Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий



Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий
Способ и устройство для анализа in vitro мphk генов, участвующих в развитии гематологических неоплазий

 


Владельцы патента RU 2426786:

ФУНДАСИОН ПАРА ЭЛЬ ЭСТУДИО ДЕ ЛА ХЕМАТОЛОХИЯ И ХЕМОТЕРАПИЯ ДЕ АРАГОН (ФЭХХА) (ES)
ХЕНДИАГ, ЭКСЕ, С.Л. (ES)

Изобретение относится к области молекулярной биологии и может быть использовано в медицине при составлении прогноза развития заболевания у пациентов с хроническим лимфолейкозом. Описана композиция, включающая, по меньшей мере, три олигонуклеотидных зонда и обеспечивающая возможность одновременного определения уровня экспрессии генов PSMB4, FCER2 и POU2F2. Олигонуклеотидную композицию по изобретению предлагается использовать, в том числе и в составе микрочипа, в способе прогнозирования развития заболевания у субъекта, страдающего хроническим лимфолейкозом, основанном на анализе уровня экспрессии в образцах крови пациента, по меньшей мере, трех названных генов. 4 н. и 4 з.п. ф-лы, 16 табл., 5 ил.

 

Область, к которой относится изобретение

Изобретение относится к технико-промышленному сектору экстракорпоральной диагностики in vitro биологических образцов методами генной инженерии, применяемыми для диагностики определенных типов неоплазий по типам экспрессии их генов и/или для прогноза их развития. Конкретнее, изобретение относится к идентификации неоплазий, происходящих из гематопоэтических клеток, по оценке уровней матричной РНК значимых генов в биологических образцах, таких как образцы периферической крови, предпочтительно посредством использования микрочипов. При этом можно идентифицировать образцы, соответствующие пациентам, страдающим CLL (хроническим лимфолейкозом), обеспечивая возможность его диагностики, и, кроме того, можно классифицировать образцы от пациентов, страдающих CLL, в образцах, которые принадлежат пациентам, у которых CLL имеет тенденцию к стабилизации или у которых он имеет тенденцию к прогрессированию, обеспечивая возможность прогноза будущего развития заболевания у этих пациентов.

Предпосылки изобретения

Ежедневно организм человека вырабатывает миллиарды новых лейкоцитов, эритроцитов и тромбоцитов, которые замещают гематопоэтические клетки, которые теряются вследствие нормального процесса обновления, заболевания или травмы. Организованный процесс выработки гематопоэтических клеток и гомеостаза известен под названием гематопоэз (Weissman I.L. et al., 2000; Leung A.Y.H. et al., 2005).

У человека гематопоэз ограничен костным мозгом (В.М.) большей части костей, и постепенно, с возрастом, он замещается жиром, так что у взрослых людей 70% костного мозга локализуется в тазовых костях, позвонках и грудине (Bernard et al., 1976).

Все зрелые клетки крови генерируются из относительно небольшого количества гематопоэтических клеток, известных как гематопоэтические стволовые клетки. Гематопоэтические стволовые клетки имеют 2 характеристики, которые представляют собой плюрипотентность, или способность вызывать развитие различных типов гематопоэтических клеток, и самообновление, или свойство постоянного самосохранения, генерирования клеток таких же, как они сами (Weissman I.L. et al., 2000). Эта способность существенна для поддержания гематопоэза в течение всей жизни, который без самообновления быстро истощил бы резерв имеющихся стволовых клеток. Гематопоэтические стволовые клетки способны генерировать различные типы зрелых гематопоэтических клеток через серию промежуточных клеток-предшественников. Эти клетки-предшественники подвергаются упорядоченной последовательности явлений, которые трансформируют их в зрелые клетки. Этот процесс известен под названием дифференциации (Lee M.F. et al., 2005). Дифференциация гематопоэтических клеток включает изменения, которые воздействуют, наряду с другими параметрами, на размер и форму клетки, экспрессию генов, белки, реакцию на сигналы и локализацию клеток.

Окончательно дифференцированные клетки утрачивают свою способность к делению и подвергаются апоптозу после периода времени, продолжающегося от нескольких часов для нейтрофилов, до десятилетий для некоторых лимфоцитов. Это значит, что В.М. должен постоянно обеспечивать клеточный обмен (Datta S.R. et al., 1999).

Процесс гематопоэза включает сложное взаимодействие между эндогенными генетическими явлениями в гематопоэтических клетках и в среде, где они обнаруживаются. Это взаимодействие таково, что оно определяет, должны ли гематопоэтические клетки-предшественники оставаться в покое, пролиферировать, подвергаться дифференцировке в одну или другую линию или вступать в апоптоз (Domen J. et al., 1999). Все генетические механизмы и механизмы окружающей среды, которые управляют продукцией клеток крови, действуют путем изменения относительного баланса этих фундаментальных клеточных процессов.

Генетические факторы и факторы окружающей среды играют решающую роль в гематопоэзе. Так, например, экспрессия генов, относящихся к семействам Rb (Bergh et al., 1999), циклинам (Della Ragione F. et al., 1997) или Hox (Magli M.C. et al., 1997), регулирует пролиферацию гематопоэтических клеток на ранних стадиях дифференциации. Гены семейства bcl-2 регулируют апоптоз гематопоэтических клеток (O'Gorman D.M. et al., 2001). Представляется, что большое разнообразие генов, среди которых обнаруживаются C/EBP (Tenen D.G. et al., 1997), Pax5 (Nutt S.L. et al., 1999) и Ikaros (Nichogiannopoulou A. еt al., 1998), участвуют в гематопоэтической дифференциации и компромиссе линий.

Гематологические неоплазии

Гематологические неоплазии представляют собой злокачественные процессы, которые поражают любой из типов клеток, относящихся к гематопоэтической системе. Как следствие этой трансформации, клетки блокируются на стадии дифференциации и начинают накапливаться вследствие неконтролируемой пролиферации, несостоятельности апоптозных механизмов или блокирования процесса их дифференциации.

Злокачественная трансформация гематопоэтических клеток во время различных стадий, которые они проходят при их дифференциации в зрелые клетки, вызывает большое количество различных неоплазий (Guttmacher A.E. et al., 2003). Поэтому данный тип неоплазий представляет собой очень разнородную группу заболеваний, которые имеют только общее гематопоэтическое происхождение трансформированного типа клеток.

Классификация гематологических неоплазий

Главным образом можно установить 2 группы: лимфоидные неоплазии, которые поражают клетки различных типов и степени зрелости и которые образуют лимфоидную линию (и В, и Т-клетки), и другую большую группу составляют миелоидные неоплазии, которые поражают различные типы клеток миелоидной линии. Однако эта упрощенная классификация в настоящее время является более развернутой, как в деталях описано ниже.

С клинической точки зрения лимфоматозные лейкозы были дифференцированы в произвольной форме, указывающей на лейкозы как на неоплазии, которые поражают костный мозг и имеют периферическое проявление, т.е. при них имеется циркуляция аномальных клеток в крови, а лимфомы - как неоплазии, которые остаются локализованными в лимфатических узлах или других лимфоидных тканях и которые, по меньшей мере, исходно лишены лейкозного поведения. В случае лейкозов острые процессы при хроническом течении первоначально дифференцировались морфоцитологическими характеристиками пролиферирующих клеток (незрелые и атипичные в первом случае и дифференцированные во втором) и клиническими проявлениями заболевания. В настоящее время знание иммунологических маркеров и генетических изменений, которые воздействуют на гематопоэтические клетки, может помочь более точно дифференцировать различные процессы.

В настоящее время известно, что гематологические неоплазии, как это происходит при других типах рака, имеют мультигенное происхождение. Значительная технологическая революция, произошедшая за последние годы, обеспечила возможность познания молекулярной основы нескольких неоплазий. Использование этих методик обеспечивает возможность идентификации релевантных генов при раке человека, подтверждения результатов, полученных в фундаментальных исследованиях на экспериментальных моделях, установления типов восприимчивости, точнее классификации неоплазий, улучшения диагностики заболевания, идентификации новых терапевтических мишеней и улучшения выбора лечения для каждого пациента.

Существующее разнообразие у различных индивидуумов также имеет значение и клиническое отражение на основании генетических различий: если обеспечена способность распознавания этих генетических различий, то появится также способность продвижения в обнаружении токсичности и различий реакций на лечение (Westbrock C.A. et al., 2005).

В 1995 г. Всемирная Организация Здравоохранения (ВОЗ) в сотрудничестве с Европейской Гематологической Ассоциацией и патологоанатомами, клиницистами и научными работниками во всем мире начали проект для получения согласованной классификации гематопоэтической ткани и лимфоидных органов. Этот проект привел к разработке системы для выявления, классификации и установления согласованных диагностических критериев миелоидной, лимфоидной и гистиоцитарной неоплазий (Jaffe E.S. et al., 2001). Критерии классификации ВОЗ те же, что используются в классификации REAL (пересмотренная Европейская Американская классификация лимфомы), опубликованная Международной Группой Изучения Лимфомы в 1994 г. (Harris N.L. et al., 1994). Система классификации REAL, в отличие от других предыдущих систем классификации, основана на определении «реальных» нозологий, а не морфологических подтипов. Вся имеющаяся информация используется для установления этих «реальных» нозологий, т.е. морфологические, иммунофенотипические и биологические данные объединяются с генетическими и клиническими характеристиками (Harris N.L. et al., 1999a).

Классификация ВОЗ, которая была представлена в 1997 г., стратифицирует нозологии в соответствии с пораженной клеточной линией: миелоидной, лимфоидной, гистиоцитарной/дендритной и мастоцитарной. В пределах каждой категории заболевание определяется в соответствии с морфологией, иммунофенотипом, генетическими и клиническими данными (Harris N.L. et al., 1999b). При многих неоплазиях стадия, на которой обнаруживаются накопившиеся опухолевые клетки, не совпадает со стадией, на которой произошло первоначальное трансформирующее явление. Таким образом, многие гематологические неоплазии происходят из исходных предшественников, и определенное генетическое изменение может определять, какая клетка продолжает продвижение в ее дифференцировке до прекращения и накопления на более поздних стадиях дифференциации (Shaffer A.L. et al., 2002). Напротив, другие неоплазии могут развиться на более поздних стадиях дифференциации, как происходит в клетках из фолликулярных центров, где генетические транслокации и перестройка вызывают активацию генов, которые участвуют в развитии опухоли. Классификация по каждой нозологии отражает наибольшую стимуляцию для ее линии клеток и стадии дифференциации, признавая, что имеющиеся в настоящее время знания несовершенны, и что по мере усовершенствования знаний могут произойти изменения в принадлежности к линии клеток и в классификации.

Современные критерии диагностики и классификация этих неоплазий основаны на комбинации следующих данных (Braziel R.M. et al., 2003):

- Морфологической оценки клетки: исследование под микроскопом вовлеченных клеток. Получают информацию по типу клетки и степени ее зрелости.

- Исследования иммунофенотипа: распознавание антигенов, экспрессированных на поверхности неопластической клетки. Эти антигены экспрессированы иначе и в иной степени, в соответствии с линией клетки и стадией, на которой находится клетка. Известна экспрессия поверхностных антигенов, характерных для линии и стадии дифференцировки клетки, например экспрессия CD19 и CD20 типична для линии В клеток, в то время как экспрессия CD3 типична для линии Т. Исследование CD23 является ключевым при дифференцировке NHLMC от CLL (Gong J.Z. et al., 2001).

Всегда предпринималась попытка связать различные типы неоплазий с их соответствующей популяцией нормальных клеток посредством их морфологических и иммунофенотипических характеристик. Поэтому многие неоплазии представляются «захваченными» на определенных стадиях развития, поскольку они имеют морфологические и иммунофенотипические характеристики, аналогичные характеристикам гематопоэтических клеток на стадии дифференциации (Shaffer A.L. et al., 2002).

- Клинические характеристики: признаки и симптомы у пациента во время диагностики.

- Определение молекулярных маркеров: измерение некоторых молекул, которые связаны с конкретными нозологиями, например присутствие PML/RARA при промиелоциарном лейкозе, или которые дают лучший или худший прогноз, такие как, например, экспрессия CD38 в клеточных маркерах CLL неблагоприятного прогноза (Durig J. et al., 2002).

- Цитогенетические исследования на основе поиска генетических изменений в ДНК в опухолевых клетках. Во многих случаях происходят определенные перестройки, которые характерны для типов опухоли или стадий (Mitelman F, et al., 1997). В соответствии с хромосомными транслокациями можно установить различные группы, имеющие клиническое значение, например, при LLA-B, где присутствие гибридных онкопротеинов встречается нечасто, присутствие t(2;21)/TEL1-AML1 и t(1;19)/E2A-PBX1 связано с реакцией на лечение, в то время как прогноз для пациентов с t(9;22)/BCR-ABL и t(4;11)/MLL-AF4 гораздо хуже (Arico M. et al., 2000). Обычно также проводится поиск специфических мутаций, делеций или инсерций в гене, который был связан с более благоприятным прогнозом, таким как, например, миелодисплазические синдромы, связанные с 5q- (Boultwood J. et al., 1994).

Как было ранее указано, ВОЗ устанавливает 4 большие группы гематологических неоплазий в соответствии с вовлеченной линией (миелоидной, лимфоидной, гистиоцитарной/дендритной и мастоцитарной линиями). Ниже детальнее описаны миелоидная линия и лимфоидная линия, поскольку они являются линиями, которые возникают с наибольшей частотой. Линии, соответствующие гистиоцитарной/дендритной и мастоцитарной линиям, представляют собой в настоящее время очень редкие нозологии.

1. Миелоидные неоплазии

Они объединяют все неоплазии, происходящие из миелоидной линии дифференциации; ВЗО различает 4 большие группы (Vardiman J.W. et al., 2002).

1.1. Миелопролиферативные синдромы (MPS)

Миелопролиферативные синдромы (MPS) представляют собой клональные изменения гематопоэтических стволовых клеток, характеризуемые эффективным гематопоэзом, который ведет к увеличению содержания в крови одной или более линий гематопоэза и гепатоспленомегалии. Они составляют группу нозологий, в которых существует увеличение предшественников миелоидного ряда или фиброза костного мозга (миелофиброза); эта группа также включает системный мастоцитоз. На первый план можно выдвинуть следующее:

- Хронические миелопролиферативные синдромы (CMPS). Клональное изменение гематопоэтических стволовых клеток, характеризуемое эффективным гематопоэзом, который вызывает увеличение в периферической крови одной или более линий клеток и часто гепатоспленомегалию, медуллярную гиперцеллюлярность со зрелостью, но без дисплазии.

- Хронический миелоидный лейкоз (CML). Он представляет собой клональный процесс, вызванный приобретенным генетическим изменением плюрипотентных клеток. Это заболевание характеризуется избыточной продукцией нейтрофилов и их предшественников. Он имеет 3 фазы: первую, называемую хронической фазой неопределенной продолжительности, за которой следует фаза ускорения и, наконец, бластный криз, который представляет собой действительный острый лейкоз.

CML имеет низкую частоту возникновения, составляющую 1 случай на 100000 жителей/год и чаще всего появляется в шестом и седьмом десятилетиях жизни. Его можно считать редким заболеванием.

Это - характерный лейкоз по своей сути, поскольку термин «лейкоз» впервые был применен к этой нозологии. 95% случаев имеют генетический маркер, филадельфийскую хромосому, полученную транслокацией фрагмента хромосомы 22, которая придерживается хромосомы 9 или t(9;22) (q34;q11). Эта транслокация вызывает гибридный ген bcr-abl. Белок, кодируемый этим химерным геном, BCR-ABL, имеет повышенную активность тирозинкиназы по сравнению с нормальной активностью abl в качестве онкогенного ростового фактора (Pane F. et al., 2002), хотя в действительности механизмы, которые вызывают избыточную продукцию миелоидных клеток, полностью не выяснены. Возможно, что другие фото-онкогены, такие как р-53, внедряются в процесс и в трансформацию хронической фазы в бластный криз. Несколько случаев, в которых выявляется филадельфийская хромосома, представляют атипичные миелопролиферативные симптомы и соответствуют варианту MDS, известному как хронический миеломоноцитарный лейкоз (CMML).

Диагностика основывается на большом количестве клеток для промежуточных серий, появлении морфологически нормальных миелоидных клеток и на всех стадиях дифференциации, но с большим количеством миелоцитов и нейтрофилов, в целом имеется базофилия и тромбоцитоз. На стадии ускорения происходит увеличение количества незрелых клеток в периферической крови, а при бластном кризе преобладающей клеткой является миелобласт (65%) или лимфобласт (35%).

- Болезнь Вакеза (VD). Это - миелопролиферативный синдром, характеризуемый увеличением массы красного ряда. Болезнь Вакеза представляет собой доброкачественное гематологическое заболевание, наличие которого не влияет на укорочение выживания. Однако это - клональное заболевание, которое у 15% пациентов может развиться в миелофиброз или острый лейкоз (5%).

- Эссенциальная тромбоцитемия (ЕТ). Миелопролиферативный синдром, характеризуемый продукцией тромбоцитов, в 15 раз большей, чем нормальная. Она может быть связана с тромботическими или геморрагическими осложнениями, вызванными дисфункцией тромбоцитов. Она появляется в возрасте примерно 60 лет при равной заболеваемости у представителей обоих полов.

- Миелофиброз (MF). Это - неопластическое клональное расстройство плюрипотентных стволовых клеток. Оно характеризуется большой продукцией аномальных мегакариоцитов. Эти клетки высвобождают молекулы (ростовой фактор, происходящий из тромбоцитов, тромбоцитарный фактор 4), которые стимулируют пролиферацию фибробластов и образуют коллагеновые волокна в костном мозге. Костный мозг неспособен нормально функционировать, и гематопоэтические клетки-предшественники транслируются в печень и селезенку, вызывая развитие экстрамедуллярного гематопоэза, характеризуемого фиброзом костного мозга и спленомегалией. Он появляется у людей в возрасте старше 50 лет и не имеет половых предпочтений.

- Мастоцитоз. Группа нозологий, характеризуемая пролиферацией мастоцитарных клеток в различных частях организма. Системный мастоцитоз (SM) представляет собой редкое заболевание, которое обычно поражает взрослых, и при котором имеются костные изменения у 70 % пациентов (Chen C.C. et al., 1994).

1.2. Миелодиспластические/миелопролиферативные синдромы (MDS/MPS)

ВОЗ установила несколько другую классификацию, отделяющую MDS/MPS как нозологии, дифференцированные от других MDS, поскольку они имеют общие характеристики с CMPS, которые их отличают. Эта группа включает 3 нозологические формы: хронический миеломоноцитарный лейкоз, хронический атипичный миелоид, лейкоз, ювенильный миеломоноцитарный лейкоз и не классифицируемые MDS/MPS. Миелодиспластические синдромы (MDS) представляют собой клональные пролиферации гематопоэтических стволовых клеток, которые во время диагностики имеют общие клинические, морфологические и аналитические данные, которые накладываются друг на друга между AML и CVPS. Они характеризуются гиперцеллюлярностью костного мозга вследствие пролиферации одной или более миелоидных линий (Heaney M.L., 1999). Присутствие дисплазии, по меньшей мере, в одной линии (миелоидной, эритроидной или мегакароцитарной-тромбоцитарной) является характерным для MDS. Частота является вариабельной, в зависимости от вида. По оценкам, заболеваемость составляет 3 случая × 100000 жителей в возрасте старше 60 лет. Классификация FAB устанавливает 4 диагностические категории (Bennett J.M. et al., 1984): простая рефракторная анемия (RA), рефракторная анемия с кольцевым сидеробластозом (ARS), рефракторная анемия с избытком бластов (RAEB) и рефракторная анемия с избытком бластов в трансформации (RAEB-T) и хронический миеломоноцитарный лейкоз (CMML).

В отношении MDS ВОЗ устанавливает 5 дифференцированных категорий (Harris N.L. et al., 1999): рефракторная анемия, рефракторная цитопения с мултилиновой дисплазией, рефракторная анемия с избытком бластов, не классифицируемый MDS и MDS, связанный с изолированным дефектом хромосомы 5 (5q) или синдром 5q-.

1.3. Острый миелобластный лейкоз (AML)

Клональная пролиферация незрелых клеток миелоидной линии. Они могут появляться вновь или вторично у пациентов с миелодиспластическим синдромом (MDS). Классификация, составленная Франко-американо-британской группой (FAB), рассматривает 8 разновидностей (М0-М7) на основании морфологических критериев и иммунофенотипа неопластических клеток (Bennett J.M. et al., 1976). Несмотря на то что эта классификация была принята в течение многих лет, обнаружение того, что многие генетические изменения имеют предсказуемую характеристику, и включение цитогенетического анализа в диагностику острых лейкозов (Bene M.C. et al., 2001) сделало возможным составление субклассификации заболевания и установления оценки прогноза, как происходит при транслокации t(15;17), которая характеризовала промиелоцитарную разновидность лейкоза, характеризуемую экспрессией рецептора ретиноевой кислоты (RAR), признака, который в большинстве случаев делает этот тип лейкоза чувствительным к лечению трансретиноевой кислотой (TRA).

ВОЗ классифицирует AML включением морфологических, иммунофенотипических, генетических и клинических данных для обеспечения возможности определения биологических однородных нозологий и с клинической релевантностью. Таким образом, AML классифицируется на 4 крупных категории: 1. - AML с рецидивирующими генетическими аномалиями. 2. - AML с мултилиновой дисплазией. 3. - AML, относящийся к лечению. 4. - Неклассифицируемый AML (по классификации ВОЗ). Первые 3 категории признают значение биологических факторов, которые прогнозируют развитие процесса. Цитогенный анализ представляет наиболее мощный фактор прогноза (Roumier C. et al., 2003). Он используется для идентификации подгрупп AML с различным прогнозом: низким риском с благоприятной реакцией на лечение (t(8;21), t(15;17) или inv(16)), промежуточным риском (нормальный кариотип или t(9;11) или высоким риском (inv(3), -5del(5q) или -7del(7q), или более чем тремя изменениями). Существует молекулярная неоднородность в пределах группы риска. В некоторых случаях у пациентов с нормальным кариотипом было обнаружено присутствие мутаций в гене FLT3 (Kottaridis P.D. et al., 2001) и MLL (Dohner K. et al., 2002).

Изображение костного мозга при микроскопическом исследовании аспирата в целом представляет собой инвазию клетками, аналогичными друг другу, с незрелыми морфологическими характеристиками, которые искажают нормальное распределение клеток, составляя листки аутентичных клеток. Состояния повышенной медуллярной продукции, в которые входят области неактивного костного мозга, снова представляют новый очаг гематопоэза во взрослом возрасте, в данном случае аномальных клеток.

Приблизительно 80-90% молодых пациентов с AML достигают полной ремиссии заболевания после химиотерапии. Однако у большинства возникают рецидивы, и излечение происходит у 30%. Онкогенный трансплантат костного мозга смог увеличить частоту излечения до 50%, но он ограничивается доступностью идентичного донора HLA. Поэтому он представляет собой группу неоплазий с разнообразными генетическими аномалиями и вариабельной реакцией на лечение (Giles F.J. et al., 2002).

2. Лимфоидные неоплазии

Классификация ВОЗ представляет собой уточнение классификации REAL (Harris N.L. et al., 1994). Выделяют 3 больших группы лимфоидных неоплазий: 1. - Лимфоидные неоплазии, происходящие из В-клеток. 2. - Лимфоидные неоплазии, происходящие из

T- и NK- (натуральных киллерных) клеток. 3. - Лимфома Ходжкина. Эта классификация включает солидные неоплазии и лимфоидные лейкозы, поскольку при многих из них происходит трансформация из одной фазы в другую и различие между ними может быть искусственным. Таким образом, хронический лимфолейкоз, лейкоз В и лимфоцитарный NHL происходят из одинаковых клеток и представляют различные проявления одной и той же неоплазии, то же самое происходит с лимфобластной лимфомой и лимфобластным лейкозом.

2.1. Неоплазии, происходящие из В-, Т- и NK-клеток

Классификация ВОЗ делит эти неоплазии в соответствии со стадией зрелости клеток на неоплазии из клеток-предшественников и неоплазии из зрелых клеток (Классификация ВОЗ «Опухоли гематопоэтической и лимфоидной тканей». E.S. Jaffe, N.L. Harris, H. Stein, J.W.Vardiman. IARC Press, Lyon, 2001). Ввиду большого количества описанных нозологическим форм, в первую очередь отмечаются следующие:

- Острый лимфобластный лейкоз (ALL): Клональная пролиферация лимфоидных предшественников. Приблизительно в 80% случаев предшественники относятся к лимфоидной линии В. Молекулярный анализ генетических изменений лейкозных клеток внес существенный вклад в понимание патогенеза и прогноза ALL (Ferrando A.A. et al., 2005). Несмотря на то, что частота генетических подтипов у детей и взрослых различается, общие механизмы, которые приводят к развитию ALL, представляют собой последствие аномальной экспрессии протоонкогенов ввиду транслокаций хромосом, которые создают гибридные гены или гиперплоидию. Это - первоначальное онкогенное явление, вероятно, недостаточно для того, чтобы вызвать лейкоз, и считают, что для определенного изменения пролиферации и выживания трансформированной клетки необходимы другие изменения, которые действуют совместно с первым изменением. Все эти изменения вносят вклад в лейкозную трансформацию гематопоэтических стволовых клеток или их предшественников, поскольку они воздействуют на ключевые регулирующие процессы, поддерживающие или увеличивающие их способность к самообновлению, избегают контролирующих механизмов нормальной пролиферации, блокирующих дифференциацию и стимулирующих устойчивость апоптозных сигналов (Hanahan D. et al., 2000).

Общий внешний вид костного мозга аналогичен таковому, описанному для миелоидного лейкоза. Исследование минимального остаточного заболевания важно, т.к. это - фактор, который обусловливает наличие и возможный рецидив заболевания. Классификация FAB определяет 3 стадии в соответствии с морфологией (L1-L3).

Это наиболее частый лейкоз в детском возрасте, и в клиническом течении и реакции на лечение он зависит от типа генетического изменения, например у пациентов с гиперплоидией имеется благоприятный прогноз, когда лейкоз лечат схемами лечения, которые включают антиметаболиты, но в целом детей излечивают стандартной химиотерапией и профилактикой по схеме CNS, а у взрослых - продление выживания при химиотерапии имеется лишь у 20% в случаях, расцениваемых как связанных с высоким риском, используется аллогенный аутологичный трансплантат.

- Хронический лимфолейкоз (CLL). CLL характеризуется клональной пролиферацией и накоплением лимфоцитов со зрелым внешним видом и устойчивостью к апоптозу в костном мозге, крови и лимфоидных органах (Galton D.A., 1966). Когда преобладает лимфоаденопатия, то клинические симптомы называются лимфоцитарной лимфомой. Пораженные лимфоциты относятся к линии В в 95% случаев и в 5% случаев поражают Т-лимфоциты.

Это наиболее часто встречающийся лейкоз в западных странах. Средний возраст пациентов с диагностированным хроническим лимфолейкозом составляет 65 лет, лишь 10-15% случаев возникают в возрасте до 50 лет (Jemal A. et al., 2003). Это - самая распространенная причина лейкоза у взрослых в западных странах и включает примерно 25% всех лейкозов. Заболеваемость составляет 3 случая на каждых 100000 жителей/год с преобладанием мужчин, при соотношении мужчин/женщин 1,7:1. В последние годы его все чаще диагностировали у молодых пациентов. Доля случаев, в которых был поставлен диагноз на ранних стадиях заболевания (Rai K.R. et al., 1975), возросла с 10 до 50%, вероятно, ввиду ранней диагностики благодаря обычному исследованию лимфоцитарной формулы. Заболевание поражает больше мужчин, чем женщин.

Прогноз и клиническое течение заболевания крайне вариабельно. У некоторых пациентов имеется быстро прогрессирующее развитие, и они умирают через 2-3 г. после диагностики, в то время как у других течение заболевания медленное, и они живут в течение 10-20 лет без проблем, связанных с CLL. У половины пациентов возникают промежуточные случаи.

Приблизительно у 20% пациентов нет симптомов заболевания во время диагностики, и диагноз ставится вследствие обычного анализа крови. Когда имеются симптомы, они неспецифичны и включают усталость, слабость и дискомфорт.

Классификация Binet (Binеt J.L. et al., 1981) определяет 3 стадии заболевания в соответствии с концентрацией гемоглобина, количеством тромбоцитов, количеством пораженных лимфоузлов и наличием висцеромегалии. В классификации Rai (Rai K.R. et al., 1975) используются те же индикаторы, но она классифицирует пациентов на 5 групп.

Эта неоплазия не характеризуется необычным и рецидивирующим изменением генома. Имеются некоторые маркеры, которые дают более неблагоприятный прогноз, такие как наличие делеций в хромосомах 17 и 11, и у тех пациентов, у которых отсутствуют мутации в генах IgVh (40% случаев) и высокая доля клеток, экспрессирующих CD38, характеризуется более агрессивным клиническим течением и худшей реакцией на лечение (Hamblin T.J. et al., 1999; Durig J. et al., 2002). Другой недавно описанный маркер представляет собой ZAP-70, независимый маркер прогноза, экспрессия которого косвенно связана с мутационным состоянием гена тяжелых цепей иммуноглобулинов (Crespo M. et al., 2003).

- Множественная миелома (ММ): ММ представляет собой злокачественное заболевание, при котором клон плазматических клеток (конечных клеток В лимфоидной линии) костного мозга подвергается неконтролируемой пролиферации. Она составляет 10-15% всех злокачественных заболеваний и характерна для пожилого возраста, только 2% случаев диагностируются в возрасте до 40 лет. По неизвестным причинам частота заболевания увеличивается.

Эти клетки продуцируют и секретируют моноклональный иммуноглобулин или фрагменты иммуноглобулинов, состоящих из класса тяжелой и легкой цепей (каппа или лямбда). Иногда миелома не может секретироваться или белок не выявляется в сыворотке или моче. Неопластическая плазматическая клетка продуцирует другие молекулы, такие как IL6, фактор опухолевого некроза или фактор-активатор остеокластов, который участвует в вызывании остеолизиса, гиперкальциемии и почечной недостаточности, являющихся характерными изменениями при этом заболевании.

Диагностика может быть случайной при выполнении анализа у пациентов без симптомологии или ограниченном заболевании (20% случаев). Заболевание у этих пациентов может оставаться стабильным в течение лет, и раннее лечение на бессимптомной фазе не обеспечивает никаких преимуществ.

Пациенты с моноклональным компонентом, но которые не соответствуют критериям диагностики ММ, считаются носителями моноклональной гаммапатии промежуточного значения (MGIM). У 10-20% этих пациентов через 10 лет развивается ММ (Kyle R.A., 1997; Zhan F. et al., 2002). Моноклональный компонент может быть также связан с другими заболеваниями, такими как лимфома, негематологические неоплазии и заболевания соединительной ткани.

- Лимфоплазмоцитоидная лимфома и макроглобулинемия Вальденстрема. Представляет собой клиническое проявление лимфопролиферативного заболевания низкой степени, характеризуемого инфильтрацией аномальных лимфоплазмоцитарных клеток в костном мозге, лимфоузлах и селезенке, сопровождающейся моноклональной продукцией иммуноглобулина М, причем эти состояния вызывают увеличение вязкости крови и появление геморрагических сосудистых проявлений и затруднение циркуляции в мелких сосудах.

Неходжкинская лимфома (HNL). HNL представляют собой солидные опухоли лимфоидной ткани, которые гораздо более гетерогенны, чем болезнь Ходжкина. Сложность и разнообразие HNL в отношении морфологии, генетики фенотипа и клинического поведения послужила основанием для существования множественных классификаций, ни одна из которых не является полностью удовлетворительной.

Это - самое часто встречающееся гематологические заболевание, и с точки зрения потерянных лет жизни это - четвертая по частоте самая важная неоплазия в западном мире, и представляется, что заболеваемость ею увеличивается.

Она может появляться во всех возрастах, но среднее появление приходится на возраст 50 лет. Причина заболевания не ясна. Были описаны специфические хромосомные транслокации, связанные с определенными типами лимфом, и по этой причине они широко используются при диагностике (Montoto S. et al., 2003). Большинство лимфом типа Буркитта представляют транслокацию t(8;14), при которой онкоген c-MYC хромосомы 8 переносится в следующую область в хромосоме 14, где кодируются тяжелые цепи иммуноглобулинов. 90% фолликулярных лимфом характеризуются транслокацией t(14;18), где ген bcl-2 хромосомы 18 передается в область тяжелых цепей иммуноглобулина. Хорошо известно, что избыточная экспрессия bcl-2 ингибирует апоптоз (запрограммированную гибель клеток). Это легко, потому что данная перестройка хромосомы требует другой стимуляции, такой как, например, совместная экспрессия второго фотоонкогена, или антигенной стимуляции для развития злокачественной пролиферации. Пример комбинации множественных комбинированных причин вызывает развитие лимфомы, связанной со СПИДом. Появление агрессивных внеузловых лимфом является результатом комбинации подавления иммунитета ВИЧ, нарушения регуляции фотоонкогена (c_MYC) и вторичной вирусной инфекции (вирусом Эпштейна-Барра). То же происходит у пациентов, подвергнутых трансплантации органов (Harris N.L. et al., 2001).

Клиническое проявление заболевания более разнообразное, чем при болезни Ходжкина. Оно может вести себя более вяло, не требуя немедленного лечения, или, напротив, вести себя агрессивно, что быстро приводит к смерти.

Чаще всего поражаются шейные лимфоузлы. Что касается внеузловых поражений, то их признаки и симптомы зависят от пораженного органа. Представляется, что костный мозг инфильтрируется чаще при NHL низкой степени и может вызвать панцитопению. Присутствие злокачественных клеток в периферической крови также часто встречается при NHL низкой степени, но свидетельствует об очень плохом прогнозе при NHL высокой степени.

Диагностика проводится гистологическим исследованием лимфатической ткани. Дополнительная информация получается моноклональными антителами, направленными против специфических лимфоцитарных антигенов (иммунофенотипа); это помогает идентифицировать степень зрелости злокачественной клетки и определить ее Т или В происхождение. Присутствие мутации в генах, которые кодируют Ig в NHL линии В, обычно используется для идентификации некоторых подтипов NHL (Kuppers R. et al., 1999).

2.2. Лимфома Ходжкина (LH)

Это нечастое заболевание и имеющее склонность поражать представителей мужского пола в пропорции 2/1. Она характеризуется присутствием больших клеток с двумя или множественными ядрами, именуемыми клетками Рид-Штернберга (Reed-Sternberg) (RS), и других более мелких и одноядерных клеток, которые появляются в маленьком количестве в опухоли; остальные клетки представляют собой лимфоциты, гранулоциты, фибробласты и плазматические клетки. Этот воспалительный инфильтрат, возможно, отражает иммунную реакцию хозяина на злокачественные клетки. Природа RS и клеток Ходжкина была в значительной степени изучена, но продолжает оспариваться. Они могут происходить из начальной стадии лимфоидных клеток.

В некоторых случаях в опухоли было выявлено существование ДНК вируса Эпштейна-Барра. Одна гипотеза заключается в том, что бимодальное распределение заболевания связано с инфекцией у молодых субъектов, а другой пик мог бы быть вызван средними причинами окружающей среды.

Диагностика достигается биопсией лимфатических узлов. Для планирования лечения необходимо определить степень заболевания (Kuppers R., 2002; Cossman J., 2001; Devilard E. et al., 2002).

Проблемы при классификации

Большое количество гематопоэтических клеток и множественные стадии дифференциации, через которые они проходят, дополнительно осложняют классификацию неоплазий, происходящих из этого типа клеток. Несмотря на усилия по установлению классификации, основанной на «действительных» нозологических формах, некоторые из категорий являются неопределенными и во многих случаях содержат очень разнородные группы в отношении реакции на клинический курс лечения. Эта неоднородность, с одной стороны, ответственна за непрекращающийся поиск маркеров, способных дифференцировать некоторые виды поведения от других, и, с другой стороны, за то, что оспариваемая классификация этого типа неоплазии подвергается постоянным пересмотрам.

Идеальная система классификации должна быть точной, воспроизводимой, легко используемой и должна, в частности, иметь биологическое и клиническое значение (Chan W.C. et al., 2005). Современные системы диагностики и классификация гематологических неоплазий основаны на признании гистологических и морфологических, иммунофенотипических и цитогенетических характеристик и исследовании молекулярного маркера, имеющего прогностическую ценность. Однако в некоторых из диагностических категорий, определенных таким образом, наблюдается следующее:

- Выраженная неоднородная реакция на лечение. В пределах одного и того же заболевания имеются пациенты, которые после определенного лечения достигают полной ремиссии, частичной ремиссии, не реагируют на него и у которых происходит рецидив. Возможность прогнозировать реакцию особенно важна при этом типе неоплазии, поскольку трансплантат стволовых клеток представляет собой эффективную, но токсичную альтернативную реакцию. Способность определить, какие пациенты будут реагировать на обычное лечение перед его проведением, может быть благоприятной для применения наиболее эффективного лечения у каждого пациента.

- Вариабельное клиническое поведение. В пределах категории имеются пациенты, у которых заболевание остается стабильным в течение длительных периодов времени, не нуждающиеся в лечении, и пациенты, у которых заболевание будет быстро прогрессировать, требуя активного лечения.

Эти различия указывают на существование молекулярной разнородности в пределах диагностических категорий, которые обычные способы диагностики не могут определить, и, следовательно, необходим поиск новых форм анализа, который обеспечивает большее разрешение в характеристике этого типа неоплазий.

В этом плане, использование чипов экспрессии продемонстрировало свою эффективность не только в расшифровке биологического и клинического разнообразия, которое обнаруживается при многих опухолях, но в понимании биологических и патологических процессов, которые воздействуют на многие симптомы и, в частности, гематопоэтическую систему. Чипы экспрессии представляют собой упорядоченные чипы последовательностей, связанные с твердой подложкой, комплементарные к мРНК или к ее соответствующей кДНК или кРНК, которые позволяют одновременно анализировать дифференциальную экспрессию сотен или тысяч генов. Одна из подложек, с которой они часто связаны, представляет собой прямоугольные фрагменты стекла, подобные предметным стеклам, формат, который часто упоминается терминами микроряд, микрочип или просто чип. Они все чаще используются для диагностики различных заболеваний или для разработки оценки восприимчивости к их развитию.

Первые работы по чипам и гематологическим неоплазиям

В 1999 г. группа Golub опубликовала одну из первых статей, относящихся к роли чипов в классификации гематологических неоплазий (Golub T.R. et al., 1999). Чип с 6817 представленными генами использовали для исследования профилей экспрессии при AML и ALL. Была выбрана группа из 50 генов со способностью прогнозирования типа лейкоза (прогнозист класса), и их использовали для классификации группы неизвестных образцов в правильных категориях. Исследование экспрессии этих 50 генов достаточно для классификации образца острого лейкоза при AML или ALL. Несмотря на то что дифференцировка между AML и ALL хорошо установлена современными диагностическими способами, исследование выявило существование специфических типов экспрессии, связанных с каждым типом острого лейкоза, и доказало возможность использования профилей экспрессии при классификации рака.

В 2000 г. группа Alizadeh опубликовала статью, в которой используется специализированный чип, лимфочип, который содержит гены, преимущественно экспрессируемые в лимфоидных клетках, или иммунологическое или онкологическое значение которых известно, с 17856 последовательностями (Alizadeh A.A. et al., 1999). Эта группа использовала «лимфочип» для исследования типов генной экспрессии, связанных с различиями клинического поведения при диффузной крупной В-клеточной лимфоме (DLCL) (Alizadeh A.A. et al., 2000). DLCL представляет собой HNL с очень неоднородным поведением и невозможной дифференцировкой при использовании обычных диагностических методов: 40% пациентов хорошо реагируют на лечение и имеют длительное выживание, хотя 60% умирают вследствие этого заболевания. Авторы обнаружили, что генная экспрессия может быть связана с клиническим поведением опухолей. Это была одна из первых статей, где речь шла о чипах для «субклассификации» гематологических неоплазий, т.е. использовании профилей экспрессии для идентификации двух различных групп DLCL с транскрипционной точки зрения, подтипов DLCL с клиническим поведением, которое невозможно прогнозировать обычными диагностическими критериями.

В настоящее время имеются множественные публикации, в которых прямо или косвенно появляются чипы, применяемые не только для классификации и субклассификации, но также для исследования, диагностики, прогноза, идентификации новых маркеров при гематологических заболеваниях (Greiner T.C., 2004; Alizadeh A.A. et al., 2000; Bea S. et al., 2005; Dave S.S. et al., 2004), а также патентные заявки, которые раскрывают использование этого типа устройства для дифференцировки между различными типами гематологических неоплазий. Так, например, в патентной заявке WO2003/008552 раскрывается использование в диагностических целях различий типа экспрессии генов для дифференцировки между лейкозом смешанной линии (MLL), острым лимфобластическим лейкозом (ALL) и острым миелогенным лейкозом (AML), защищая возможность проведения этой дифференциальной диагностики данными, полученными после диагноза по образцам от пациентов, пораженных каждым из этих типов лейкоза, путем использования имеющихся в продаже чипов от компании Affymetrix. Хотя гены указаны с вариациями экспрессии между тремя типами лейкозов, что могло бы обеспечить возможность дифференцировки между ними, специфические последовательности, кроме тех, которые присутствуют в чипе Affymetrix, которые можно было бы использовать для выявления этих генов устройствами, отличными от устройств указанной компании, не упоминаются, и в указанном документе не рассматривается конструкция устройств или способов, которые бы позволили диагностировать другие типы лейкозов или, в целом, неоплазий, происходящих из гематопоэтических клеток.

Патентная заявка WO2005/024043 частично также относится к области анализа экспрессии генов для более детального познания различий, существующих на молекулярном уровне между различными неоплазиями, происходящими из гематопоэтических клеток, в частности сосредотачиваясь на случае лимфом, для получения данных, помогающих в диагностике или в прогнозе развития лимфом. В частности, в документе раскрывается способ получения полезных функций для прогноза развития заболевания у индивидуумов, пораженных различными типами лимфом, по оценке биопсий лимфатических узлов с целью выяснения, в какой степени типы или генетические отпечатки вносят вклад в каждый из них, групп генов, которые экспрессированы координированным образом и которые связаны с клеточным происхождением неоплазии, различные типы незлокачественных клеток, присутствующие в биопсии, и онкогенные механизмы, ответственные за развитие рака. Различные типы или генетические отпечатки также устанавливаются в этом случае по данным, полученным с имеющимися в продаже чипами от компании Affymetrix. Кроме того, в заявке WO2005/024043 указано, что она предоставляет альтернативный микрочип, составленный из меньшего числа последовательностей, чем микрочипы Affymetrix, которые бы также позволили проводить анализ различий экспрессии генов между лимфомами и использовать их для установления функций прогноза или выживаемости и для дифференциации между различными типами лимфом. Хотя в документе указаны гены, анализ которых был бы возможен этим микрочипом, в описании заявки WO2005/024043 не указана последовательность зондов, которые могли бы составить микрочип, а лишь упоминается то, что они могли бы быть типа кДНК, и оставляя сомнения в том, что кДНК оказалась бы полной или анализ экспрессии соответствующих генов можно было бы провести, используя в качестве зонда только один фрагмент указанной кДНК, который бы еще нужно было определить.

Представляло бы интерес наличие специально предназначенных для этой группы неоплазий композиций и способов, которые бы позволили проводить дифференциацию между неоплазиями гематопоэтического происхождения на основании их различия на молекулярном уровне, где бы проводилась оценка экспрессии меньшего количества генов, чем в имеющихся в продаже микрочипах, использованных в исследованиях, описанных в указанных выше патентных заявках, и которые бы обеспечили возможность и диагностики определенных неоплазий, и прогноза их будущего развития, таким образом, помогая в назначении лечения, подходящего для каждого пациента, особенно интересной характеристики при таких неоплазиях, как CLL, где прогноз будущего развития патологии у пациента на основании имеющихся в настоящее время представлений и тестов является трудным. Кроме того, было бы особенно удобно, чтобы зонды, используемые для оценки экспрессии экспрессированных генов, были бы сконструированы определенным образом с тем, чтобы в дополнение к специфичности и четко определенной последовательности все они имели одинаковое поведение, что сделало бы их подходящими в целом для использования в комбинации в том же тесте и, в частности, для формирования части того же упорядоченного чипа, связанного с твердой подложкой, такого как чипы или микрочипы. Композиции и способы по настоящему изобретению удовлетворяют эту потребность.

Вместо имеющихся в продаже микрочипов для выявления генов, значимых для дифференцировки между неоплазиями или создающих функции, которые прогнозируют выживание индивидуума, страдающего ими, изобретение предоставляет новые олигонуклеотиды с четко определенной последовательностью, способные специфически выявлять гены, которые были выбраны, поскольку известно, что они значимы для биологии клеток крови или для патологии в виде различных неоплазий, олигонуклеотиды, которые также имеют признак конструирования таким образом, чтобы они разделяли общие характеристики и имели такое же поведение как олигонуклеотиды, используемые в качестве зондов при гибридизации, что делает их пригодными для использования в композициях, которые включают их комбинации. Указанные композиции и, в частности, те, в которых данные нуклеотиды расположены в упорядоченном виде на легко манипулируемой твердой подложке, такой как стекло, подобной предметным стеклам, подходят для проведения тестов с целью выявления статистически значимых генов или дифференциации образцов, взятых у индивидуумов, страдающих определенными типами неоплазий, происходящих из гематопоэтических клеток, от образцов, взятых у индивидуумов, не страдающих указанными неоплазиями, поскольку они представляют собой композиции, которые содержат количество нуклеотидов, меньшее, чем количество в имеющихся в продаже микрочипах, сконструированных для более общего назначения, специально предназначенных для анализа образцов от индивидуумов, страдающих неоплазиями, и составленных из известной последовательности зондов, превосходно воспроизводимых, которые предназначены для использования вместе в одном и том же тесте, поскольку они имеют одинаковое поведение. Дополнительное включение в микрочипы по изобретению олигонуклеотидов с низкой гомологией с человеческими генами, но выбранных так, чтобы их остальные характеристики были аналогичны характеристикам олигонуклеотидов по изобретению, предназначенных действовать в качестве зондов, способных распознавать человеческие гены с высокой специфичностью, обеспечивает возможность использования указанных микрочипов для идентификации статистически значимых генов при идентификации образцов, связанных с определенными неоплазиями гематопоэтического происхождения, путем использования тестов, в которых возможно установление контролей на всех их фазах. Как показано в примерах, которые представлены ниже в настоящем описании, использование микрочипов в комбинации с различными статистическими методиками обеспечивает возможность правильной классификации различных биологических образцов способом, который является точным, воспроизводимым, легко используемым и имеющим биологическое и клиническое значение, поскольку они основаны на различиях экспрессии генов, имеющих значение для анализируемых биологических процессов. В частности, использование микрочипа по изобретению в комбинации со способом по изобретению обеспечивает возможность идентификации образцов крови у пациентов, страдающих хроническим лимфолейкозом (изменение, не рассматриваемое в заявках WO2003/008552 и WO2005/024043, и диагностика которого не была описана путем использования имеющихся в продаже микрочипов), дифференцируя хронический лимфолейкоз и от образцов, полученных у здоровых индивидуумов, и от образцов, связанных с другими типами лейкозов, и от образцов, соответствующих клеткам Jurkat или U937, что облегчает диагностику CLL посредством анализа уровней экспрессии статистически значимых генов для осуществления этого, и даже обеспечивая возможность получения функций, которые позволяют производить математический подсчет вероятности того, что образец принадлежит индивидуумам, пораженным стабильным хроническим лимфолейкозом, и его дифференцировки от образцов, принадлежащих индивидуумам, пораженным прогрессирующим хроническим лимфолейкозом, дифференцировки, которую в настоящее время трудно проводить заведомо имеющимися методиками, что свидетельствует о том, что предлагаемые композиции и способ представляют собой полезный и новый инструмент для прогноза будущего развития патологии у индивидуумов, пораженных этим заболеванием, индивидуумов, диагностику у которых можно также проводить композициями и способом по настоящему изобретению, или диагноз у которых мог быть известен благодаря применению другого способа, но у которых, при наличии инструмента, который обеспечивает возможность прогнозирования того, как CLL, которым они страдают, будет развиваться позднее, было бы легче принять решение, подходит ли для них применение немедленного агрессивного лечения или нужно просто наблюдать для проверки того, что полученные у них данные экспрессии генов продолжают указывать на то, что заболевание будет оставаться стабильным в течение длительного период времени.

Краткое описание сущности изобретения

Изобретение предоставляет композиции, которые cодержат, по меньшей мере, один олигонуклеотид из группы, состоящей из:

SG1, SG2, SG3, SG4, SG5, SG6, SG7, SG8, SG9, SG10, SG11, SG12, SG13, SG14, SG15, SG16, SG17, SG18, SG19, SG20, SG21, SG22, SG23, SG24, SG25, SG26, SG27, SG28, SG29, SG30, SG31, SG32, SG33, SG34, SG35, SG36, SG37, SG38, SG39, SG40, SG41, SG42, SG43, SG44, SG45, SG46, SG47, SG48, SG49, SG50, SG51, SG52, SG53, SG54, SG55, SG56, SG57, SG58, SG59, SG60, SG61, SG62, SG63, SG64, SG65, SG66, SG67, SG68, SG69, SG70, SG71, SG72, SG73, SG74, SG75, SG76, SG77, SG78, SG79, SG80, SG81, SG82, SG83, SG84, SG85, SG86, SG87, SG88, SG89, SG90, SG91, SG92, SG93, SG94, SG95, SG96, SG97, SG98, SG99, SG100, SG101, SG102, SG103, SG104, SG105, SG106, SG107, SG108, SG109, SG110, SG111, SG112, SG113, SG114, SG115, SG116, SG117, SG118, SG119, SG120, SG121, SG122, SG123, SG124, SG125, SG126, SG127, SG128, SG129, SG130, SG131, SG132, SG133, SG134, SG135, SG136, SG137, SG138, SG139, SG140, SG141, SG142, SG143, SG144, SG145, SG146, SG147, SG148, SG149, SG150, SG151, SG152, SG153, SG154, SG155, SG156, SG157, SG158, SG159, SG160, SG161, SG162, SG163, SG164, SG165, SG166, SG167, SG168, SG169, SG170, SG171, SG172, SG173, SG174, SG175, SG176, SG177, SG178, SG179, SG180, SG181, SG182, SG183, SG184, SG185, SG186, SG187, SG188, SG189, SG190, SG191, SG192, SG193, SG194, SG195, SG196, SG197, SG198, SG199, SG200, SG201, SG202, SG203, SG204, SG205, SG206, SG207, SG208, SG209, SG210, SG211, SG212, SG213, SG214, SG215, SG216, SG217, SG218, SG219, SG220, SG221, SG222, SG223, SG224, SG225, SG226, SG227, SG228, SG229, SG230, SG231, SG232, SG233, SG234, SG235, SG236, SG237, SG238, SG239, SG240, SG241, SG242, SG243, SG244, SG245, SG246, SG247, SG248, SG249, SG250, SG251, SG252, SG253, SG254, SG255, SG256, SG257, SG258, SG259, SG260, SG261, SG262, SG263, SG264, SG265, SG266, SG267, SG268, SG269, SG270, SG271, SG272, SG273, SG274, SG275, SG276, SG277, SG278, SG279, SG280, SG281, SG282, SG283, SG284, SG285, SG286, SG287, SG288, SG289, SG290, SG291, SG292, SG293, SG294, SG295, SG296, SG297, SG298, SG299, SG300, SG301, SG302, SG303, SG304, SG305, SG306, SG307, SG308, SG309, SG310, SG311, SG312, SG313, SG314, SG315, SG316, SG317, SG318, SG319, SG320, SG321, SG322, SG323, SG324, SG325, SG326, SG327, SG328, SG329, SG330, SG331, SG332, SG333, SG334, SG335, SG336, SG337, SG338, SG339, SG340, SG341, SG342, SG343, SG344, SG345, SG346, SG347, SG348, SG349, SG350, SG351, SG352, SG353, SG354, SG355, SG356, SG357, SG358, SG359, SG360, SG361, SG362, SG363, SG364, SG365, SG366, SG367, SG368, SG369, SG370, SG371, SG372, SG373, SG374, SG375, SG376, SG377, SG378, SG379, SG380, SG381, SG382, SG383, SG384, SG385, SG386, SG387, SG388, SG389, SG390, SG391, SG392, SG393, SG394, SG395, SG396, SG397, SG398, SG399, SG400, SG401, SG402, SG403, SG404, SG405, SG406, SG407, SG408, SG409, SG410, SG411, SG412, SG413, SG414, SG415, SG416, SG417, SG418, SG419, SG420, SG421, SG422, SG423, SG424, SG425, SG426, SG427, SG428, SG429, SG430, SG431, SG432, SG433, SG434, SG435, SG436, SG437, SG438, SG439, SG440, SG441, SG442, SG443, SG444, SG445, SG446, SG447, SG448, SG449, SG450, SG451, SG452, SG453, SG454, SG455, SG456, SG457, SG458, SG459, SG460, SG461, SG462, SG465, SG468, SG469, SG470, SG471, SG472, SG473, SG474, SG475, SG476, SG477, SG478, SG479, SG480, SG481, SG482, SG483, SG484, SG485, SG486, SG487, SG488, SG489, SG490, SG491, SG492, SG493, SG494, SG495, SG496, SG497, SG498, SG499, SG500, SG501, SG502, SG503, SG504, SG505, SG506, SG507, SG508, SG509, SG510, SG511, SG512, SG513, SG514, SG515, SG516, SG517, SG518, SG519, SG520, SG521, SG522, SG523, SG524, SG525, SG526, SG527, SG428, SG529, SG530, SG531, SG532, SG533, SG534, SG535, SG536, SG537, SG538, SG539, SG540, SG541, SG542, SG543, SG544, SG545, SG546, SG547, SG548, SG549, SG550, SG551, SG552, SG553, SG554, SG555, SG556, SG557, SG558, SG559, SG560, SG561, SG562, SG563 или их комбинаций.

Указанные олигонуклеотиды были сконструированы так, что, в дополнение к специфичности по отношению к соответствующим генам, экспрессию которых желательно оценить, они имеют одинаковое поведение, поскольку они имеют одинаковую длину, и все они имеют GC в диапазоне от 40% до 60%, в дополнение к соответствию зонам, расположенным менее чем на 3000 нуклеотидов от конца 3' (поли(А)) мРНК, которую желательно выявить и оценить, и составлены последовательностями, которые совпадают по их смыслу с последовательностями соответствующей мРНК. Поэтому они подходят для использования в том же тесте или образования части композиции, которая содержит их комбинации. Определенный вариант осуществления изобретения представлен композициями, которые включают смеси нескольких из указанных олигонуклеотидов. Особенно предпочтительны те композиции, которые включают смеси олигонуклеотидов, соответствующих генам, значимым для классификации образца как связанного с определенной неоплазией и/или для определения их будущего развития. Особенно предпочтительные варианты осуществления изобретения представляют собой также те композиции, которые содержат полный набор олигонуклеотидов из группы, состоящей из:

SG1, SG2, SG3, SG4, SG5, SG6, SG7, SG8, SG9, SG10, SG11, SG12, SG13, SG14, SG15, SG16, SG17, SG18, SG19, SG20, SG21, SG22, SG23, SG24, SG25, SG26, SG27, SG28, SG29, SG30, SG31, SG32, SG33, SG34, SG35, SG36, SG37, SG38, SG39, SG40, SG41, SG42, SG43, SG44, SG45, SG46, SG47, SG48, SG49, SG50, SG51, SG52, SG53, SG54, SG55, SG56, SG57, SG58, SG59, SG60, SG61, SG62, SG63, SG64, SG65, SG66, SG67, SG68, SG69, SG70, SG71, SG72, SG73, SG74, SG75, SG76, SG77, SG78, SG79, SG80, SG81, SG82, SG83, SG84, SG85, SG86, SG87, SG88, SG89, SG90, SG91, SG92, SG93, SG94, SG95, SG96, SG97, SG98, SG99, SG100, SG101, SG102, SG103, SG104, SG105, SG106, SG107, SG108, SG109, SG110, SG111, SG112, SG113, SG114, SG115, SG116, SG117, SG118, SG119, SG120, SG121, SG122, SG123, SG124, SG125, SG126, SG127, SG128, SG129, SG130, SG131, SG132, SG133, SG134, SG135, SG136, SG137, SG138, SG139, SG140, SG141, SG142, SG143, SG144, SG145, SG146, SG147, SG148, SG149, SG150, SG151, SG152, SG153, SG154, SG155, SG156, SG157, SG158, SG159, SG160, SG161, SG162, SG163, SG164, SG165, SG166, SG167, SG168, SG169, SG170, SG171, SG172, SG173, SG174, SG175, SG176, SG177, SG178, SG179, SG180, SG181, SG182, SG183, SG184, SG185, SG186, SG187, SG188, SG189, SG190, SG191, SG192, SG193, SG194, SG195, SG196, SG197, SG198, SG199, SG200, SG201, SG202, SG203, SG204, SG205, SG206, SG207, SG208, SG209, SG210, SG211, SG212, SG213, SG214, SG215, SG216, SG217, SG218, SG219, SG220, SG221, SG222, SG223, SG224, SG225, SG226, SG227, SG228, SG229, SG230, SG231, SG232, SG233, SG234, SG235, SG236, SG237, SG238, SG239, SG240, SG241, SG242, SG243, SG244, SG245, SG246, SG247, SG248, SG249, SG250, SG251, SG252, SG253, SG254, SG255, SG256, SG257, SG258, SG259, SG260, SG261, SG262, SG263, SG264, SG265, SG266, SG267, SG268, SG269, SG270, SG271, SG272, SG273, SG274, SG275, SG276, SG277, SG278, SG279, SG280, SG281, SG282, SG283, SG284, SG285, SG286, SG287, SG288, SG289, SG290, SG291, SG292, SG293, SG294, SG295, SG296, SG297, SG298, SG299, SG300, SG301, SG302, SG303, SG304, SG305, SG306, SG307, SG308, SG309, SG310, SG311, SG312, SG313, SG314, SG315, SG316, SG317, SG318, SG319, SG320, SG321, SG322, SG323, SG324, SG325, SG326, SG327, SG328, SG329, SG330, SG331, SG332, SG333, SG334, SG335, SG336, SG337, SG338, SG339, SG340, SG341, SG342, SG343, SG344, SG345, SG346, SG347, SG348, SG349, SG350, SG351, SG352, SG353, SG354, SG355, SG356, SG357, SG358, SG359, SG360, SG361, SG362, SG363, SG364, SG365, SG366, SG367, SG368, SG369, SG370, SG371, SG372, SG373, SG374, SG375, SG376, SG377, SG378, SG379, SG380, SG381, SG382, SG383, SG384, SG385, SG386, SG387, SG388, SG389, SG390, SG391, SG392, SG393, SG394, SG395, SG396, SG397, SG398, SG399, SG400, SG401, SG402, SG403, SG404, SG405, SG406, SG407, SG408, SG409, SG410, SG411, SG412, SG413, SG414, SG415, SG416, SG417, SG418, SG419, SG420, SG421, SG422, SG423, SG424, SG425, SG426, SG427, SG428, SG429, SG430, SG431, SG432, SG433, SG434, SG435, SG436, SG437, SG438, SG439, SG440, SG441, SG442, SG443, SG444, SG445, SG446, SG447, SG448, SG449, SG450, SG451, SG452, SG453, SG454, SG455, SG456, SG457, SG458, SG459, SG460, SG461, SG462, SG465, SG468, SG470, SG472, SG473, SG474, SG475, SG476, SG477, SG478, SG479, SG480, SG481, SG482, SG483, SG484, SG485, SG486, SG487, SG488, SG489, SG490, SG491, SG492, SG493, SG494, SG495, SG496, SG497, SG498, SG499, SG500, SG501, SG502, SG503, SG504, SG505, SG506, SG507, SG508, SG509, SG510, SG511, SG512, SG513, SG514, SG515, SG516, SG517, SG518, SG519, SG520, SG521, SG522, SG523, SG524, SG525, SG526, SG527, SG428, SG529, SG530, SG531, SG532, SG533, SG534, SG535, SG536, SG537, SG538, SG539, SG540, SG541, SG542, SG543, SG544, SG545, SG546, SG547, SG548, SG549, SG550, SG551, SG552, SG553, SG554, SG555, SG556, SG557, SG558, SG559, SG560, SG561, SG562, SG563.

Кроме того, изобретение предоставляет олигонуклеотиды, которые можно использовать в качестве контролей в способе по изобретению. С одной стороны, в качестве контролей единства, предоставляются пары олигонуклеотидов SG463 и SG464 (комплементарные соответственно на концах 5' и 3' гена β-актина) и SG466 и SG467 ((комплементарные соответственно на концах 5' и 3' гена GAPD). Кроме того, предоставляются олигонуклеотиды SSPC1, SSPC2, SSPC3, SSPC4, SSPC5, SSPC6 и SSPC7, которые можно использовать в качестве экзогенных внутренних положительных контролей качества процесса после добавления к образцу, который содержит молекулы исходной мРНК полиаденилированных нуклеиновых кислот, которые содержат фрагменты, соответствующие по их последовательности фрагментам этих олигонуклеотидов (таких как транскрипты, соответствующие генам, из которых происходят указанные нуклеотиды) и которые подвергаются такой же обработке, как исходная мРНК, а также олигонуклеотиды SCN2, SCN3, SCN6, SCN8, SCN11, SCN12 и SCN13, сконструированные для использования в качестве положительных контролей гибридизации, и олигонуклеотиды SCN1, SCN5, SCN7, SCN10, SC1, SC2, SC3, SC4, SC5, SC6 и SC7, сконструированные для использования в качестве отрицательных контролей; они все соответствуют условиям наличия низкой гомологии с человеческими генами, в дополнение к соответствию таким же условиям наличия одинаковой длины для олигонуклеотидов, комплементарных человеческим генам, и наличию у всех их содержания GC в диапазоне от 40% до 60%, соответствия зонам, расположенным менее чем на 3000 нуклеотида от конца 3' (поли(А)) нечеловеческой мРНК, которые могли бы выявить и были бы составлены последовательностями, которые совпадают по своему смыслу с последовательностями соответствующей мРНК. Любая композиция, которая содержит, по меньшей мере, один из олигонуклеотидов SG463, SG464, SG466, SG467, SSPC1, SSPC2, SSPC3, SSPC4, SSPC5, SSPC6, SSPC7, SCN2, SCN3, SCN6, SCN8, SCN11, SCN12, SCN13, SCN1, SCN5, SCN7, SCN10, SC1, SC2, SC3, SC4, SC5, SC6 и SC7, в комбинации, по меньшей мере, с одним из олигонуклеотидов, комплементарных человеческим генам по изобретению, указанных выше, также представляет собой композицию, включенную в объем настоящего изобретения.

Особенно предпочтительно, чтобы олигонуклеотиды, которые составляют часть композиции по изобретению, были связаны с твердой подложкой. В частности, предпочтительны те из указанных композиций, в которых распределение олигонуклеотидов на твердой подложке имеет упорядоченную форму, ввиду чего твердая подложка представляет собой прямоугольный кусочек стекла, подобный предметному стеклу микроскопа, и чтобы олигонуклеотиды были связаны со стеклом ковалентными связями; композиции, которые соответствуют указанным характеристикам, в остальной части описания именуются словами «микрочип», «чип» или «микропанель». Среди этих композиций в форме микрочипа особое предпочтение отдается тем, которые содержат более чем одну копию каждого из олигонуклеотидов, которые образуют ее часть, причем особенно предпочтительно, чтобы количество копий каждого из присутствующих олигонуклеотидов составляло, по меньшей мере, 12.

Объем изобретения также включает любое диагностическое устройство, которое включает композицию по изобретению. Выражение «диагностическое устройство» относится не только к устройству, которое служит для определения того, страдает ли индивидуум заболеванием или нет, но также к тем устройствам, которые служат для классификации заболевания, имеющегося у индивидуума, как относящегося к подтипу, связанному с определенной формой будущего развития указанного заболевания, и которое поэтому также имеет прогностическую ценность в отношении будущего развития заболевания.

Изобретение также предоставляет способ диагностики неоплазии, происходящей из гематопоэтических клеток, и/или составления прогноза его развития, который включает выявление in vitro из биологического образца и статистический анализ уровня экспрессии, по меньшей мере, одного значимого гена для классификации образца как связанного или не связанного с указанной неоплазией, гена, который выбран из группы, состоящей из GABARAP, NPM3, ABCB1, ABCB4, ABCC3, ABCC5, ABCC6, ABHD1, ABL1, ACTN1, AF1q, AKR1A1, ALDH1A1, ALK, ANK2, ANPEP, ANXA6, ANXA7, APAF1, APEX, ARHGEF2, ARS2, ASNS, ATIC, ATM, ATP5O, BAX, BCL10, BCL2, BCL2A1, BCL2L1, BCL2LAA, BCL3, BCL6, BCL7A, BCL7b, BCR, BECN1, BIK, BIRC3, BIRC5, BLMH, BLR1, BLVRB, BMI1, BMP6, BRMS1, BST2, BTG1, BUB1, C21orf33, C5orfl3, CA12, CALD1, CANP2, CASC3, CASP1, CASP3, CASP4, CASP5, CASP6, CASP7, CASP8, CASP9, CAST, CATSD, CBFA2T1, CBFB, CCNA1, CCNB1, CCND1, CCND2, CCND3, CCNE1, CCR6, CCR7, CCT6A, CD14, CD19, CD2, CD22, CD24, CD28, CD33, CD34, CD36, CD38, CD3E, CD4, CD44, CD47, CD48, CD5, CD58, CD59, CD6, CD7, CD79A, CD79B, CD8, CD81, CD83, CD86, CD9, CDA, CDC25A, CDC25B, CDK2, CDK4, CDK5R1, CDKN1A, CDKN1B, CDKN1C, CDKN2A, CDKN2B, CDKN2C, CDKN3, CDW52, CEBPA, CEBPB, CEBPD, CFL1, CKMT1, CKS2, CML66, COL3A1, COL4A6, CR2, CREB1, CREBBP, CRYAB, CSF2, CSF3, CSRP2, CTGF, CTSB, CUZD1, CXADR, CXCL9, CXCR3, CXCR4, CYC1, CYP1A1, CYP2A6, DAD-1, DAPK1, DCK, DDX6, DEK, DHFR, DLAD, DNAJA1, DNMT3B, DNTT, DOK1, DPF2, DPP4, DRG1, DRP2, E2F1, EB-1, EBI2, EDF1, EEF1A1, EEF1B2, EEF1D, EEF1G, EFNB1, EGFR, EGR1, EIF2B2, EIF3S2, EIF4B, EIF4E, EIF5A, ELF1, ELF4, ENPP1, EphA3, EPOR, ERBB2, ERBB4, ERCC1, ERCC2, ERCC3, ERCC5, ERCC6, ETS1, ETS2, ETV6, ETV7, EZH2, FABP5, FADD, FAIM3, FAM38A, FARP1, FAT, FCER2, FCGR3A, FCGR3B, FGFR1, FGFR3, FGR, FHIT, FKBP9, FLI1, FLJ22169, FLT3, FN1, FNTB, FOS, FUS, G1P2, GABPB2, GATA1, GATA2, GATA3, GCET2, GDI2, GGA3, GJA1, GLUD1, GNL3, GOT1, GRB2, GRIA3, GRK4, GSTP1, GSTT1, GUSB, GZMA, H2AFX, H3F3A, HCK, HELLS, HIF1A, HIST1H2BN, HLA-A, HLA-DPA1, HLA-DQA1, HLA-DRA, HLA-DRB3, HLF, HMMR, HNRPH3, HNRPL, HOXA10, HOXA9, HOXD8, HOXD9, HRAS, HSD17B1, HSPB1, IBSP, ICAM1, ICAM3, ID2, IER3, IFRD1, IGFBP2, IGFBP3, IGFIR, IGLV6-57, IL10, IL15, IL1B, IL2, IL2RA, IL3, IL32, IL3RA, IL4R, IL6, IL6R, IL8, ILF2, IRF1, IRF2, IRF4, IRF8, ITGA2, ITGA3, ITGA4, ITGA5, ITGA6, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, JAK1, JAK2, JUNB, KAI1, KIAA0247, KIAA0864, KIT, KLF1, KLF13, KRAS2, KRT18, LADH, LAG3, LASP1, LCK, LCP1, LEPR, LGALS3, LGALS7, LIF, LIMS1, LMO2, LOC285148, LRP, LSP1, LYL1, LYN, LYZ, MAFB, MAFK, MAGEA1, MAL, MAP3K12, MAP4K1, MAPK10, MAZ, MBP1, MCL1, MCM3, MCM7, MDM2, MEIS1, MEN1, MERTK, MKI67, MLF1, MLF2, MLL, MLLT10, MME, MMP2, MMP7, MMP8, MMP9, MNDA, MPL, MPO, MRPL37, MS4A1, MTCP1, MUC-1, MX1, MYB, MYBL1, MYC, MYOD1, NCALD, NCAM1, NCL, NDP52, NDRG1, NDUFA1, NDUFB, NF1, NFATC1, NFIC, NFKB1, NFKB1A, NINJ1, NPM1, NR3C1, NUMA1, NXF1, ODC1, OGGI, OLIG2, OPRD1, p14ARF, P55CDC, PABPC1, PAX5, PAX6, PAX8, PBX1, PBX3, PCA1, PCD, PCNA, PDCD1, PDGFA, PDGFRB, PDHA1, PGF, PGRMC1, PICALM, PLA2G6, PLAU, PLK1, PLP, PLS3, PLZF, PML, PMM1, POLR2C, POU2F2, PPP1CC, PRAME, PRKCI, PRKCQ, PRKDC, PRL, PRTN3, PSMA5, PSMB4, PSMC5, PSMD7, PTEN, PTGS1, PTHLH, PTK2, PTK2B, PTN, PTPRCCD, PYGB, RAD51, RAF1, RAG1, RARA, RARB, RB1, RBBP4, RBBP6, RBBP8, RBP4, RET, RGS1, RGS1, RIS1, RORA, RPL17, RPL23A, RPL24, RPL36A, RPL37A, RPL41, RPS3, RPS5, RPS9, RUNX1, RXRA, S100A2, S100A8, SDC1, SDHD, SELE, SELL, SEPW1, SERPINA9, SERPINB5, SERPNINA9, SFTPB, SIAT4A, SLC7A5, SNRPB, SOSTDC1, SP1, SPI1, SPN, SPRR1A, SREBF1, SSBP1, STAT1, STAT3, STAT5B, SUMO1, TACSTD2, TAGLN2, TAL1, TBP, TCEB1, TCF1, TCF3, TCF7, TCL1A, TCRbeta, TEGT, TERF1, TERT, TFCP2, TFRC, THBS1, THPO, TIA-2, TIAM1, TK1, TLX1, TMEM4, TNF, TNFRSF10C, TNFRSF1A, TNFRSF25, TNFRSF5, TNFRSF6, TNFRSF8, TNFSF10, TNFSF5, TNFSF6, TOP2A, TOPORS, TP73, TRA@, TRADD, TRAF3, TRAP1, TRIB2, TXNRD1, UBE2C, UHRF1, UVRAG, VCAM1, VEGF, VPREB1, WBSCR20C, WNT16, WT1, XBP1, XPO6, XRCC3, XRCC5, ZAP70, ZFPL1, ZNF42, ZNFN1A1, ZYX, 18S рРНК, 28S рРНК, и уровень экспрессии которого определяется оценкой концентрации его соответствующей мРНК использованием, по меньшей мере, одного зонда, который имеет последовательность, комплементарную фрагменту нити указанного гена, причем зонд выбран из группы олигонуклеотидов, состоящей из:

SG1, SG2, SG3, SG4, SG5, SG6, SG7, SG8, SG9, SG10, SG11, SG12, SG13, SG14, SG15, SG16, SG17, SG18, SG19, SG20, SG21, SG22, SG23, SG24, SG25, SG26, SG27, SG28, SG29, SG30, SG31, SG32, SG33, SG34, SG35, SG36, SG37, SG38, SG39, SG40, SG41, SG42, SG43, SG44, SG45, SG46, SG47, SG48, SG49, SG50, SG51, SG52, SG53, SG54, SG55, SG56, SG57, SG58, SG59, SG60, SG61, SG62, SG63, SG64, SG65, SG66, SG67, SG68, SG69, SG70, SG71, SG72, SG73, SG74, SG75, SG76, SG77, SG78, SG79, SG80, SG81, SG82, SG83, SG84, SG85, SG86, SG87, SG88, SG89, SG90, SG91, SG92, SG93, SG94, SG95, SG96, SG97, SG98, SG99, SG100, SG101, SG102, SG103, SG104, SG105, SG106, SG107, SG108, SG109, SG110, SG111, SG112, SG113, SG114, SG115, SG116, SG117, SG118, SG119, SG120, SG121, SG122, SG123, SG124, SG125, SG126, SG127, SG128, SG129, SG130, SG131, SG132, SG133, SG134, SG135, SG136, SG137, SG138, SG139, SG140, SG141, SG142, SG143, SG144, SG145, SG146, SG147, SG148, SG149, SG150, SG151, SG152, SG153, SG154, SG155, SG156, SG157, SG158, SG159, SG160, SG161, SG162, SG163, SG164, SG165, SG166, SG167, SG168, SG169, SG170, SG171, SG172, SG173, SG174, SG175, SG176, SG177, SG178, SG179, SG180, SG181, SG182, SG183, SG184, SG185, SG186, SG187, SG188, SG189, SG190, SG191, SG192, SG193, SG194, SG195, SG196, SG197, SG198, SG199, SG200, SG201, SG202, SG203, SG204, SG205, SG206, SG207, SG208, SG209, SG210, SG211, SG212, SG213, SG214, SG215, SG216, SG217, SG218, SG219, SG220, SG221, SG222, SG223, SG224, SG225, SG226, SG227, SG228, SG229, SG230, SG231, SG232, SG233, SG234, SG235, SG236, SG237, SG238, SG239, SG240, SG241, SG242, SG243, SG244, SG245, SG246, SG247, SG248, SG249, SG250, SG251, SG252, SG253, SG254, SG255, SG256, SG257, SG258, SG259, SG260, SG261, SG262, SG263, SG264, SG265, SG266, SG267, SG268, SG269, SG270, SG271, SG272, SG273, SG274, SG275, SG276, SG277, SG278, SG279, SG280, SG281, SG282, SG283, SG284, SG285, SG286, SG287, SG288, SG289, SG290, SG291, SG292, SG293, SG294, SG295, SG296, SG297, SG298, SG299, SG300, SG301, SG302, SG303, SG304, SG305, SG306, SG307, SG308, SG309, SG310, SG311, SG312, SG313, SG314, SG315, SG316, SG317, SG318, SG319, SG320, SG321, SG322, SG323, SG324, SG325, SG326, SG327, SG328, SG329, SG330, SG331, SG332, SG333, SG334, SG335, SG336, SG337, SG338, SG339, SG340, SG341, SG342, SG343, SG344, SG345, SG346, SG347, SG348, SG349, SG350, SG351, SG352, SG353, SG354, SG355, SG356, SG357, SG358, SG359, SG360, SG361, SG362, SG363, SG364, SG365, SG366, SG367, SG368, SG369, SG370, SG371, SG372, SG373, SG374, SG375, SG376, SG377, SG378, SG379, SG380, SG381, SG382, SG383, SG384, SG385, SG386, SG387, SG388, SG389, SG390, SG391, SG392, SG393, SG394, SG395, SG396, SG397, SG398, SG399, SG400, SG401, SG402, SG403, SG404, SG405, SG406, SG407, SG408, SG409, SG410, SG411, SG412, SG413, SG414, SG415, SG416, SG417, SG418, SG419, SG420, SG421, SG422, SG423, SG424, SG425, SG426, SG427, SG428, SG429, SG430, SG431, SG432, SG433, SG434, SG435, SG436, SG437, SG438, SG439, SG440, SG441, SG442, SG443, SG444, SG445, SG446, SG447, SG448, SG449, SG450, SG451, SG452, SG453, SG454, SG455, SG456, SG457, SG458, SG459, SG460, SG461, SG462, SG465, SG468, SG469, SG470, SG471, SG472, SG473, SG474, SG475, SG476, SG477, SG478, SG479, SG480, SG481, SG482, SG483, SG484, SG485, SG486, SG487, SG488, SG489, SG490, SG491, SG492, SG493, SG494, SG495, SG496, SG497, SG498, SG499, SG500, SG501, SG502, SG503, SG504, SG505, SG506, SG507, SG508, SG509, SG510, SG511, SG512, SG513, SG514, SG515, SG516, SG517, SG518, SG519, SG520, SG521, SG522, SG523, SG524, SG525, SG526, SG527, SG428, SG529, SG530, SG531, SG532, SG533, SG534, SG535, SG536, SG537, SG538, SG539, SG540, SG541, SG542, SG543, SG544, SG545, SG546, SG547, SG548, SG549, SG550, SG551, SG552, SG553, SG554, SG555, SG556, SG557, SG558, SG559, SG560, SG561, SG562, SG563.

Гены, которые образуют часть указанной выше группы, представляют собой человеческие гены. Поэтому, когда ниже используются слова «субъект» или «индивидуум», они будут указывать на человека.

Особый случай настоящего способа представляет собой тот, который включает дополнительную предварительную стадию идентификации генов, значимых для классификации биологического образца, анализируемого как связанного или не связанного с определенным типом неоплазии, происходящей из гематопоэтических клеток, классификации, которая включает не только диагноз существования указанной неоплазии у индивидуума, у которого был взят образец, но который может также состоять, в дополнительной или альтернативной форме, из различения между определенными подтипами указанной неоплазии, которые соответствуют различным будущим формам развития указанной неоплазии, что составляет классификацию одного или другого подтипа развития неоплазии, рассматриваемой в будущем. В этом конкретном случае способа по изобретению, который включает предварительную стадию идентификации генов, значимых для составления желаемой классификации, указанная предварительная стадия включает стадии:

а) выявления возможных категорий, в которых может классифицироваться образец;

b) получения биологических образцов у индивидуумов, которые ранее были способом, отличным от заявляемого, отнесены к любой из возможных категорий классификации так, чтобы были образцы каждой из возможных категорий;

с) получения общей мРНК каждого из образцов;

d) получения соответствующей общей кРНК, меченной способом, который обеспечивает возможность последующего выявления, по меньшей мере, одной аликвоты каждого из образцов мРНК, в которую перед получением крДНК добавляется, по меньшей мере, одна последовательность полиаденилированных нуклеотидов с низкой гомологией с человеческими генами, для которых он действует в качестве внутреннего положительного контроля процесса;

е) добавления к одной из аликвот кРНК, которые подлежат использованию на стадии f), по меньшей мере, одного олигонукелеотида с низкой гомологией с человеческими генами, отличного от любой возможной последовательности нуклеотидов, которые были добавлены на стадии d), и не комплементарные им, для которых он действует в качестве положительного контроля гибридизации;

f) гибридизации в жестких условиях, по меньшей мере, одной аликвоты общей крДНК каждого из образцов, по меньшей мере, с одним микрочипом, который включает, по меньшей мере, 2 копии каждого из олигонуклеотидов из группы, состоящей из:

SG1, SG2, SG3, SG4, SG5, SG6, SG7, SG8, SG9, SG10, SG11, SG12, SG13, SG14, SG15, SG16, SG17, SG18, SG19, SG20, SG21, SG22, SG23, SG24, SG25, SG26, SG27, SG28, SG29, SG30, SG31, SG32, SG33, SG34, SG35, SG36, SG37, SG38, SG39, SG40, SG41, SG42, SG43, SG44, SG45, SG46, SG47, SG48, SG49, SG50, SG51, SG52, SG53, SG54, SG55, SG56, SG57, SG58, SG59, SG60, SG61, SG62, SG63, SG64, SG65, SG66, SG67, SG68, SG69, SG70, SG71, SG72, SG73, SG74, SG75, SG76, SG77, SG78, SG79, SG80, SG81, SG82, SG83, SG84, SG85, SG86, SG87, SG88, SG89, SG90, SG91, SG92, SG93, SG94, SG95, SG96, SG97, SG98, SG99, SG100, SG101, SG102, SG103, SG104, SG105, SG106, SG107, SG108, SG109, SG110, SG111, SG112, SG113, SG114, SG115, SG116, SG117, SG118, SG119, SG120, SG121, SG122, SG123, SG124, SG125, SG126, SG127, SG128, SG129, SG130, SG131, SG132, SG133, SG134, SG135, SG136, SG137, SG138, SG139, SG140, SG141, SG142, SG143, SG144, SG145, SG146, SG147, SG148, SG149, SG150, SG151, SG152, SG153, SG154, SG155, SG156, SG157, SG158, SG159, SG160, SG161, SG162, SG163, SG164, SG165, SG166, SG167, SG168, SG169, SG170, SG171, SG172, SG173, SG174, SG175, SG176, SG177, SG178, SG179, SG180, SG181, SG182, SG183, SG184, SG185, SG186, SG187, SG188, SG189, SG190, SG191, SG192, SG193, SG194, SG195, SG196, SG197, SG198, SG199, SG200, SG201, SG202, SG203, SG204, SG205, SG206, SG207, SG208, SG209, SG210, SG211, SG212, SG213, SG214, SG215, SG216, SG217, SG218, SG219, SG220, SG221, SG222, SG223, SG224, SG225, SG226, SG227, SG228, SG229, SG230, SG231, SG232, SG233, SG234, SG235, SG236, SG237, SG238, SG239, SG240, SG241, SG242, SG243, SG244, SG245, SG246, SG247, SG248, SG249, SG250, SG251, SG252, SG253, SG254, SG255, SG256, SG257, SG258, SG259, SG260, SG261, SG262, SG263, SG264, SG265, SG266, SG267, SG268, SG269, SG270, SG271, SG272, SG273, SG274, SG275, SG276, SG277, SG278, SG279, SG280, SG281, SG282, SG283, SG284, SG285, SG286, SG287, SG288, SG289, SG290, SG291, SG292, SG293, SG294, SG295, SG296, SG297, SG298, SG299, SG300, SG301, SG302, SG303, SG304, SG305, SG306, SG307, SG308, SG309, SG310, SG311, SG312, SG313, SG314, SG315, SG316, SG317, SG318, SG319, SG320, SG321, SG322, SG323, SG324, SG325, SG326, SG327, SG328, SG329, SG330, SG331, SG332, SG333, SG334, SG335, SG336, SG337, SG338, SG339, SG340, SG341, SG342, SG343, SG344, SG345, SG346, SG347, SG348, SG349, SG350, SG351, SG352, SG353, SG354, SG355, SG356, SG357, SG358, SG359, SG360, SG361, SG362, SG363, SG364, SG365, SG366, SG367, SG368, SG369, SG370, SG371, SG372, SG373, SG374, SG375, SG376, SG377, SG378, SG379, SG380, SG381, SG382, SG383, SG384, SG385, SG386, SG387, SG388, SG389, SG390, SG391, SG392, SG393, SG394, SG395, SG396, SG397, SG398, SG399, SG400, SG401, SG402, SG403, SG404, SG405, SG406, SG407, SG408, SG409, SG410, SG411, SG412, SG413, SG414, SG415, SG416, SG417, SG418, SG419, SG420, SG421, SG422, SG423, SG424, SG425, SG426, SG427, SG428, SG429, SG430, SG431, SG432, SG433, SG434, SG435, SG436, SG437, SG438, SG439, SG440, SG441, SG442, SG443, SG444, SG445, SG446, SG447, SG448, SG449, SG450, SG451, SG452, SG453, SG454, SG455, SG456, SG457, SG458, SG459, SG460, SG461, SG462, SG465, SG468, SG469, SG470, SG471, SG472, SG473, SG474, SG475, SG476, SG477, SG478, SG479, SG480, SG481, SG482, SG483, SG484, SG485, SG486, SG487, SG488, SG489, SG490, SG491, SG492, SG493, SG494, SG495, SG496, SG497, SG498, SG499, SG500, SG501, SG502, SG503, SG504, SG505, SG506, SG507, SG508, SG509, SG510, SG511, SG512, SG513, SG514, SG515, SG516, SG517, SG518, SG519, SG520, SG521, SG522, SG523, SG524, SG525, SG526, SG527, SG428, SG529, SG530, SG531, SG532, SG533, SG534, SG535, SG536, SG537, SG538, SG539, SG540, SG541, SG542, SG543, SG544, SG545, SG546, SG547, SG548, SG549, SG550, SG551, SG552, SG553, SG554, SG555, SG556, SG557, SG558, SG559, SG560, SG561, SG562, SG563, где микрочип дополнительно содержит:

а. по меньшей мере, 2 точки, которые соответствуют различным аликвотам растворителя, в котором нуклеотиды обнаруживаются во время их расположения на поверхности микрочипа, для которого они служат в качестве контроля;

b. по меньшей мере, 2 копии, по меньшей мере, одного олигонуклеотида для каждой из полиаденилированных последовательностей, добавленных на стадии d), последовательность которого будет соответствовать фрагменту, отличному от зоны полиаденилирования последовательности полиаденилированных нуклеотидов, развитие которого в процессе подлежит контролю;

с. для каждого из олигонуклеотидов, добавленных на стадии е), по меньшей мере, 2 копии олигонуклеотида, комплементарного им;

d. по меньшей мере, 2 копии каждого члена, по меньшей мере, одной пары олигонуклеотидов, где последовательность одного из членов соответствует последовательности зоны 5', а последовательность другого соответствует последовательности зоны 3' мРНК гена, который экспрессируется в конститутивной форме в любой клетке гематопоэтического происхождения;

е. по меньшей мере, 2 копии, по меньшей мере, одного олигонуклеотида с низкой гомологией с человеческими генами, отличного от любого из олигонуклеотидов, определенных в п.b, и отличного от любого из синтетических олигонуклеотидов, необязательно добавленных на стадии е);

g) выявления и количественного определения сигнала кРНК, гибридизированной с каждой из копий каждого из олигонуклеотидов, присутствующих в микрочипе, а также сигнала, соответствующего точкам растворителя;

h) расчета среднего уровня интенсивности гибридизации каждого из олигонуклеотидов микрочипа расчетом средней величины интенсивности копий каждого из олигонуклеотидов;

i) оценки гибридизации как состоявшейся, если выполняются следующие условия:

а. соотношение между средней интенсивностью и средним фоном всех олигонуклеотидов микрочипа составляет больше чем 10;

b. величина среднего коэффициента вариации всех повторений олигонуклеотидов должна быть менее чем 0,3;

с. средняя величина отрицательного контроля должна быть в 2,5 раза меньше, чем средняя величина точек, соответствующих растворителю;

d. имеется сигнал и в контролях гибридизации, и во внутренних положительных контролях, используемых в качестве контроля процесса;

j) нормализации данных;

k) устранения олигонуклеотидов с величинами средней интенсивности минус средний фоновый шум приблизительно в 2 раза меньше, чем средняя величина, полученная в точках, соответствующих растворителю, а также олигонуклеотидов с межквантильным диапазоном нормализованной интенсивности по образцам менее чем 0,3;

l) выполнения статистического анализа для обнаружения статистически значимых олигонуклеотидов с целью дифференциации между различными категориями и возможности классификации образца, который ранее не был отнесен к какой-либо категории, выбора указанных олигонуклеотидов среди олигонуклеотидов, которые не были устранены на предыдущих стадиях, до получения “n” олигонуклеотидов, которые или имеют величину р менее чем предел, который выбран из открытого интервала от 0 до 0,05, предпочтительно с использованием для этого способа, способного снизить ложно положительные результаты, или того, который лучше всего определяет установленную категорию;

m) проверки того, что группировка образцов в соответствии с различиями величин интенсивности между различными образцами, выявленными для статистически значимых олигонуклеотидов, обеспечивает получение образцов, классифицированных в те же категории, что и образцы, которые были ранее отнесены к ней другим способом.

Предпочтительно, чтобы средняя величина, рассчитанная в пункте h), представляла собой уравновешенную среднюю, и по этой причине предпочтительно, чтобы микрочип включал, по меньшей мере, 4 копии каждого из присутствующих в нем олигонуклеотидов.

Нормализацию можно проводить различными способами. Предпочтительно использование функций, содержащихся в свободно доступных пакетах в Интернете, предназначенных для обработки, расчета и графического представления данных, таких как пакеты, обозначенные на языке программирования R, доступные для загрузки из сайтов CRAN (http://cran.r-project.org/) или Bioconductor (http://www.bioconductor.org). Метод «стабилизации нормализации дисперсии» имеется в пакете “vsn” на языке программирования R.

Идентификацию статистически значимых олигонуклеотидов для дифференциации между различными категориями можно проводить, используя различные методы, с предпочтением тех, где определяется величина р, которая определяет порог вероятности, ниже которого все гены, чья разность экспрессии имеет величину, меньше чем р, считались бы значимыми, и среди них те, которые имеют способность проводить коррекции величины р, такие как, среди других, метод Bonferroni или критерий Welch. Величина р должна выбираться из открытого интервала от 0 до 0,05, отдавая, где возможно, предпочтение величине р, близкой к 0,001 и с коррекцией, причем она способна увеличить указанную величину максимум до 0,05 (величины, которая не включена в возможные величины), до которой обнаруживается, что статистически значимые олигонуклеотиды дифференцируются между категориями, среди которых желательна классификация образцов. Одной из возможностей проведения этих расчетов снова является использование функций, содержащихся в пакетах, свободно доступных через Интернет, предназначенных для обработки, расчета и графического представления данных. В частности, функцию mt.maxT пакета multtest на языке R можно использовать для идентификации статистически значимых олигонуклеотидов.

Другой возможностью для идентификации статистически значимых олигонуклеотидов, которая способна дифференцировать между категориями установленных образцов, является использование метода «ближайших сжатых центроидов» (Tibshirani et al., 2002), который идентифицирует группу генов, которые наилучшим образом характеризуют предварительно определенный класс, и использует эту группу генов для прогноза класса, к которому относятся новые образцы. Для этого можно снова обратиться к функциям, содержащимся в свободно доступных в Интернете пакетах, таких как пакет “pama” на языке R, где можно найти функции для проведения так называемого «Прогностического анализа для микрочипов (РАМ)», в котором используется метод «ближайших сжатых центроидов».

После идентификации статистически значимых генов для дифференцировки между категориями образцов, установленных по соответствующим олигонуклеотидам, эти гены можно использовать для классификации новых образцов ввиду подобия между профилем экспрессии этих генов в анализируемом образце и генов, соответствующих каждой из категорий классификации. Альтернативно, когда имеются только 2 возможные категории классификации (что будет нормально при желании диагностировать присутствие или отсутствие определенного типа лейкоза у индивидуума), то можно получить математическую функцию классификации образцов, которые определяют вероятность “pi” образца “i”, относящегося к одной или другой категории. Для этого выбирается субъединица образцов, которые ранее были отнесены к каждой одной из возможных категорий, методом, отличным от метода по изобретению, и величина 0 произвольно связывается с каждым из образцов одной из категорий “а” (обычно, категории, «не» связанной с лейкозом, который желательно диагностировать), относящимся к другой возможной категории, в то время как каждый из образцов субъединицы, относящейся к другой возможной категории “b” (обычно, категории, «связанной» с лейкозом, который желательно диагностировать), произвольно получает величину «1» за вероятность его отношения к его собственной категории. При этом для расчета используется логистическая регрессия, с помощью величин вероятности, отнесенных к каждому из образцов, и величины нормализованной упорядоченной средней интенсивности, полученной для каждого из образцов с каждым из “n” олигонуклеотидов, которые были идентифицированы в качестве статистически значимого олигонуклеотида на предыдущей стадии, коэффициенты для каждого из указанных олигонуклеотидов, которые обеспечивают возможность получения функции вероятности pi образца ”i”, относящегося к категории “b”, функция, которая будет типа

pi=1/(1+e-xi)

и которая получена в результате алгебраического преобразования выражения, которое уравнивает натуральный логарифм частного между вероятностью происходящего явления и вероятностью, что оно не произойдет при функции xi, которая включает в качестве переменных величин каждый из факторов, который может оказать влияние на явление, т.е.

ln,

функции xi, которая в настоящем случае будет зависеть от величин интенсивности, полученных для каждого из статистически значимых олигонуклеотидов и которая реагирует на выражение типа:

xi=константа+,

где

coeff_oligm представляет коэффициент, рассчитанный для определенного олигонуклеотида “m”;

Imni_oligm представляет среднюю величину нормализованной интенсивности, полученную при гибридизации образца i, рассчитанную для олигонуклеотида “m”;

“m” варьируется от 1 до “n”;

n представляет собой общее число олигонуклеотидов, которые считаются значимыми.

Функция pi, полученная после расчета логистической регрессией коэффициента, соответствующего каждому олигонуклеотиду, позволяет классифицировать образец “i” как относящийся к одной или другой категории, считая, что величины pi более 0,5 (и которые будут менее или равны 0) указывают на то, что образец относится к категории “b”, тогда как величины pi менее чем 0,5 указывают на то, что образец относится к категории «а». Указанная функция pi будет рассматриваться как имеющая силу, если после применения к образцам, из которых она была выведена, она способна правильно их классифицировать, и, кроме того, поскольку она применена к подгруппе образцов, которые не принимались во внимание для выведения этой функции, но чья категория, как известно, была ранее определена способом, отличным от способа по изобретению, она также способна правильно их классифицировать.

Альтернативно, когда идентификация статистически значимых генов выполнялась с использованием способа «Прогностического анализа для микрочипов», может быть получен классификатор с соответствующими функциями пакета “pamra” в R, который также начинается с отнесения величины вероятности 0 к подгруппе членов одной из категорий и величины вероятности 1 к подгруппе членов другой категории. И снова, расчет коэффициентов для статистически значимых олигонуклеотидов позволяет классифицировать величины вероятности принадлежности к одной или другой категории, также считая, что величины более 0,5 указывают на принадлежность к категории, членам которой произвольно присвоена величина 1, и величины менее чем 0,5 указывают на принадлежность к другой категории.

Особый случай способа по изобретению представляет собой тот, где желательна классификация образцов как связанных или не связанных с типом лейкоза. В этом случае предпочтительны образцы крови, в частности образцы периферической крови, в качестве биологических образцов для проведения способа in vitro по изобретению.

После того как были идентифицированы статистически значимые гены, связанные с определенным типом неоплазии как происходящей из гематопоэтических клеток, способ по изобретению можно использовать для классификации образцов в соответствии с уровнем экспрессии указанных генов в указанных образцах. Неоплазия может представлять собой, например, определенный тип лейкоза. Конкретный случай этого варианта осуществления способа по изобретению заключается в установлении связи с хроническим лимфолейкозом, таким образом, обеспечивая возможность диагностики заболевания способом по изобретению. Для этого значимыми генами считаются те гены, уровень экспрессии которых анализируется после применения способа по изобретению, по меньшей мере, генов групп CD79A, FAIM3, HLA-DRA, HLA-DRB3, HLA-DQA1, и анализ проводится на образцах крови. Способ можно, кроме того, применять, включая анализ уровня экспрессии, по меньшей мере, генов IRF8 и COL3A1. Предпочтительно анализ уровня экспрессии этих генов проводится оценкой уровня их соответствующих мРНК гибридизацией их соответствующих кРНК с олигонуклеотидами SG117, SG428, SG459, SG507, SG508, SG461 и SG493, которые предпочтительно должны быть связаны с твердой подложкой, образуя часть микрочипа. Когда оценка гибридизированной кРНК с каждым из этих олигонуклеотидов проводится, благодаря предшествующему мечению кРНК биотином, окрашиванием гибридизированного микрочипа, стрептавидином, сопряженно связанным с флуорофором, и выявлением сигнала, испускаемого указанным флуорофором, то предпочтительно, чтобы флуорофор представлял собой Су3, который позволяет диагностировать присутствие CLL у субъекта, у которого был взят образец, путем классификации образца “i”, анализированного как связанного с CLL, по расчету вероятности того, что указанный образец связан с CLL, по формуле pi=1/(1+e-xi), где xi рассчитывается по формуле

xi=-719,241486+(2,44756372*Imni_CD79A)+(7,38657611*Imni_FAIM3)+(23,1465464*Imni_HLA-DRA)+(43,6287742*Imni_IRF8)-(19,3978182*Imni_COL3A1)-(2,80282646*Imni_HLA-DRB3)+(49,5345672*Imni_HLA-DQA1),

формуле, где каждая из величин, обозначенных аббревиатурой “Imni”, с последующей аббревиатурой гена указывает среднюю величину нормализованной интенсивности, полученную после выявления сигнала гибридизации, соответствующего олигонуклеотиду, который используется в качестве зонда для оценки экспрессии указанного гена,

и которая позволяет классифицировать субъекта как субъекта, не страдающего CLL, если величина pi меньше, чем 0,5, и как субъекта, страдающего CLL, если величина pi больше чем 0,5.

Альтернативно значимыми генами можно считать гены, уровень экспрессии которых анализируется с применением способа по изобретению для диагностики CLL, по меньшей мере, гены группы CD79A, FAIM3, HLA-DRA, HLA-DRB3, HLA-DQA1, дополнительно включая анализ уровня экспрессии, по меньшей мере, гена CDW52. Предпочтительно анализ уровня экспрессии этих генов проводится оценкой уровня их соответствующей мРНК гибридизацией их соответствующей кРНК с олигонуклеотидами SG117, SG428, SG459, SG507, SG508 и SG237, которые предпочтительно связаны с твердой подложкой, образуя часть микрочипа.

Другой конкретный случай применения способа по изобретению для классификации образцов как связанных с определенным типом лейкоза в соответствии с уровнем экспрессии в указанных образцах статистически значимых генов составляет классификацию образца как связанного с определенным подтипом хронического лимфолейкоза, «стабильным» CLL или «прогрессирующим» CLL, что делает возможным использовать способ по изобретению для составления прогноза будущего развития заболевания у субъектов, у которых был диагностирован CLL. Если анализируемые образцы получены из периферической крови, то гены, которые считают статистически значимыми для выполнения классификации образцов, представляют собой, по меньшей мере, гены PSMB4, FCER2 и POU2F2. Причем возможен дополнительный анализ уровня экспрессии, по меньшей мере, одного гена, выбранного из группы, состоящей из ODC1, CD79A, CD2, CD3E, CD5, MS4A1, EIF4E, FHIT, NR3C1, LCP1, MAPK10, ABCC5, XRCC3, CML66, PLZF, RBP4 или их полностью.

Дополнительный аспект изобретения представляет собой использование устройств для оценки уровня экспрессии, по меньшей мере, одного из генов из группы, состоящей из PSMB4, FCER2, POU2F2, ODC1, CD79A, CD2, CD3E, CD5, MS4A1, EIF4E, FHIT, NR3C1, LCP1, MAPK10, ABCC5, XRCC3, CML66, PLZF, RBP4, CD79A, FAIM3, HLA-DRA, HLA-DRB3, HLA-DQA1, IRF8 и COL3A1, с целью диагностики присутствия CLL у индивидуума и/или составления прогноза развития у него/нее заболевания. Конкретный случай этого аспекта изобретения представляет собой использование устройств оценки уровня экспрессии, по меньшей мере, одного гена из группы, состоящей из CD79A, FAIM3, HLA-DRA, HLA-DRB3, HLA-DQA1, IRF8 и COL3A1, для диагностики присутствия CLL у индивидуума, где предпочтительно, чтобы устройство оценивало, по меньшей мере, уровень экспрессии генов CD79A, FAIM3, HLA-DRA, HLA-DRB3, HLA-DQA1, причем дополнительно возможна была оценка устройством уровня экспрессии, по меньшей мере, генов IRF8 и COL3A1 или, по меньшей мере, гена CDW52. Другим конкретным случаем этого аспекта изобретения является использование устройств оценки уровня экспрессии, по меньшей мере, одного гена из группы, состоящей из PSMB4, FCER2, POU2F2, ODC1, CD79A, CD2, CD3E, CD5, MS4A1, EIF4E, FHIT, NR3C1, LCP1, MAPK10, ABCC5, XRCC3, CML66, PLZF, RBP4, CD79A, FAIM3, HLA-DRA, HLA-DRB3, HLA-DQA1, IRF8 и COL3A1, для составления прогноза будущего развития CLL у индивидуума.

Детальное описание изобретения: конструкция устройства микрочипа

Гены, включенные в микрочип

Была выполнена ревизия научной литературы, и гены были выбраны ввиду их особого участия в биологии клеток крови или в патологии различных неоплазий. Выбранные гены можно включить в эти 4 большие группы:

а) Играющие важную роль в биологии гематопоэтических клеток:

- Гены, чей белок экспрессирован или репрессирован на различных стадиях, через которые эти клетки проходят при их дифференциации в зрелые формы.

- Гены, чей белок специфически экспрессирован в соответствии с линией, к которой относится клетка.

- Гены, которые кодируют адгезионные молекулы.

b) Участвуют в различных типах гематологических неоплазий:

- Гены, чья экспрессия (уровень мРНК или белка) изменена при различных типах неоплазий, или связанные с устойчивостью к химиотерапии.

с) Связанные с раком:

- Гены, которые кодируют белки, связанные с пролиферацией, метастазированием, или гены, чья экспрессия увеличена в большом количестве опухолей.

d) Описанные в публикациях, относящихся к неоплазиям:

- Гены, которые, не имея особого отношения к гематологическим неоплазиям или биологии клеток крови, появились в научной литературе как статистически связанные с типом неоплазии.

По характеристикам генов можно проконсультироваться, например, на сайте: http://www.ncbi.nlm.nih.gov/Genbank, выбрав опцию «Ген» в «падающем» меню, которое появляется, и введя соответствующий идентификационный номер (GenID) в GenBank. Гены, чью экспрессию можно анализировать микрочипом, их соответствующий идентификационный номер в GenBank, а также олигонуклеотиды, присутствующие в микрочипе, которые предстоит использовать в качестве зондов для анализа экспрессии указанных генов, представлены ниже в таблице 1.

Зонды олигонуклеотидов, которые представляют каждый ген

Для каждого из 543 генов, связанных с гематологическими неоплазиями, а также для генов, соответствующих β-актину, глицеральдегид-3-фосфат-дегидрогеназе, 18S рРНК и 28S рРНК, последовательность мрРНК разыскивается в базе данных GenBank (http://www.ncbi.nlm.nih.gov/Genbank). Олигонуклеотид сконструирован (зонд) из последовательности GenBank, специфичной для каждого из выбранных генов. В некоторых генах были сконструированы несколько олигонуклеотидов, расположенных в зонах 5' и 3' гена, для анализа целостности мРНК.

Для обеспечения специфичности конструкции зондов учитывали следующие критерии:

- Длину зонда для гарантии того, что все зонды будут иметь одинаковое поведение.

- Содержание GC в зонде от 40 до 60%. Эта характеристика также учитывается для обеспечения того, чтобы все зонды имели одинаковое поведение.

- Локализацию в гене. Были локализованы зонды, локализующиеся, по меньшей мере, на 3000 нуклеотида от зоны 3' (поли(А)) выбранной последовательности мРНК.

- Смысл зонда. Выбирали нить со «смыслом», т.е. последовательности олигонуклеотидов совпадают с последовательностями фрагментов соответствующей мРНК, вместо того чтобы представлять собой последовательности, комплементарные указанным фрагментам. Это решение включает то, что меченый генетический материал должен быть антисмысловым (комплементарным смыслу).

- Специфичность зонда. Во избежание неспецифической гибридизации выбирали зонды, которые имеют процентную долю гомологии, рассчитанную инструментом поиска BLAST (имеющимся на вебсайте (http://www.ncbi.nlm.nih.gov/Genbank), менее чем 70%.

Данные по олигонуклеотидам, использованным в качестве зондов, идентификационный номер их соответствующей последовательности в прилагаемом списке, а также данные (идентификационный номер в GenBank, обычная аббревиатура и название) генов, для выявления экспрессии которых были сконструированы указанные олигонуклеотиды, показаны ниже в таблице 1.

Среди этих генов 4 из них (ACTB, GAPD, 18S рРНК и 28S рРНК) не имеют особого отношения к неоплазиям и были первоначально включены в микрочип, потому что в течение длительного времени считали, что их экспрессия оставалась постоянной, и их использовали при нормализации данного микрочипа: они представляют собой тип генов, которые упоминаются в других местах описания, когда речь идет о «конститутивных» генах. В настоящее время не считают, что существует ген, экспрессия которого остается постоянной в любых обстоятельствах, и по этой причине в настоящем исследовании с генами ACTB, GAPD, 18S рРНК и 28S рРНК такое же обращение, как с другими генами микрочипа, за исключением того, что первые 2 из них использовались в качестве контролей целостности, как описано ниже.

Из таблицы 1 видно, что имеются гены, которые представлены более чем одним олигонуклеотидом. Это связано с тем, что существование двух или более зондов можно использовать для измерения целостности синтезированной кPНК. Гены, для которых были сконструированы более чем один олигонуклеотид для действия в качестве зонда, каждый из которых гибридизируется с другой последовательностью, указаны ниже в таблице 2.

Таблица 2
Гены, представленные более чем одним олигонуклеотидом в качестве зонда
Обычная аббревиатура гена Зонд 1 Зонд 2 Зонд 3
ABL1 SG10 SG180
BCR SG169 SG170
CBFB SG189 SG526
CD28 SG403 SG404
EIF4E SG293 SG305
ELF1 SG512 SG535 SG502
ETS2 SG95 SG537
GCET2 SG504 SG509
MAFB SG258 SG545
MTCP1 SG358 SG359
POU2F2 SG366 SG367
RGS1 SG56 SG409
S100A2 SG35 SG71
SNRPB SG142 SG143
STAT1 SG77 SG559 SG468
TIA-2 SG7 SG73
TAGLN2 SG24 SG476
TCF3 SG277 SG279
XRCC5 SG32 SG330
ZYX SG97 SG402
CD44 SG228 SG229
ACTB SG463 SG464
GAPD SG464 SG467

Установление контрольных зондов

Для снижения вариабельности большое количество контролей было включено в каждый микрочип. Эти контроли предполагают объективное измерение качества процесса и, поэтому, качество полученных данных. Они относятся к нескольким типам и происхождениям:

а) Зонды, используемые в качестве контролей целостности

Эти зонды представляли собой 2 пары олигонуклеотидов, комплементарных концам 5' и 3' генов β-актина (код зондов SG463 и SG464) и глицеральдегид-3-фосфат дегидрогеназы (коды зондов SG466 и SG467). Соотношение между интенсивностями зонда, локализованного на конце 3' и 5', обеспечивает возможность проверки качества исходной РНК и функционирования реакции мечения. Детали по этим олигонуклеотидам представлены в таблице 3.

Таблица 3
Олигонуклеотиды, используемые в качестве контролей целостности
Олигонуклеотид SEQ ID NO: Ген-источник Аббревиатура гена Идентификационный № гена
SG463 SEQ ID NO:463 β-актин ACTB 60
SG464 SEQ ID NO:464 β-актин ACTB 60
SG466 SEQ ID NO:466 Глицеральдегид-3-фосфат дегидрогеназа GAPD 2597
SG467 SEQ ID NO:467 Глицеральдегид-3-фосфат дегидрогеназа GAPD 2597

b) Зонды, используемые в качестве отрицательных контролей

Эти зонды, главным образом, образованы группой олигонуклеотидов из 50 нуклеотидов (50-членные), которые не являются комплементарными к какой-либо известной последовательности. Для них к этим зондам применяли инструмент BLAST, и наблюдали, что они не гибридизировались ни с какой человеческой последовательностью. Они идентифицируются кодами SC1 (SEQ ID NO:564), SC2 (SEQ ID NO:565), SC3 (SEQ ID NO:566), SC4 (SEQ ID NO:567), SC5 (SEQ ID NO:568), SC6 (SEQ ID NO:569) и SC7 (SEQ ID NO:570), и олигонуклеотиды SCN1 (SEQ ID NO:571), SCN5 (SEQ ID NO:575), SCN7 (SEQ ID NO:577) и SCN10 (SEQ ID NO:580) также используются в качестве отрицательных контролей. Они используются для определения оптимальных условий гибридизации, промывания и развития чипов или микрочипов. Появление сигнала, связанного с ними, указывает на существование неспецифической гибридизации.

с) Экзогенные зонды, используемые в качестве внутренних положительных контролей: «Пиковые контроли»

«Пиковые контроли» представляют собой синтетические олигонуклеотиды, чья последовательность совпадает с фрагментом транскрипта нечеловеческого гена или любой другой последовательности нуклеотидов низкой гомологии с транскриптами человеческих генов, которые полиаденилированы на конце 3', и используются в качестве положительного контроля при определении качества процесса, при нормализации данных и для установления линейного диапазона процесса (Benes V. et al., 2003). Для этого транскрипты или соответствующие полиаденилированные последовательности добавляют к общей исходной РНК перед началом процесса мечения, и поэтому они подвергаются некоторым реакциям (мечение, гибридизация и развитие) в качестве общей РНК образцов.

Используют 7 «Пиковых контролей». Для обеспечения низкой гомологии с человеческими генами используют 5 транскриптов генов Bacillus subtilis (dap, thr, trp, phe и lys) и 2 транскрипта генов вируса Sharkav, часто именуемых «Сливовый поксвирус» (Sppv), который представляет собой сливовый вирус. Детали этих олигонуклеотидов показаны ниже в таблице 4. Номера АТСС (Американской коллекции типовых культур), которые указаны после названия генов-источников, относятся к идентификационному номеру в АТСС штаммов E. Coli, содержащих рекомбинантные плазмиды, которые содержат последовательность генов, из которых получены транскрипты, добавляемые к РНК, и которые также используются для конструкции последовательностей соответствующих олигонуклеотидов, связанных с микрочипом.

Таблица 4
Олигонуклеотиды, используемые в качестве «Пиковых контролей»
Олигонуклеотиды SEQ ID NO: Ген-источник Код банка генов Размер транкрипта (нт) Концентрация (пМ) в растворе «пиковых контролей»
SSPC1 SEQ ID NO:584 Dap (ATCC №87486) L38424 1820 2000
SSPC2 SEQ ID NO:585 Lys (ATCC № 87482) X17013 1000 1250
SSPC3 SEQ ID NO:586 Thr (ATCC № 87484) X04603 1980 5
SSPC4 SEQ ID NO:587 Вирус скрытой мозаики сливы, изолированный PENN2 (Sppv1) AF401296 100
SSPC5 SEQ ID NO:588 Потивирус скрытой мозаики сливы, мРНК-покрытый белок (Sppv2) X57975 750
SSPC6 SEQ ID NO:589 Phe (ATCC № 87483) M24537 1320 1000
SSPC7 SEQ ID NO:590 Trp (ATCC № 87485) K01391 2500 500

с.1.: Получение 5 «Пиковых контролей» Bacillus subtilis

Бактерии E. coli с рекомбинантными плазмидами были приобретены в АТСС (Rockville M.D., USA). Плазмиды (pBluescript II-KS) содержали клонированную кДНК гена Bacillus subtilis с иссеченными сайтами для ферментов Notl на конце 5' и BamHI на конце 3' и поливыступающий конец (dA) перед иссеченным сайтом для BamHI.

После восстановления и предоставления клеткам возможности расти в течение ночи при 37°С в среде LB + ампициллин, плазмиду получали набором Midipreps (Jetstar) в соответствии с рекомендациями изготовителя. 10 мкг каждой из плазмид линеаризовали перевариванием 30 ЕД рестрикционного фермента Notl в присутствии буфера 1XNE3 и 1XBSA в течение 3 ч при 37°С. Линеаризованные плазмиды подвергали экстракции фенолом: хлороформом: изоамиловым спиртом (Ambion), осаждению 0,1 об. 3М ацетата натрия (Sigma) и 2,5 об. 100% этанола и удалению солей 80% этанолом, соблюдая указанную выше последовательность операций. Полученную ДНК ресуспендировали в 10 мкл воды, лишенной РНазы.

Затем транскрипты со смыслом синтезировали реакцией транскрипции in vitro (I.V.T.) из 1 мкг плазмиды, линеаризованной с использованием набора MegaScript T3 (Ambion), и соблюдая рекомендации изготовителя. Полученные плазмиды очищали набором выделения полной РНК RNeasy (QIAGEN), соблюдая рекомендации изготовителя.

Количественную характеристику, определение чистоты, качества и размера полученных транскриптов выполняли в соответствии с теми же способами, которые описаны ниже для общей РНК.

с.2. Получение 2 «Пиковых контролей», которые представляют гены CPPV

Рекомбинантные плазмиды (Progenika Biopharma) содержали клонированную кДНК двух генов sppv1 и sspv2, вставленных между двумя рестрикционными сайтами Pvull и Pstl. Конец 3' каждой вставки содержит выступающий конец полиаденилирования.

Клетки JM109 трансформировали плазмидами, которые содержали транскрипты. Клетки оставляли для роста в чашках со средой LB+ампициллин при 37°С, выбирали колонии с перенесенными клетками, и их выращивали в жидкой среде LB + ампициллин.

Извлечение плазмид выполняли набором очистки плазмид Midipreps Plasmid Purification (Qiagen), соблюдая рекомендации изготовителя. 10 мкг каждой плазмиды линеаризовали 30 ЕД рестрикционного фермента Pvull. Вставку экстрагировали хлороформом: изоамиловым спиртом (Ambion), осаждению 0,1 объемом 7,5 М ацетата натрия и 2,5 объемами 100% этанола. Соли удаляли двумя промываниями 80% этанолом. Полученную ДНК ресуспендировали в 10 мкл воды, лишенной РНазы.

Затем транскрипты со смыслом синтезировали 1 мкг плазмиды, линеаризованной с использованием набора MegaScript T7 (Ambion), и соблюдая рекомендации изготовителя. Продукт реакции очищали набором выделения полной РНК RNeasy (QIAGEN).

Затем выполняли количественное определение, измерение чистоты полученных транскриптов и верификацию их размера.

Раствор «Пиковых контролей» готовили из транскриптов, полученных при различных концентрациях каждого из «пиковых олигонуклеотидов» (см. таблицу 3), так что они покрывали весь диапазон интенсивностей «сканерного» считывающего устройства (величины интенсивности, которые составляют от 0 до 65535 в произвольных единицах). Этот раствор добавляли в одинаковом количестве к 5 мкг общей исходной РНК из каждого образца перед началом процесса.

с.3. Конструкция зондов, репрезентативных по каждому из транскриптов:

Так как поведение зондов было, насколько возможно, аналогичным поведению зондов, сконструированных для генов, подлежащих изучению программой Oligo 6.0 (M.B.I.), то для каждого из “Пиковых контролей» были выбраны те последовательности, которые соответствовали тем же требованиям, которые были установлены для зондов представленных генов (длина, содержание GC, «смысловая» нить и расстояние до конца 3'), и которые не образовывали устойчивых петель (энергия менее чем -7 ккал/моль). Инструмент BLAST применяли к последовательностям, которые отвечали этим требованиям, и были выбраны те, которые имели меньшую гомологию с человеческими последовательностями.

После осаждения и иммобилизации зонды, соответствующие “Пиковым контролям» на стекле, были верифицированы: а) что зонды не гибридизировались неспецифическим образом с образцами для анализа, b) что все зонды имели одинаковые характеристики гибридизации, и с) что сигнал интенсивности, полученный от каждого из них, мог быть связан с количеством транскрипта, добавленного к РНК.

d) Контроли гибридизации

Синтетические олигонуклеотиды ДНК с 70 нуклеотидами (70-членные) использовали в качестве контролей гибридизации, модифицированных на одном конце молекулой биотина. Эти молекулы добавляли в одинаковом количестве к образцу непосредственно перед гибридизацией, проявлением и захватом изображений микрочипа. Для каждого из этих 70-членных олигонуклеотидов на микрочипе было несколько копий олигонуклеотида с 50 нуклеотидами длиной (50-членных), комплементарного соответствующему 70-членному олигонуклеотиду, с которым он должен гибридизироваться. 50-членные олигонуклеотиды, которые образуют часть микрочипа и которые комплементарны 70-членным олигонуклеотидам, добавляемым к кРНК перед гибридизацией, имеют коды SCN2, SCN3, SCN6, SCN8, SCN11, SCN12 и SCN13. Для обеспечения низкой гомологии с человеческими последовательностями последовательности этих олигонуклеотидов получали из последовательностей Arabidopsis thaliana и Tripanosoma brucei. Их характеристики представлены в таблице 5.

Таблица 5
Олигонуклеотиды, использованные в микрочипe в качестве положительных контролей гибридизации
50-членные олигонуклеотиды, присутствующие в микрочипе SEQ ID NO: Ген-источник Код генного банка Комплементарный 70-членный олигонуклеотид
SCN2 SEQ ID NO:572 Альфа-1,4-фукозилтрансфераза (FT4-M) из Arabidopsis thaliana AY026941 C2
SCN3 SEQ ID NO:573 мРНК тиоредоксина Tripanosoma brucei AJ239128 C3
SCN6 SEQ ID NO:576 мРНК из предполагаемого белка экспрессии RBP (полная CDS) из Arabidopsis thaliana AY051079 C6
SCN8 SEQ ID NO:578 мРНК из предполагаемого белка передачи липидов (At1g48750) (полная CDS) из Arabidopsis thaliana AY045879 C8
SCN11 SEQ ID NO:581 мРНК из предполагаемого белка передачи липидов (At1g48750) (полная CDS) из Arabidopsis thaliana AY045879 C11
SCN12 SEQ ID NO:582 мРНК из предполагаемого белка передачи липидов (At1g48750) (полная CDS) из Arabidopsis thaliana AY045879 C12
SCN13 SEQ ID NO:583 мРНК цистеин-эндопептидазы типа папаина ХСР2 (полная CDS) из Arabidopsis thaliana AF191028 C13

Для конструкции 50-членного олигонуклеотида было верифицировано способом, аналогичным способу, ранее описанному для «Пиковых контролей», что подлежащие использованию олигонуклеотиды не гибридизировались в неспецифической форме с подлежащими анализу образцами, что у всех зондов были одинаковые характеристики гибридизации, и что сигнал с интенсивностью, полученной от каждого из них, мог быть связан с количеством соответствующего 70-членного олигонуклеотида, добавленного в кРНК. Это обеспечило возможность взять как обоснованные олигонуклеотиды, указанные в таблице 5. Было видно, что олигонуклеотиды SCN4 (SEQ ID NO:574) и SCN9 (SEQ ID NO:579), сконструированные в принципе для действия в качестве контролей гибридизации, продуцируют специфическую гибридизацию при гибридизации с человеческой кРНК, и по этой причине они тоже появляются в микрочипе, как если бы они представляли собой зонды, которые представляют человеческий ген, но они не принимаются во внимание в качестве положительных контролей гибридизации. Со своей стороны, олигонуклеотиды SCN1 (SEQ ID NO:571), SCN5 (SEQ ID NO:575), SCN7 (SEQ ID NO:577) и SCN10 (SEQ ID NO:580), которые также не гибридизируются в специфической форме с образцами, также присутствуют в микрочипе в качестве отрицательных контролей гибридизации, поскольку в кРНК не были добавлены комплементарные им олигонуклеотиды.

Со своей стороны, раствор контроля гибридизации, который содержал 70-членные олигонуклеотиды, комплементарные 50-членным олигонуклеотидам, присутствующим в микрочипе в качестве положительных контролей гибридизации, получали из соответствующих биотинилированных 70-членных последовательностей, используя другую концентрацию для каждого из них, как показано в таблице 6:

Таблица 6
Состав раствора положительного контроля гибридизации
70-членный олигонуклеотид, добавленный в кРНК SEQ ID NO: Комплементарный 50-членный олигонуклеотид Концентрация (пкМ) в растворе контроля гибридизации
C2 SEQ ID NO:591 SCN2 750
C3 SEQ ID NO:592 SCN3 250
C6 SEQ ID NO:593 SCN6 1500
C8 SEQ ID NO:594 SCN8 1250
C11 SEQ ID NO:595 SCN11 2000
C12 SEQ ID NO.596 SCN12 4500
C13 SEQ ID NO:597 SCN13 2500

Контроли

Использовали диметилсульфоксид (DMSO) без какого-либо зонда, поскольку это растворитель, в котором олигонуклеотиды обнаруживаются во время осаждения на поверхности микрочипа.

Описание устройство микрочипа

12 реплик каждого зонда осаждались в различных участках на поверхности твердой подложки (стекло в форме, подобной предметному стеклу микроскопа) с использованием микрорешетки Microgrid II Spoter (Biorobotics). 12 реплик каждого зонда распределяли на подложке случайным методом: 6 в верхней области и 6 в нижней области. В качестве твердой подложки использовали аминосиланизированное стекло (Corning). Влажность и температуру регулировали посредством способа получения отпечатков.

Ковалентное связывание зондов с твердыми подложками проводили поперечной сшивкой ультрафиолетовым излучением, используя прибор “Stratalinker” (Stragene).

Контроль качества способа получения микрочипов был следующий: а) При каждом производственном цикле микрочип окрашивали бромидом этидия, который обеспечивал возможность анализа размера и формы отпечатанных точек. b) Другой чип каждого цикла гибридизировали с уже гибридизированной кРНК, анализируя сигнал гибридизации, фоновый шум и воспроизводимость реплик.

Характеристики чипа показаны ниже в таблице 7:

Таблица 7
Характеристики микрочипа
Количество представленных генов 538
Длина олигонуклеотидов 22-55 мер
Анализированная нить Смысловая
Количество олигонуклеотидов на ген 1 (кроме 21 гена, которые представлены 2 или 3 различными олигонуклеотидами)
Количество реплик каждого олигонуклеотида 12
Контроль DMSO
Контроли целостности 4
Пиковые контроли (внутренние положительные контроли) 7
Положительные контроли гибридизации 9
Отрицательные контроли 11
Общее число точек 8192 (32 области × 16×16)
Размер микрочипа 25×75 мм
Область нанесения пятен 16,38×17,82 мм
Расстояние между точками х-y - ось 360 мкм

Обработка образцов

Клеточные культуры

Культуры клеток Jurkat (линия клеток из Т-лейкоза) и U937 (линия клеток из промоноцитарного лейкоза) центрифугировали в течение 10 мин при 1200 об/мин, и после декантации супернатанта преципитат ресуспендировали в RNAlater (Ambion Inc) и хранили при -80°С во время экстракции РНК. РНК экстрагировали TRIzol (Gibco-BRL Carlbad, CA, USA), следуя рекомендациям изготовителя.

Образцы крови

Образцы крови собирали прямо в пробирки PAXgene Blood RNA Tubes-PreAnalytix (Qiagen). 2,5 мл крови экстрагировали в каждой пробирке и двух пробирках на индивидуума. Пробирки переворачивали несколько раз для обеспечения возможности смешивания крови со стабилизирующей жидкостью, которая содержалась в пробирке, и их хранили при -20°С до ночи перед экстракцией РНК.

Экстракция общей РНК

Пробирки с образцом инкубировали при окружающей температуре в течение ночи, предшествующей экстракции РНК. Набор PAXgene Blood RNA (Qiagen) использовали для экстракции в соответствии с рекомендациями изготовителя, включая промежуточную стадию обработки ДНазой (лишенный РНазы набор ДНазы, Qiagen) в колонке. РНК каждой экстракционной пробирки элюировали в 80 мкл буфера BR5. РНК из двух пробирок, которые соответствовали каждому пациенту, собирали в одну пробирку.

Очистка общей РНК

Для обеспечения того, чтобы полученная РНК была свободна от примесей, которые могут препятствовать дальнейшим реакциям мечения, ее проводили следующим образом: 16 мкл (0,1 об.) 7,5 М ацетата натрия (Sigma) и 400 мкл (2,5 об.) 100% этанола добавляли к 160 мкл раствора общей РНК. Раствор смешивали в «вихревой» мешалке, и его инкубировали в течение 1 ч при -20°С. После 20 мин центрифугирования при 12000×g при 4°С осадок дважды промывали 500 мкл 80% этанола, и его ресуспендировали в 35 мкл воды без РНазы. Полученные РНК хранили при -80°С до их последующего использования.

Количественное определение общей РНК

Количественное определение общей РНК проводили измерением спектральной поглощательной способности при 260 нм в спектрофотометре (DU 65, Beckman Coulter). 2 мкл раствора общей РНК разбавляли в 98 мкл 1 мМ Tris-HCl при рН 7,5, и концентрацию оценивали (мкг/мл), принимая во внимание, что 1 единица оптической плотности при 260 нм соответствует концентрации РНК 44 мкг/мл.

Определение чистоты и качества РНК

Степень чистоты устанавливали по соотношению спектральной поглощательной способности А260/А280 (нуклеиновой кислоты/белков), считая, что РНК является подходящей, имеющей «хорошее качество», когда соотношение А260/А280 составляет от 1,9 до 2,1.

Качество общей РНК определяли осмотром РНК после электрофореза. 500 нг общей РНК подвергали электрофорезу в 1% агарозном геле (FMC) в буфере ТАЕ 1х с BrEt (0,5 мг/мл), в условиях разности потенциалов 100 В в течение 25 мин в кюветах электрофореза АС (BioRad). В качестве маркера молекулярных масс использовали фаг φ 29, переваренный рестрикционным ферментом BamH I. Гели осматривали в устройстве для просвечивания ультрафиолетовым светом Gel Doc (BioRad).

Мечение образца

Выбор нити со смыслом в качестве зонда ограничивали стратегию мечения при тех аппроксимациях, которые дают антисмысловой меченый продукт (комплементарный к зонду, иммобилизованному на твердой подложке).

Мечение кРНК

Этот тип мечения выполняли во время хода процесса амплификации, который состоит в использовании для синтеза однонитевой кДНК, олиго(dT) затравки, которая содержит промотер для фермента РНК полимеразы фага Т7, фермента, который должен использоваться на стадии амплификации образца.

а. - Синтез кДНК: стадия, на которой была синтезирована ДНК (кДНК), комплементарная к исходной мРНК. 5 мкг общей РНК инкубировали с 2 мкл раствора «Пиковых контролей» и 100 пкмоль затравки Т7-(dT)24 (Genset Corp) в конечном объеме 12 мкл в течение 10 мин при 70°С в термоблоке, смесь охлаждали на льду и добавляли 4 мкл 5Х Первого нитевого буфера (Gibco BRL Life Technologies), 0,1М 2 мкл DTT (Gibco BRL Life Technologies), 1 мкл смеси dNTP 10 мМ (Gibco BRL Life Technologies) и 1 мкл SuperScript II RNase H RT (200 OR/мкл) (Gibco BRL Life Technologies). После 1 ч инкубации в бане, оборудованной термостатом (Selecta), при 42°С, реакционную смесь охлаждали на льду.

b. Синтез ДНК с двойной цепью (дцДНК): двойную цепь ДНК синтезировали из кДНК, синтезированной на предыдущей стадии. К 20 мкл предыдущей реакционной смеси добавляли 91 мкл воды, лишенной РНазы, 30 мкл «Реакционного буфера второй нити» (Gibco B.R.L. Life Technologies), 3 мкл 10 мМ dNTPs (Gibco BRL Life Technologies), 10 Ед лигазы ДНК E. Coli (Gibco BRL Life Technologies), 40 ЕД полимеразы I ДНК E. Coli (Gibco BRL Life Technologies), 2 ЕД РНазы Н E. Coli (Gibco BRL Life Technologies), в конечном объеме 150 мкл. Реакционную смесь инкубировали в термоблоке при 16°С в течение 2 ч. Затем добавляли 10 ЕД полимеразы ДНК Т4 (Gibco BRL Life Technologies), и смесь инкубировали при 16°С в течение 5 мин. Для остановки реакции добавляли 10 мкл 0,5 М EDTA.

c. Очистка дцДНК: Для устранения возможных остатков продуктов реакции, которые могут препятствовать последующим реакциям мечения, полученную посредством экстракции фенолом/хлороформом, и затем осажденную ДНК очищали. К 162 мкл предыдущей реакционной смеси добавляли 162 мкл раствора фенола: хлороформа: изоамилового спирта (25:24:1) (Ambion). Ее центрифугировали в течение 2 мин при 12000×g в центрифуге при окружающей температуре, верхнюю водную фазу собирали. К этой верхней фазе добавляли 0,5 объемов 7,5 М ацетата аммония (Sigma Chemical) и 2,5 объема 100% этанола, охлажденного до -20°С. После перемешивания «вихревой» мешалкой для тщательного смешивания компонентов и центрифугирования в течение 20 мин при 12000×g при окружающей температуре, супернатант устраняли и осадок дважды промывали 80% этанолом. Полученную ДНК ресуспендировали в 10 мкл воды, лишенной РНазы, и ее концентрировали в концентраторе “Speed-Vac” до объема 2 мкл. Эту ДНазу хранили при -20°С до ее последующего использования.

d. Синтез и мечение кРНК: Реакцию проводили в объеме 20 мкл, и используя набор T7 Megascript (Ambion), выполняя инструкции изготовителя и включая нуклеотиды, модифицированные биотином, Bio-11-CTP и Bio-11 UTP (Perkin Elmer) при соотношении не модифицированного нуклеотида/модифицированного нуклеотида 1:3. Реакционную смесь инкубировали в течение 5 ч и 15 мин в бане с термостатом (Selecta) при 37°С, перемешивая реакционную смесь через каждые 45 мин. После этой инкубации добавляли 1 мкл ДНазы, и ее инкубировали в течение 30 мин при 37°С.

е. Очистка биотинилированной кРНК: Биотинилированную кРНК очищали набором для выделения общей РНК RNeasy (Qiagen), следуя рекомендациям изготовителя. Полученные биотинилированные кРНК элюировали в объеме 80 мкл, и их хранили при -80°С до их последующего использования.

Количество, чистоту и качество полученной кРНК определяли в соответствии с теми же способами, которые описаны для общей РНК.

кРНК хранили при -80°С до ее последующего использования.

Фрагментация биотинилированной кРНК

10 мкг биотинилированной кРНК фрагментировали в присутствии 5х (200 мМ Tris-ацетата, рН 8,1, 500 мМ HOAC, 150 мМ MgOAc) фрагментационного буфера в течение 35 мин при 94°С в термоблоке. То, что реакция фрагментации была проведена, верифицировали осмотром 1 мкл раствора фрагментации при электрофорезе на 1% агарозном геле.

Гибридизация кРНК, меченной зондами микрочипа

На этой стадии меченый генетический материал помещали в контакт с зондами, иммобилизованными на твердой подложке.

10 мкл контрольного раствора гибридизации добавляли к раствору биотинилированной и фрагментированной кРНК, и смесь инкубировали в течение 3 мин при 95°С для денатурации возможных вторичных структур. После инкубации смесь сразу переносили на лед для предотвращения возможной ренатурации образца.

Гибридизацию проводили в течение 6 ч при 42°С в установке автоматической гибридизации Ventana Discovery (Ventana Medical Systems). Буферы для гибридизации и промывания поставляла компания Ventana Medical System. Микрочипы автоматически окрашивались в установке гибридизации стрептавидином, сопряженно связанным с Cy3 (Amersham Biosciences), с использованием рекомендаций изготовителя.

Захват изображений и количественная характеристика микрочипов

После гибридизации и проявления изображения микрочипов идентифицировали и анализировали конфокальным флюоресцентным сканнером ScanArray 4000 (Perkin Elmer), оборудованным лазером для зеленого спектра (543 нм для иссечения флуорофора Cy3). Использованное «программное обеспечение» представляла собой ScanArray 3.1. Использование компьютерной программы QuantArray 3.0 (Perkin Elmer) предоставляло абсолютные величины интенсивности гибридизации и фонового шума, в соответствии со светом, испускаемым Cy3 в каждом зонде, в формате Excel.

Анализ данных: предварительная обработка

Сначала величину фонового шума вычитали из величин абсолютной интенсивности всех олигонуклеотидов. Для этого величины абсолютной интенсивности и величины фонового шума, которые программа использовала для превращения сигналов возвратов флуорофора, автоматически использовались для каждой из точек микрочипа: соответствующая величина интенсивности получается из зоны, которая была определена в виде точки, а величина фонового шума получается из зоны, расположенной вокруг точки.

Затем средний уровень интенсивности гибридизации каждого из олигонуклеотидов микрочипа рассчитывали по уравновешенной средней интенсивностей 12 реплик каждого из олигонуклеотидов. Для этого перед расчетом средней величины, необходимо устранить верхнюю и нижнюю величины точек распределения сигналов гибридизации, полученных с каждой из реплик одного и того же олигонуклеотида. Расчет выполняли, используя программу Excel от компании Microsoft, в частности ее функцию TRIMMEAN, где параметр «процентной доли» был установлен на 0,2, что предполагает фиксацию процентной доли устраненных величин в 20% верхних величин и 20% нижних величин; функция округляет исключенный ряд точек данных, до ближайшей величины умножения 2.

В конце и для обеспечения возможности определения достоверности гибридизации, необходимо, чтобы соблюдался ряд установленных критериев: 1) соотношение между средней интенсивностью и средним фоном всех олигонуклеотидов чипа должно составлять больше чем 10; 2) величина среднего коэффициента вариации (стандартное отклонение реплик, по сравнению со средней величиной реплик) всех реплик олигонуклеотидов чипа должна быть меньшей, чем 0,3; 3) средняя величина отрицательного контроля должна быть в 2,5 раза меньше величины среды DMSO; 4) сигнал должен быть получен и в контролях гибридизации, и в экзогенных внутренних положительных контролях (пиковые контроли).

Анализ данных выполняли на языке R, версии 1.9.1. R представляет собой язык программирования, где могут применяться и классические, и современные статистические методики (R Developmental Core Team, 2004; http://R-project.org), который имеет ряд функций, хранящихся в пакетах для манипулирования, расчета и графического представления данных (Venables et al., 2004). Существуют сотни пакетов, написанных различными авторами для R, со специальными статистическими функциями, или которые обеспечивают возможность доступа и манипулирования данными, и имеются для загрузки из сайтов Интернета CRAN (http:///) или Bioconductor (http://). В некоторых определенных случаях использовали программное обеспечение для статистического анализа SPSS (Chicago, USA).

ПРИМЕРЫ

Пример 1

Результаты, полученные при использовании устройства микрочипа с образцами U937 в сравнении с клетками Jurkat

Для определения того, позволяет ли устройство дифференцировать 2 линии клеток, гибридизированных в 10 микрочипах: 5 образцов биотинилированных кРНК, синтезированных в соответствии с оптимизированным рабочим протоколом, полученных из РНК клеток U937 (линия клеток из промоноцитарного лейкоза) и 5 образцов биотинилированных кРНК, полученных из РНК клеток Jurkat (линии клеток из Т-лейкоза).

Проводили первоначальные стадии предварительной обработки данных и подтверждение достоверности гибридизации, указанные ранее в разделе «Анализ данных: Предварительная обработка», и затем данные нормализовали и фильтровали:

- Нормализация данных. Использовали способ «нормализации стабилизации дисперсии», имеющийся в пакете “vsn” в языке программирования R. В Интернете имеются различные пакеты для R, со специальными статистическими функциями или которые обеспечивают возможность доступа и обработки данных, и доступны для загрузки из сайтов Интернета CRAN (http:///) или Bioconductor (http://).

- Фильтрация данных. Операции фильтрации проводили функцией “Filterfun” фильтра “Genefilter” в языке программирования R. Гены, которые не проводили через любой из этих двух фильтров, не использовали для анализа данных. Проведенные фильтры представляли собой:

- Фильтрацию для исключения генов с величиной интенсивности, близкой к DMSO.

Этот фильтр обеспечивал возможность работы с генами с величиной интенсивности минус средний фоновый шум более чем 550 произвольных единиц (приблизительно в 2 раза больше величины DMSO).

- Фильтрацию для исключения генов с минимальным изменением интенсивности по всем образцам. С генами работали в межквантильном диапазоне нормализованной интенсивности по образцам больше чем 0,3.

Фильтрация данных оставила 83 зонда, которые составили рабочий список. С ними проводили группировку не контролировавшихся образцов, которые представляют собой такие группировки, где структура данных ранее неизвестна, причем система узнает о том, как данные распределяются среди классов на основании функции расстояния. При группировке получали дерево иерархической группы, где образцы сгруппированы в соответствии с их сходством в экспрессии определенных генов, те, которые соответствуют олигонуклеотидов рабочего списка, так что самыми близкими образцами являются те, которые имеют одинаковый профиль экспрессии. Группировку выполняли функцией hclust пакета stats в R. Неконтролируемый анализ 10 образцов дал их разделение на 2 группы или основные ветви, в соответствии с типом клеток, к которому относятся образцы: группа содержит 5 гибридизаций, проведенных из клеток U937, а другая группа содержит 5 гибридизаций, проведенных из клеток Jurkat. Полученное дерево этой неконтролируемой группировки частично показано в части А фиг.1.

Затем, для выяснения, существовали ли статистически значимые различия между этими двумя группами образцов, использовали способ «Методов множественного тестирования maxT с пошаговым снижением» (метод maxT), который представляет собой применение функции mt.max T пакета множественного тестирования программного обеспечения в языке программирования R с сайта Bioconductor, который применяет статистический тест и проводит жесткий контроль над частотой ложно положительных результатов. Для этой функции должно быть обеспечено следующее:

а) Величины, к которым желательно применить статистические тесты, в данном случае к нормализованным величинам 83 олигонуклеотидов, которые прошли фильтры.

b) Группы, между которыми желательно выявление различий, в данном случае 5 образцов клеток Jurkat в сравнении с 5 образцами клеток U937.

c) Количество перестановок, которые желательно выполнить. В данном случае проводятся 100000 перестановок.

d) По умолчанию был выбран критерий Welch для определения статистического инструмента, подлежащего использованию для тестирования гипотезы отсутствия связи между переменными величинами и метками класса.

Применение этого анализа при величине p<0,001 предоставило перечень 69 статистически значимых зондов между этими двумя группами, которые являются следующими:

SG12, SG20, SG23, SG24, SG38, SG39, SG45, SG49, SG53, SG59,

SG60, SG62, SG76, SG78, SG89, SG92, SG94, SG102, SG474, SG478,

SG487, SG114, SG120, SG140, SG142, SG145, SG150, SG154, SG158,

SG174, SG175, SG194, SG195, SG211, SG230, SG231, SG235, SG260, SG264,

SG266, SG268, SG270, SG272, SG282, SG294, SG308, SG311, SG330, SG332,

SG333, SG339, SG344, SG364, SG403, SG423, SG434, SG456, SG506,

SG513, SG514, SG515, SG524, SG533, SG538, SG541, SG559.

После того как стали известны статистически значимые гены для различения между двумя группами образцов (которыми были бы гены, соответствующие зондам, идентифицированным как статистически значимыми), проводилась контролируемая группировка образцов в соответствии с интенсивностью сигнала 69 полученных статистически значимых зондов. Термин «контролируемая», применяемый к группировке, указывает на то, что структура данных предварительно известна, что обеспечивает возможность использования предшествующей информации; имея ее, после процесса тренировки, который позволяет системе научиться различать классы, можно использовать сеть для отнесения новых членов к предварительно определенным классам. В этом случае контролируемая группировка образцов в соответствии с интенсивностью сигнала, полученного с выявленными 69 статистически значимыми зондами, снова представляет собой дерево, которое делится на 2 основные ветви в соответствии с типом клеток, к которому относятся образцы. Полученное дерево при контролируемой группировке показано в части В фиг.1.

Пример 2

Результаты, полученные после использования «чипового» устройства с образцами от здоровых лиц, в сравнении с клетками U937 и Jurkat

Экспрессию 5 образцов клеток U937 и 5 образцов клеток Jurkat сравнивали с экспрессией 10 образцов из цельной крови от здоровых лиц. Методом, аналогичным проводившемуся в примере 1, проводили стадии обработки первоначальных данных, утверждение действительности гибридизации, нормализацию и фильтрование. Всего 180 генов прошли процессы фильтрования. Неконтролируемая группировка образцов (проводившаяся функцией hclust пакета stats R, применяя корреляцию Pearson) в соответствии с экспрессией 180 генов предоставила дерево с двумя основными ветвями: одна ветвь содержит все образцы их культуры клеток, а другая ветвь содержит все образцы из цельной крови здоровых лиц, которая демонстрирует, что этот инструмент способен найти различия экспрессии. Дерево, полученное после проведения неконтролируемой группировки, показано в части А фиг.2.

Выполняли тест maxT (p<0,001) для обнаружения генов со статистически значимыми различиями между образцами из культур клеток U937 и Jurkat и 10 образцами цельной крови от здоровых лиц. Статистический анализ предоставил список из 131 зонда со статистически значимыми различиями между обеими группами образцов. Они следующие:

SG1, SG4, SG7, SG8, SG10, SG13, SG15, SG16, SG17, SG18, SG19, SG20, SG26, SG29, SG30, SG34, SG36, SG39, SG42, SG44, SG49, SG51, SG52, SG58, SG64, SG65, SG67, SG76, SG77, SG80, SG84, SG86, SG89, SG92, SG93, SG94, SG98, SG99, SG101, SG102, SG107, SG463, SG464, SG474, SG475, SG485, SG487, SG466, SG467, SG471, SG472, SG473, SG120, SG129, SG138, SG141, SG144, SG145, SG147, SG158, SG163, SG164, SG176, SG185, SG186, SG197, SG207, SG208, SG217, SG227, SG231, SG265, SG266, SG277, SG278, SG283, SG285, SG299, SG307, SG308, SG311, SG313, SG318, SG319, SG328, SG333, SG336, SG342, SG344, SG357, SG361, SG376, SG384, SG389, SG395, SG398, SG403, SG404, SG407, SG416, SG420, SG423, SG430, SG436, SG446, SG455, SG461, SG489, SG491, SG492, SG493, SG498, SG500, SG504, SG505, SG506, SG514, SG516, SG517, SG520, SG526, SG530, SG533, SG538, SG545, SG547, SG554, SG555, SG558.

Группировка 20 образцов в соответствии с экспрессией статистически значимых зондов снова дала начало дереву с двумя основными ветвями, одной, соответствующей образцам из культур клеток, и другой, соответствующей образцам от здоровых индивидуумов. Указанная группировка представлена в части В фиг.2.

Пример 3

Результаты, полученные с образцами от пациентов с хроническим лимфолейкозом (CLL) в сравнении с клетками U937 и Jurkat

Сравнивали профили экспрессии образцов из культур клеток U937 и Jurkat с 26 образцами из цельной крови субъектов с CLL.

Образца были подвергнуты предварительной обработке данных, их нормализовали и фильтровали способом, аналогичным способам, использованным в примерах 1 и 2, и через фильтры прошли всего 236 зондов. Неконтролируемая группировка образцов в соответствии с экспрессией зондов, которые прошли через фильтры, выявила дерево с двумя основными ветвями: одной, которая содержала образцы культур клеток, а другая - образцы CLL. Указанное дерево показано в части А фиг.3.

Проводили тест maxT (p<0,001) для обнаружения генов со статистически значимыми различиями между двумя группами образцов. Этот анализ дал список из 120 зондов. Они следующие:

SG2, SG4, SG8, SG10, SG13, SG15, SG16, SG19, SG20, SG23, SG26, SG28, SG31, SG34, SG36, SG39, SG48, SG58, SG60, SG65, SG76, SG77, SG84, SG89, SG94, SG9, SG97, SG99, SG102, SG106, SG107, SG463, SG464, SG474, SG475, SG481, SG465, SG485, SG487, SG466, SG467, SG471, SG473, SG115, SG116, SG117, SG120, SG129, SG134, SG135, SG138, SG139, SG141, SG145, SG158, SG161, SG163, SG176, SG178, SG185, SG207, SG208, SG210, SG217, SG227, SG231, SG237, SG264, SG272, SG277, SG281, SG283, SG286, SG294, SG298, SG299, SG307, SG308, SG319, SG328, SG330, SG333, SG336, SG342, SG344, SG345, SG347, SG361, SG384, SG389, SG395, SG404, SG407, SG416, SG423, SG428, SG430, SG432, SG434, SG444, SG446, SG453, SG458, SG459, SG491, SG498, SG507, SG508, SG511, SG517, SG518, SG522, SG526, SG530, SG533, SG538, SG541, SG554, SG558, SG561.

Группировка 30 образцов в соответствии с экспрессией 120 статистически значимых зондов снова дала начало дереву с двумя основными ветвями, одной, соответствующей образцам из культур клеток, и другой, соответствующей образцам от здоровых индивидуумов. Указанная группировка представлена в части В фиг.3.

Пример 4

Результаты, полученные с образцами от здоровых лиц в сравнении с пациентами с хроническим лимфолейкозом (CLL)

68 гибридизаций, которые соответствовали критериям качества, из 68 образцов различных здоровых субъектов и с клиническим диагнозом CLL, делили на 2 группы: группу подготовки, использованную для получения функций классификатора, и тестируемую группу, использованную для испытания полученного классификатора. Группа подготовки состояла из 30 образцов (10 от здоровых субъектов и 20 от субъектов с CLL), а тестируемая группа состояла из 38 образцов (5 образцов от здоровых субъектов и 33 образца от субъектов с CLL).

Для получения функции классификации работали с результатами, полученными от гибридизации группы подготовки. Стадии, проводимые для получения функции классификации, были следующие:

- Нормализация данных. Использовали способ «нормализации стабилизации дисперсии», имеющийся в пакете “vsn” в языке программирования R.

- Фильтрация данных. Операции фильтрации проводили функцией “Filterfun” фильтра “Genefilter” в языке программирования R. Гены, которые не проходили через любой из этих двух фильтров, не использовали для анализа данных. Из 588 олигонуклеотидов чипа 224 прошли через 2 фильтра и составили рабочий список.

2. Фильтрация для исключения генов с величиной интенсивности, близкой к DMSO.

Этот фильтр обеспечивал возможность работы с генами с величиной интенсивности минус средний фоновый шум более чем 550 произвольных единиц (приблизительно в 2 раза больше величины DMSO) у более чем 25% из 30 образцов (7 образцов), которые составляют группу подготовки.

3. Фильтрация для исключения генов с минимальным изменением интенсивности по всем образцам. Работали с генами, у которых в межквантильном диапазоне нормализованная интенсивность по образцам была больше чем 0,3.

Использовали 2 системы классификации:

4.1. - Составление системы классификации РАМ

Для идентификации генов, которые наилучшим образом характеризуют каждый тип образца и верифицируют классификационный разряд этих групп генов, использовали Прогностический анализ для микрочипов (РАМ), доступный в виде пакета программ “pamra” в языке программирования R. Это - статистическая методика, которая идентифицирует группу генов, наилучшим образом характеризующую заданный класс, и использует эту группу генов для прогноза класса, к которому относятся новые образцы. РАМ использует модифицированную версию метода классификации «ближайшие центроиды» (Tibshirani et al., 2002), называемую «Ближайшие сжавшиеся центроиды». Проводили обоснование, называемое «10-кратное перекрестное обоснование», которое состоит в конструировании модели с 90% образцов и предпринятой попытке прогнозирования класса 10% образцов, которые не вмешивались в конструкцию модели. Этот метод повторяется 10 раз, и ошибка классификации 10% образцов прибавляется для расчета общей ошибки. Эта ошибка отражает число неудовлетворительно классифицированных образцов (Bullinger et al., 2005).

4.1.1. Построение модели. Из отфильтрованных и нормализованных данных по 30 образцам, которые составляют группу подготовки, относя в произвольной форме Здоровую группу к группе 0, а группу CLL к группе 1, выполняли 10 перекрестных обоснований при пороговой величине Дельта 3.1. Полученная модель была образована следующими олигонуклеотидами: SG459, SG428, SG507, SG508, SG117, SG237. Коэффициенты классификаторов, соответствующих каждому из этих олигонуклеотидов, показаны ниже в таблице 8.

Таблица 8
Коэффициенты классификаторов РАМ
Идентификация Величина 0 Величина 1
[1,] SG459 -0,4344 0,2172
[2,] SG428 -0,146 0,073
[3,] SG507 -0,1111 0,0555
[4,] SG508 -0,1044 0,0522
[5,] SG117 -0,1003 0,0502
[6,] SG237 -0,0539 0,027

4.1.2. Обоснование классификатора РАМ. Перекрестное обоснование образцов, которые составляют группу подготовки, правильно классифицировало 28 из 30 образцов.

Из фильтрованных и нормализованных данных 38 образцов, которые составляют тестируемую группу, были получены величины р, относящиеся к группе 0 (здоровой группе) или группе 1 (группа CLL). Чем больше величина р, тем больше вероятность принадлежности этой группе. Величины р, полученные для каждого образца, указаны в таблице 9.

Таблица 9
Величины вероятности, полученные классификатором РАМ для тестируемой группы
Образец р (Группа 0) р (Группа 1)
S229 0,8031905 0,1968095
S231 0,7403173 0,2596827
S232 0,8810574 0,1189426
S233 0,7973159 0,2026841
S251 0,8714224 0,1285776
CLL166 0,3764637 0,6235363
CLL184 0,1278230 0,8721770
CLL132 0,2081423 0,7918577
CLL210 0,3248082 0,6751918
CLL213 0,3536033 0,6463967
CLL214 0,2705277 0,7294723
CLL221 0,3650277 0,6349723
CLL208 0,2323872 0,7676128
CLL225 0,4034316 0,5965684
CLL236 0,4893545 0,5106455
CLL240 0,3807527 0,6192473
CLL168 0,1616066 0,8383934
CLL172 0,2002317 0,7997683
CLL174 0,1601147 0,8398853
CLL175 0,6009558 0,3990442: → Единственный неудовлетворительно классифицированный образец
CLL177 0,1634185 0,8365815
CLL179 0,2300440 0,7699560
CLL181 0,2177406 0,7822594
CLL182 0,3450880 0,6549120
CLL164 0,2590083 0,7409917
CLL159 0,3688586 0,6311414
CLL142R 0,2111712 0,7888288
CLL105 0,2962797 0,7037203
CLL107 0,3764637 0,6235363
CLL109 0,3525788 0,6474212
CLL112 0,2059187 0,7940813
CLL151 0,2951067 0,7048933
CLL158 0,1932882 0,8067118
CLL169 0,3525937 0,6474063
CLL171 0,1495153 0,8504847
CLL178 0,2260191 0,7739809
CLL111 0,2951168 0,7048832
CLL155 0,2832151 0,7167849

С помощью этой модели правильно классифицированы 37 из 38 образцов тестируемой группы: все образцы, соответствующие здоровым индивидуумам (те, чье название начинается с буквы “S”), имеют вероятность больше чем 0,5 принадлежности к группе 0, в то время как все образцы, соответствующие индивидуумам, страдающим CLL (которые представляют собой образцы, название которых начинается с букв “CLL”), кроме одного, имеют вероятность принадлежности к группе 1 больше чем 0,5.

4.2. Построение системы классификации логистической регрессией.

4.2.1. Отбор генов со статистически значимыми различиями среди здоровых лиц и страдающих CLL (группа подготовки). Как было ранее описано, по фильтрованным и нормализованным данным, способ «Методов множественного тестирования maxT с пошаговым снижением» (maxT) использовали для отбора генов со статистически значимыми различиями, который представляет собой применение функции mt.maxT пакета “multtest” в R из Bioconductor, который применяет статистический тест и проводит жесткий контроль над частотой ложноположительных результатов. Применение этого статистического теста при величине p<0,001 к 224 олигонуклеотидам, которые прошли через фильтры, дало список из 7 олигонуклеотидов: SG117, SG428, SG459, SG461, SG493, SG507, SG508.

Стадии, использованные для получения списка из 7 значимых генов среди здоровых и страдающих CLL индивидуумов, были следующие:

Метод, который проводит перестановки и регулирует величину р resT<-mt.maxT (эксперименты (224 олигонуклеотида, которые прошли через фильтры и нормализованы из группы подготовки, Типы образцов в группе подготовки, test=“t”, B-100000): функцию mt.maxT, которая посредством перестановки регулирует величины вероятности (получение значимости), что обеспечивает жесткий контроль над частотой ложно положительных результатов.

Для этой функции должно быть обеспечено следующее:

1. Величины, к которым желательно применение статистических тестов, в данном случае к нормализованным величинам 83 олигонуклеотидов, которые прошли через фильтры.

2. Группы, между которыми желательно выявление различий, в данном случае 5 образцов клеток Jurkat в сравнении с 5 образцами клеток U937.

3. Число перестановок, выполнение которых желательно. В данном случае проводятся 100000 перестановок.

4. По умолчанию, в качестве статистического теста был выбран критерий Welch.

Статистически значимые гены на уровне p<0,001 были отобраны этим критерием, и было получено число 7.

4.2.3. Получение классификационной функции SPSS. Путем логистической регрессии по нормализованным величинам 7 статистически значимых олигонуклеотидов, полученным по 30 образцам, которые составляют Группу подготовки, и произвольным образом относя группу 0 к здоровым образцам и группу 1 к образцам CLL, получали величины квалификационной функции. Коэффициенты, соответствующие каждому олигонуклеотиду, представляли собой те, которые показаны ниже в таблице 10.

Таблица 10
Коэффициенты классификационной функции, рассчитанные логистической регрессией
Олигонуклеотид Коэффициенты (коэфф.)
SG117 2,44756372
SG428 7,38657611
SG459 23,1465464
SG461 43,6287742
SG493 -19,3978182
SG507 -2,80282646
SG508 49,5345672
Константа -719,241486

По этим коэффициентам для каждого образца i величина xi рассчитывается следующим образом:

xi=константа+(коэффициент ohle0009*Imni SG117)+(коэффициент SG428*Imni SG428)+(коэффициент SG459*Imni SG459)+(коэффициент SG461*Imni SG461)+(коэффициент SG493*Imni SG493)+(коэффициент SG507*Imni SG507)+(коэффициент SG508*Imni SG508),

где Imni представляет собой среднюю величину нормализованной интенсивности образца i.

По величине xi рассчитывается величина вероятности (pi). Чем ближе величина р:0, тем больше вероятность принадлежности к группе здоровых субъектов (обозначенной как группа 0), и чем ближе величина р:1, тем больше вероятность того, что имеется образец, относящийся к группе субъектов с CLL (обозначенной как группа 1). Формула, использованная для определения величины р, представляет собой

Pi=1/(1+e-xi).

Как показано в таблице 11, полученная функция правильно классифицировала 30 образцов, относящихся к группе подготовки. Чем ближе к 0, тем больше вероятность того, что индивидуум здоров, а чем ближе к 1, тем больше вероятность CLL.

Таблица 11
Классификационная таблицаа
Наблюдаемые Прогноз
EVOL Правильная процентная доля
0 1
Стадия 1 EVOL 0 10 0 100,0
1 0 20 100
Общая процентная доля 100,0
а. Величина отсечки составляет 0,500

4.2.3. Обоснование классификатора системы. Подетально описанным выше фильтрованным и нормализованным данным были получены величины Imni 7 олигонуклеотидов, которые составляют классификатор каждого из 38 образцов, которые составляют тестируемую группу.

Результаты обоснования классификатора системы. Ниже показаны таблицы, где получена величина Imni каждого из 7 олигонуклеотидов, включенных в классификатор, и величины xi и pi, рассчитанные в соответствии с ранее описанными формулами, полученные для каждого из 38 образцов тестируемой группы. Образцы, которые начинаются с буквы S, соответствуют здоровым субъектам, а образцы, которые начинаются с CLL, получены от субъектов с CLL. Правильно классифицированы 37 из 38 образцов. Неправильно классифицирован только образец CLL175, для которого получена величина pi=0.

Таблица 12
Результаты, полученные в тестируемой группе классификационной функцией, полученной логистической регрессией
Imni S229 S231 S232 S233 S251 CLL166 CLL184 CLL132 CLL210 CLL213 CLL214
SG117 4,89 5,17 5,14 5,33 5,37 6,17 7,45 7,05 7,06 6,88 6,86
SG428 4,82 4,80 4,52 4,69 4,52 5,74 6,97 6,46 6,66 6,08 6,49
SG459 6,50 6,95 6,10 6,59 5,96 8,11 9,04 8,71 8,13 8,15 8,40
SG461 6,47 6,41 6,44 6,43 6,05 6,35 7,22 6,99 6,75 6,75 7,04
SG493 7,20 7,31 7,02 7,16 6,83 7,53 7,69 7,35 7,43 7,35 7,57
SG507 8,32 7,82 7,26 7,77 7,47 9,11 9,82 9,32 9,19 8,49 9,18
SG508 6,67 6,82 6,34 6,82 6,81 7,79 8,71 7,80 7,55 7,66 7,68
xi -71,35 -56,83 -93,68 -61,26 -86,57 17,23 129,51 70,11 33,93 38,26 55,19
pi 0,00 0,00 0,00 0,00 0,00 1,00 1,00 1,00 1,00 1,00 1,00
Imn i CLL221 CLL208 CLL225 CLL236 CLL240 CLL168 CLL172 CLL174 CLL175 CLL177
SG117 7,00 7,42 6,91 6,40 6,76 7,34 7,32 7,40 5,32 7,72
SG428 6,40 6,98 6,00 6,24 6,09 6,77 6,16 7,49 4,85 6,38
SG459 7,93 8,54 8,01 7,55 8,19 8,94 8,86 8,69 7,72 8,78
SG461 6,77 7,18 6,89 6,79 6,54 6,72 7,02 7,18 5,98 6,86
SG493 7,14 7,92 7,72 7,47 6,73 7,97 7,96 8,45 7,16 8,05
SG507 9,00 8,98 8,41 8,74 8,80 9,53 9,67 10,09 8,76 9,76
SG508 7,50 7,43 7,22 7,36 6,90 8,08 7,38 7,81 6,43 7,94
xi 31,80 50,30 12,52 8,94 3,77 67,59 39,95 63,19 -75,92 59,42
p i 1,00 1,00 1,00 1,00 0,98 1,00 1,00 1,00 0,00 1,00
Imni CLL179 CLL181 CLL182 CLL164 CLL159 CLL142R CLL105 CLL107 CLL109 CLL112
SG117 6,89 6,92 6,14 8,03 6,98 6,80 6,52 6,17 6,79 7,31
SG428 6,32 6,22 5,64 5,40 5,55 5,94 6,05 5,74 5,81 6,52
SG459 8,52 8,71 8,35 8,54 8,00 8,87 8,32 8,11 8,20 8,77
SG461 6,83 6,95 6,87 6,96 6,63 7,07 6,72 6,35 6,66 6,80
SG493 7,99 7,92 7,71 7,73 7,49 7,96 7,79 7,53 7,70 7,99
SG507 9,40 9,53 9,37 8,86 9,34 9,49 9,49 9,11 8,89 9,41
SG508 8,17 8,18 7,37 7,80 7,81 7,97 7,75 7,79 7,46 7,69
xi 62,78 73,52 19,76 53,03 28,34 68,92 33,36 17,23 16,00 45,86
p i 1,00 1,00 1,00 1,00 1,00 1,00 1,00 1,00 1,00 1,00
Imni CLL151 CLL158 CLL169 CLL171 CLL178 CLL111 CLL155
SG117 6,51 7,26 6,79 7,76 6,62 6,51 6,90
SG428 6,14 6,17 5,81 5,96 5,97 6,14 5,44
SG459 8,40 8,81 8,20 9,18 8,77 8,40 8,44
SG461 6,64 7,01 6,66 7,10 6,79 6,64 6,71
SG493 8,00 8,12 7,70 8,03 8,05 8,00 7,91
SG507 9,11 9,36 8,89 9,52 9,36 9,11 9,35
SG508 7,87 8,29 7,46 7,99 8,06 7,87 8,23
xi 35,32 81,12 16,00 79,33 57,33 35,32 53,92
p i 1,00 1,00 1,00 1,00 1,00 1,00 1,00

Была сформирована третья группа из 40 образцов. Для этого использовали реплики гибридизации или мечения (образцы, название которых начинается с S и Strans, представляют собой образцы от людей, считающихся здоровыми, а образцы, которые начинаются с CLL, представляют собой образцы от пациентов с хроническим лимфолейкозом). Эту группу образцов использовали для обоснования классификационной системы. Данные были нормализованы, как было ранее описано. Результаты классификации показаны в таблице 13. Правильно классифицированы 40 из 40 образцов.

Таблица 13
Результаты, полученные при обосновании классификационной функции, полученные логистической регрессией
Imni S120.7 S120.14 Strans.3 Strans.4 S150.2 S228.6 S229.7 CLL142.8 CLL147.9 S120.7
SG117 5,22 5,40 5,41 4,95 5,47 6,05 5,34 7,06 5,39 5,22
SG428 4,95 4,64 4,29 4,20 5,01 3,89 5,07 6,31 5,59 4,95
SG459 6,39 6,14 5,46 4,98 7,14 5,72 6,23 9,01 8,56 6,39
SG461 5,73 6,16 6,23 6,38 6,72 6,01 6,39 7,02 7,05 5,73
SG493 6,78 7,05 5,03 5,15 6,95 6,37 6,22 7,87 8,07 6,78
SG507 7,83 7,62 5,83 5,78 8,17 7,26 7,85 9,74 8,82 7,83
SG508 6,42 6,46 6,90 4,56 6,62 6,70 6,71 8,19 8,17 6,42
xi -107,44 -99,01 -48,21 -172,85 -40,21 -93,50 -56,20 85,27 64,43 -107,44
p i 0,00 0,00 0,00 0,00 0,00 0,00 0,00 1,00 1,00 0,00
Imni CLL148b.10 CLL148c.11 CLL111.12 CLL163.13 CLL108.15 CLL160.1 CLL160.2 CLL187.5
SG117 6,98 6,83 6,54 6,16 6,87 7,74 7,71 7,58
SG428 6,64 6,63 6,17 5,61 6,56 5,92 5,69 7,24
SG459 9,13 9,29 8,44 8,33 8,55 8,29 8,25 9,01
SG461 7,16 7,48 6,67 6,61 6,86 7,21 7,25 7,35
SG493 7,70 7,89 8,05 7,92 7,67 7,66 7,58 8,05
SG507 9,90 10,02 9,16 9,16 9,66 8,88 8,93 9,99
SG508 8,27 8,45 7,92 7,86 7,89 7,57 7,51 8,30
xi 102,70 125,01 39,43 28,30 58,29 51,63 48,76 109,23
p i 1,00 1,00 1,00 1,00 1,00 1,00 1,00 1,00
Imni CLL197.14 CLL198.15 CLL199.16 CLL200.17 CLL201.18 CLL20_LE CLL208.1 CLL210.2
SG117 6,66 6,13 7,14 7,58 7,97 6,67 7,40 7,11
SG428 5,98 5,10 6,71 6,72 7,54 5,97 6,77 6,71
SG459 8,35 7,97 8,34 8,99 9,30 8,26 8,34 8,19
SG461 6,76 6,36 7,02 7,26 7,35 6,83 6,99 6,79
SG493 7,80 7,27 7,96 8,09 8,39 7,53 7,44 7,48
SG507 9,38 8,71 9,58 9,87 10,23 9,04 8,65 9,26
SG508 8,00 7,48 7,72 8,64 8,76 7,17 7,09 7,61
xi 48,40 0,40 48,33 116,75 134,69 14,31 29,64 39,38
p i 1,00 0,60 1,00 1,00 1,00 1,00 1,00 1,00
Imni CLL225.6 CLL236.7 CLL240.8 CLL184b.9 CLL184c.10 CLL208.1 CLL213.5 CLL214.6
SG117 7.35 6,54 6,80 7,12 7,06 7,24 6,97 7,06
SG428 6,46 6,43 6,11 6,97 6,36 6,34 5,80 6,45
SG459 8,20 7,60 8,24 8,37 8,37 8,07 8,17 8,35
SG461 6,90 6,85 6,58 7,05 6,73 6,53 6,43 6,79
SG493 7,28 6,90 6,77 7,40 7,17 7,59 7,47 7,63
SG507 8,45 8,55 8,85 9,22 8,88 8,08 8,61 9,13
SG508 7,13 7,29 6,93 8,21 8,01 7,14 7,77 7,72
xi 25,36 22,47 7,52 88,13 65,29 0,80 26,04 44,00
p i 1,00 1,00 1,00 1,00 1,00 0,69 1,00 1,00
Imni CLL221.7 CLL193.1 CLL193.2 CLL197.1 CLL197.2
SG117 6,97 6,76 6,73 6,22 6,00
SG428 6,47 7,26 7,22 5,81 5,71
SG459 7,98 8,28 8,27 8,26 8,07
SG461 6,60 7,18 7,17 6,78 6,62
SG493 7,66 7,95 7,93 7,79 7,85
SG507 9,23 9,01 9,04 8,86 8,72
SG508 7,74 7,68 7,77 7,55 7,64
xi 27,46 56,71 60,37 23,63 14,87
p i 1,00 1,00 1,00 1,00 1,00

Пример 5

Результаты, полученные с образцами «стабильных» клеток, по сравнению с образцами «прогрессирующего» CLL

Образцы «CLL-стабильного типа» (S) считаются те, которые получены у пациентов, имеющих стабильный CLL в течение 5 лет, а образцами «CLL-прогрессирующего типа» (Р) считаются образцы от пациентов, классифицированных как стабильные во время диагностики, и заболевание которых прогрессировали менее чем за один год.

Анализировали всего 6 образцов S и 6 образцов Р. 12 образцов брали во время диагностики, без клинических различий между ними, но через 1 год, у 6 из этих пациентов наблюдалось прогрессирование заболевания. 12 гибридизаций прошли указанные выше критерии качества.

Стабильные образцы: E142R, E148, E156, E163, E164, E193.

Прогрессирующие образцы: Р111, Р105, Р177, Р158, Р157 и Р197.

Анализ всех данных выполняли в версии 1.9.1. языка программирования R.

Нормализация данных. В этом случае и во избежание того, что значимые гены получены вследствие действительных различий между образцами, а не вследствие эффекта нормализации, данные нормализовали в двух различных формах («нормализация стабилизацией дисперсии» (vsn) и надежными квантилями), и при каждой нормализации выполняли одинаковый статистический анализ.

- Статистический анализ нормализованных данных «нормализацией стабилизации дисперсии». Список статистически значимых генов получали по критерию Welch функцией mt.maxT пакета множественного тестирования в языке программирования R, при величине p<0,05 без коррекции, т.е. без выполнения какого-либо контроля за ложно положительным результатам, и получили список из 29 генов со статистически значимыми различиями между группами CLL-стабильного типа и CLL-прогрессирующего типа.

Полученные статистически значимые олигонуклеотиды представляли собой:

SG26, SG31, SG70, SG98, SG177, SG194, SG195, SG208, SG213, SG216, SG272, SG293, SG301, SG309, SG321, SG333, SG343, SG352, SG357, SG366, SG368, SG405, SG426, SG439, SG447, SG452, SG521, SG555, SG556.

Образцы группировали, что выполнялось функцией hclust пакета stats в R, применяя корреляции Pearson. Полученное дерево показано в части А фиг.4.

Иерархическая группировка 12 образцов в соответствии с экспрессией полученных 29 статистически значимых генов правильно группировала образцы: дерево содержит 2 основные ветви, правая из которых содержит 6 стабильных образцов, а левая ветвь содержит 6 прогрессирующих образцов.

Статистический анализ нормализованных данных надежными квантилями. Список статистически значимых генов получали по критерию Welch функцией mt.maxT пакета множественного тестирования в языке программирования R, при величине p<0,05 без коррекции, т.е. без выполнения какого либо контроля за частотой ложно положительных результатов, и получили список из 19 генов со статистически значимыми различиями между группами CLL-стабильного типа и CLL-прогрессирующего типа.

SG26, SG31, SG177, SG194, SG195, SG197, SG213, SG216, SG293, SG301, SG309, SG333, SG343, SG357, SG366, SG439, SG452, SG555, SG556.

Контролируемая группировка из 12 образцов в соответствии с экспрессией полученных 19 статистически значимых генов предоставила дерево, которое показано в части В фиг.4, где также представлены правильно сгруппированные образцы.

Были отобраны 18 олигонуклеотидов, общих для обоих списков статистически значимых олигонуклеотидов, и рассчитывали среднюю интенсивность каждого из них в группе стабильных образцов и в группе прогрессирующих образцов, а также вариацию и среднюю интенсивность между стабильной и прогрессирующей группами. Полученные величины показаны в таблице 14.

Таблица 14
Величины, соответствующие интенсивности 18 значимых олигонуклеотидов для различения CLL-стабильных и CLL-прогрессирующих
Зонд Статистическая значимость (данные величины р) Группа стабильного CLL Группа прогрессирующего CLL Изменение стабильный/прогрессирующий
Средняя интенсивность SD Средняя интенсивность SD
SG177 0,001 14 1,71 21 4,84 0,7
SG366 0,001 18 2,33 14 1,80 1,3
SG309 0,004 20 2,76 15 3,58 1,4
SG26 0,005 97 19,20 70 13,24 1,4
SG452 0,010 16 2,19 12 3,08 1,3
SG216 0,012 46 14,64 31 7,13 1,5
SG333 0,013 36 7,28 53 16,25 0,7
SG357 0,014 134 6,50 175 38,67 0,8
SG213 0,014 26 5,51 41 17,20 0,6
SG31 0,014 69 32,50 30 10,57 1,8
SG301 0,014 21 5,02 16 3,10 1,4
SG194 0,019 37 9,52 50 9,95 0,7
SG456 0,022 11 2,06 14 2,08 0,8
SG293 0,029 17 1.88 21 3,72 0,8
SG343 0,033 27 7,43 21 1,61 1,3
SG439 0,038 18 2.00 20 1,74 0,9
SG195 0,041 21 3,56 25, 4,60 0,8
SG555 0,049 163 23,55 137 20,69 1,2

Для обоснования результатов, полученных с микрочипом, были выбраны 5 общих статистически значимых зондов после сравнения данных экспрессии от субъектов со стабильным CLL по сравнению с субъектами с прогрессирующим CLL, и экспрессию изучали RT-PCR (полимеразной цепной реакцией обращенного типа) генов, представленных этими зондами. Использовали следующие критерии для отбора 5 зондов: интенсивность гибридизации, изменение интенсивности между стабильной и прогрессирующей группами и величина статистической значимости. Таким образом, были отобраны 5 зондов, которые представляют гены PSMB4, CD23A, LCP1, ABCC5 и POU2F2. Экспрессию этих 5 генов определяли в 11 из 12 образцов типа CLL, так как не было общей РНК образца 105. Величиной экспрессии генов в каждом образце определяли частоту изменения между стабильной и прогрессирующей группами и величину значимости этой вариации, и ее сравнивали с результатами, полученными микрочипами.

Методика, использованная для обоснования, представляла собой RT-PCR или PCR (полимеразную цепную реакцию) в реальном масштабе времени, с использованием LightCycler. Эта методика представляет собой методику выбора для обоснования чипов данных и как с микрочипами, и измеряет уровень мРНК.

Затравки были сконструированы для каждого из 5 генов, чей репрезентативный олигонуклеотид был выбран. Их детали показаны ниже в таблице 15.

Таблица 15
Затравки и продукты амплификации генов, выбранных для их обоснования RT-PCR
Ген Последовательности затравки (5'-3') SEQ ID NO: Размер амплифицированного продукта Tm
PSMB4 Прямая: PSMB4_F
TTCTGGGAGATGGACACAGCTATA
SEQ ID NO:598 95pb 81°C
Инверсная: PSMB4_R
CCACAAAGGGTTCATCTTCGA
SEQ ID NO:599
CD23A Прямая: CD23A_F
TGCCCTGAAAAGTGGATCAAT
SEQ ID NO:600 97pb 82°C
Обратная: CD23A_R
CCATGTCGTCACAGGCATACC
SEQ ID NO:601
LCP1 Прямая: LCP1_F
CCAGGTACCCTTCTCGCTTTT
SEQ ID NO:602 126pb 77°C
Обратная: LCP1_R
CTCCTGGCCCTCATCTTGAA
SEQ ID NO:603
ABCC5 Прямая: ABCC5_F
CCCTCAAAGTCTGCAACTTTAAGC
SEQ ID NO:604 119pb 82°C
Обратная: ABCC5_R
ACACACCAAACCACACAGCAA
SEQ ID NO:605
POU2F2 Прямая: POU2F2_F
GAGGACCAGCATCGAGACAAA
SEQ ID NO:606 136pb 82°C
Обратная: POU2F2_R
AACCAGACGCGGATCACTTC
SEQ ID NO:607

На фиг.5 показано распределение данных экспрессии, полученных RT-PCR (левый график) и микрочипом (правый график). Часть А соответствует гену PSMB4, часть В - гену CD23A и часть с - гену POU2F2.

Ниже в таблице 16 показаны полученные микрочипом RT-PCR результаты величин изменения 5 генов, выбранных в группе стабильных образцов, по сравнению с группой прогрессирующих образов, полученные в виде статистической значимости изменения. У 3 из 5 отобранных генов (PSMB4, CD23A и POU2F2) величины изменения, направление изменения и величины статистической значимости, полученные RT-PCR, согласуются с результатами, полученными микрочипом, и по этой причине эти 3 гена считаются обоснованными, т.е. результаты, полученные для этих 3 генов микрочипом, совпадают с результатами, полученными другими методиками, которые также измеряют уровень мРНК.

Таблица 16
Величины изменения и статистической значимости изменения, полученные микрочипом и RT-PCR
Стабильное/прогрессирующее изменение Статистическая значимость изменения
Зонды Гены Чип RT-PCR Чип RT-PCR
SG26 PSBM4 1,3 1,5 0,04 0,15
SG216 CD23A 1,5 3,2 0,04 0,03
SG333 LCP1 0,7 1 0,05 0,97
SG357 ABCC5 0,8 1,3 0,10 0,28
SG366 POU2F2 1,3 2,3 0,01 0,05

БИБЛИОГРАФИЧЕСКИЕ ССЫЛКИ

Краткое описание чертежей

На фиг.1 показана группировка образцов клеток U937 в сравнении с клетками Jurkat, в соответствии с различиями экспрессии гена между образцами. Часть А соответствует неконтролируемой группировке; часть В соответствует контролируемой группировке.

На фиг.2 показана группировка образцов здоровых субъектов по сравнению с клетками U937 и Jurkat, в соответствии с различиями экспрессии гена между образцами. Часть А соответствует неконтролируемой группировке; часть В соответствует контролируемой группировке.

На фиг.3 показана группировка образцов от пациентов с хроническим лимфолейкозом по сравнению с клетками U937 и Jurkat, в соответствии с различиями экспрессии гена между образцами. Часть А соответствует неконтролируемой группировке; часть В соответствует контролируемой группировке.

На фиг.4 показана группировка образцов от пациентов со «стабильным» хроническим лимфолейкозом по сравнению с образцами от пациентов с «прогрессирующим» хроническим лимфолейкозом, в соответствии с различиями экспрессии гена между образцами. Часть А соответствует группировке в соответствии с генами, идентифицированными как значимые, после нормализации “vsn” и использования функции mt.maxT в R; часть В соответствует группировке в соответствии с генами, идентифицированными как значимые надежными квантилями и использованием функции mt.maxT в R.

На фиг.5 показано распределение данных экспрессии, полученных RT-PCR (левый график) и по величинам интенсивности, полученным микрочипом (правый график) для генов PSMB4 (часть А: верхний график), CD23A (часть В: промежуточный график) и POU2F2 (часть С: нижние графики), в образцах от пациентов со «стабильным» хроническим лимфолейкозом (столбцы, отмеченные буквой «Е») и в образцах от пациентов с «прогрессирующим» хроническим лимфолейкозом (столбцы, отмеченные буквой «Р»).

1. Композиция для прогнозирования in vitro развития заболевания у субъекта с хроническим лимфолейкозом, которая содержит, по меньшей мере, группу из трех олигонуклеотидов: SEQ ID NO:26, SEQ ID NO:216 и SEQ ID NO:366 (или 367).

2. Композиция по п.1, дополнительно содержащая пару олигонуклеотидов SEQ ID NO:463 и SEQ ID NO:464 и/или пару олигонуклеотидов SEQ ID NO:466 и SEQ ID NO:467.

3. Композиция по п.1, дополнительно содержащая, по меньшей мере, один олигонуклеотид из группы: SEQ ID NO:584-590.

4. Композиция по п.1, дополнительно содержащая, по меньшей мере, один олигонуклеотид из группы: SEQ ID NO:572, SEQ ID NO:573, SEQ ID NO:576, SEQ ID NO:578, SEQ ID NO:581, SEQ ID NO:582 и SEQ ID NO:583.

5. Композиция по п.1, дополнительно содержащая, по меньшей мере, один олигонуклеотид из группы: SEQ ID NO:571, SEQ ID NO:575, SEQ ID NO:577, SEQ ID NO:580, SEQ ID NO:564, SEQ ID NO:565, SEQ ID NO:566, SEQ ID NO:567, SEQ ID NO:568, SEQ ID NO:569 и SEQ ID NO:570.

6. Микрочип, содержащий композицию по любому из пп.1-5.

7. Применение микрочипа по п.6 для прогнозирования in vitro развития заболевания у субъекта с хроническим лимфолейкозом.

8. Способ прогнозирования in vitro развития заболевания у субъекта, страдающего хроническим лимфолейкозом, с помощью композиции по любому из пп.1-5, в котором классификация субъектов проводится после выявления in vitro и статистического анализа уровня экспрессии в соответствующих образцах крови, по меньшей мере, генов PSMB4, FCER2 и POU2F2.



 

Похожие патенты:
Изобретение относится к области биотехнологии, конкретно к способу дифференциации штаммов возбудителя чумы основного и неосновных подвидов и возбудителя псевдотуберкулеза.
Изобретение относится к области молекулярной биологии и генетической инженерии и может быть использовано в медицинской генетике. .

Изобретение относится к области аналитической биохимии, а точнее анализу ДНК. .
Изобретение относится к области физики и биологии, может быть использовано для экологического мониторинга водоемов. .

Изобретение относится к области биотехнологии, конкретно к способу определения целостности ДНК в бактериях, и может быть использовано в микробиологических исследованиях.

Изобретение относится к области биотехнологии, а именно к способу количественного анализа количества клеток представляющей интерес бактерии в живом состоянии, праймеру для применения в данном способе и к набору для осуществления данного способа.

Изобретение относится к области биотехнологии и вирусологии. .

Изобретение относится к области медицины. .

Изобретение относится к области биотехнологии, а именно к способу количественного анализа количества клеток представляющей интерес бактерии в живом состоянии, праймеру для применения в данном способе и к набору для осуществления данного способа.

Изобретение относится к биотехнологии и представляет собой применение киРНК, способной ингибировать экспрессию 11бета-стероидной дегидрогеназы 1 (11beta-HSD1), для получения лекарственного средства для лечения глазной болезни, отличающейся изменением внутриглазного давления (ВГД).

Изобретение относится к биотехнологии и представляет собой новые эндо-(1-4)- -D-ксиланазы мицелиального гриба Penicillium canescens. .

Изобретение относится к выделенному вирусу растений, названному вирус томата торрадо (ToTV), и его компонентам, а также к способам получения устойчивых к ToTV растений. .

Изобретение относится к области биотехнологии и медицины, а именно к прямым ингибиторам тромбина. .

Изобретение относится к области медицины и касается дозирования олигонуклеотида
Наверх