Определение предрасположенности к раку путем идентификации генотипических комбинаций специфичных вариантов генов cyp1b1, brca2 и снек2



Определение предрасположенности к раку путем идентификации генотипических комбинаций специфичных вариантов генов cyp1b1, brca2 и снек2
Определение предрасположенности к раку путем идентификации генотипических комбинаций специфичных вариантов генов cyp1b1, brca2 и снек2
Определение предрасположенности к раку путем идентификации генотипических комбинаций специфичных вариантов генов cyp1b1, brca2 и снек2
Определение предрасположенности к раку путем идентификации генотипических комбинаций специфичных вариантов генов cyp1b1, brca2 и снек2
Определение предрасположенности к раку путем идентификации генотипических комбинаций специфичных вариантов генов cyp1b1, brca2 и снек2

 


Владельцы патента RU 2470998:

ЦЫБУЛЬСКИЙ Цезарий (PL)
СЕРРАНО-ФЕРНАНДЕС Пабло (PL)
ГОРСКИЙ Бохдан (PL)
МАТИЯСИК Иоанна (PL)
ЛЮБИНСКИ Ян (PL)
КУРЗАВСКИЙ Гжегож (PL)
ДЕБНЯК Тадеуш (PL)
СУХИ Янина (PL)
ПОМОРСКИ УНИВЭРСИТИТ МЭДИЧНЫ, (PL)

Настоящее изобретение относится к области медицинской генетики и может быть использовано для диагностики предрасположенности к раку молочной железы. Предложен способ выявления повышенного риска заболевания субъекта-человека раком молочной железы, основанный на результатах анализа образца ДНК на наличие SNP в позициях 142, 355 и 4326 гена CYP1B1; делеционных вариантов 1100 delC, del5395, а также IVS2+1G>A гена СНЕК2 и замены С5972Т в гене BRCA2. При этом определены комбинированные генотипы по всем указанным позициям трех названных генов, при которых риск развития рака молочной железы превышает сумму эффектов, определяемых соответствующими вариантами каждого из трех генов в отдельности, которые рассматриваются как признак особой предрасположенности субъекта к заболеванию (непропорционально высокого риска заболевания) раком молочной железы. Этот способ с высокой степенью вероятности можно применять к исследованию различных этнических групп. 3 н. и 7 з.п. ф-лы, 2 табл., 1 пр.

 

Область изобретения

Способ и композиция для обнаружения наследственной предрасположенности к ракам различных локализаций и применение конкретных генотипических комбинаций вариантов генов CYP1B1, CHEK2 и BRCA2 зародышевой линии для диагностики такой предрасположенности составляют объект изобретения. В целом изобретение относится к новому способу диагностики. Объект изобретения дает возможность синтезировать ДНК и идентифицировать геномные аномалии, которые коррелируют с повышенной генетической предрасположенностью к ракам различных органов, которая не просто составляет сумму эффектов отдельных рассматриваемых вариантов.

На протяжении всего текста данного описания процитировано несколько документов. Каждый из документов, цитируемых здесь (включая любые спецификации, инструкции изготовителей и т.д.), включены здесь путем ссылки; однако любой цитируемый документ в действительности составляет предшествующий уровень техники по отношению к настоящему изобретению.

Предшествующий уровень техники

CYP1B1

CYP1B1 представляет собой один из основных ферментов цитохрома Р450, вовлеченных в канцерогенное гидроксилирование (Hayes et al., Proc. Natl. Acad. Sci. USA 93:9776-81, 1996; Shimada et al., Cancer Res. 56:2979-84, 1996; Spink et al, J. Steroid. Biochem. Mol. Biol. 51:251-8, 1994). Активность гидроксилирования CYP1B1 метаболизирует эстрадиол до 4-гидроксиэстрадиола, который представляет собой катехиновый эстроген, который, как показано, индуцирует депуринизацию ДНК, которая приводит к мутациям в ДНК (Bailey et al., Cancer Res. 58:5038-41, 1998; Chakravarti et al., Oncogene 20:7945-53, 2001; Spink et al., J. Steroid. Biochem. Mol. Biol. 2/3:223-32, 1997). В дополнение к эстрогенам CYP1B1 также активирует ряд химически различающихся проканцерогенов, включая бензо[а]пирен (Rylander-Rudqvist et al., Carcinogenesis 24:1533-9, 2003; Shimada et al., Cancer Res. 56:2979-84, 1996, 20).

В нескольких исследованиях показано, что некоторые варианты CYP1B1 проявляют необычно высокие активности канцерогенного гидроксилирования (Hanna et al., Cancer Res. 60:3440-4, 2000; Shimada et al, Cancer Res. 56:2979-84, 1996; Shimada et al., Carcinogenesis 20/8:1607-13, 1999). Предположены потенциальные взаимоотношения между различными сайтами однонуклеотидного полиморфизма (SNP), присутствующими в человеческом гене CYP1B1, и встречаемостью различных типов рака (Fritzsche et al., Pharmacogenetics 9:405-8, 1999; Goodman et al., Cancer Epidemiol Biomarkers Prev. 10(3):209-16, 2001).

В WO 02/04683 показан способ идентификации людей с повышенным риском эстрогензависимых типов рака, в частности рака молочной железы, где исследуют генотипы CYP1B1, CYP1A1, СОМТ и GSTM1. Среди SNP, встречающихся в гене CYP1B1, только кодоны 432 и 453 используют в вышеуказанной заявке. Патентная заявка US 2004/0002071 описывает способ оценки риска рака молочной железы путем исследования по меньшей мере двух генов. Среди аллелей, повышающих вероятность рака, существует два аллеля CYP1B1, содержащие G или С в положении нуклеотида 1294 (№ по GeneBank U 56438), которое соответствует кодону 432.

Вариант CYP1B1 355T/T положительно ассоциирован с развитием рака простаты (Tanaka et al., BBRC 296:820-6, 2002) с более активными клиническими характеристиками (Cicek et al., Cancer Epidemiol. Biomarkers Prev. 14(9):2173-7, 2005), а также ассоциирован с раком почки (Sasaki et al., Clinical Cancer Res. 10:2015-9, 2004) и раком молочной железы и гортани с ранним началом (Jaworoska et al., Breast Cancer Res. Treat. 97(2):215-9, 2006). Эффекты предрасположенности варианта 355T/T к раку во множественных локализациях также составили объект патента US 60/693149.

В некоторых сообщениях также показана связь целого гаплотипа полиморфных SNP гена CYP1B1 с раком. Было доказано, что гаплотип G-G-C-48G119 ассоциирован с повышенным риском рака простаты, а гаплотипы T-A-T-G48119 и G48-T119-C432-A453 ассоциированы с пониженным риском рака простаты (Chang et al., British J. Cancer 89:1524-9, 2003). Гаплотип 355Т-4326С положительно ассоциирован с раком простаты среди мужчин с высоко активным течением заболевания (Cicek et al., Cancer Epidemiol. Biomarkers Prev. 14(9):2173-7, 2005).

CHEK2

CHEK2 (также известный как "CHK2" [MM 604373]) представляет собой киназу контрольной точки клеточного цикла, которая активируется в ответ на повреждение ДНК. Активированная CHEK2 фосфорилирует белки BRCA1 и ТР53, регулируя функцию опухолевой супрессии этих белков, и, таким образом, предотвращает пролиферацию пораженной клетки (Matsuoka et al, Proc. Natl. Acad. Sci. USA, 97:10389-94, 2000; Chaturvedi et al., Oncogene 18:4047-54, 1999; Ahn et al, Cancer Res. 60:5934-6, 2000; Falck et al., Nature 410:842-7, 2001; Chehab et al., Genes Dev. 14:278-288, 2000; Shieh et al., Genes Dev. 14:289-300, 2000; Lee et al, Nature 404:201-4, 2000).

В Польше существует, в основном, четыре полиморфных варианта CHEK2, которые присутствуют у 5,7% населения, взятых вместе; три из них (1100delC, del5395 и IVS2+1G>A) являются относительно редкими и приводят в результате к преждевременному укорочению белка. Третий является распространенным миссенс-вариантом (I157T), который приводит в результате к аминокислотной замене: изолейцин на треонин.

Обнаружено, что все четыре варианта ассоциированы с повышенной предрасположенностью к раку молочной железы (Cybulski et al. Clin. Cancer Res., 12(16):4832-5, 2006; Cybulski et al., Breast Cancer Res. Treat, электронный препринт, 2006, Weischer et al., J. Clin. Oncol. электронный препринт, 2006). Вариант I157T также предрасполагает к раку прямой и ободочной кишки (Kilpivaara et al, J. Med. Genet. 43(7):e34, 2006), некоторым типам рака яичника (Szymanska-Pasternak et al., Gynecol. Oncol, электронный препринт, 2006) и раку простаты (Seppala et al., Br. J. Cancer, 89:1966-70, 2003). Вариант 1100delC также повышает риск рака простаты (Seppala et al., Br. J. Cancer, 89:1966-70, 2003). Хотя полный диапазон типов рака, ассоциированных с инактивирующими мутациями CHEK2, еще не определен, доказано, что эти мутации вовлечены в рак множественной локализации по меньшей мере для населения Польши и другого.

В патенте WO 2005/068659 заявлена идентификация вариантов, укорачивающих белок, IVS2+1G>A и 1100delC, и миссенс-варианта I157T CHEK2 как индикаторов повышенного риска рака прямой и ободочной кишки и простаты.

BRCA2

Ген склонности к раку молочной железы 2 (BRCA2, breast cancer susceptibility gene 2) является высоко полиморфным геном, играющим, как известно, основную роль в репарации ДНК и контроле клеточной пролиферации. Ген BRCA2 стимулирует гомологичную рекомбинацию, которая включает один из основных биохимических путей репарации двунитевых разрывов ДНК и, следовательно, может функционировать для поддержания целостности генома и подавления малигнизации пролиферирующих клеток (Sharan et al, Nature 386:804-810, 1997; Xia et al., Proc. Nat. Acad. Sci. 98:8644-49, 2001; Moynahan et al., Mol. Cell 7:263-272, 2001; Davies et al., Mol. Cell 7:273-282, 2001).

Продемонстрировано, что несколько вариантов BRCA2, такие как 6174delT, A1342C, 999del5, 185delAG, 5382insC, 6174delT, 8765delAG и другие, повышают риск рака молочной железы (Friedman et al., Am. J. Hum. Genet. 63:1224-1227, 1998; Healey et al., Nat. Genet. 26(3): 362-4, 2000; Tulinius et al, J. Med. Genet. 39(7):457-62, 2002; Tonin et al., Am. J. Hum. Genet. 63(5):1341-51, 1998), а также других типов рака, таких как рак желудка, яичников, простаты, поджелудочной железы, женских половых путей, щитовидной железы или прямой и ободочной кишки (Risch et al., Am. J. Hum. Genet. 68(3):700-10, 2001; Thorlacius et al., Nat. Genet. 13(1):117-9, 1996). Особенно интересующим население Польши является вариант BRCA2 С5972Т, который повышает риск развития рака молочной железы в молодом возрасте (Gorski et al., Breast Cancer Res. 7(6):R1023-7, 2005). Панели скрининга для нескольких вариантов BRCA2, разработанные для оценки рака молочной железы и яичника, уже являются объектом международных заявок и патентов США (WO 99/15701; WO 99/15704; WO 99/28506; WO 99/09164; WO 03/068054; US 6033857; US 2004115717; US 2006154272), включая вариант BRCA2 С5972Т, который является вариантом риска в панели, заявленной в патенте США US 6033857. Также вариант сплайсинга BRCA2 заявлен как потенциальный маркер рака молочной железы и яичника в US 2002031785.

Генетические взаимодействия

Комбинированное использование различных генов для достижения конкретной цели является общим объектом патентных заявок в биотехнологии. Однако существует прецедент использования генетических взаимодействий в диагностических и превентивных целях в медицинской генетике. Обнаружение некоторых мутаций гена RAD51 заявлено как способ диагностики генетической предрасположенности или склонности к раку молочной железы среди носителей мутаций BRCA1 и BRCA2 (WO 01/18254), что, таким образом, указывает на возможное взаимодействие между генами BRCA1 и BRCA2 с геном RAD51. В WO 2006/044933 заявлено применение соединений, которые прерывают взаимодействие между RAD51 и BRCA2, в контексте терапии рака. Взаимодействия между вариантами генов CYP1B1, CHEK2 и BRCA2 никогда не были опубликованы ни в научной литературе, ни как объект патентной заявки. Способ диагностики для идентификации повышенной предрасположенности к раку различных локализаций является основной темой в медицинской генетике. С развитием новых технологий и расширенных баз данных центр внимания перемещается от конкретных генетических вариантов, ассоциированных с повышенным риском рака, к специфичным взаимодействиям между этими генами, которые модулируют этот риск нелинейным путем. Целью данного изобретения является разработка способов и композиций, которые могут быть полезны при обнаружении повышенной/пониженной наследственной предрасположенности к ракам различных локализаций.

Краткое описание изобретения

Объектом изобретения является способ обнаружения генетической предрасположенности к ракам различных локализаций, характеризующийся анализом биологического материала, полученного от пациента, при поиске комбинированных генотипов, основанных на SNP C142G, G355T и C4326G в гене CYP1B1; укорачивающих вариантов 1100delC, del5395 и IVS2+1G>A и миссенс-варианта I157T гена CHEK2; и варианта С5972Т гена BRCA2, где присутствие какой-либо из исследуемых генотипических комбинаций (представленных в таблицах А и Б) упомянутых вариантов этих трех генов является показателем предрасположенности повышенного риска к раку молочной железы и, с высокой вероятностью, ободочной кишки, почки, гортани, легкого, поджелудочной железы, простаты, щитовидной железы, женских половых путей и яичников, который качественно и количественно отличается от суммы эффектов низкого риска упомянутых вариантов этих трех генов, взятых по отдельности.

Таблица А
Перечень вариантов CYP1B1 (в 3 кодонах: 48, 119 и 432), CHEK2 и BRCA2, которые взаимодействуют друг с другом, повышая риск развития рака, нелинейным образом
1 CYP1B1 Локализация рака
48 119 432 Молочная железа, ободочная кишка, гортань, легкое, поджелудочная железа, простата, почка
1.1 не G/G не G/G С/С
1.2 С/С G/G не G/G
1.3 G/G T/T С/С
2 CHEK2 Молочная железа, ободочная кишка, яичники, простата
2.1 1100delC
2.2 del5395
2.3 IVS2+1G>A
2.4 I157T
3 BRCA2 Молочная железа
3.1 C5972T
Таблица Б
Перечень генотипических комбинаций между различными вариантами CYP1B1, CHEK2 и BRCA2 (описанных в таблице А), приводящих к непропорциональному повышению риска рака молочной железы
Варианты CYP1B1 1.1 или 1.2 или 1.3 Варианты CHEK2 2.1 или 2.2 или 2.3
Варианты CHEK2 2.1 или 2.2 или 2.3 или 2.4 вариант BRCA2 3.1
Варианты CYP1B1 1.1 или 1.2 или 1.3 Варианты CHEK2 2.1 или 2.2 или 2.3 или 2.4 вариант BRCA2 3.1

Варианты CYP1B1 зародышевой линии в положениях 142 (кодон 48), 355 (кодон 119) и 4326 (кодон 432), которые описаны в таблице А, приводят к продуцированию измененных вариантов РНК и белка CYP1B1. Эти варианты включают три комбинации, приведенные ниже. Первая: 142 негомозиготный G (по меньшей мере один из обоих аллелей кодирует аргинин в кодоне 48) и 355 негомозиготный G (по меньшей мере один из обоих аллелей кодирует серин в кодоне 119) и 4326 гомозиготный С (оба аллеля кодируют лейцин в кодоне 432). Вторая: 142 гомозиготный С (оба аллеля кодируют аргинин в кодоне 48) и 355 гомозиготный G (оба аллеля кодируют аланин в кодоне 119) и 4326 негомозиготный G (по меньшей мере один из обоих аллелей кодирует лейцин в кодоне 432). Третья: 142 гомозиготный G (оба аллеля кодируют глицин в кодоне 48) и 355 гомозиготный Т (оба аллеля кодируют серин в кодоне 119) и 4326 гомозиготный С (оба аллеля кодируют лейцин в кодоне 432). Эти три комбинации являются взаимоисключающими.

Варианты CHEK2 зародышевой линии, которые описаны в таблице А, приводят к продуцированию укороченного, нефункционального варианта РНК и белков CHEK2 в случае делеции С в положении 1100 в 1100delC, к делеции 5395 оснований, включающей экзоны 9 и 10, в del5395 и к инсерции 4 оснований вследствие аномального сплайсинга в IVS2+1G>A. Вариант CHEK2 зародышевой линии I157T, который описан в таблице А, представляет собой распространенную миссенс-мутацию, которая кодирует замену изолейцина на треонин в кодоне 157 и приводит к продуцированию измененного варианта РНК и белка CHEK2.

Вариант BRCA2 зародышевой линии С5972Т, который описан в таблице А, кодирует аминокислотную замену треонина на метионин в кодоне 1915, которая, таким образом, приводит к продуцированию измененного варианта РНК и белка BRCA2 RNA.

Для изобретения изменения в генах CYP1B1, CHEK2 и BRCA2 зародышевой линии, как описано выше, понимают как изменения, вызывающие продуцирование белков CYP1B1, CHEK2 и BRCA2 соответственно со значительной измененной функцией или активностью, которые связаны со значительно повышенным риском рака различных локализаций.

Авторы изобретения обнаружили данные о прямом или косвенном генетическом взаимодействии между генами CYP1B1 и CHEK2, между генами CHEK2 и BRCA2 и между генами CYP1B1, CHEK2 и BRCA2. Данное изобретение относится к повышенному риску развития рака молочной железы у людей по меньшей мере с одной из трех генотипических комбинаций, описанных в таблице Б. Они включают: во-первых, присутствие одного из трех взаимоисключающих генотипов CYP1B1, описанных выше (первого 48 не-G/G и 119 не-G/G и 432С/С, второго 48С/С и 119G/G и 432-нe-G/G, и третьего 48G/G и 119Т/Т и 432С/С) и присутствие по меньшей мере одного из вариантов CHEK2, укорачивающих белок (1100delC, del5395, IVS2+1G>A); во-вторых, присутствие любого из описанных вариантов CHEK2 (I157T, 1100delC, del5395, IVS2+1G>A) и присутствие описанного варианта BRCA2 (С5972Т); и, в-третьих, присутствие одного из трех взаимоисключающих генотипов CYP1B1, описанных выше (первого 48 не-G/G и 119 не-G/G и 432С/С, второго 48С/С и 119G/G и 432-не-G/G, и третьего 48G/G и 119T/T и 432С/С), присутствие любого из описанных вариантов CHEK2 (I157T, 1100delC, del5395,IVS2+1G>A) и присутствие описанного варианта BRCA2 (С5972Т). Повышение риска рака молочной железы для любой из этих трех генотипических комбинаций составляет значение выше ожидаемого при добавлении эффектов генетических вариантов трех генов по отдельности, что, таким образом, указывает на эффект взаимодействия, который качественно и количественно отличается от суммы эффектов его компонентов.

Встречаемость любой из этих трех генотипических комбинаций среди пациентов с раком и здоровых контролей населения Польши исследуют в качестве примера применения способа согласно изобретению.

Поскольку сообщают, что различные варианты CYP1B1, CHEK2 и BRCA2 ассоциированы с предрасположенностью к раку множественных органов в нескольких популяциях, можно предположить, что эти варианты также должны быть ассоциированы со значительно повышенной предрасположенностью к злокачественным опухолям множественных органов, встречающейся не только среди людей польского происхождения, но также и в других этнических группах.

При конкретном осуществлении способа согласно изобретению присутствие различных изменений в зародышевой линии исследуют на уровне ДНК, РНК или белка. ДНК можно исследовать, например, используя методику, выбранную среди ПДРФ, АСА, микрочипов и секвенирования.

Согласно изобретению также возможно предположить, а затем экспериментально проверить другие формы ДНК, РНК и белка CYP1B1, CHEK2 и BRCA2 соответственно, аналогичные формам CYP1B1, продуцируемым в результате замен A119S, R48G и L432V, формам CHEK2, продуцируемым в результате замены I157T, и формам BRCA2, продуцируемым в результате замены С5972Т.

Рекомендовано включать генетические изменения, которые находятся в неравновесном сцеплении с изменениями, описанными здесь (представленными в таблицах А и Б), поскольку их диагностическое значение в качестве маркеров положения может быть сравнимо с функциональными маркерами, описанными здесь.

Для других встречающихся в природе вариантов гена/белка CYP1B1, CHEK2 или BRCA2 экспериментальная проверка их вовлеченности в канцерогенез должна быть основана на анализе ассоциаций, как описано в прилагаемом примере.

Следующим объектом изобретения также является композиция для обнаружения изменений CYP1B1, CHEK2 и BRCA2 зародышевой линии, дающая возможность идентификации людей со значительно повышенной генетической предрасположенностью к раку молочной железы и наиболее вероятно ободочной кишки, почки, гортани, легкого, поджелудочной железы, простаты, щитовидной железы, женских половых путей и яичников при условии, что исследуют варианты CYP1B1 зародышевой линии C142G (R48G), G355T (A119S) и G4326C (V432L), варианты CHEK2 зародышевой линии I157T, 1100delC, del5395, IVS2+1G>A и вариант BRCA2 зародышевой линии С5972Т (представленные в таблицах А и Б) или другие варианты или изменения с аналогичными признаками или в неравновесном сцеплении с ними.

ДНК, РНК и белки можно использовать в качестве материала для диагностических анализов. В диагностических целях пригодно также применение измененных форм ДНК или РНК, а также белков, кодируемых соответствующими аллелями с изменениями CYP1B1, CHEK2 и BRCA2. Следующим объектом изобретения, таким образом, является комбинированное применение полипептидов, кодируемых аллелем CYP1B1, содержащим варианты R48G, A119S или V432L зародышевой линии, либо другие комбинации (представленные в таблице А) полипептидов, кодируемых аллелем CHEK2, содержащим варианты I157T, 1100delC, del5395 и/или IVS2+1G>A, зародышевой линии, полипептидов, кодируемых аллелем BRCA2, содержащим вариант С5972Т зародышевой линии, а также другие изменения в неравновесном сцеплении с любым из вышеуказанных вариантов или изменения с аналогичными признаками, для обнаружения значительно повышенной генетической предрасположенности к ракам молочной железы и с высокой вероятностью одной из приведенных ниже локализаций: ободочной кишки, почки, гортани, легкого, поджелудочной железы, простаты, щитовидной железы, женских половых путей и яичников.

Согласно изобретению присутствие полипептидов, кодируемых аллелем CYP1B1 с изменением в зародышевой линии, аллелем CHEK2 с изменением в зародышевой линии и/или аллелем BRCA2 с изменением в зародышевой линии, обнаруживают с помощью антител или других веществ, специфичных к любому из этих полипептидов или к некоторым из их фрагментов соответственно.

Положение изменения не определяется номерами последовательных нуклеотидов или аминокислот.

Согласно изобретению положение данного нуклеотида или данной аминокислоты может быть обозначено различными номерами, но должно обладать такими же свойствами.

В частности, может быть важно, когда антитела или другие вещества, специфичные к такому полипептиду или его фрагменту, распознают эпитоп, содержащий характеристическое изменение в аминокислотной последовательности и в структуре белка, кодируемого вариантами в CYP1B1 зародышевой линии, CHEK2 и BRCA2, представленными в таблице А.

Антитела могут быть получены, например, способом, описанным Kohler and Milstein, Nature 256 (1975), 7, 495, и в Meth. Enzymol. 73 (1981), 9, 3. Антитела могут быть моноклональными, поликлональными, либо можно использовать фрагменты антител (такие как Fab, Fv или scFv). Они могут быть получены способами, описанными Harlow and Lane "Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988.

Следующим объектом изобретения является композиция для обнаружения значительно повышенной предрасположенности к опухолям с использованием методик, основанных на ПЦР и характеризующихся использованием по меньшей мере двух различных праймеров, дающих возможность амплификации области, содержащей варианты CYP1B1, CHEK2 и BRCA2 зародышевой линии (представленные в таблице А) или изменения в неравновесном сцеплении с этими вариантами или с аналогичными свойствами, дающими возможность обнаружения предрасположенности к раку молочной железы, и с высокой вероятностью приведенных ниже локализаций: ободочной кишки, почки, гортани, легкого, поджелудочной железы, простаты, щитовидной железы, женских половых путей и яичников.

Следующим объектом изобретения является применение различных полинуклеотидов, содержащих в соответствующем положении 142, 355 или 4326 экзона 2/3 человеческого гена CYP1B1 замены 355 G>T, либо 142 G>C, либо 4326A>G соответственно, или восьми различных олигонуклеотидов, перекрывающих все возможные генотипические комбинации, описанные в таблице Б, такие как 142С 355Т 4326С, 142G 355Т 4326С, 142С 355G 4326С, 142С 355Т 4326G, 142G 355Т 4326G, 142G 355G 4326С, 142G 355G 4326G и 142С 355G 4326G, или другие замены с аналогичными свойствами, либо другого полинуклеотида, кодирующего вариант белка CYP1B1, содержащий замену A119S или R48G или V432L (или другую с аналогичными свойствами), либо полипептидов, кодируемых вышеописанными полинуклеотидами, либо антител, специфичных к вышеописанным полипептидам, а также применение различных полинуклеотидов, содержащих изменения нуклеотидной последовательности, соответствующие вариантам CHEK2 зародышевой линии I157T, 1100delC, del5395 и IVS2+1G>A CHEK2 соответственно, или другие изменения с аналогичными свойствами, либо другого полинуклеотида, кодирующего вариант белка CHEK2, содержащий I157T или другую замену с аналогичными свойствами или содержащий изменения с укорачивающими свойствами, аналогичные 1100deIC, del5395 и IVS2+1G>A, либо полипептидов, кодируемых вышеописанными полинуклеотидами, либо антител, специфичных к вышеописанным полипептидам, а также применение полинуклеотида, содержащего изменения нуклеотидной последовательности, соответствующие вариантам С5972Т зародышевой линии, или другие с аналогичными свойствами, либо полипептидов, кодируемых вышеописанными полинуклеотидами, либо антител, специфичных к вышеописанным полипептидам, для изготовления диагностической композиции, дающей возможность обнаружения значительно повышенной предрасположенности к раку у людей, несущих специфичную генотипическую комбинацию этих вариантов, а именно: во-первых, присутствие одного из трех взаимоисключающих генотипов CYP1B1, описанных выше (первого 48 не-G/G и 119 не-G/G и 432С/С, второго 48С/С и 119G/G и 432-нe-G/G, и третьего 48G/G и 119Т/Т и 432С/С) и присутствие по меньшей мере одного из вариантов CHEK2, укорачивающих белок (1100delC, del5395, IVS2+1G>A); во-вторых, присутствие любого из описанных вариантов CHEK2 (I157T, 1100delC, del5395, IVS2+1G>A) и присутствие описанного варианта BRCA2 (С5972Т); и, в-третьих, присутствие одного из трех взаимоисключающих генотипов CYP1B1, описанных выше (первого 48 не-G/G и 119 не-G/G и 432С/С, второго 48С/С и 119G/G и 432-нe-G/G, и третьего 48G/G и 119Т/Т и 432С/С), присутствие любого из описанных вариантов CHEK2 (I157T, 1100delC, del5395, IVS2+1G>A) и присутствие описанного варианта BRCA2 (С5972Т). Вышеописанная предрасположенность ассоциирована с повышенным риском рака молочной железы и, вероятно, одной из приведенных ниже локализаций: ободочной кишки, почки, гортани, легкого, поджелудочной железы, простаты, щитовидной железы, женских половых путей и яичников.

Одним из возможных примеров вышеописанных полинуклеотидов являются полинуклеотиды, полученные с использованием диагностической композиции для генотипических комбинаций в соответствии с изобретением; примерами вышеописанных полипептидов являются полипептидные варианты, кодируемые вышеописанными полинуклеотидами и соответствующие изменениям, представленным в таблице А, а также следующие генотипическим комбинациям в таблице Б. Определение "соответствующий" применительно к данному описанию означает, что положение не определяется номерами последовательных нуклеотидов или аминокислот. Согласно изобретению положение конкретного нуклеотида или аминокислоты, который может быть делетирован или заменен, может быть отличным от такового в гене или полипептиде дикого типа. Таким образом, "соответствующее" положение согласно изобретению означает, что нуклеотиды или аминокислоты могут быть описаны с использованием различных номеров, но все же обладают одинаковыми свойствами. Такие нуклеотиды или аминокислоты, которые могут быть заменены или делегированы, также охвачены определением "соответствующего" положения. Такие нуклеотиды или аминокислоты могут, например, составлять часть структур, играющих важную роль в регуляции генной экспрессии, стабильности или варианте РНК, а также кодирующих или функциональных доменов, сайтов сплайсинга или характеристических мотивов вариантов белка или его производных.

Следующим объектом изобретения является применение ферментов рестрикции, которые расщепляют аллель, содержащий (Т или G) в сайте нуклеотида 355 или (С или G) в 142 или (С или G) в 4326, гена CYP1B1 например, (Eam 1105I, Pdil Olil Aval-Fermentas), а также применение ферментов рестрикции, которые расщепляют аллель, содержащий нуклеотид (С или Т) в нуклеотиде 430 и инсерцию IVS2+1G>A, гена CHEK2, например, (PstI и Нру188III), и применение специфичных праймеров для мультиплексной ПЦР для вариантов 1100delC и del5395 гена CHEK2, например, (CHK2ex10f, CHK2ex10r, CHK2delC, CHLdel2F, CHLc2R, CHLdelR, CHLcF), а также применение ферментов рестрикции, которые расщепляют аллель, содержащий нуклеотид (С или Т) в сайте нуклеотида 5972 гена BRCA2, например, (Mph 1103I Fermentas), для изготовления диагностической композиции, дающей возможность обнаружения значительно повышенной предрасположенности к раку молочной железы и, вероятно, ободочной кишки, почки, гортани, легкого, поджелудочной железы, простаты, щитовидной железы, женских половых путей и яичников.

Следующим объектом изобретения является способ идентификации генетического маркера, ассоциированного со значительно повышенным риском развития злокачественной опухоли, основанный на оценке биологических образцов (ДНК, РНК или белка) от пациентов, пораженных злокачественной опухолью, на присутствие одной из трех генотипических комбинаций, описанных в таблице Б; во-первых, присутствие одного из трех взаимоисключающих генотипов CYP1B1, описанных выше (первого 48 не-G/G и 119 не-G/G и 432С/С, второго 48С/С и 119G/G и 432-нe-G/G, и третьего 48G/G и 119Т/Т и 432С/С) и присутствие по меньшей мере одного из вариантов CHEK2, укорачивающих белок (1100delC, del5395, IVS2+1G>A); во-вторых, присутствие любого из описанных вариантов CHEK2 (I157T, 1100delC, del5395, IVS2+1G>A) и присутствие описанного варианта BRCA2 (С5972Т); и, в-третьих, присутствие одного из трех взаимоисключающих генотипов CYP1B1, описанных выше (первого 48 не-G/G и 119 не-G/G и 432С/С, второго 48С/С и 119G/G и 432-нe-G/G, и третьего 48G/G и 119Т/Т и 432С/С), присутствие любого из описанных вариантов CHEK2 (I157T, 1100delC, del5395, IVS2+1G>A) и присутствие описанного варианта BRCA2 (С5972Т), либо других изменений в неравновесном сцеплении с любым из этих вариантов изменения. Затем встречаемость сравнивают с частотой встречаемости соответствующей генотипической комбинации в контрольной популяции. Вариант со значительным доминированием/редкой встречаемостью среди пациентов с данной злокачественной опухолью считают генетическим маркером, ассоциирован со значительно повышенным/пониженным риском развития злокачественной опухоли. Это значимо, если числа исследуемых пациентов и контролей достаточно велики, и результаты считают статистически значимыми, когда различия между долями достигает р<0,05. Эффект различных генотипических комбинаций сравнивают с эффектами вариантов зародышевой линии каждого из генов, взятыми по отдельности, с помощью логистической регрессии, и эффект комбинации считают эффектом взаимодействия, когда он превышает значение, ожидаемое для добавления отдельных эффектов каждого гена с р<0,05. Теперь изобретение описано путем ссылки на приведенные ниже биологические примеры, которые являются исключительно иллюстративными и не должны быть истолкованы как ограничение объема настоящего изобретения.

Пример 1

Анализ логистической регрессии и исследования корреляции между генотипическими комбинациями изменений зародышевой линии в CYP1B1, CHEK2 и BRCA2 и предрасположенностью к раку молочной железы

- Пациенты

Чтобы установить диапазон типов рака, ассоциированных с тремя исследуемыми генотипическими комбинациями CYP1B1, CHEK2 и BRCA2 (как описано в таблицах А и Б), 1956 пациентов с раком молочной железы из 8 больниц во всей Польше (Щецин, Бельско-Бяла, Познань, Ополе, Люблин, Краков, Кошалин и Быдгощ). Все случаи были неотобранными и подтвержденными гистопатологически. Не использовали никакие критерии отбора, такие как возраст, пол и семейная история рака. Кроме того, авторы изобретения генотипировали контрольную группу, состоящую из 1173 новорожденных, родившихся в 2003-2004 в 8 больницах во всей Польше (Щецин, Белосток, Горзов, Катовице, Вроцлав, Познань, Лодзь и Жешув), 669 взрослых из Щецинской области (не отобранных на встречаемость злокачественных опухолей среди родственников, соотношение мужчины/женщины 1:1) и группы из 464 женщин, соответствующих по возрасту пациентам с раком молочной железы (суммарное число контролей 2306).

Выделение ДНК

5 мл периферической крови получали от пациентов и смешивали со 100 мкм 1 М ЭДТА, затем центрифугировали в 50 мл полипропиленовых пробирках в течение 10 минут при 3000 g при 4°С. Сыворотку в верхней фазе удаляли и осадок, содержащий клетки, смешивали с 45 мл буфера 2Х (0,1 М NH4Cl, 0,25 М KHCO3, 1 мМ ЭДТА) и оставляли на 15 минут при 4°С. Затем смесь центрифугировали при 3000 g в течение 10 минут при 4°С. Надосадочную жидкость после центрифугирования удаляли. Оставшийся осадок с лейкоцитами ресуспендировали в 2Х буфере и центрифугировали в течение 10 минут при 3000 g при 4°С. Эту очистку лейкоцитов в 2Х буфере и центрифугирование повторяли три раза до получения чистого осадка лейкоцитов. Затем лейкоциты смешивали с 3 мл буфера для переваривания (50 мМ NaCl, 25 мМ MgCl2, 1 мМ ЭДТА; рН 8,0) с 200 мкл 10% додуцилсульфата натрия (ДСН) и 500 мкг протеиназы K. Переваривание проводили в течение 24 ч при 37°С.

ДНК очищали, используя фенол/хлороформ. Кратко, продукты переваривания смешивали с 3 мл фенола, забуференного 0,5 М Трис HCl (рН 8,4), а затем 3 мл смеси хлороформа и изоамилового спирта (смешанных в соотношении 1:25 об/об). Смесь встряхивали в течение примерно 1 минуты и центрифугировали в течение 10 минут при 8000 g при 20°С. После центрифугирования верхнюю фазу переносили в новую пробирку и смешивали с равным объемом хлороформа, а затем центрифугировали в течение 10 минут при 8000 g. Вышеописанную очистку хлороформом повторяли 3 раза до исчезновения белкового кольца в интерфазе.

Очищенную водную фазу, содержащую ДНК, смешивали с 5 М NaCl в соотношении 10:1 (об/об) и 96% этанолом в соотношении водной фазы с NaCl к этанолу 1:10 (об/об). Смесь оставляли на ночь при 20°С. Полученный в результате осадок ДНК помещали в новую пробирку и очищали 70% этанолом, центрифугировали при 3000 g в течение 5 минут, и этанол выливали. Затем очищенный осадок ДНК высушивали в открытой пробирке в течение 30 минут при 37°С. ДНК ресуспендировали в 400 мкл буфера ТЕ (25 мМ Трис HCl, 1 мМ ЭДТА; рН 8,4) и хранили при 4°С до использования.

Полимеразная цепная реакция на полиморфизм длины рестрикционных фрагментов (ПДРФ-ПЦР)

Варианты 355T>G CYP1B1

Изменение варианта 355Т/Т идентифицировали с помощью ПДРФ-ПЦР, используя ферменты рестрикции Eam 11051 и Pdil (Fermentas). ПЦР проводили с праймерами, например, CYP119F (CTCGTTCGCTCGCCTGGCGC) и, например, CYP119R (GAAGTTGCGCATCATGCTGT). Реакции ПЦР проводили в термоциклере для ДНК РТС-200 Peltier DNA ThermalCycler (MJ Research) в объеме 25 мкл, и они включали: 1 мкл (50 нг) геномной ДНК, 4 пмоль каждого набора праймеров, 2,5 мкл буфера для ПЦР 2 (Expand Long Template PCR System Roche - 22,5 мМ MgCl2), 200 мкМ каждого dATP, dCTP, dGTP и dTTP и 1 ед. Taq ДНК полимеразы. В каждой реакции использовали отрицательный контроль (контроль без ДНК).

Условия ПЦР:

а) Исходная денатурация - 95°С 15 минут

б) 15 циклов, каждый из: денатурации - 95°С 30 с

отжига праймеров - 62-54, 5°С 30 с

(понижение температуры на 0,5°С в каждом цикле)

элонгации праймеров - 72°С 2 минуты

в) 21 цикл, каждый из: денатурации - 95°С 30 с

отжига праймеров - 57°С 30 с

элонгации праймеров - 72°С 30 с

г) элонгация - 72°С 8 минут

Расщепление проводили в течение ночи при 37°С в объеме 24 мкл, содержащих: 12 мкл продукта ПЦР, 10х буфер Танго (Fermentas) и 2 ед. фермента Eam 1105I (Fermentas). Затем 15 мкл продукта рестрикции смешивали с 10 мкл буфера нанесения и подвергали электрофорезу в агарозном геле (3% агарозный гель (SeaKem FMC), 1х буфер ТБЭ, 25 мкг/мл бромистого этидия) при 6 В/см в течение 30 минут. Разделенные продукты ПЦР визуализировали в УФ свете. Продукт ПЦР (250 п.о.) был расщеплен на два фрагмента: 136 п.о. и 114 п.о. в случаях, которые содержали Т в сайте нуклеотида 355 гена CYP1B1. Все случаи с изменениями проверяли путем использования фермента рестрикции Pdil (Fermentas). Рестриктная смесь в объеме 18 мкл содержала: 4 мкл продукта ПЦР, 10х буфер Танго (Fermentas) и 2 ед. фермента Pdil (Fermentas). Затем 15 мкл продукта рестрикции подвергали электрофорезу в тех же условиях. Продукт ПЦР (250 п.о.) был расщеплен на два фрагмента: 138 п.о. и 112 п.о. в случаях, которые содержали G в сайте нуклеотида 355 гена CYP1B1. Кроме того, случайно выбранные случаи с вариантами G/G, Т/Т и G/T были секвенированы в целях подтверждения присутствия замены A119S. Секвенирование готовили с помощью стандартных методов.

Очистка продукта ПЦР

Продукт секвенирования помещали на колонку Microcon-100 (Amicon), которая была надета на пробирку Эппендорф на 0,5 мл. Добавляли 400 мкл дистиллированной воды, затем центрифугировали в течение 15 минут при 1850 g при 25°С. Колонки промывали 4 раза 400 мкл дистиллированной воды. После последней стадии отмывки колонки переворачивали нижней стороной вверх и помещали на новую пробирку Эппендорф. Путем центрифугирования в течение 3 минут при 9000 g было получено 5 мкл очищенного продукта ПЦР, который разводили в 4 раза дистиллированной водой.

Варианты 142 G>C CYP1B1

Варианты замены R48G были идентифицированы с помощью ПДРФ-ПЦР с использованием фермента рестрикции Есо881 (Aval) (Fermentas). ПЦР проводили с праймерами, например, F1CYP (TCCATCCAGCAGACCACGCT) и, например, R1 (GCCGGACACCACACGGAAG). Реакции ПЦР проводили в термоциклере для ДНК РТС-200 Peltier DNA ThermalCycler (MJ Research) в объеме 25 мкл, и они включали: 1 мкл (50 нг) геномной ДНК, 4 пмоль каждого набора праймеров, 2,5 мкл буфера для ПЦР 2 (Expand Long Template PCR System Roche - 22,5 мМ MgCl2), 200 мкМ каждого dATP, dCTP, dGTP и dTTP и 1 ед. Taq ДНК полимеразы. В каждой реакции использовали отрицательный контроль (контроль без ДНК).

Условия ПЦР:

а) Исходная денатурация - 95°С 15 минут

б) 29 циклов, каждый из: денатурации - 95°С 30 с

отжига праймеров - 56°С 30 с

элонгации праймеров - 72°С 30 с

в) элонгация - 72°С 5 минут

Расщепление проводили в течение ночи при 37°С в объеме 24 мкл, содержащих: 12 мкл продукта ПЦР, 10х буфер Танго (Fermentas) и 2 ед. фермента Есо881 (Aval) (Fermentas). Затем 15 мкл продукта рестрикции смешивали с 10 мкл буфера нанесения и подвергали электрофорезу в агарозном геле (3% агарозный гель (SeaKem FMC), 1х буфер ТБЭ, 25 мкг/мл бромистого этидия) при 6 В/см в течение 30 минут. Разделенные продукты ПЦР визуализировали в УФ свете. Продукт ПЦР (336 п.о.) был расщеплен на три фрагмента: 14 п.о., 91 п.о. и 230 п.о. в случаях, которые содержали нуклеотид G в сайте нуклеотида 142 гена CYP1B1. Кроме того, случайно выбранные случаи с вариантами G/G, С/С и C/G были секвенированы для подтверждения присутствия замены R48G. Секвенирование готовили с помощью стандартных методов.

Очистка продукта ПЦР

Продукт секвенирования помещали на колонку Microcon-100 (Amicon), которая была надета на пробирку Эппендорф на 0,5 мл. Добавляли 400 мкл дистиллированной воды, затем центрифугировали в течение 15 минут при 1850 g при 25°С. Колонки промывали 4 раза 400 мкл дистиллированной воды. После последней стадии отмывки колонки переворачивали нижней стороной вверх и помещали на новую пробирку Эппендорф. Путем центрифугирования в течение 3 минут при 9000 g было получено 5 мкл очищенного продукта ПЦР, который разводили в 4 раза дистиллированной водой.

Варианты 432 C>G CYP1B1

Варианты замены L432V были идентифицированы с помощью ПДРФ-ПЦР с использованием фермента рестрикции Olil (Fermentas). ПЦР проводили с праймерами, например, CYP1294F (ATGCGCTTCTCCAGCTTTGT) и, например, CYP1294R (TATGGAGCACACCTCACCTG). Реакции ПЦР проводили в термоциклере для ДНК РТС-200 Peltier DNA ThermalCycler (MJ Research) в объеме 25 мкл, и они включали: 1 мкл (50 нг) геномной ДНК, 4 пмоль каждого набора праймеров, 2,5 мкл буфера для ПЦР 2 (Expand Long Template PCR System Roche - 22,5 мМ MgCl2), 200 мкМ каждого dATP, dCTP, dGTP и dTTP и 1 ед. Taq ДНК полимеразы. В каждой реакции использовали отрицательный контроль (контроль без ДНК).

Условия ПЦР:

а) Исходная денатурация - 95°С 15 минут

б) 10 циклов, каждый из: денатурации - 95°С 30 с

отжига праймеров - 62-57°С 30 с

(понижение температуры на 0,5°С в каждом цикле)

элонгации праймеров - 72°С 2 минуты

в) 21 цикл, каждый из: денатурации - 95°С 30 с

отжига праймеров - 57°С 30 с

элонгации праймеров - 72°С 30 с

г) элонгация - 72°С 8 минут

Переваривание проводили в течение ночи при 37°С в объеме 24 мкл, содержащих: 12 мкл продукта ПЦР, 10х буфер Танго (Fermentas) и 2 ед. фермента Olil (Fermentas). Затем 15 мкл продукта рестрикции смешивали с 10 мкл буфера нанесения и подвергали электрофорезу в агарозном геле (3% агарозный гель (SeaKem FMC), 1х буфер ТБЭ, 25 мкг/мл бромистого этидия) при 6 В/см в течение 30 минут. Разделенные продукты ПЦР визуализировали в УФ свете. Продукт ПЦР (623 п.о.) был расщеплен на два фрагмента: 132 п.о. и 491 п.о. в случаях, которые содержали нуклеотид С в сайте нуклеотида 4329 гена CYP1B1. Кроме того, случайно выбранные случаи с вариантами G/G, С/С и C/G секвенировали с целью подтверждения присутствия замены L432V. Секвенирование готовили с помощью стандартных методов.

Очистка продукта ПЦР

Продукт секвенирования помещали на колонку Microcon-100 (Amicon), которая была надета на пробирку Эппендорф на 0,5 мл. Добавляли 400 мкл дистиллированной воды, затем центрифугировали в течение 15 минут при 1850 g при 25°С. Колонки промывали 4 раза 400 мкл дистиллированной воды. После последней стадии отмывки колонки переворачивали нижней стороной вверх и помещали на новую пробирку Эппендорф. Путем центрифугирования в течение 3 минут при 9000 g было получено 5 мкл очищенного продукта ПЦР, который разводили в 4 раза дистиллированной водой.

Вариант IVS2+1G>A CHEK2

Мутация IVS2+1G>A была идентифицирована с помощью ПДРФ-ПЦР с использованием Hpy 188III (New England Biolabs). ПЦР проводили с праймерами CHEK2ex2/3F:

5'-ATTTATGAGCAATTTTTAAAC G-3' (SEQ ID NO: 35) и CHEK2ex2/3R: 5'-TCCAGTAACCATAAGATAATAATATTA C-3'(SEQ ID NO: 36).

Реакции ПЦР проводили на термоциклере DNA ThermalCycler 9600 (Perkin Elmer) в объеме 25 мкл, включающем: 1 мкл (50 нг) геномной ДНК, 4 пмоль праймера Nbsex6f, 6 пмоль Nbsex6r, 10 пмоль праймера Nbsdel5, 2.5 мкл ПЦР буфера (100 мМ Трис-HCl, 500 мМ KCl, 15 мМ MgCl2, 1 мг/мл желатина; рН 8,6), 200 мкМ каждого dATP, dCTP, dGTP и dTTP и 1 ед. Taq ДНК полимеразы. В каждой реакции использовали отрицательный контроль (контроль без ДНК).

Условия ПЦР:

а) Исходная денатурация - 95°С. 5 минут

б) 35 циклов, каждый из: денатурации - 94°С. 30 с

отжига праймеров - 53-58°С. 45 с

элонгации праймеров - 72°C. 60 с

Расщепление проводили в течение ночи при 37°С в объеме 20 мкл, содержащем: 5 мкл продукта ПЦР, 1*NE буфер 4 (New England Biolabs) и 2 ед. фермента Нру 188III. Затем 15 мкл продукта рестрикции смешивали с 10 мкл буфера нанесения и проводили электрофорез в агарозном геле (2% агарозный гель (SeaKem FMC), 1* буфер ТБЭ, 25 мкг/мл бромистого этидия) при 6 В/см в течение 30 минут. Разделенные продукты ПЦР визуализировали в УФ свете. Продукт ПЦР был расщеплен в случаях с мутациями.

Очистка продукта ПЦР

Продукты ПЦР переносили пипеткой в резервуар для образцов Microcon-100 (Amicon), помещенный во флакон, 400 мкл dH2O добавляли в резервуар и центрифугировали при 1850*g в течение 15 минут. После центрифугирования резервуар для образцов вставляли в новый флакон, наполняли 400 мкл dH2O и центрифугировали при 1850*g в течение 15 минут. Последнюю стадию повторяли 3 раза. Резервуар для образцов помещали в перевернутом положении в новый флакон, а затем центрифугировали в течение 3 минут при 9000*g. Все центрифугирования проводили при 25°С. Примерно 5 мкл очищенного продукта ПЦР видели во флаконе, и его разводили в 20 мкл dH2O.

Вариант 430Т>С CHEK2

Вариант 430Т>С (IIe157Thr) анализировали с помощью полимеразной цепной реакции на полиморфизм длин рестрикционных фрагментов, используя праймеры Chl57F (5'-ACCCATGTATCTA GGAGAGCTG-3' (SEQ ID NO: 37)) и Chl57R (5'-CCACTGTGATCTTCT ATGTCTGCA-3' (SEQ ID NO: 38)). Обратный праймер вводит искусственный сайт рестрикции фермента Pstl. Продукты ПЦР были расщеплены в случаях, положительных по мутации. Экспериментальные условия были такими, как для ПДРФ-ПЦР для варианта IVS2+1G>A CHEK2 за исключением того, что использовали 2 ед. фермента Pstl (вместо Нру 188III) и NE буфер 3 (вместо NE буфера 4), и продукты ПДРФ-ПЦР разделяли в 3% агарозном геле.

Вариант С5972Т BRCA2

Вариант С5972Т (Thr1915Met) анализировали с помощью ПЦР на полиморфизм длин рестрикционных фрагментов, используя праймеры b5972F (5'-СТС ТСТ AGA ТАА TGA TGA ATG ATG СА) и b5972R (5'-ССА ААС ТАА CAT САС AAG GTG). Прямой праймер вводит искусственный сайт рестрикции фермента Mph 1103I (Fermentas). Продукты ПЦР были расщеплены в случаях, положительных по мутации. Экспериментальные условия были такими, как для ПДРФ-ПЦР для варианта IVS2+1G>A CHEK2 за исключением того, что использовали 2 ед. фермента Mph 1103I (вместо Нру 188III) и NE буфер 3 (вместо NE буфера 4), и продукты ПДРФ-ПЦР разделяли в 3% агарозном геле и визуализировали в ультрафиолетовом свете.

Мультиплексная полимеразная цепная реакция

Мультиплексные реакции ПЦР проводили в термоциклере DNA ThermalCycler 9600 (Perkin Elmer) в объеме 25 мкл, включавшем: 1 мкл (50 нг) геномной ДНК, 5 пмоль праймера CHLdelR, 5 пмоль праймера CHLcF, 5 пмоль праймера CHLdel2F или, соответственно, 5 пмоль праймера CHLc2R, 5 пмоль праймера Chk2ex10f, 5 пмоль праймера Chk2ex10r, 5 пмоль праймера Chk2delC, 2,5 мкл ПЦР буфера (100 мМ Трис-HCl, 500 мМ KCl, 15 мМ MgCl2, 1 мг/мл желатина; рН 8,6), 200 мкМ каждого dATP, dCTP, dGTP и dTTP и 1 ед. Taq ДНК полимеразы. В каждой реакции использовали отрицательный контроль (контроль без ДНК).

Вариант del5395 CHEK2

Две пары праймеров были сконструированы специфично для генотипирования большой делеции из 5395 нуклеотидов, включающей экзоны 9 и 10, в мультиплексной реакции ПЦР. Первая пара (CHLdel2F 5'-TGT AAT GAG CTG AGA TTG TGC-3'; CHLc2R 5'-CAG AAA TGA GAC AGG AAG TT-3') фланкировала точку разрыва в интроне 8. Вторая пара (CHLdelR 5'GTC TCA ААС TTG GCT GCG-3'; CHLcF 5'CTC TGT TGT GTA САА GTG АС-3') фланкировала точку разрыва в интроне 10. В отрицательных случаях мутации были амплифицированы только два фрагмента ПЦР 379 и 522 п.о. с аллеля дикого типа. Прямой праймер первой пары и обратный праймер второй пары амплифицировали дополнительный продукт ПЦР 450 п.о. в положительных случаях мутации.

Условия ПЦР

1. 94°С 10 мин

2. 94°С→25 сек. 9 циклов

68°С→25 сек. Понижение температуры на 1,4°С в каждом цикле (68°С первый цикл →55°С - 9-й цикл) 72°С - * 35 сек

3. 94°C→25 сек

55°C→30 сек. 31 цикл

72°С→35 сек

4. 4°С→∞

Вариант 1100delC CHEK2

1100delC анализировали, используя анализ аллель-специфичной полимеразной цепной реакции с использованием праймеров Chk2ex10f (5'-TTA АТТ ТАА GCA ААА ТТА ААТ GTC), Chk2ex10r (5'-GGC ATG GTG GTG TGC АТС), Chk2delC (5'-TGG AGT GCC CAA ААТ CAT А). Условия ПЦР, как для варианта del5395.

Результаты

Доли в распределении различных генотипических комбинаций вариантов CYP1B1, CHEK2 и BRCA2 среди пациентов и контролей (как описано в таблице А) сравнивали, включая и исключая миссенс-вариант I157T CHEK2 соответственно. Поскольку варианты укороченного белка del5395, 1100delC и IVS2+1G>A CHEK2 полностью прерывают функцию белка CHEK2, а миссенс-вариант I157T только изменяет ее, сочли разумным также анализировать варианты укороченного белка отдельно. Все проанализированные комбинации (как описано в таблице 1) показали повышенную долю среди пациентов по сравнению с контролями. Исключение миссенс-варианта CHEK2 сильно обострило эту тенденцию (более высокие коэффициенты неравенства), но в целом при более низких числах пораженных пациентов и контролей, таким образом, указывающих на более специфичный потенциал идентификации группы риска, однако, стоит значительного уменьшения охвата популяции пациентов. В случае генотипических комбинаций всех вариантов трех генов, но исключая миссенс-вариант CHEK2, оцениваемый риск был самым высоким (5,9-кратным), но мощность критерия падала ниже уровня значимости.

Также для совместной встречаемости генотипических комбинаций, проанализированной для вариантов CYP1B1 (описанных в таблицах А и Б) и варианта С5972Т BRCA2 наблюдаемое умеренное повышение риска (1,3) было статистически не значимым. Совместная встречаемость генотипических комбинаций, проанализированных для CYP1B1 (описанных в таблицах А и Б), и любого из вариантов CHEK2 также привела в результате только к умеренному повышению риска (1,4-кратного), хотя в то же время статистически значимому.

Самые высокие статистически значимые различия наблюдали для приведенных ниже генотипических комбинаций: CYP1B1 (1,1 или 1,2 или 1,3) и CHEK2 (2,1 или 2,2 или 2,3) с коэффициентом неравенства 2,8 (р=0,0012); CHEK2 (2,1 или 2,2 или 2,3) и BRCA2 (3,1) с коэффициентом неравенства 5,3 (р=0,02); CHEK2 (2,1 или 2,2 или 2,3 или 2,4) и BRCA2 (3,1) с коэффициентом неравенства 2,9 (р=0,0004); CYP1B1 (1,1 или 1,2 или 1,3) и CHEK2 (2,1 или 2,2 или 2,3 или 2,4) и BRCA2 (3,1) с коэффициентом неравенства 4,7 (р=0,009).

Таблица 1
Сравнение долей в распределении различных генотипических комбинаций вариантов CYP1B1, CHEK2 и BRCA2 среди пациентов и контролей (как описано в таблице А)
Генотипическая комбинация Больные (+) Всего больных Контроли (+) Всего контролей КН 95% ДИ р-значение
CYP1B1
1,1 или 1,2 или 1,3
CHEK2
2,1 или 2,2 или 2,3
31 1956 13 2306 2,8 (1,5-5,4) 0,0012
CYP1B1
1,1 или 1,2 или 1,3
CHEK2
2,1 или 2,2 или 2,3 или 2,4
101 1956 85 2306 1,4 (1,1-1,9) 0,02
CHEK2
2,1 или 2,2 или 2,3
BRCA2
3,1
9 1956 2 2306 5,3 (1,1-25) 0,02
CHEK2
2,1 или 2,2 или 2,3 или 2,4
BRCA2
3,1
37 1956 15 2306 2,9 (1,6-5,4) 0,0004
CYP1B1
1,1 или 1,2 или 1,3
BRCA2
3,1
60 1956 55 2306 1,3 не значимо
CYP1B1
1,1 или 1,2 или 1,3
CHEK2
2,1 или 2,2 или 2,3
BRCA2
3,1
5 1956 1 2306 5,9 не значимо
CYP1B1
1,1 или 1,2 или 1,3
CHEK2
2,1 или 2,2 или 2,3 или 2,4
BRCA2
3,1
12 1956 3 2306 4,7 (1,3-17) 0,009

Сравнение различий между наблюдаемыми коэффициентами неравенства и коэффициентами неравенства, ожидаемыми для аддитивной модели, где различные варианты обладают независимыми эффектами, и их встречаемость повышает риск рака простым аддитивным путем (описанным в таблице 2), выявило важные результаты. Следует отметить, что эффекты предрасположенности к раку варианта BRCA2 С5972Т влияют только на развитие рака в молодом возрасте. В неотобранной группе последующих случаев рака, как в данном примере, эффект является разбавленным (КН=0,82). Поэтому даже более впечатляющим является наблюдение повышения риска рака молочной железы, достигнутого для целой группы пациентов при комбинированных генотипах, как описано ниже.

Эти результаты (как описано в таблице 1 и 2) показывают, что эффекты взаимодействия между CHEK2 и BRCA2 могут быть, в основном, следствием вариантов укороченного белка CHEK2, поскольку исключение миссенс-варианта CHEK2 всегда резко повышает различия во всех анализируемых генотипических комбинациях. Эти результаты также указывают на взаимодействие между CYP1B1 и CHEK2, но не на взаимодействие между CYP1B1 и BRCA2. Следовательно, при генотипических комбинациях, учитывающих все три гена, авторы изобретения должны ожидать, что обнаружат конфлюентность двух независимых эффектов взаимодействия вместо трех соединенных.

Логистическая регрессия, таким образом, была применена к данным, учитывая только комбинации 2. Результаты впервые показывают, что CHEK2 и BRCA2 обладают реальным эффектом взаимодействия (р=0,038). Это означает, что их эффект на риск заболевания качественно и количественно отличается от суммы их отдельных эффектов.

Однако ожидаемое взаимодействие (таблица 2) между CYP1B1 и CHEK2 (только мутации, укорачивающие белок) не может быть подтверждено (р=0,078), хотя тенденция очевидна, и неудача подтверждения наиболее вероятно является следствием недостаточных общих чисел проанализированных пациентов и контролей: числа пораженных пациентов и контролей только несколько ниже, чем в случае CHEK2 и BRCA2 (таблица 1). Поэтому целесообразно считать, что при повышении числа проанализированных индивидуумов должно быть возможно показать взаимодействие между CYP1B1 и CHEK2 (только мутации, укорачивающие белок), которое с большой вероятностью можно предполагать на основании данных распределения их совместной встречаемости среди пациентов по сравнению с контролями.

Таблица 2
Ожидаемое и наблюдаемое повышение риска рака молочной железы в зависимости от присутствия одиночных мутаций и их совместной встречаемости в генотипических комбинациях
Генотипическая комбинация Наблюдаемый КН Ожидаемый КН
CYP1B1
1,1 или 1,2 или 1,3
1,4 -
CHEK2
2,1 или 2,2 или 2,3
1,6 -
CHEK2
2,1 или 2,2 или 2,3 или 2,4
1,2 -
BRCA2
3,1
0,8 -
CYP1B1
1,1 или 1,2 или 1,3
CHEK2
2,1 или 2,2 или 2,3
2,8 2,0
CYP1B1
1,1 или 1,2 или 1,3
CHEK2
2,1 или 2,2 или 2,3 или 2,4
1,4 1,6
CHEK2
2,1 или 2,2 или 2,3
BRCA2
3,1
5,3 1,4
CHEK2
2,1 или 2,2 или 2,3 или 2,4
BRCA2
3,1
2,9 1,0
CYP1B1
1,1 или 1,2 или 1,3
BRCA2
3,1
1,3 1,2
CYP1B1
1,1 или 1,2 или 1,3
CHEK2
2,1 или 2,2 или 2,3
BRCA2
3,1
5,9 1,8
CYP1B1
1,1 или 1,2 или 1,3
CHEK2
2,1 или 2,2 или 2,3 или 2,4
BRCA2
3,1
4,7 1,4

Будущие эксперименты:

1. Распространение анализов на другие полиморфизмы тех же генов CYP1B1, CHEK2 и BRCA2.

2. Распространение анализов на все локализации рака.

3. Анализы взаимодействий с другими генами/изменениями, признанными в лаборатории авторов изобретения вовлеченными в предрасположенность к раку (например, NOD2, pl6, XPD, NBS1 и т.д.).

1. Способ обнаружения непропорционально высокого риска заболевания раком молочной железы у субъекта-человека, характеризующийся тем, что он включает
а) выявление в биологическом образце от субъекта генотипов:
i) SNP C142G, G355T и C4326G в гене CYP1B1;
ii) укороченных вариантов 1100delC, del5395, IVS2+1G>A и миссенс-варианта I157T в гене СНЕК2;
iii) варианта C5972T гена BRCA2;
б) определение, включает ли идентифицированный генотип гена CYP1B1, по меньшей мере, один из следующих генотипов гена CYP1B1, являющийся показателем значительно повышенной предрасположенности к раку:
- 142 не G/G, 355 не G/G, 4326 C/C,
- 142C/C, 355G/G, 4326 не G/G,
- 142G/G, 355Т/Т, 4326C/C;
в) определение, включает ли идентифицированный генотип гена СНЕК2, по меньшей мере, один из следующих генотипов гена СНЕК2, являющийся показателем значительно повышенной предрасположенности к раку:
- 1100delC,
- del 5395,
- IVS2+1G>A,
- I157T;
г) определение, включает ли идентифицированный генотип гена BRCA2 генотип C5972T гена BRCA2, являющийся показателем значительно повышенной предрасположенности к раку;
д) установление наличия лидирующего генотипа по отношению к непропорциональному увеличению риска заболевания раком молочной железы в случае отождествления, по меньшей мере, одного из следующих комбинированных генотипов:
- по меньшей мере, одного варианта генотипа гена CYP1B1, указанного в подпункте б), комбинированного, по меньшей мере, с одним вариантом генотипа гена СНЕК2, указанного в подпункте в), или
- по меньшей мере, одного варианта генотипа гена СНЕК2, указанного в подпункте в), комбинированного с вариантом генотипа гена BRCA2, указанного в подпункте г), или
- по меньшей мере, одного из вариантов генотипа гена CYP1B1, указанного в подпункте б), и, по меньшей мере, одного варианта генотипа гена СНЕК2, указанного в подпункте в), и варианта генотипа гена BRCA2, указанного в подпункте г).

2. Способ по п.1, где генетическое тестирование показано к проведению среди всех взрослых людей.

3. Способ по п.1, где присутствие варианта генотипа обнаруживают с помощью анализа ДНК, РНК или белков.

4. Способ по п.3, где анализ ДНК или РНК проводят с использованием любой методики косвенного обнаружения мутации, более предпочтительно выбранной среди ASA-, ASO-, ПДРФ-ПЦР, микрочипов, или способов прямого обнаружения мутации, таких как секвенирование.

5. Способ по п.3, где присутствие полипептида, кодируемого аллелем в пределах специфичного варианта генотипа, обнаруживают с использованием антител или других веществ, специфичных к данному полипептиду или его фрагменту.

6. Способ по любому из пп.1-5, где исследуемый субъект-человек представляет собой человека польского или другого этнического происхождения.

7. Применение обнаружения комбинированного генотипа гена CYP1B1, гена СНЕК2 и гена BRCA2, как указано по п.1, для диагностики у субъекта-человека предрасположенности к увеличению риска заболевания раком молочной железы, где высокий риск вызывается комбинированным генотипом, качественно и количественно отличным от суммы эффектов низкого риска вариантов этих трех генов, взятых по отдельности, где идентифицированный вариант генотипа по гену CYP1B1 включает, по меньшей мере, один из генотипов, основанных на SNP C142G, C4326G в гене CYP1B1, а идентифицированный вариант генотипа по гену СНЕК2 включает, по меньшей мере, один из генотипов, основанных на укороченнных вариантах 1100delC, del5395 и IVS2+1G>A и миссенс-варианте 1157T гена СНЕК2, а идентифицированный вариант генотипа по гену BRCA2 включает вариант C5972T гена BRCA2.

8. Применение по п.7, где вариант генотипа обнаруживают способом, выбранным из любой методики косвенного обнаружения мутации, более предпочтительно выбранной из ASA-, ASQ-, ПДРФ-ПЦР, микрочипов, или способов прямого обнаружения мутации, таких как секвенирование и наличие полипептидного закодированного аллеля, характерного для этого варианта генотипа, обнаружения с использованием антител или других веществ, характерных для этого полипептида или его фрагмента.

9. Диагностический набор для обнаружения высокого риска заболевания раком молочной железы у субъекта-человека, содержащий олигонуклеотиды, обеспечивающие амплификацию областей генома, включающих позиции генов CYP1B1, СНЕК2 и BCRA2, указанные по п.1а.

10. Диагностический набор по п.9, характеризующийся тем, что амплифицированные области используют для идентификации комбинированных генотипов, как указано по п.1д, где эти комбинированные генотипы являются показателем непропорционального повышения риска заболевания раком молочной железы.



 

Похожие патенты:

Изобретение относится к соединению формулы (I): Также предложены способ детекции гибридизации и применение соединения формулы (I) в качестве электрохимического индикатора гибридизации.

Изобретение относится к области биотехнологии, медицинской биохимии, диагностической медицинской микробиологии, прикладной иммунохимии и разработке диагностических тест-систем.

Изобретение относится к молекулярной биологии, генетической инженерии и медицине. .

Изобретение относится к области молекулярной биологии и биотехнологии и может быть использовано в медицине и в фармацевтической промышленности. .

Изобретение относится к медицине, а именно к оториноларингологии, и касается способа лечения хронического риносинусита. .

Изобретение относится к области медицины, а именно к гематологии. .

Изобретение относится к области биотехнологии, а именно к способу оценки эффективности терапии рака мочевого пузыря человека методом ПЦР в режиме реального времени и набору для его осуществления.
Изобретение относится к медицине, а именно к терапии и кардиологии, и касается способа прогнозирования риска развития метаболического синдрома у пациента с абдоминальным ожирением в российской популяции

Изобретение относится к области биотехнологии, а именно к способу определения строения интерфазных хромосом, способу колориметрической гибридизации in situ, способу визуального обнаружения Робертсоновских транслокаций между акроцентрическими хромосомами в образце, полученном от человека, и способу подтверждения присутствия маркерных хромосом в образце

Изобретение относится к области медицинской микробиологии и касается способа дифференциации штаммов Yersinia pestis

Изобретение относится к области биотехнологии, а именно к способу формирования систем маркеров метилирования ДНК

Изобретение относится к медицине, а именно к урологии и молекулярной диагностике, и касается способа оценки эффективности терапии циклофосфамидом у больных хроническим гломерулонефритом

Изобретение относится к области биотехнологии, конкретно к средствам и методам диагностики и дифференцирования разных типов рака молочной железы, и может быть использовано в медицине

Изобретение относится к области биотехнологии, а именно к способу выявления мутаций BRCA1 5382insC и CHEK2 1100delC в геномной ДНК

Изобретение относится к области молекулярной биологии и генетике
Наверх