Способ оценки риска развития метаболического синдрома у детей на основе генетических и биохимических маркеров



Способ оценки риска развития метаболического синдрома у детей на основе генетических и биохимических маркеров
Способ оценки риска развития метаболического синдрома у детей на основе генетических и биохимических маркеров
Способ оценки риска развития метаболического синдрома у детей на основе генетических и биохимических маркеров

 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2492485:

Глотов Олег Сергеевич (RU)
Махрова Ирина Александровна (RU)
Глотов Андрей Сергеевич (RU)

Изобретение относится к области медицины. Предложен способ оценки риска развития метаболического синдрома (МС) у детей на основе генетических и биохимических маркеров по наличию инсулинорезистентности с помощью индекса инсулинорезистентности HOMA-IR. После исследования биохимических показателей HOMA-IR проводят исследование коэффициента атерогенности (КА). По коэффициенту 3хКА+HOMA-IR делают вывод о развитии МС и выявлении группы риска развития заболевания среди детей. Диапазон значений коэффициента до 10 соответствует здоровым детям; от 10 до 14,5 - дети с отдельными метаболическими нарушениями и ожирением; выше 14,5 - диагностируют МС. В группе детей со значениями, посчитанными по формуле больше 10, но меньше 14,5, дополнительно определяют риск МС с помощью метода ПЦР участков гена метилентетрагидрофолатредуктазы (MTHFR) с дальнейшей обработкой эндонуклеазами рестрикции и при выявлении генотипа С/Т полиморфного варианта 677С/Т гена MTHFR таких детей относят к группе риска по развитию МС. Изобретение обеспечивает эффективный способ оценки риска развития МС у детей и позволяет начать терапевтические и профилактические мероприятия на самых ранних сроках развития данного заболевания. 3 ил., 1 пр.

 

Изобретение относится к области медицины, а именно к педиатрии, детской эндокринологии, медицинской генетики, связано с разработкой способа прогнозирования риска развития метаболического синдрома.

Метаболический синдром (МС) относится к группе многофакторных заболеваний, в развитии которых важную роль играет наследственная предрасположенность. Ранняя диагностика, выявление группы риска и профилактика метаболического синдрома являются социально значимой проблемой современной медицины, так как заболевание включает компоненты: абдоминальное ожирение, сахарный диабет 2 типа (СД 2 типа), артериальную гипертензию (АГ), которые приводят к ухудшению качества жизни, ранней инвалидизации и преждевременной смертности. Заболеваемость метаболическим синдромом демонстрирует неуклонный рост во многих развитых странах, в том числе и России. Частота метаболического синдрома у детей по данным разных авторов колеблется от 15% до 30%, высокая вариабельность распространенности в первую очередь связана с неоднозначностью диагностических критериев. Несмотря на многочисленные исследования, до сих пор нет четкого представления о причинах возникновения метаболического синдрома, отсутствуют точные сведения о патогенезе заболевания, и как следствие, не разработаны общепризнанные диагностические критерии, нет единого мнения о способах прогнозирования развития и оценки риска возникновения синдрома.

Анализ патентной и специальной литературы показал, что в настоящее время существует ряд способов диагностики и прогнозирования риска развития метаболического синдрома у детей. Можно выделить способы диагностики метаболического синдрома и выявления группы риска заболевания.

Известен способ, основанный на введении эффективной дозы агониста кортизола, позволяющий диагностировать МС и выявлять группу риска по ингибирующему эффекту агониста на аутопродукцию кортизола. При ингибировании аутопродукции кортизола меньше по сравнению с нормой диагностируют МС (патент РФ №2171471, 2001 г., Кортендо АБ). Однако данный способ можно использовать только у взрослых пациентов, так как для детей не доказана безопасность применения инвазивного метода для диагностикой заболевания. Кроме того, метод трудоемкий, так как связан с введением препарата и забором крови.

В настоящее время существуют клинико-лабораторные способы диагностики МС (Критерии метаболического синдрома у детей и подростков (Международная Диабетическая Федерация) (Zimmet P., Alberti G., Kaufman F. et al. The metabolic syndrome in children and adolescents // Diabetes Voice. 2007. Vol.52, №4. P.29-32). Согласно критериям детям до 10 лет диагноз МС не устанавливается, но если помимо абдоминального ожирения имеется отягощенный семейный анамнез по МС, СД 2 типа, АГ, то исследуют другие показатели. МС диагностируется с 10 лет при наличии абдоминального ожирения и двух и более из следующих признаков: повышения уровня триглицеридов ≥1,7 ммоль/л, глюкозы ≥5,6 ммоль/л или диагностированный СД 2 типа, нарушение толерантности к глюкозе, повышение уровня артериального давления (АД) ≥130/85 мм рт.ст., снижение холестерина липопротеидов высокой плотности (ХС ЛПВП) <1,03 ммоль/л. Для детей 16 лет и старше используют существующие критерии для взрослых: абдоминальное ожирение (объем талии у мужчин ≥94 см, у женщин ≥80 см) плюс любые два из следующих симптомов: повышения уровня триглицеридов ≥1,7 ммоль/л, глюкозы ≥5,6 ммоль/л или диагностированный СД 2 типа, нарушение толерантности к глюкозе, повышение уровня артериального давления (АД) ≥130/85 мм рт.ст., снижение ХС ЛПВП у мужчин <1,03 ммоль/л, у женщин <1,29 ммоль/л.

Известен способ диагностики МС с применением центильного метода: окружность живота >75-го центиля, АД >90-го центиля по полу возрасту и росту, а также триглицеридемия >1,1 ммоль/л, снижения уровня ХС ЛПВП <1,3 ммоль/л, повышения уровня глюкозы натощак >6,1 ммоль/л (Синицын П.А., Щербакова М.Ю., Ларионова В.И. и др. Метаболический синдром у детей // Педиатрия. 2008. Т.87, №5. С.124-126).

Существует также способ диагностики МС по наличию инсулинорезистентности (диагностируется с помощью индекса инсулинорезистентности HOMA-IR), ожирения абдоминального типа, дислипидемии, АГ, гиперурикемии, нарушения толерантности к глюкозе или СД 2 типа (Бекезин В.В. Ожирение и инсулинорезистентность у детей и подростков: метаболические, психологические, кардиоваскулярные аспекты, оптимизация лечения: Автореф. дис. д-ра мед. наук. Смоленск, 2008. 38 с.).

Известен метод ранней детекции метаболического синдрома у детей на основе исследования уровня холестерина (0,5-0,6 mMol/L), фосфолипидов (0,06-0,07 mMol/L) и глюкозы (0,11-0,16 mMol/L), диапазон значений которых служит для постановки диагноза данного заболевания (межд. патент - MD3468 F1, 2008.21.01).

Данные методы диагностики имеют важное клиническое значение для выявления МС у детей и подростков, но они не позволяют определять группу риска развития синдрома и проводить дифференциальную диагностику между метаболическим синдромом и осложненным ожирением, протекающим с АГ и СД 2 типа.

Для своевременного лечения и профилактики МС необходимо выявлять детей, входящих в группу риска развития заболевания. Большинство авторов для выявления группы риска пользуются косвенными факторами: отягощенный семейный анамнез по ожирению, АГ и СД 2 типа, неблагополучие перинатального периода жизни со стороны матери (токсикозы беременности, угроза невынашивания, оперативное родоразрешение) и плода (гипоксия, задержка внутриутробного развития, асфиксия в родах), низкая масса тела при рождении или крупный плод, искусственное вскармливание на первом году жизни, ранняя манифестация ожирения до 5 лет (Бородина О. В. Лептин и его свойства // Диабет. Образ жизни. 2006. №2. С.26-27; Болотова Н.В., Лазебникова С.В., Аверьянов А.П. Особенности формирования метаболического синдрома у детей и подростков // Педиатрия. 2007. Т.86, №3. С.35-39; Дедов И.И., Мельниченко Г.А. (ред.). Ожирение: этиология, патогенез, клинические аспекты. М.: Медицинское информационное агентство, 2004. 456 с.; Zimmet P., Alberti G., Kaufman F. et al. The metabolic syndrome in children and adolescents // Diabetes Voice. 2007. Vol.52, №4. P.29-32).

Основным недостатком выявления группы риска развития МС по этим признакам является косвенный характер диагностики. Кроме того, не все исследования подтверждают влияние этих факторов на развитие заболевания.

В нашем изобретении мы останавливаемся на метаболических изменениях и генетических «дефектах» как факторов выявления риска метаболического синдрома. Анализ патентной литературы показал, что до сих пор не предложен способ выявления групп риска и прогнозирования метаболического синдрома на основе биохимических выражений и генетических исследований, то есть, способа-аналога нет.

Однако известен способ оценки риска метаболического синдрома, основанный на выявлении генотипа 4G/4G (вариант - 675 4G/5G) по гену РА1. Он нацелен на формирование группы риска, но не позволяет проводить дифференциальную диагностику (Веrberoglu) М. et al. Plasminogen activator inhibitor (PAI-1) gene polymorphism (-675 4G/5G) associated with obesity and vascular risk in children. J/ Pediatr. Endocrinol Metab. 2006 May; 19(5):741-8).

Этот способ является прототипом разработанного метода прогнозирования риска и дифференциальной диагностики метаболического синдрома у детей. В отличие от него, разработанный метод связан на первом этапе с биохимическими показателями, что является менее затратным, так как позволяет выделять ограниченную группу риска в еще поликлинических условиях, и дает возможность врачу выявить показания к генетическому исследованию.

Задачей настоящего изобретения является разработка способа прогнозирования риска развития метаболического синдрома на основе биохимических и генетических маркеров, позволяющих оценить риск его возникновения у детей и подростков как с избыточным весом, так и с неосложненным конституционально-экзогенным ожирением.

Технический результат изобретения основан на прогнозировании риска развития МС в результате исследования биохимических показателей инсулинорезистентности HOMA-IR и коэффициента атерогенности (КА), исследования генетических показателей методом ПЦР с дальнейшей обработкой эндонуклеазами рестрикции участков гена метилентетрагидрофолатредуктазы (MTHFR), математической обработкой результатов исследования.

Технический результат достигается следующим образом.

В способе оценки риска развития метаболического синдрома у детей на основе генетических и биохимических маркеров по наличию инсулинорезистентности с помощью индекса инсулинорезистентности HOMA-IR, после исследования биохимических показателей инсулинорезистентности HOMA-IR проводят исследование коэффициента атерогенности (КА) и по коэффициенту 3хКА+HOMA-IR делают вывод о развитии МС и выявлении группы риска развития заболевания среди детей, а именно - диапазон значений коэффициента до 10 соответствует здоровым детям; от 10 до 14,5 - дети с отдельными метаболическими нарушениями и ожирением; выше 14,5 - диагностируют МС, причем в группе детей со значениями, посчитанными по формуле больше 10, но меньше 14,5, дополнительно определяют риск МС с помощью метода ПЦР участков гена метилентетрагидрофолатредуктазы (MTHFR) с дальнейшей обработкой эндонуклеазами рестрикции, и при выявлении генотипа С/Т полиморфного варианта 677С/Т гена MTHFR таких детей относят к группе риска по развитию МС.

В качестве биохимических показателей выбраны индекс инсулинорезистентности HOMA-IR, характеризующий углеводный обмен, и коэффициент атерогенности, отражающий изменения липидного обмена. Выбор показателей обусловлен тем, что повышение HOMA-IR и КА часто встречаются при МС. С помощью линейной модели с факторным анализом (GLM) составлено выражение, на основании которого возможно предсказать развитие МС и выявить группу риска развития заболевания среди детей: 3хКА+HOMA-IR. Подобное выражение рассчитано используя регрессионный анализ при исследовании данных параметров риска у 160 детей с ожирением и метаболическим синдромом и составлено на основании того, что КА и HOMA-IR совместно являются факторами характерными для МС (р<0,001).

МС наиболее часто сопутствуют инсулинорезистентность - 90,9% и повышение КА - 77,4% (см. фиг.1).

Изобретение поясняется фиг.1 и 2. На фиг.1 показаны нарушения, сопутствующие метаболическому синдрому. Распределение детей в нашей выборке соответствовало данной математической модели (см. фиг.2). На фиг.3 представлена электрофореграмма результата обработки эндонуклеазой рестрикции HinFI ПЦР продуктов гена MTHFR.

Диапазон значений коэффициента до 10 соответствует здоровым детям; от 10 до 14,5 - дети с отдельными метаболическими нарушениями, ожирением - составляют группу риска по развитию МС; выше 14,5 - метаболический синдром.

Ген MTHFR выбран для исследования, так как его полиморфизм связан с развитием нарушений характерных для МС, в частности, полиморфизм 677C>Т гена MTHFR связан с возникновением венозных и артериальных тромбозов, АГ, ишемической болезни сердца, инфарктом миокарда. Использование специфических праймеров позволяет провести амплификацию указанного гена, что в свою очередь необходимо для выявления генотипа, связанного с риском развития метаболического синдрома.

Изобретение поясняется протоколом биохимических исследований и электрофореграммой (фиг.3) результата обработки эндонуклеазой рестрикции HinFI ПЦР продуктов гена MTHFR соответственно.

Для осуществления способа предлагаются следующие шаги.

1. Сбор биологического материала для биохимического исследования

Для биохимического исследования венозной крови забор производят в утренние часы, строго натощак.

Процедура забора крови из вены состоит в следующем. Под локоть пациента подкладывается небольшой валик. Рука в области нижней трети плеча перетягивается жгутом и просят пациента сжать кулак. Затем кожу в области пункции вены (на локтевом сгибе) обрабатывают спиртом и выполняют пункцию. Необходимое для анализа количество крови (определяется фирмой-производителем анализатора) набирают шприцом или, опустив руку пациента вниз, просто спускают через иглу кровь в подставленную пробирку. Далее жгут снимают, иглу вынимают из вены, а пациента просят согнуть руку в локте, предварительно положив на место пункции ватный тампон, смоченный в спирте.

Кровь забирают в пробирки с активатором свертывания - красная крышка и белое кольцо. Внутренние стенки пробирки покрыты сухим активатором свертывания (SiO - оксид кремния) для ускорения образования сгустка крови. Время свертывания 20-30 мин.

Далее с помощью анализаторов закрытого типа фирмы "Roche" (Швейцария): Elecsys-2010, Cobas Integra-400 Plus, Cobas-6000; и фирмы "Siemens - Advia Centaur" (Германия), проводят анализ инсулина, глюкозы и липидов в плазме крови натощак. Рассчитывают индекс HOMA-IR, взяв за исходное значение инсулина плазмы натощак (мкЕд./мл), которое затем умножают на значение глюкозы плазмы натощак (ммоль/л)/22.5. Рассчитывают коэффициент атерогенности по формуле значение липопротеидов низкой плотности/ липопротеидам высокой плотности.

2. Прогнозирование группы риска метаболического синдрома

Используя рассчитанное выражение - 3хКА+HOMA-IR, на основании которого возможно предсказать развитие МС, выявляют группу риска развития метаболического синдрома среди детей на основании значений коэффициента больше 10, но меньше 14,5. Для таких детей показано генетическое исследование. При диапазоне значений коэффициента выше 14,5 диагностируют метаболический синдром.

3. Сбор биологического материала для генетического исследования

Материалом для генетического исследования может быть кровь, буккальный эпителий, полученные от обследуемого пациента.

4. Выделение ДНК из полученного материала

На сегодняшний день известно множество способов выделения ДНК. В последнее время широкое распространение получили методы, позволяющие экстрагировать высокоочищенную ДНК, а также автоматизировать процесс ее выделения. Это широкий спектр коммерческих наборов реагентов, производимых американскими и европейскими компаниями.

ДНК может быть выделена самыми разнообразными способами в зависимости от того, какой был взят биоматериал

- классическими методами:

с использованием протеиназы К, с последующей депротеинизацией либо фенольным методом, либо солевым методом;

- с помощью коммерческих наборов;

- автоматически (с помощью специальных роботов и специальных наборов).

5. Исследование участков гена MTHFR

Можно использовать самые разнообразные молекулярно-генетические методы: анализ полиморфизма длин рестрикционных фрагментов после полимеразной цепной реакции (ПЦР-ПДРФ), ПЦР с использованием аллель-специфичных праймеров (ПЦР-АСП), метод "обратной дот-блот гибридизации" (ПЦР-АСО), ПЦР в реальном времени, анализ конформации одноцепочечных фрагментов (SSCP), масс-спектрометрические методы, биочипы и многие др. Использовать метод детекции мутаций без предварительной амплификации непосредственно на геномной ДНК (инвазивное расщепление олигонуклеотидов (Invader)).

Для получения специфических продуктов ПЦР подбирают праймеры. Их разрабатывают согласно общепринятым критериям.

В качестве праймеров для проведения полимеразной цепной реакции используют уникальные последовательности, приведенные ниже:

для исследования участка гена MTHFR:

Праймеры:

Прямой F: CCAGTCCCTGTGGTCTCTTCAT

Обратный R: AGGGAGCTTATGGGCTCTCCT

После подбора праймеров проводят амплификацию. Причем температура отжига праймеров одинакова для обоих ПЦР (она составляет 58-60°C).

Существуют разнообразные химические подходы к синтезу олигонуклеотидных праймеров, например фосфодиэфирный метод, гидрофосфорильный метод и т.д., но наибольшее распространение в настоящее время имеет фосфорамидитный метод. Синтез праймеров осуществляют, используя автоматические ДНК/РНК синтезаторы, например (без ограничения) производства фирмы Applied Biosystems (США).

Непосредственно полимеразная цепная реакция может быть проведена с использованием любого вида термостабильной полимеразы, работающей в соответствующем буфере. Для построения новой цепи в буфер добавляется смесь дНТФ (дАТФ, дГТФ, дЦТФ, дТТФ) в принятых концентрациях. Для проведения ПЦР могут быть использованы готовые коммерчески доступные наборы, содержащие все необходимые компоненты за исключением праймеров.

Проведение реакции позволяет наработать достаточное количество ПЦР-продукта для дальнейшего анализа рестрикцией.

Непосредственно рестрикция эндонуклеазами может быть проведена с использованием определенных ферментов, способных «расщеплять» ПЦР продукты в определенных сайтах (указанных ниже), которые работают в соответствующих буферах и при соответствующих условиях, рекомендованных производителями. Для рестрикции могут быть использованы ферменты разных производителей.

Для исследования участка гена MTHFR:

Рестриктаза HinFI (сайт G|ANTC)

После обработки эндонуклеазами рестрикции проводят детекцию фрагментов ДНК в полиакриламидном или ином гелях разной процентности, рекомендованной для разделения соответствующих ПЦР продуктов. Подтверждением результата прохождения ферментативного гидролиза служат наличие соответствующих бэндов.

При анализе гена MTHFR можно выявить три фрагмента длиной 304 п.н., 154 п.н., 150 п.н., соответствующие разным генотипам. О наличии генотипа Т/Т в исследуемом образце судят по наличию на двух фрагментов длиной 154 п.н., 150 п.н.

6. Прогнозирование риска развития метаболического синдрома

У детей со значениями, посчитанными по формуле больше 10, но меньше 14,5, и генотипом MTHFR 677C/T прогнозируют риск развития метаболического синдрома.

Изобретение подтверждается примерами конкретного осуществления способа.

Пример 1. Использование предложенного способа для выявления метаболического синдрома

У группы детей для биохимического исследования берут (4-5 мл) натощак кровь в пробирки с активатором свертывания - красная крышка и белое кольцо (внутренние стенки пробирок покрыты сухим активатором свертывания (SiO - оксид кремния).

Далее с помощью анализаторов закрытого типа фирмы "Roche" (Швейцария): Elecsys-2010, Cobas Integra-400 Plus, Cobas-6000; и фирмы "Siemens - Advia Centaur" (Германия), проводят анализ инсулина, глюкозы и липидов в плазме крови натощак. Рассчитывают индекс HOMA-IR по формуле=значение инсулина плазмы натощак (мкЕд/мл) × значение глюкозы плазмы натощак (ммоль/л)/22.5. Рассчитывают коэффициент атерогенности по формуле значение липопротеидов низкой плотности/ липопротеидам высокой плотности.

Используя рассчитанное выражение - 3хКА+HOMA-IR, рассчитывают индивидуальные значения коэффициента. Диапазон значений коэффициента до 10 соответствует здоровым детям; от 10 до 14,5 - дети отдельными метаболическими нарушениями, ожирением, которые составляют группу риска по развитию МС; выше 14,5 - метаболический синдром.

Далее у детей с коэффициентами от 10 до 14,5 берут венозную кровь (2-5 мл), которую добавляют в пробирки с ЭДТА. Далее из лейкоцитов периферической крови стандартным методом выделяют ДНК.

Для каждого из образцов ДНК готовят две ПЦР смеси в пробирках объемом 25 мкл (соответствующие двум генам). Состав смеси следующий: 67 мМ трис-HCl, рН 8,8 при 25°С; 16,6 мМ (NH4)2SO4; 6,7 мМ MgCl2; 6,7 мкм ЭДТА; 10 мМ 2-меркаптоэтанола, 170 мкг БСА, смесь четырех основных dNTP в концентрации 0,8 мМ каждого, термостабильная ДНК-полимераза 0,5 ед./мкл, и праймеры по 10 пмоль каждого. В каждую пробирку вносят по 1 мкл ДНК. Всю смесь нагревают при 95°С в течение 5 мин, затем проводят 35 циклов амплификации с использованием любого отечественного и зарубежного термоциклера по следующей схеме: 95°C - 30 сек, 60°С - 30 сек, 72°С - 1 мин. Завершающая инкубация: 72°С - 5 мин.

Далее выполняют идентификацию продуктов, используя электрофоретическое разделение продуктов ПЦР в 6% полиакриламидном геле (ПААГ), приготовленном на десятикратном трис-боратном буфере в аппарате для вертикального электрофореза с длиной стекла 20-22 см. Для приготовления 40 мл 6% геля смешивают: 8 мл 30% р-р акриламида (29 г акриламида; 1 г N,N метилен-бисакриламида на 100 мл водного раствора), 4 мл 10х ТБЕ (89 мМ трис-борат (рН 8,3-8,6), 2 мМ ЭДТА), 28 мл дистиллированной воды, 40 мкл тетраэтилендиамина (TEMED), 400 мкл персульфата аммония (PSA). Перед заливкой раствор тщательно перемешивают. После амплификации непосредственно к аликвотам реакционной смеси (~10 мкл) добавляют буфер для нанесения проб (~2 мкл) и проводят электрофорез (шестикратный буфер для нанесения проб состоит из 0,25% бромфенола, 0,25% ксилен-цианола и 15% фикола). Электрофорез проводят при напряжении 100 В до тех пор, пока образец не входит в гель и не проходит около 1 см от начала лунок. В дальнейшем напряжение увеличивают до 300 В. Остановку электрофореза проводят за 1 см до выхода бромфенола из геля. Затем гель окрашивают в водном растворе этидиум-бромида (0,5 мкг/мл), а визуализация результатов проводят в проходящем ультрафиолетовом свете на трансиллюминаторе Macrovue (LKB, Великобритания).

При подтверждении результата прохождения амплификации, по наличию соответствующих бэндов (полос) (для гена MTHFR -304 п.н.), получившийся продукт ПЦР подвергают ферментативному гидролизу, по схеме (на одно исследование):

- 0,5 мкл эндонуклеазы рестрикции HinFI (Fermentas)

- 1,5 мкл буфер R (Fermentas)

- 8 мкл воды

- 5 мкл продукта мультиплексной ПЦР.

Гидролиз проводят в течение 12 часов, при температуре 37°С. Данные эндонуклеазы рестрикции расщепляют специфическую последовательность ДНК или же этого не происходит.

Затем проводят электрофорез в 8% полиакриламидном геле. Определяемые мутации, количество и размер визуализируемых фрагментов приведены на фиг.3.

На фиг.3 представлена элекгрофореграмма результата обработки эндонуклеазой рестрикции HinFI ПЦР продуктов гена MTHFR.

Справа указаны размеры амплифицированного участка в нуклеотидных парах. Снизу указаны номера дорожек на электрофорезе.

Дорожка 1 соответствует наличию генотипа С/С по гену MTHFR.

Дорожка 2 соответствует наличию генотипа С/Т по гену MTHFR.

Дорожка 3 соответствует наличию генотипа С/С по гену MTHFR.

Дорожка 4 соответствует наличию генотипа С/Т по гену MTHFR.

Дорожка 5 соответствует наличию генотипа Т/Т по гену MTHFR.

Дети, образцы ДНК которых анализировали на дорожках 2 и 4, имеют риск развития метаболического синдрома.

Предлагаемый способ основан на биохимическом и генетическом исследовании, прост в исполнении, не требует высокоспециализированного оборудования.

Предлагаемый способ может быть применен в таких медицинских организациях, как детские поликлиники, медико-генетические лаборатории, организации, осуществляющие комплексное медицинское обслуживание, поликлиники и др.

Способ имеет важное практическое значение. Позволяет начать терапевтические и профилактические мероприятия на самых ранних сроках, направленные на снижение частоты такого социально значимого заболевания, как метаболический синдром.

Способ оценки риска развития метаболического синдрома (МС) у детей на основе генетических и биохимических маркеров по наличию инсулинорезистентности с помощью индекса инсулинорезистентности HOMA-IR, отличающийся тем, что после исследования биохимических показателей инсулинорезистентности HOMA-IR проводят исследование коэффициента атерогенности (КА), и по коэффициенту ЗхКА+HOMA-IR делают вывод о развитии МС и выявлении группы риска развития заболевания среди детей, а именно - диапазон значений коэффициента до 10 соответствует здоровым детям; от 10 до 14,5 - дети с отдельными метаболическими нарушениями и ожирением; выше 14,5 - диагностируют МС, причем в группе детей со значениями, посчитанными по формуле больше 10, но меньше 14,5, дополнительно определяют риск МС с помощью метода ПЦР участков гена метилентетрагидрофолатредуктазы (MTHFR) с дальнейшей обработкой эндонуклеазами рестрикции, и при выявлении генотипа С/Т полиморфного варианта 677С/Т гена MTHFR таких детей относят к группе риска по развитию МС.



 

Похожие патенты:

Изобретение относится к медицине и может быть использовано в кардиологии, терапии. .
Изобретение относится к медицине, а именно к дерматовенерологии, и касается способа определения резистентности больных распространенными хроническими дерматозами (псориазом, атопическим дерматитом, вульгарной или акантолитической пузырчаткой) к проводимой терапии.

Изобретение относится к клинической биохимии и описывает среду для определения наличия в сыворотке крови множественно модифицированных липопротеинов (ммЛП), которая содержит 10% раствор ПВП-12600 в 0,01М Трис-HCl-буфере, рН 7,4, содержащем 0,15 М NaCl.

Изобретение относится к медицине и касается способа прогнозирования ишемической болезни сердца. .

Изобретение относится к медицине и касается способа оценки эффективности лечения ишемической болезни сердца. .

Изобретение относится к медицине и касается способа определения фракций липопротеинов крови у больных ишемической болезнью сердца. .
Изобретение относится к клинической биохимии и может быть использовано для экспресс-определения атерогенности плазмы крови человека. .
Изобретение относится к медицине, а именно к кардиологии, и касается способа дифференциальной диагностики заживающего инфаркта миокарда и постинфарктного кардиосклероза.
Изобретение относится к области медицины. .
Изобретение относится к области медицины. .
Изобретение относится к области медицины. .

Изобретение относится к области медицины. .

Изобретение относится к области медицины, а именно к кардиологии. .
Изобретение относится к области медицины, в частности к онкологии, и может найти применение для прогнозирования периода безрецидивной выживаемости при раке шейки матки (РШМ).

Изобретение относится к области медицины, а именно к способу скрининговой диагностики инсулинорезистентности. Способ основан на определении биохимических показателей сыворотки венозной крови, в которой ферментативным методом определяют показатели липидного спектра и глюкозы. Согласно заявленному способу проводили однократный забор крови у пациента из локтевой вены натощак после 12 часового голода, затем в сыворотке венозной крови определяли показатели холестерина липопротеидов высокой плотности прямым ферментативным колориметрическим методом (direct HDL-Cholesterol), уровня триглицеридов ферментативным колориметрическим методом реакцией GPO-PAP и концентрацию глюкозы гексокиназным методом, затем рассчитывали показатель инсулинорезистентности (МИ) по формуле. При значении показателя МИ≥7,0 диагностировали инсулинорезистентность. Использование заявленного способа позволяет дать качественную и количественную оценку состояния инсулинорезистентности и подтверждает высокую информативность при скрининговых обследованиях, является высокоинформативным при скрининговых обследованиях. 2 табл., 2 ил.
Наверх