Способ формирования систем маркеров метилирования днк



Способ формирования систем маркеров метилирования днк

 


Владельцы патента RU 2472859:

Государственное образовательное учреждение высшего профессионального образования Первый Московский государственный медицинский университет им. И.М. Сеченова Министерства здравоохранения и социального развития Российской Федерации (ГОУ ВПО Первый МГМУ им. И.М. Сеченова Минздравсоцразвития России) (RU)
Российская Федерация, от имени которой выступает Министерство образования и науки Российской Федерации (Минобрнауки России) (RU)

Изобретение относится к области биотехнологии, а именно к способу формирования систем маркеров метилирования ДНК. Способ включает выделение геномной ДНК, гидролиз метилчувствительным и неметилчувствительным изошизомерами эндонуклеаз рестрикции. Лигируют продукты гидролиза ДНК с универсальными адаптерами из олигонуклеотидов CCGGTCAGAGCTTTGCGAAT и ATTCGCAAAGCTCTGA. Проводят полимеразную цепную реакцию с универсальным флуоресцентно меченым праймером ATTCGCAAAGCTCTGACCGGGN, конъюгированным по 5'-концу с флуоресцентным красителем FAM, с последующим капиллярным электрофорезом, которая приводит к формированию системы маркеров в виде пиков электрофореграммы. Для анализа пиков электрофореграммы используют весь набор маркеров системы в виде полной репрезентации. Предложенное изобретение позволяет повысить воспроизводимость формируемых систем маркеров метилирования ДНК, упростить процедуру характеристики нормальных тканевых метилотипов, сократить время цикла скрининга, обеспечивая высокую производительность метода. 3 ил., 1 пр.

 

Настоящее изобретение относится к биомедицине, в частности к онкологии.

Одним из основных генетических событий, необходимых для развития любого типа опухоли, является системное нарушение процессов метилирования/деметилирования ДНК. Аномалии метилирования ДНК играют причинную роль и выявляются задолго до появления атипичных белков, используемых в качестве биохимических маркеров опухоли. Гиперметилирование генов, вовлеченных в канцерогенез, является одним из наиболее ранних событий опухолеобразования и часто обнаруживается во многих предраковых состояниях. В то же время такой механизм инактивации генов-супрессоров опухолевого роста не проявляется при острых и хронических воспалительных заболеваниях. Гиперметилирование участков генома может служить молекулярным маркером ранней диагностики, мониторинга и клинического прогноза опухолей. Однако на сегодняшний день сертифицированных тест-систем и способов ДНК-диагностики маркеров метилирования не существует.

Различают два принципиальных подхода к анализу нарушений метилирования в различных типах опухолей. Первый подразумевает изучение статуса метилирования уже известных генов, вовлеченных в канцерогенез, на основе информации о структуре их промоторных областей и CpG-островков. Подобные исследования абсолютно необходимы для характеристики эпигенетического портрета того или иного типа опухолей и обычно охватывают ограниченный круг хорошо охарактеризованных генов, вовлеченных в канцерогенез (р16, р14, р15, RB1, HIC, ECAD и ряд других), что позволяет унифицировать результаты исследований метилотипов опухолей. Подобный стандартизированный подход имеет определенные преимущества, поскольку позволяет сравнивать результаты десятков исследований, что значительно повышает их статистическую достоверность и практическую ценность. В то же время ограниченность круга генов, включенных в такие системы маркеров по изучению метилирования, не позволяет решить одну из главных задач онкогенетики по созданию наборов молекулярных, в том числе эпигенетических, диагностических маркеров, позволяющих эффективно дифференцировать различные типы злокачественных новообразований, в том числе, в зависимости от их тканевого происхождения. Решение этой задачи сопряжено с идентификацией новых генов, вовлеченных в канцерогенез, путем выявления аномалий их эпигенетической регуляции в опухолях, точнее, скрининга дифференциального метилирования геномов нормальных и опухолевых клеток.

Описано несколько способов формирования систем маркеров метилирования ДНК.

Метод метилчувствительного репрезентативно-дифференциального анализа (МЧ-РДА) заключается в сравнении характера метилирования образцов ДНК, выделенных из опухолевой и нормальной тканей, путем многократного повторения циклов рестрикции, дотирования, амплификации и вычитательной гибридизации со сменой адаптеров, различающихся последовательностями свободных концов (Ushijima T., Morimura K., Hosoya Y., Okonogi H., Tatematsu M., Sugimura T., Nagao M. Establishment of methylation-sensitive-representational difference analysis and isolation of hypo- and hypermethylated genomic fragments in mouse liver tumors // 1997. PNAS, 94, 2284-2289). Для вычитательной гибридизации используется набор не менее чем из трех различных адаптеров. Конечные продукты МЧ-РДА подвергаются клонированию с последующим секвенированием для идентификации фрагментов дифференциально метилированных CpG-островков. Огромное количество производимых операций требует соблюдения высокой точности на каждом этапе и катастрофически снижает воспроизводимость результатов, поэтому метод МЧ-РДА широкого распространения не получил.

Вычитательную гибридизацию проводят также для хроматографически изолированных пулов CpG-островков (Brock G.J.R., Huang T.H., Chen C., Johnson KJ. A novel technique for the identification of CpG islands exhibiting altered methylation patterns (ICEAMP) // 2001. Nucleic Acids Res., 29, el 23). Метод не менее трудоемок, чем МЧ-РДА, и требует наличия дополнительного оборудования и специальных навыков, не типичных для лабораторий, занимающихся геномными исследованиями. Кроме того, первичные результаты исследования лишены наглядности, а окончательная идентификация интересующих CpG-островков сопряжена с необходимостью скрининга огромного количества клонов, что само по себе значительно повышает стоимость и трудоемкость работы.

Альтернативный способ анализа результатов метил-CpG-иммунопреципитации предложен в патенте США (Esteller, M. Methylation detection. United States Patent Application 2009/0176655). В этой модификации вычитательная гибридизация метилированной и общей фракций генома заменена гибридизацией на биологических микрочипах, несущих на себе зонды, соответствующие фрагментам 44 тысяч промоторных CpG-островков генома человека. Такой подход позволяет стандартизировать и значительно упростить процедуру скрининга дифференциально метилированной ДНК, однако значительным его недостатком становится утрата непредвзятого характера исследований и ограниченность тестируемой фракции генома. Эффективность метода в плане выхода научной продукции также оказалась невысокой: на примере анализа клеточной линии рака толстого кишечника НСТ116 продемонстрирована идентификация всего лишь пяти аномально метилированных промоторов.

Метод метилчувствительного рестрикционно-ориентированного геномного сканирования (МЧ-РОГС) теоретически позволяет одновременно анализировать статус метилирования нескольких тысяч CpG-островков в геноме. Суть его заключается в разделении двумерным электрофорезом радиоактивно меченых фрагментов, полученных обработкой геномной ДНК несколькими рестриктазами (Costello J.F., Hong C., Plass C., Smiraglia D.J. Restriction landmark genomic scanning: analysis of CpG islands in genomes by 2D gel electrophoresis // 2009. Methods Mol. Biol., 507, 131-148). Метод МЧ-РОГС не получил широкого распространения по ряду причин. Прежде всего, он излишне трудоемок, как методически, так и с точки зрения анализа результатов. Результаты исследований не всегда воспроизводимы, в частности, вследствие неполного гидролиза геномной ДНК редкощепящей рестриктазой NotI. Кроме того, для идентификации аномально метилированных CpG-островков в образце опухоли того или иного тканевого происхождения необходимо предварительно охарактеризовать нормальный метилотип соответствующей ткани, что представляет собой отдельное трудоемкое исследование. Наконец, изоляция интересующих CpG-островков из геля затруднена вследствие невозможности непосредственного визуального контроля.

Задачей изобретения является повышение воспроизводимости формируемых систем маркеров метилирования ДНК, упрощения процедуры характеристики нормальных тканевых метилотипов, сокращения времени цикла скрининга, высокой производительности метода и совершенствования способа визуализации результатов.

Поставленная задача решается тем, что проводят выделение геномной ДНК, гидролиз метилчувствительным и неметилчувствительным изошизомерами эндонуклеаз рестрикции, лигируют с универсальными адаптерами, проводят полимеразную цепную реакцию с универсальным флуоресцентно меченым праймером с последующим капиллярным электрофорезом, которая приводит к формированию систем маркеров в виде пиков электрофореграммы.

Под универсальным адаптером в настоящем изобретении подразумевается молекулярная конструкция, состоящая из олигонуклеотидов CCGGTCAGAGCTTTGCGAAT и ATTCGCAAAGCTCTGA, имеющая следующую структуру:

Способ основан на патогенетическом факторе канцерогенеза - нарушении процессов метилирования без нарушения структуры ДНК.

Способ осуществляется следующим образом.

Выделение геномной ДНК

Для получения ДНК из ткани опухоли используют следующий метод выделения ДНК:

1. Ткань опухоли измельчают глазными ножницами и затем гомогенизируют, растирая со стеклом.

2. Гомогенизат переносят в пробирку и добавляют экстракционный буфер (10 мМ Tris-HCl, 2 мМ ЭДТА, 4 мМ NaCl, pH=8,0).

3. Добавляют протеиназу К до концентрации 50 мкг/мл и SDS до 0.5%. Образец тщательно перемешивают.

4. Инкубируют 2 часа при 37°C.

5. Доводят объем образца до 5 мл раствором ТЕ, pH 8.0 и последовательно проводят экстракцию ДНК равными объемами фенола, смеси фенол-хлороформ и хлороформом.

6. К образцу добавляют 1/10 объема 5М ацетата натрия, pH 5,3, перемешивают и осаждают ДНК 2,5 объемами холодного 96% этанола, выдерживают образец 30 мин при температуре - 70°C.

7. Пробу центрифугируют при 0°C 15 мин с ускорением 12000 g. Высушивают осадок ДНК на воздухе и растворяют в 200 мкл ТЕ pH 8.0.

Гидролиз ДНК, полученной из образца, рестриктазами SmaI и XmaI (CCCGGG).

Для создания пула GC-богатых фрагментов образцы ДНК подвергаются поэтапному гидролизу. На первом этапе ДНК гидролизуют метилчувствительной рестриктазой SmaI, формирующей фрагменты ДНК с тупыми концами (CCC/GGG). Затем продукты реакции подвергают гидролизу нечувствительным к метилированию изошизомером рестриктазы SmaI - ферментом XmaI, формирующим липкие концы (C/CCGGG).

В рестрикционную смесь с общим объемом 20 мкл добавляют 2-10 мкг нативной ДНК, 2 мкл соответствующего 10-кратного буфера и 20 единиц рестриктазы Smal. Смесь инкубируют 16 часов при температуре 25°C, после чего в нее добавляют 20 единиц рестриктазы XmaI и инкубируют 6 часов при температуре 37°C. Для инактивации ферментов перед процедурой дотирования продуктов гидролиза ДНК с адаптерами смесь термостатируют в течение 20 минут при 65°C.

Для приготовления полной репрезентации системы маркеров (всего набора фрагментов, получаемых при конкретных условиях эксперимента) из протокола исключают этап гидролиза метилчувствительной рестриктазой SmaI.

Лигирование с универсальными адаптерами.

Адаптеры готовят путем инкубации равных объемов олигонуклеотидов следующего состава: CCGGTCAGAGCTTTGCGAAT и ATTCGCAAAGCTCTGA в течение 6 минут при температуре 65°C, с последующим охлаждением при комнатной температуре в течение 60 минут.

Продукты гидролиза ДНК лигируют с 2 нмоль адаптеров при помощи ДНК-лигазы Т4 в реакционной смеси следующего состава: 20 мкл адаптера в концентрации 100 мкмоль, 100 ед. акт. ДНК-лигазы Т4, 8 мкл 10× SE-буфера для ДНК-лигазы, 25 мкл деионизованной воды. Конечный объем реакции составлял 80 мкл. Время инкубации - 1 час при 16°C.

Полимеразная цепная реакция (ПЦР).

ПЦР проводят в общем объеме 25 мкл по следующей схеме: К 3 мкл смеси лигированных рестриктов добавляют 1 мМ олигопраймера, по 200 мкМ каждого дезоксинуклеотидтрифосфата, 3% формамида, 2,5 мкл 10-кратного буфера для ПЦР следующего состава: 500 мМ KCl, 100 мМ трис-HCl pH 8,4; 15 мМ MgCl2, деионизованной воды до 25 мкл. Начальную денатурацию проводят при 98°C в течение 5 минут, затем в смесь добавляют 1 ед. акт. термофильной ДНК-полимеразы и проводят 33 цикла ПЦР при следующих условиях: денатурация: 95°C - 25 секунд, отжиг: 70°C - 45 секунд, элонгация: 72°C - 90 секунд. ПЦР завершают инкубацией смеси при 72°C в течение 10 мин. В качестве праймера используют олигонуклеотид ATTCGCAAAGCTCTGACCGGGN, конъюгированный по 5'-концу с флуоресцентным красителем FAM. N соответствует любой последовательности нуклеотидов в количестве от 1 до 3. Эта последовательность является дискриминирующим удлинителем универсального праймера.

Разделение продуктов ПЦР в 8%-ном полиакриламидном геле (ПААГ) методом вертикального электрофореза.

Контроль эффективности ПЦР осуществляют путем разделения продуктов реакции в 8%-ном неденатурирующем полиакриламидном геле следующего состава: 8.4 мл 30%-го раствора акриламида, 0.6 мл 10%-го персульфата аммония, 26 мкл ТЕМЕД, до 30 мл разведенного буфера ТВЕ. Персульфат аммония и ТЕМЕД вносят после всех остальных компонентов и тщательно перемешивают полученную смесь. Электрофорез проводят при напряжении 400 В с использованием камеры для вертикального электрофореза («Хеликон», Москва) в течение 2.0-3.0 часов.

В качестве контроля молекулярной массы ДНК используют ДНК стандартной молекулярной массы pUC19/Msp1. Визуальный контроль пробега проб ДНК проводят по ксиленцианолу и бромфеноловому синему. Окрашивание геля нитратом серебра для визуализации продуктов ПЦР проводят по приведенной ниже методике.

Ультратонкое окрашивание нитратом серебра.

Окрашивание гелей проводят по усовершенствованной методике Liberman. После электрофореза гель инкубируют в растворе 0,011 М AgNO3 в течение 10-15 минут, затем трижды промывают в дистиллированной воде. Проявление проводят в модифицированном растворе проявителя (увеличена концентрация НСНО) следующего состава: 0,75 М NaOH; 0,5 М НСНО; 2,3 mM Na(BH4) около 10-15 минут, в зависимости от интенсивности проявления геля.

Капиллярный электрофорез.

Продукты реакции разделяют методом капиллярного электрофореза при постоянной температуре 60°C в денатурирующем геле на автоматическом генетическом анализаторе ABI PRISM 3100 (Applied Biosystems, США) по протоколам фирмы-производителя в режиме фрагментного анализа. В качестве маркера молекулярной массы ДНК используют LIZ500 (Applied Biosystems). Для анализа результатов используют компьютерную программу GeneMapper или аналогичную.

Оптимальные критерии интерпретация результатов исследования.

Если в опухолевой ДНК присутствует аномальное метилирование, то цитозины в составе CpG-динуклеотидов заменены на 5-метилцитозины, в том числе, в сайтах узнавания SmaI. В этом случае рестриктаза SmaI не в состоянии гидролизовать геномную ДНК в сайтах узнавания, и матрица для адаптер-опосредованной метилчувствительной ПЦР остается интактной. В результате на электрофореграмме капиллярного электрофореза видны фрагменты, отсутствующие при анализе контрольной ДНК нормальных клеток. При отсутствии аномального метилирования происходит гидролиз геномной ДНК в сайтах узнавания SmaI. Матрица для ПЦР разрушается и соответствующий ПЦР-продукт не нарабатывается. Отрицательный контроль не должен содержать ПНР-продуктов, в положительном контроле должны присутствовать ПНР-продукты, соответствующие участкам генома, облигатно метилированным в исследуемой ткани.

На фигуре 1 показан пример выявления аномально метилированного фрагмента генома (указан стрелками). В левой части электрофореграммы - фрагменты константно метилированных генов. Использован удлинитель универсального праймера CCG. Двоение сигналов объясняется различиями в электрофоретической подвижности комплементарных цепей фрагмента ДНК в денатурирующих условиях.

На фигуре 2 показан пример выявления аномально метилированного фрагмента генома (указан стрелками). В левой части электрофореграммы - фрагменты константно метилированных генов. Использован удлинитель универсального праймера GCG.

Полный набор фрагментов ДНК, состояние метилирования которых оценивается с использованием конкретной системы, визуализируется капиллярным электрофорезом полной репрезентации. На фигуре 3 показан пример визуализации полной репрезентации системы маркеров при использовании в реакции удлинителя универсального праймера CCG. Пики, указанные стрелками, соответствуют фрагментам облигатно метилированных локусов генома.

Задача повышения воспроизводимости формируемых систем маркеров метилирования ДНК, упрощения процедуры характеристики нормальных тканевых метилотипов, сокращения времени цикла скрининга и повышения производительности метода решена разработкой способа формирования систем маркеров метилирования ДНК, заключающегося в том, что проводят выделение геномной ДНК, гидролиз метилчувствительным и неметилчувствительным изошизомерами эндонуклеаз рестрикции, лигируют продукты гидролиза ДНК с универсальными адаптерами, проводят полимеразную цепную реакцию с универсальным флуоресцентно меченым праймером, образующую после капиллярного электрофореза систему маркеров в виде пиков электрофореграммы.

Способ формирования систем маркеров метилирования ДНК, заключающийся в том, что проводят выделение геномной ДНК, гидролиз метилчувствительным и неметилчувствительным изошизомерами эндонуклеаз рестрикции, лигируют продукты гидролиза ДНК с универсальными адаптерами из олигонуклеотидов CCGGTCAGAGCTTTGCGAAT и ATTCGCAAAGCTCTGA, проводят полимеразную цепную реакцию с универсальным флуоресцентно меченым праймером ATTCGCAAAGCTCTGACCGGGN, конъюгированным по 5'-концу с флуоресцентным красителем FAM, с последующим капиллярным электрофорезом, которая приводит к формированию системы маркеров в виде пиков электрофореграммы, для анализа которых используют весь набор маркеров системы в виде полной репрезентации.



 

Похожие патенты:

Изобретение относится к области медицинской микробиологии и касается способа дифференциации штаммов Yersinia pestis. .

Изобретение относится к области биотехнологии, а именно к способу определения строения интерфазных хромосом, способу колориметрической гибридизации in situ, способу визуального обнаружения Робертсоновских транслокаций между акроцентрическими хромосомами в образце, полученном от человека, и способу подтверждения присутствия маркерных хромосом в образце.
Изобретение относится к медицине, а именно к терапии и кардиологии, и касается способа прогнозирования риска развития метаболического синдрома у пациента с абдоминальным ожирением в российской популяции.

Изобретение относится к соединению формулы (I): Также предложены способ детекции гибридизации и применение соединения формулы (I) в качестве электрохимического индикатора гибридизации.

Изобретение относится к области биотехнологии, медицинской биохимии, диагностической медицинской микробиологии, прикладной иммунохимии и разработке диагностических тест-систем.

Изобретение относится к молекулярной биологии, генетической инженерии и медицине. .

Изобретение относится к области молекулярной биологии и биотехнологии и может быть использовано в медицине и в фармацевтической промышленности. .

Изобретение относится к медицине, а именно к оториноларингологии, и касается способа лечения хронического риносинусита. .

Изобретение относится к области молекулярной биологии и биотехнологии и может быть использовано в медицине и в фармацевтической промышленности. .

Изобретение относится к области медицины, в частности онкологии и молекулярной биологии, и касается способа диагностики рака мочевого пузыря (РМП) и набора для его осуществления.

Изобретение относится к области молекулярной биологии и может быть использовано для направленной модификации последовательности дуплексной ДНК (днДНК). .
Изобретение относится к области медицины, а именно к иммунологии, и предназначено для обнаружения нейтрофильных внеклеточных ловушек экспресс-методом с количественной оценкой данного явления.

Изобретение относится к области биотехнологии и молекулярной генетики. .

Изобретение относится к микробиологии и молекулярной генетике микроорганизмов и касается способов выявления экспрессирующихся генетических детерминант патогенных микроорганизмов рода Burkholderia с использованием реакций обратной транскрипции и сопряженной амплификации (ОТ-ПЦР) для их последующего структурно-функционального анализа, что, в свою очередь, позволит оценить влияние адаптационных изменений клеток при изменении условий внешней среды на выраженность важнейших биологических характеристик микроорганизмов, в частности вирулентности и устойчивости к антимикробным препаратам.

Изобретение относится к области биотехнологии, а именно к способу получения образца для амплификации нуклеиновой кислоты и к набору для получения образца для амплификации нуклеиновой кислоты.

Изобретение относится к области биотехнологии, генной инженерии и иммунологии. .

Изобретение относится к области биотехнологии, а именно к способу измерения длины теломер в клетках. .

Изобретение относится к области молекулярной биологии и вирусологии
Наверх