кодирующих последовательностей, причем указанные методы генетического анализа выбраны из RFLP и T-RFLP, которые проводят на уровне мРНК, и где указанный один или несколько методов генетического анализа проводят на образцах, содержащих смесь популяций клеток без выделения единичных клеток.

2. Способ характеристики образца, содержащего различные известные гомологичные рекомбинантные антитела с различающимися вариабельными областями, причем указанные антитела продуцируются поликлональной клеточной линией и связываются с заданным антигеном-мишенью, при котором получают информацию об относительной пропорции отдельных гомологичных антител указанного образца, где способ включает анализ аликвот указанного образца с помощью одного или нескольких методов характеристики белка, выбранных из хроматографических анализов, разделяющих белки по их физико-химическим свойствам.

3. Способ по п.2, где указанные хроматографические анализы основаны на любых физико-химических свойствах, кроме размера.

4. Способ по п.3, где указанный индивидуальный хроматографический анализ основан на физико-химических свойствах, выбранных из (i) суммарного заряда, (ii) гидрофобности, (iii) изоэлектрических точек и (iv) аффинности.

5. Способ по любому из п.3 или 4, где указанные хроматографические анализы осуществляют с помощью многомерной хроматографии.

6. Способ по п.2, дополнительно включающий анализ протеолитических гидролизатов гомологичных антител с целью выделения N-концевых маркерных пептидов или пептидов с характерными функциональными группами боковых цепей аминокислот.

7. Способ по п.2, дополнительно включающий анализ, в котором используются специфические детекторные молекулы для гомологичных антител.

8. Способ по п.7, где указанными специфическими детекторными молекулами являются антиидиотипические пептиды или антиидиотипические антитела.

9. Способ по п.8, где указанный антиидиотипический пептид или антиидиотипическое антитело используют для определения отдельных антител-продуцирующих клеток в поликлональной клеточной линии.

10. Способ по п.2, где указанный образец получен из супернатанта клеточной культуры.

11. Способ по любому из пп.1-10, где указанная характеристика дополнительно включает анализ одного или нескольких белков-индикаторов или последовательностей нуклеиновых кислот-индикаторов, присутствующих в указанном образце.

12. Способ по любому из пп.1-10, где для анализа указанных образцов используют по меньшей мере два аналитических способа.

13. Способ по п.12, где одним из аналитических способов является способ характеристики белка по п.2, а другим аналитическим способом является генетический анализ по п.1.

14. Способ по любому из пп.1-10, где указанные образцы получают из одной поликлональной клеточной культуры в различные моменты времени в процессе культивирования, и сравнивают относительные количества указанных отдельных гомологичных антител и/или кодирующих последовательностей.

15. Способ по любому из пп.1-10, где указанные образцы получают из различных поликлональных клеточных культур в конкретные моменты времени и сравнивают относительные количества указанных отдельных гомологичных антител и/или кодирующих последовательностей.

16. Способ по любому из пп.1-10, где различные вариабельные области антитела являются различными областями CDR.



 

Похожие патенты:
Изобретение относится к области биотехнологии, конкретно к способу диагностирования болезни Альцгеймера (БА). .
Изобретение относится к медицине, а именно к акушерству и неонатологии. .
Изобретение относится к медицине, а именно к психиатрии, и может быть использовано для прогнозирования эффективности терапии больных шизофренией атипичными нейролептиками.

Изобретение относится к способам прогнозирования чувствительности образца ткани или клеток млекопитающих (например, злокачественных клеток) к Apo2L/TRAIL или антителу-агонисту рецептора смерти.
Изобретение относится к области медицины, а именно к акушерству и перинатологии, и может быть использовано для прогнозирования поражений центральной нервной системы новорожденного.

Изобретение относится к медицине и касается способа определения фракций модифицированных липопротеинов крови. .

Изобретение относится к методам количественного определения действующих веществ в растительном сырье и в препаратах и может быть использовано в химико-фармацевтической и пищевой промышленности.
Изобретение относится к медицине, а именно к педиатрии и неонатологии. .
Изобретение относится к области медицины, в частности к акушерству, и предназначено для прогнозирования плацентарной недостаточности. .

Изобретение относится к способам прогнозирования чувствительности образцов тканей или клеток млекопитающих (например, раковых клеток) к Apo2L/TRAIL или агонистическим антителам рецепторов клеточной смерти.

Изобретение относится к области биохимии, а именно к способам определения IgA-протеиназной активности, и может быть использовано в энзимологии, микробиологии, фармакологии, клинической биохимии для скрининга и количественной оценки активности протеолитических ферментов.
Изобретение относится к медицине, в частности к челюстно-лицевой хирургии и стоматологии. .

Изобретение относится к медицине, а именно к трансплантологии, и может быть использовано для прогнозирования распространенности стенотического поражения коронарного русла после трансплантации сердца.

Изобретение относится к медицинской иммунологии и представляет собой способ определения функциональной активности субкомпонентов C1r2s2 первого компонента комплемента человека, предусматривающий сорбцию в лунках микропанели активатора классического пути комплемента, внесение раствора, содержащего сыворотку морской свинки и этилендиаминтетраацетат натрия, затем после инкубации и осушения планшета внесение анализируемой пробы, содержащей комплекс C1r2s2 комплемента человека с неизвестной активностью, и псевдоглобулиновой фракции сыворотки крови человека, получаемой диализом против дистиллированной воды, (R1), а также буферного раствора, содержащего ионы кальция и магния, проведение инкубации и после отмывки и осушения планшета внесение в лунки конъюгата фермента с антителами против компонента С3 человека и субстрата этого фермента, проведение расчета активности субкомпонентов C1r2s2 по количеству образовавшегося продукта ферментативной реакции, отличающийся тем, что в качестве активатора классического пути комплемента используют деринат, а также набор для определения функциональной активности субкомпонентов C1r2s2 первого компонента комплемента человека.

Изобретение относится к медицинской диагностике, а именно к экспресс-определению кардиомиоглобина в плазме крови с помощью электрохимического иммуносенсора. .

Изобретение относится к области медицины, а именно к педиатрии и иммунологии, и описывает способ оценки эффективности иммуносупрессивной терапии у детей с хроническим гломерулонефритом, характеризующийся тем, что определяют кинетику клеток периферической крови методом проточной ДНК-цитометрии, при выявлении доли клеток в фазах пролиферации не менее 0,74% считают показанным назначение иммуносупрессанта и при снижении уровня клеток в фазах пролиферации через 2-3 недели после начала приема препарата не менее чем в 2 раза проводимую терапию считают эффективной, при отсутствии положительной динамики считают показанным изменение дозы или замену препарата.
Изобретение относится к области медицины и описывает способ определения гепарина у родильниц, перенесших в третьем триместре беременности вспышку герпес-вирусной инфекции, характеризующийся тем, что у родильниц забирают кусочек плаценты, готовят гомогенат и обрабатывают его для выделения гликозаминогликанов, затем полученные экстракты глюкозаминогликанов разделяют методом гель-электрофореза в полиакриламидном геле и рассчитывают процентное содержание гепарина методом денситометрии по оптической плотности, при этом вспышку герпес-вирусной инфекции устанавливают спектрофотометрически по нарастанию титра антител к вирусу герпеса.

Изобретение относится к медицине, а именно к иммунологии и клинической лабораторной диагностике, и может быть использовано для прогнозирования течения острых респираторных вирусных инфекций (ОРВИ) у детей в первые дни заболевания и своевременного назначения иммуномодулирующих препаратов.
Изобретение относится к области медицины, а именно к лабораторной диагностике. .

Изобретение относится к медицине, точнее к хирургии, и может найти применение при трансплантации трупной печени. .

Изобретение относится к области молекулярной биологии и может быть использовано в медицине при составлении прогноза развития заболевания у пациентов с хроническим лимфолейкозом.

Способ структурной характеристики рекомбинантного поликлонального белка или поликлональной клеточной линии

Наверх