Способ прогнозирования риска развития метаболитического синдрома у пациента с абдоминальным ожирением


 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2471193:

Государственное образовательное учреждение высшего профессионального образования "Санкт-Петербургский государственный медицинский университет имени академика И.П. Павлова Федерального агентства по здравоохранению и социальному развитию" (RU)

Изобретение относится к медицине, а именно к терапии и кардиологии, и касается способа прогнозирования риска развития метаболического синдрома у пациента с абдоминальным ожирением в российской популяции. Выделяют ДНК лимфоцитов из периферической крови и далее идентифицируют T45G полиморфизм гена адипонектина методом полимеразной цепной реакции с последующим рестрикционным анализом. При выявлении T45T генотипа гена адипонектина прогнозируют риск развития метаболического синдрома. Способ является высокоспецифичным, может использоваться для раннего прогнозирования риска развития метаболического синдрома у пациентов с абдоминальным ожирением. 1 пр.

 

Изобретение относится к области медицины, в частности терапии и кардиологии, и может быть использовано для прогнозирования риска развития метаболического синдрома у пациента с абдоминальным ожирением среди российской популяции.

Метаболический синдром представляет собой сочетание нарушений обмена липидов, углеводов, которые в сочетании с абдоминальным ожирением и артериальной гипертензией являются факторами риска развития сердечно-сосудистых заболеваний и сахарного диабета тип 2. В связи с чем профилактика, диагностика и лечение метаболического синдрома являются важной задачей современной медицины. В России наблюдается высокая заболеваемость метаболическим синдромом. Среди этих больных отмечен рост показателей смертности от ИБС и инсульта. Поэтому прогнозирование риска развития метаболического синдрома у пациентов с абдоминальным ожирением позволит своевременно проводить профилактические мероприятия и снизить частоту жизнеугрожающих состояний.

По данным литературы большое внимание уделяется изучению молекулярно-генетических факторов развития метаболического синдрома, поиску генов предрасположенности и ассоциаций их полиморфизмов с различными компонентами синдрома. Имеются данные, свидетельствующие об ассоциации метаболического синдрома и ожирения с полиморфизмами некоторых генов, продукты экспрессии которых играют важную роль в адипогенезе, углеводном и липидном обменах. Малоизученным остается значение гена адипонектина - цитокина, вырабатываемого жировой тканью, в формировании метаболического синдрома [Gable D.R., Hurel S.J., Humphries S.E Adiponectin and its gene variants as risk factors for insulin resistance, the metabolic syndrome and cardiovascular disease // Atherosclerosis. - 2006. - Vol.188 - P.231-244; Gottlieb MG, Bodanese LC, Leite LE, Schwanke CH, Piccoli Jda C, da Rocha MI, da Cruz IB. Association Between the Gln223Arg Polymorphism of the Leptin Receptor and Metabolic Syndrome in Free-Living Community Elderly // Metabolic syndrome and related disorders. - 2009. - Vol.7(4). - P.1-8].

Известен способ прогнозирования риска развития метаболического синдрома с помощью идентификации полиморфизма Gly10Lys гена KCNJ11, расположенного на хромосоме 11 в области р15.1. Ген кодирует одну из двух субъединиц АТФ-зависимых калиевых каналов [Aguilar-Bryan L., Clement IV J. P., Gonzales Z. Molecular biology of adenosine triphospatesensitive potassium channels // Endocr. Rew. - 1999. - Vol.78(1). - P.227-45].

Недостатком этого способа является его неспецифичность и отсутствие ассоциации полиморфного маркера Gly10Lys гена KCNJ11 с метаболическим синдромом в русской популяции [Мкртумян A.M., Бирюкова Е.В., Маркина Н.В. Молекулярно-генетические особенности, характер метаболизма глюкозы и функция эндотелия у больных метаболическим синдромом русской популяции // Сахарный диабет. - 2008. - №4. - С.26-31]. Подобные результаты получены и на индийской популяции [Ranjith N., Pegoraro R. J., Naidoo D. P. et al. Genetic Variants Associated with Insulin Resistance and Metabolic Syndrome in Young Asian Indians with Myocardial Infarction // Metabolic Syndrome and Related Disorders. - 2008. Vol.6(3). P.209-214].

Известен способ, результаты которого свидетельствуют о риске развития метаболического синдрома в русской популяции у носителей аллеля G и генотипа GG полиморфного маркера гена TCF7L2, расположенного на хромосоме 10q, кодирующего ядерный рецептор β-катенина, канонического активатора Wnt-сигнального пути, играющего важную роль в пролиферации, дифференцировании и росте различного рода клеток [Мкртумян A.M., Бирюкова Е.В., Маркина Н.В. Молекулярно-генетические особенности, характер метаболизма глюкозы и функция эндотелия у больных метаболическим синдромом русской популяции // Сахарный диабет. - 2008. - №4. - С.26-31]. Подобный результат был получен для европейской популяции, но для прогнозирования риска развития сахарного диабета тип 2 [Florez J. С, Jablonski K. A., Bayley N. TCF7L2 polymorphisms and progression to diabetes in the diabetes prevention program // N Engl J Med. - 2006. Vol.355(3). P.241-50].

Способ специфичен, но его недостатками для российской популяции являются небольшая выборка, включающая 100 пациентов без метаболического синдрома и 104 пациента с данным синдромом, а также отсутствие проспективного наблюдения за пациентами без метаболического синдрома для оценки роли генотипа в развитии данного синдрома.

Техническим результатом изобретения является создание высокоспецифичного способа прогнозирования метаболического синдрома у пациентов с абдоминальным ожирением в российской популяции на ранних сроках.

Указанный технический результат достигается тем, что в известном способе прогнозирования метаболического синдрома у пациента с абдоминальным ожирением в российской популяции, включающем выделение ДНК лимфоцитов из периферической крови, проведение полимеразной цепной реакции и рестрикционный анализ для идентификации полиморфизма исследуемого гена, согласно изобретению идентифицируют T45G полиморфизм гена адипонектина, и при выявлении T45T генотипа гена адипонектина прогнозируют риск развития метаболического синдрома.

Способ был разработан на основе проведенных исследований у 438 больных абдоминальным ожирением, из которых 294 человека имели метаболический синдром, а также при проспективном наблюдением (три года) за 44 больными абдоминальным ожирением без метаболических нарушений. У всех пациентов анализировались уровень артериального давления, антропометрические (окружность талии) и биохимические параметры (глюкоза плазмы крови натощак, уровень триглицеридов и холестерина липопротеинов высокой плотности), с тем чтобы диагностировать метаболический синдром. Для прогнозирования риска развития метаболического синдрома исследовали T45G полиморфизм гена адипонектина и рассчитывали отношение шансов (ОШ). Как отсутствие ассоциации риска развития метаболического синдрома с носительством аллеля или генотипа рассматривали ОШ=1, как положительную ассоциацию - ОШ>1 и ОШ<1- как отрицательную ассоциацию аллеля или генотипа с метаболическим синдромом (пониженный риск развития). Доверительный интервал представляет собой интервал значений, в пределах которого с вероятностью 95% находится ожидаемое значение ОШ.

Доверительные интервалы для частотных показателей рассчитывались с использованием точного метода Фишера.

Проведенные исследования показали, что носительство T45T генотипа гена адипонектина достоверно увеличивает риск развития метаболического синдрома в 2,2 раза (отношение шансов: 2,2; для 95% доверительный интервал: 1,1-4,9; р=0,02) у больных абдоминальным ожирением; в то время как носительство T45G и G45G генотипов не влияет на риск возникновения метаболического синдрома у больных абдоминальным ожирением.

Способ выполняется, например, следующим образом.

Для выделения ДНК лимфоцитов из периферической крови в пластиковую пробирку, содержащую Na2ЭДТА (рН=8,0) в качестве антикоагулянта, забирают кровь самотеком из локтевой вены в количестве 2,0 мл. Кровь перемешивают в пробирке для предотвращения образования тромбов.

К 0,5 мл цельной крови добавляют 1,0 мл стерильной дистиллированной воды, перемешивают и центрифугируют 7 минут при температуре 4°С со скоростью 800g. Полученный осадок еще дважды ресуспендируют и отмывают в 1,0 мл стерильной дистиллированной воды. Полученный осадок ядер ресуспендируют в 300 мкл подогретого буфера для выделения (300 мМ ацетат натрия, 50 мМ Na2ЭДТА, рН 7.5), содержащего протеиназу К (110 мкг/мл) и саркозил (0,55%, в/о). Инкубируют образцы в течение 3 часов при 65°С до получения гомогенного раствора. Экстракцию белков проводят, добавив равный объем смеси фенол: хлороформ: изоамиловый спирт в соотношении 1:1:24 и центрифугируют 5 минут со скоростью 3500 g. Отбирают водную фазу и проводят повторную экстракцию белков равным объемом смеси хлороформ: изоамиловый спирт (24:1) при тех же условиях центрифугирования. Переносят осветленный лизат в новые пробирки, добавляют два объема холодного 96% этанола, перемешивают, выдерживают 1 час при -20°С и центрифугируют при 4000 g в течение 10 мин. Осадок ДНК промывают 1 мл 70% этанола, подсушивают при комнатной температуре в течение 30-40 мин и растворяют в 100 мкл буфера ТЕ (10 мМ трис-HCl, 1 мМ ЭДТА, рН 8.0). Оценку качества препаратов геномной ДНК проводят в 0,7% агарозе. Обычно выход ДНК из 0,5 мл крови составляет 20-30 мкг.

Идентификацию T45G полиморфизма гена адипонектина проводят методом ПЦР с последующим рестрикционным анализом, используя последовательности олигонуклеотидных праймеров, описанных в работе N. Xita и соавт. [Xita N., Georgiou I., Chatzikyriakidou A. et al. Effect of adiponectin gene polymorphisms on circulating adiponectin arid insulin resistance indexes in women with polycystic ovary syndrome // Clin Chem. - 2005. - Vol.51(2). - P.416-23]:

прямой: 5' - GAAGTAGACTCTGCTGAGATGG - 3';

обратный: 5' - TATCAGTGTAGGAGGTCTGTGATG - 3'.

Амплификацию ДНК проводят в стандарном буфере для ПЦР, описанном выше, при концентрации ионов магния 1.5 mM и в следующем температурно-временном режиме: начальная денатурация 95°С - 2 мин, 35 циклов амплификации при 95°С - 60 сек, 58°С - 45 сек, 72°С - 45 сек, заключительный синтез при 72°С в течение 5 минут.

Для проведения рестрикционного анализа 5 мкл полученного ампликона инкубируют с 6 ед. рестриктазы Smal («СибЭнзим») в буфере, рекомендованном производителем. Рестрикционные фрагменты ДНК анализируют в 2% агарозном геле.

Полиморфизм T45G обусловлен заменой Т→G во втором экзоне гена адипонектина, что приводит к появлению рестрикционного сайта для эндонуклеазы Smal. В результате присутствие Т аллеля определяется электрофоретически как один фрагмент, размером 372 п.н., G аллель детектируется по наличию рестрикционных фрагментов с молекулярной массой 219 и 153 п.н., соответственно.

Достижение технического результата объективно подтверждается следующим клиническим примером.

Пример 1. Пациент Ч., 50 лет. Диагноз: Абдоминальное ожирение. Через три года при повторном осмотре диагноз: Метаболический синдром: абдоминальное ожирение, артериальная гипертензия, гипергликемия. С помощью предлагаемого способа было установлено, что этот пациент является носителем T45T генотипа гена адипонектина.

Предлагаемый способ является высокоспецифичным (89,9%), может использоваться для раннего прогнозирования риска развития метаболического синдрома у пациентов с абдоминальным ожирением врачами разных специальностей. Результаты медико-генетического исследования позволяют своевременно осуществить мероприятия по профилактике метаболического синдрома.

Способ прогнозирования риска развития метаболического синдрома у пациента с абдоминальным ожирением в российской популяции, включающий выделение ДНК лимфоцитов из периферической крови, проведение полимеразной цепной реакции и рестрикционный анализ для идентификации полиморфизма исследуемого гена, отличающийся тем, что идентифицируют T45G полиморфизм гена адипонектина и при выявлении T45T генотипа гена адипонектина прогнозируют риск развития метаболического синдрома.



 

Похожие патенты:
Изобретение относится к области медицины, а именно к разработке способов ранней диагностики онкологических заболеваний, в частности, для персонала, работающего во вредных для здоровья условиях труда.

Изобретение относится к медицине, а именно к оториноларингологии, и касается способа лечения хронического риносинусита. .

Изобретение относится к медицине и предназначено для прогнозирования развития рецидива кровотечения из острых гастродуоденальных язв желудка и/или двенадцатиперстной кишки.

Изобретение относится к области медицины, а именно к гематологии. .

Изобретение относится к области медицины, а именно к медицинской диагностике, и может быть использовано для прогнозирования риска развития гиперплазии эндометрия у женщин с генитальным эндометриозом на протяжении всей жизни.

Изобретение относится к области биотехнологии, конкретно к исследованию рецептору, сопряженному с G-белком, и может быть использовано в медицине. .

Изобретение относится к области медицины, а именно к спортивной медицине, и может быть использовано для определения стероидного профиля при допинговом контроле спортсменов.

Изобретение относится к медицине и касается способа прогнозирования риска раннего развития профессиональных аллергических дерматозов. .
Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для дифференциальной диагностики сахарного диабета и ацетонемической рвоты у детей.

Изобретение относится к медицинским токсикологическим исследованиям, в частности к санитарной токсикологии. .

Изобретение относится к соединению формулы (I): Также предложены способ детекции гибридизации и применение соединения формулы (I) в качестве электрохимического индикатора гибридизации.

Изобретение относится к области биотехнологии, медицинской биохимии, диагностической медицинской микробиологии, прикладной иммунохимии и разработке диагностических тест-систем.

Изобретение относится к молекулярной биологии, генетической инженерии и медицине. .

Изобретение относится к области молекулярной биологии и биотехнологии и может быть использовано в медицине и в фармацевтической промышленности. .

Изобретение относится к медицине, а именно к оториноларингологии, и касается способа лечения хронического риносинусита. .

Изобретение относится к области медицины, а именно к гематологии. .

Изобретение относится к области биотехнологии, а именно к способу оценки эффективности терапии рака мочевого пузыря человека методом ПЦР в режиме реального времени и набору для его осуществления.

Изобретение относится к области биотехнологии, а именно к способу определения строения интерфазных хромосом, способу колориметрической гибридизации in situ, способу визуального обнаружения Робертсоновских транслокаций между акроцентрическими хромосомами в образце, полученном от человека, и способу подтверждения присутствия маркерных хромосом в образце
Наверх